text
stringlengths 2
1.05M
| repo_name
stringlengths 5
101
| path
stringlengths 4
991
| language
stringclasses 3
values | license
stringclasses 5
values | size
int64 2
1.05M
|
|---|---|---|---|---|---|
A pair holding U.S. and British nationalities were among the 11 foreigners killed after a series of explosions struck three churches and three luxury hotels in and just outside of Sri Lanka’s capital Easter Sunday, leaving at least 207 people dead and 450 others injured, officials said.
Sri Lanka's foreign ministry said the other foreigners whose nationalities have been verified included three Indians, one Portuguese national, two Turkish nationals, and three British nationals.
The U.S. State Department confirmed in a statement that “several U.S. citizens were among those killed” in the explosions, though details were still emerging. Secretary of State Mike Pompeo went on to condemn the Easter morning "terror attacks."
"Attacks on innocent people gathering in a place of worship or enjoying a holiday meal are affronts to the universal values and freedoms that we hold dear, and demonstrate yet again the brutal nature of radical terrorists whose sole aim is to threaten peace and security," Pompeo said in the statement.
POPE CELEBRATES EASTER SUNDAY AMID BLOODSHED IN SRI LANKA
The six nearly simultaneous blasts—followed hours later by two more explosions—marked the bloodshed as among the worst since the South Asian country’s 26-year civil war ended a decade ago, a spokesperson for the Sri Lanka police said.
A police spokesman said 13 suspects have been arrested in connection with the attacks. Police said they also found a vehicle they believe was used to transport the suspects into Colombo, along with a safe house used by the attackers.
Defense Minister Ruwan Wijewardena described the attacks as a terrorist attack by religious extremists, though no one immediately claimed responsibility. Prime Minister Ranil Wickremesinghe said he feared the violence could trigger instability in the country and its economy.
The explosions collapsed ceilings and blew out windows, killing worshippers and hotel guests. People were seen carrying the wounded out of blood-spattered pews. Witnesses described powerful explosions, followed by scenes of smoke, blood, broken glass, alarms going off and victims screaming in terror.
"People were being dragged out," Bhanuka Harischandra of Colombo, a 24-year-old founder of a tech marketing company who was going to the city's Shangri-La Hotel for a meeting when it was bombed. "People didn't know what was going on. It was panic mode."
He added: "There was blood everywhere."
The first explosion occurred around 8:45 a.m. local time, with the deadliest appearing to be at St. Sebastian’s Church in Negombo, a city about 20 miles north of Colombo. Other attacks occurred at St. Anthony’s Shrine in Colombo and Zion Church in the eastern city of Batticaloa. The three hotels – the Shangri La, Cinnamon Grand and Kingsbury Hotel – all in Colombo are frequented by foreign tourists.
The other two blasts occurred in Dematagoda, where the occupants of a safehouse apparently detonated explosives to prevent arrest.
An official told the Associated Press that at least two of the church blasts were believed to have been coordinated attack carried out by suicide bombers.
“The United States offers heartfelt condolences to the great people of Sri Lanka,” U.S. President Donald Trump tweeted in part early Sunday. “We stand ready to help!”
U.S. Ambassador to Sri Lanka Alaina Teplitz offered her condolences over Twitter early Sunday.
"Deeply saddened by the senseless attacks in Sri Lanka today. Our thoughts are with the victims and their families. We stand with Sri Lanka’s people at this terrible moment," she tweeted.
Former President Barack Obama in a tweet called the Easter bloodshed an “attack on humanity.”
"The attacks on tourists and Easter worshippers in Sri Lanka are an attack on humanity," Obama wrote. "On a day devoted to love, redemption, and renewal, we pray for the victims and stand with the people of Sri Lanka."
Cardinal Daniel N. DiNardo, the president of the United States Conference of Catholic Bishops, in a statement condemned the deadly blasts as a “great evil," and said the attack cannot "overcome the hope" found in the Easter holiday.
SRI LANKA AVERTS RIFT SPILLING OVER TO UN RIGHTS SESSION
St. Sebastian's pleaded for help on its Facebook page. The explosion ripped the roof off the building and knocked out doors and windows. Churches throughout the country have been placed on alert, with many canceling Easter services.
Sri Lankan Member of Parliament Harsha de Silva tweeted Sunday of "many casualties including foreigners."
"Sec Defence and I am at Kochchikade church. Also was at ShangriLa n Kingsbury. PM is on his way from Bentota. Emergency meeting called in a few minutes. Rescue operations underway. Please stay calm and indoors. Many casualties including foreigners," he posted.
"Horrible scenes. I saw many body parts strewn all over. Emergency crews are at all locations in full force. We, at 1990 also have close to 20 units at the various locations. We took multiple casualties to hospital. Hopefully saved many lives," he continued.
The Archbishop of Colombo, Cardinal Malcolm Ranjith, called on Sri Lanka's government to launch a "very impartial strong inquiry" and to punish those found responsible "mercilessly because only animals can behave like that."
Pope Francis denounced the "cruel violence" at the end of his traditional Easter Sunday blessing.
Speaking from the loggia of St. Peter's Basilica, Francis said: "I want to express my loving closeness to the Christian community, targeted while they were gathered in prayer, and all the victims of such cruel violence."
He added: "I entrust to the Lord all those who were tragically killed and pray for the injured and all those who are suffering as a result of this dramatic event."
British Prime Minister Teresa May tweeted "We must stand together to make sure that no one should ever have to (practice) their faith in fear."
New Zealand Prime Minister Jacinda Ardern condemned the "devastating" attacks, and referred to the March 15 shootings at two mosques in the New Zealand city of Christchurch in which 50 died.
"New Zealand condemns all acts of terrorism and our resolve has only been strengthened by the attack on our soil," Ardern said. "New Zealand rejects all forms of extremism and stands for freedom of religion and the right to worship safely."
CLICK HERE TO GET THE FOX NEWS APP
Sri Lankan security forces in 2009 defeated Tamil Tiger rebels who had fought to create an independent homeland for the country's ethnic minority Tamils. The U.N. initially estimated the death toll from 26 years of fighting to be about 100,000 but a U.N. experts' panel later said some 45,000 ethnic Tamils may have been killed in the last months of the fighting alone.
Sri Lanka, a small island nation at the southern tip of India, has a long history with Christianity. Christian tradition holds that St. Thomas the Apostle visited Sri Lanka and southern India in the decades after the death of Christ. The majority of the island's Christians are Roman Catholic.
The Associated Press contributed to this story. | null | minipile | NaturalLanguage | mit | null |
Q:
Attempted to read or write protected memory. This is often an indication that other memory is corrupt
We are running Windows Server 2003 R2 with SP2. When I login I get the following messagebox twice
"Attempted to read or write protected memory. This is often an indication that other memory is corrupt."
Below are the steps I have tried and still get the error when I login
Disabled all Non-Microsoft Service and reboot the server
Disabled all startup items from msconfig and reboot the server
Repaired .Net Framework 3.5 SP1
There are no event in either Application of System log indicating the cause of the error message
My question is how do I stop these error messages and find out which application is throwing them. Are there utilities out there to diagnose the problem.
Thanks for your help and helping a newbie to the IT Field
Juzer
A:
When you get the messagebox on the screen, if you bring up task manager, and then select go to process, you should be able to see the process responsible for the display of the messagebox. That is to say from the "Applications" tab select the messagebox in task manager and then select go to process
| null | minipile | NaturalLanguage | mit | null |
Live Stream: Watch The First Libertarian Party Chairperson Debate
The Liberty Underground Show proudly presents the first Libertarian National Committee Chairman Debate for 2016. You can view the debate broadcast via the embedded YouTube video above.
The program has invited Charles Peralo, Mark Rutherford, Brett Pojunis and incumbent chairperson for the Libertarian Party, Nick Sarwark. The broadcast will start at approximately 9 PM EST Time and that’s when the live stream embedded above will be activated so check back here then. | null | minipile | NaturalLanguage | mit | null |
Trouble logging in?If you can't remember your password or are having trouble logging in, you will have to reset your password. If you have trouble resetting your password (for example, if you lost access to the original email address), please do not start posting with a new account, as this is against the forum rules. If you create a temporary account, please contact us right away via Forum Support, and send us any information you can about your original account, such as the account name and any email address that may have been associated with it.
Because he understands what happened.
In the flashback (Marcoh telling Ed and Al about the Ishbar War), he said that Roy was ordered by Grand to kill them, he also told them that Roy was so disgusted with what he had done that he tried to commit suicide. It wasn't just a flashback by Marcoh, it was Marcoh telling Ed about it.
So that brings you to where Marcoh said who the doctors were, Winly/Winry's parents, the Rockwell/Rockbell (gotta love those l's/r's and w's/b's switching). He then realised that Roy had killed them but, what could he do about it? Roy has gone through enough already, right?
Nah like someone earlier said...when there's flashbacks... it means that Ed see exactly what the flashback shows.... ie... Marcoh's entire story of what happened... someone somewhere also asked the question of what Roy was doing at the Rockwells place after Ed and Al did their human transmutation... that person speculated that Roy could have been there initially to appologise.. not only there in response to the letter that Ed and Al sent him...
However, you're quite right about the gun usage... I myself can't understand why he had to shoot them with a gun rather than burn them...
besides he already got to know in ep.3 that a state alchemist killed winrys parents, and still he wanted to be one too, even so he would have to kill inocent people too if he get the order to do so. I think thats the reason he doesn't reproach marco or "this soldier" with the death of the two doctors.
Nah like someone earlier said...when there's flashbacks... it means that Ed see exactly what the flashback shows.... ie... Marcoh's entire story of what happened... someone somewhere also asked the question of what Roy was doing at the Rockwells place after Ed and Al did their human transmutation... that person speculated that Roy could have been there initially to appologise.. not only there in response to the letter that Ed and Al sent him...
However, you're quite right about the gun usage... I myself can't understand why he had to shoot them with a gun rather than burn them...
Well, maybe he thought it would be less cruel;
Think about how he normally kills people- by burning them to a crisp. (*thinks back to train episode... 5, I think it was?*)
I'd MUCH prefer to have a bullet go through my brain than recieve burns covering 90% of my body, melting the skin off, and my eyes being burned out of my socket, and my ears, and.... anyway.
That, or when you're in situations like those, you tend to just do what would come naturally; and almost any person would take a gun first. But, these are just speculation, and I'm no psych major, so... draw your own conclusions.
Mayb he didn't go to apologize to them, but to look for ed and el. I think Their father was a real good alchemist, and the colonel wants to see i they got some talent or something. So that they would be from great use for the militairy.
Mayb he didn't go to apologize to them, but to look for ed and el. I think Their father was a real good alchemist, and the colonel wants to see i they got some talent or something. So that they would be from great use for the militairy.
well... i suppose it depends what roy thinks is good for the military... to me I think Roy has seen so much corruption that he wanted these two on his side to help him with the cleaning up of all that the military has done wrong... he was probably trying to curb the problem of having someone like scar turn up or something like Ishbal from happening again... but I doubt that he'd be able to stop it....
Anyway, perhaps he went to Rockwell for both reasons... to see the brothers and to check whether Winry is doing fine... Thinking back to that ep... i think the grandma knew that it was roy who was ordered to kill them... that's why she asked him to get out of the house... i'm pretty sure winry doesn't know though.... ok i think I've rambled on enough....
I think it wasn't Mustang. Mustang would use alchemy to kill someone and not a gun.
REasoing 1:Well at the time all alchemy was enchanced by the stone, so if alchemy- if roy were to use his flame attack it would kill him in the process
REasoing 2:Mustang already hated using his alchemy on innocent people, but these people werent just innocent they were good people and they were also their own people. so it was of a assination rather then an act of war, so a gun would leave less evidence and there might have been stuff that they could use in their office.
As far as i understood transforming / mutation drains power.
( At the test to become an state alchemist you can see that. )
Since they wern't a thread in any kind he just shot them... i mean, sure, alchemy might look cooler, but who cares in such a situation? It just wasn't necessary.
I think edward could understand Roy, it was an order, if he didn't do it he would be most likely killed by his komerades for deserting, or refusing of an order in front of his superior.
And i think he could also understand why he tried to commit suicide... i think he just understood that, and as he said before: Revenge acomplishes nothing, if anyone would revenge someone there would be alot of avenging going on. | null | minipile | NaturalLanguage | mit | null |
Pages
Friday, 24 March 2017
These United States by Clive Tern #rednosereviews #rednoseday
I want to begin this review by telling you a story. When I was a young boy, our bedroom had a wide window, with a large fixed pane in the middle, and parts that opened on the left and on the right. I am not proud of what I am about to tell you, but I would exit on the left, walk across the exterior window sill to the right, then come back inside. It frightens me to think of it, now more than ever, as I think of all the joy that would have been lost if I had fallen to my death. No lovely wife, no beautiful children, and worst of all so many wonderful novels never written! Imagine if I had died then, never having seen Game of Thrones, never having used the internet, never having played an Elder Scrolls game!
It doesn't bear thinking about, so let's not, let's move on to another childhood memory. We lived near one of the (if not the) smallest train stations in Britain, Damems, on the Worth Valley Light Railway. We would walk down there to see the steam trains go by, and if that sounds like a scene from The Railway Children, well, parts of that film were indeed filmed there. I never took off my underwear and waved it at a train, but we did discover the ruins of an abandoned mill, with a huge enticing crack in one wall. The mystery of this entranced us for weeks, until we were able to take advantage of a Tandy special offer and get ourselves a torch.
I then led an expedition into the crack. This may all sound like an episode of Stranger Things, but let me assure you that this really happened. Following me into the crack were my little brother and a gaggle of other children, some of them probably as young as five or six. We shone the torch into the crack and made our way inside. It was terrifying, but we kept going, step by worrisome step, the light shining ahead of us into the darkness, but seeming to illuminate only more darkness. Before long the crack narrowed and I began to worry about being trapped in there.
I called a retreat, and had to wait, anxiously breathing as deeply as I could, while the youngest children at the back got the message and led us out. I think back to that often, and consider how easily we all could have died. No one knew we were there. No one would have looked for us there. If the walls of that crumbling mill had fallen, that would have been it for all of us. We would all have died, and it would have been my fault. I'd be famous for being the idiot that led a group of younger children into a hole in the wall of a abandoned mill.
All of which is by way of explaining how intensely you may be affected by the stories in These United States by Clive Tern. It's a collection that will make you gasp in horror at how easily you might have let it pass you by, changing your life forever, very much for the worse. He is not from the United States, but declares a strange love for them. He writes about a man who can't die, and another who is locked up all day, and aliens and sea-gods and dangerous cigarette lighters all while making you think and taking you to a different state of the union each time.
In thirty years time, do you really want to think back to this moment and rue the terrible mistake you made, or do you want to read this book right now? And it's only volume one! How many more can we look forward to?! I give it five red noses. | null | minipile | NaturalLanguage | mit | null |
alicia turnerBrighton MI 481146:30pm First Place 4 Health is a Christ-Centered Weight-Loss and Healthy Living Program, based on biblical scripture. This group is open to men and women. You will experience the difference when you put Christ first in all areas of your life: Mentally, Physically, Emotionally and Spiritually.
sherry mcwilliamBrighton MI 4811410:30 am. A refreshingly simple twist on Bible Study. Reading the Gospel of John together over the course of 12 weeks. Homework will be to simply read two chapters a week. Our time together will be sharing what we heard from God during our reading and how we can apply His truth in our lives. | null | minipile | NaturalLanguage | mit | null |
Grubwithus launches a social dining app for the impatient: GrubTonight
Ever had the urge to go out to dinner at a restaurant but couldn’t find anyone to dine with? Social dining startup Grubwithus might just have an app for you. Over the weekend it launched GrubTonight, an iPhone app that allows strangers in the same city to meet up for impromptu meals with just a few hours notice. Think of it as a tweetup with a set menu.
If you’re not familiar, Grubwithus is Los Angeles-based startup that specializes in organizing group meals for people with similar interests. Users sign up for a Grubwithus account, and then start signing up for dinners, organized weeks in advance around themes such as the love of sushi or a fascination with Ron Paul. Grubwithus pre-arranges set meals with partner restaurants, and diners prepay their bills before attending. Once there everyone only needs to cover their drink tabs.
GrubTonight works in a similar way, though much accelerated. The iPhone-only app — Grubwithus probably isn’t hosting any Android-lover meals just yet — alerts members to dinners being held that night along with their menus and locations. Unlike the regular Grubwithus dinners, there’s no theme, just social interaction. Diners again prepay and they receive a confirmation an hour before the meal is held. At launch, GrubTonight is only offering up meals in the LA area, but the company said it would expand to more cities in the coming months.
Grubwithus said that the app is focused on immediacy, making it ideal for business travelers, tourists looking to meet each other or the locals or as a means for the newly relocated to meet the community. If a group of diners hit it off they can meet for future meals using the social tools in the larger Grubwithus network.
Grubwithus is one of many startups exploring the idea of a “real-life” social network built around the communal table, but it’s developed more momentum than most. A Y Combinator alum, Grubwithus raised $1.6 million in seed funding from Ashton Kutcher, Andreessen Horowitz, First Round Capital, Aviv Nevo, and other angel investors. | null | minipile | NaturalLanguage | mit | null |
Email
KARACHI: An excessive and irrational drug use across the health sector in Pakistan is creating resistance to frontline antibiotics used to control infections, says an official report.
The recent report said that antimicrobial resistance resulted from irrational use of drugs and showed that a high level of resistance to ampicillin, cotrimoxazole, chloramphenicol and erythromycin had long since been established in Karachi. “The results are alarming as these are the frontline antibiotics for control of infections,” it said.
The report said the irrational drug use was rampant despite the fact that Pakistan was one of the first countries to introduce the World Health Organisation’s (WHO) essential medicines programme.
The report pointed out low checks on registration and marketing of drugs and said there were 1,100-1,200 registered molecules and about 76,000-88,000 registered products in Pakistan, which was one of the highest in the developing world.“
Unnecessary number of registrations is due to both low quality checks required for registration and reportedly high influence of pharmaceutical industry. This contributes to irrational use of drugs with availability of excessive number of originator brands at different dosages and prices,” it said.
Moreover there was ‘almost no restriction’ on health providers interacting with industry. A visit by industry representatives to general practitioners “is alarmingly often the only source of treatment information, underscoring lack of in-service training, however, information provided is questionable”.
The report quoted a study saying some 18 per cent of sales advertisements “have unjustified or misleading claims” while another study showed that only 15 per cent of claims in promotional brochures met the WHO criteria for optimal drug information.
It quoted a study conducted previously by a private consultant saying self-medication and drugs purchased over the counter from medical stores of “questionable quality” was rampant.
“Although there are no national figures on self-medication, available studies indicate that in at least 51 per cent of ailments medicines are purchased over the counter through self-prescription. There is little restriction over type of medication that can be purchased and quality of drug stores is poor,” it said.
WHO defines the essential drugs as “those that satisfy the healthcare needs of majority of population; they should therefore be available at all times in adequate amounts and in appropriate dosage forms at a price the community can afford.”
However, the recent official report said the prescriptions by non-qualified practitioners as well as self-medication by patients were common in Pakistan.
To authenticate its contention, a previous study conducted in Karachi said potent drugs such as antibiotics, psychotropic, narcotics, anti-cancer therapy and harmones were frequently misused due to inappropriate prescriptions by quacks who mostly operated in remote rural areas of Sindh.
Estimates of the Pakistan Medical Association showed that there were more than 600,000 quacks operating across the country, of whom one-third were in Sindh and of them most were in Karachi.
At present, there is no official legal mechanism, through which authorities could monitor and take action against fake doctors.
The recent study, however, held the licensed practitioners responsible as well for recommending high level of inappropriate prescriptions to their patients. “Many qualified medical practitioners frequently prescribe inappropriately even for endemic problems,” it said.
In Karachi, it said, appropriate therapy for hypertension in elderly people was given by only 35 per cent of general practitioners (GPs). There were frequent variations from the recommended tuberculosis treatment with only 50 per cent of GPs being able to prescribe TB drugs in correct doses or correct duration.
Similarly, the treatment for psychiatric and paediatric illnesses did not correlate to diagnosis in 25 per cent of cases and doses of drugs were inappropriate in 31pc prescriptions.
Moreover, GPs in 76.5pc of patient encounters also dispense drug formulations of unknown composition, commonly known as ‘mixtures’, made in their own drug dispensing corner – a practice, which is not open to monitoring.
The report also highlighted a high number of drugs per prescription and rampant use of injections. The average number of drugs prescribed per patient is three or more in Pakistan as compared to an average of two to three in low- and middle-income countries, and over 70pc of patients are prescribed antibiotics.
Across Pakistan, 2.75 drugs per prescription are reported from basic health units and rural health centres, which is close to the average of 2.79 at teaching hospitals, showing low rationality at lower tiers.
The number of drugs prescribed is higher in the private sector with an average of 4.5 medicines per prescription in urban Sindh with over-prescriptions of antimicrobials, vitamins or minerals and injections.
“Pakistan is globally among the countries with the highest rate of injection usage with over 60 per cent of patient encounters involving an injection and mostly administered by private providers including quacks,” said the report.
“This is a dangerous trend as syringes are re-used amongst different patients, and are improperly disposed and sterilisation practices are not followed for injecting, with clear linkage shown to blood borne diseases such as hepatitis B,C and HIV.” | null | minipile | NaturalLanguage | mit | null |
Where do you draw a line in the sand that separates judgment from an inability to relate? It seems as if a lot of the men trying to date are in situations that make it hard for a woman to want to deal with them.
On and off, hide and reveal, resign and restart. The vicious cycle known as online dating and for the life of me, I just don’t understand how men can continue to sabotage themselves by ruining the most important part of the process – the dating profile and specifically, the photos. Do these men not realize that they can turn a woman all the way on by what he’s sharing in his profile and just the same, can turn us off completely by choosing the lazy, cheesy and sleazy photos like this debonair fella right here: Yes, this is an actual photo from someone’s profile and yes – he looks like…
The funny thing about dating is that there are so many different types of men and situations out there so you really are placed in a position of picking your poison. My last date from a few months ago really had it together. He owned a couple of properties, had a stable career with no debt and only one child and was just as eager as myself to find someone special and settle down. That same man was also a self-centered, controlling, condescending asshole who believed he was the crème de la crème and couldn’t understand why or how any woman could reject him. But like the others he’d complained…
I’m caught up in this vicious cycle where the levels of frustration are so bad that I say to hell with it all. I take down all of my decorations and pretty pictures, and might even leave some threatening note before finally ending things for good. After a couple of weeks or so, boredom usually sets in and a little sliver of hope pops into my mind that maybe – just maybe things will be different this time. Aren’t these the types of thoughts that makes a person want to have some reflective moments to re-evaluate their purpose and goals? Hell yeah, it certainly is so after much thought and…
Last week’s date marked the first time I’ve gone out with a non-black man and while one “quick” meet up will never allow me to claim an interracial dating experience, at least I was open coerced enough to have tried it. During that excruciating hour and eleven minutes with the hangover I’ll call Guido, a few things became perfectly clear to me: (1) nearly every man lies about at least one thing on his dating profile, (2) broken English and improper verb tense isn’t something I’ll ever be able to stomach, and (3) being told how beautiful I am repeatedly in one sitting is a little creepy. That being said,…
“So um hypothetically speaking, let’s say you and I keep doing this right here you know and after about three months we’re in a really cool place. Does that mean you’ll eventually close out your dating account or do we have that conversation when you feel like you’re ready?” Blank stare. “I’m ready, you know what I’m saying because you are the type of woman who is on my level, is over the clubbing, you’re a good parent and think the same way as I do. So um are you ready to take this to the next level?” Fool, what level and why are you talking like you’re with the homies on…
This week in online dating fuckery…. “Grab my attention, huh? Well I’m certainly interested in being locked from top to bottom. I just need to get rid of these cold sores and finish this prescription for this HPV…” Okay, so I really didn’t say this but it sure would have been a hoot to see what Mister Carmel had to say. FUCKERY. Most of the time these foolish tyoes of messages are simply ignored but every now and then, I’ll reply. I know this is a little odd, but sometimes I just want to pass the time being entertained by these idiots. I’m realizing more and more that the number…
How do you respond to a dude who’s photos shows a money struggle between bills, weed and women and if you think this photo is bad, just imagine what his dating profile says. I normally ignore messages from ingrates like this (using the Urban Dictionary meaning here), but sometimes I really want to message EXACT what I am thinking and feel. The Inland Empire (San Bernardino, Riverside) area seems to be breeding a special kind of loser because this happens to be the fourth of his kind that has reached out to me this week. Sometimes I really wonder if breaking up with any of my ex’s was such a good…
You May Also Like
If only he hadn’t invited me upstairs to his place after dinner, things might have gone differently. I may not have figured it out so soon. Let’s roll back the tape to that date two weeks ago… I’m unapologetically shallow when it comes to physical attractiveness, it’s a turn on. We know this, so I no longer pretend that looks don’t matter. A man with a high level of intelligence and great communication skills is equally sexy and if his integrity and goals are in alignment? A definite panty dropper. It’s just so damn hard finding that perfect balance, so I try to work with some of the ones who…
You May Also Like
It’s been a long week for me and today is only Tuesday, so I welcomed a little break with a few dating site messages. Things started off kind of odd with this dude because his first message said “Hello, you are very beautiful so I had to message. I read your profile carefully and no one is perfect.” What the hell? Who’s looking for perfection?? I just make it pretty darn clear with this newly reactivated profile that my threshold for bullshit is negative zero. I reply something simple and this dude asks me how my day was and if I was headed home. I said not yet and returned…
Sometimes I really wished my levels of perception were dialed down from a level 10 to maybe a 2. Maybe if my instincts about certain situations with these hangovers weren’t so on point, then perhaps I wouldn’t be struggling so much in trying to find my guy. Translation – I should either ignore a lot of shit and be as naïve as a lot of women and just suck it up. The problem is that the thought of doing this aches me to the core of my soul, because it just isn’t in me to ignore the obvious. I guess th is all means the man I’m supposed to be with…
Well, I have just made it through the first week of being “back” into the scheme of things, back in the mix, back in the shit. Online dating. I guess it wouldn’t be fair to complain about anything such as of the types and quality of men just yet because you get out what you put in, right? Meaning I really haven’t done much other than create the profile, write the abridged versions of “why I’m great and should no longer be single” thesis, and post a decent profile picture. What else have I done, you may ask – not a damn thing. Like a bird kicking back and waiting…
Before I can even go into all of the things that went running through my mind when picking a dating web and signing up, I have to say the experts are wrong. They say that only the good, well written, and carefully thought out profiles are noticed the most. I’m going to have to say no, no, and no. The ones that stand out like that yellow and black tape at a crime scene are the ones that stand out and for the life of me, I can’t understand why those are the ones making the most contact. They say you are what you attract, right? Since this seems to… | null | minipile | NaturalLanguage | mit | null |
The Men's Mountain Designs 150 Merino Short Sleeve Crew uses the natural properties of Merino wool to keep you dry and comfortable when you’re getting active or layering up.
The high quality, 100% Australian Merino fabric draws sweat away from your skin to the surface of the fabric where it evaporates quickly to keep you dry. It also naturally holds antimicrobial properties that inhibit bacteria growth that can cause odours – a great feature for long trips away where washing opportunities can be few and far between.
The Merino wool fibres are itch and static free, feeling soft and comfortable against your skin. They are also self-extinguishing and flame retardant – a great safety feature if you like nights by the fire. An embroidered Mountain Designs logo adorns the chest of the Men's Mountain Designs 150 Merino Short Sleeve Crew and the hems use a twin needle coverstitch for increased durability.
Great on its own for pounding the urban pavements or as the foundation for your cold weather layering system, the Men's Mountain Designs 150 Merino Short Sleeve Crew is a versatile, natural choice.
Design features:
Made from 100% Australian Merino wool – a biodegradable and renewable resource. | null | minipile | NaturalLanguage | mit | null |
Saturday, August 5, 2017
Crazyhead (TV)
There’s so much good TV around these days that some excellent shows get lost in the shuffle. I didn’t hear about Crazyhead until recently, and when I discovered it was written by Howard Overman of Misfits (the best superhero show ever broadcast), I knew I had to watch it.
The story starts out with Amy (Clara Theobald), who works at a bowling alley and has been having some strange visions. She thinks she’s cracking up until she runs into Raquel (Susan Wakoma), who sets her straight: the two of them have the ability to see demons, who possess humans, killing them. Amy’s best friend Suzanne (Riann Steele) is one of them, and they have to perform an exorcism, which goes horribly wrong. But they discover that Raquel is an essential element of a plot by Callum (Tony Curran) to set loose the gates of hell and release demons into the world. Callum also is Raquel’s psychologist, and uses this to keep one step ahead of them. The enlist Jake (Lewis Reeves), a guy from work who has a crush on Amy as their ally, while keeping everything secret from Raquel’s brother Tyler – who Amy is attracted to.
The parallels to Buffy the Vampire Slayer are clear, and the show is much like it, with a sense of humor about everything, like the demon Mercy (Lu Corfield) who has taken over a single mother and laments having to get a babysitter when she goes out to destroy the world.
Susan Wakoma is just plain terrific as Raquel – blunt, foul mouthed, and strongly opinionated. She won an award for best performance and certainly deserves it.
Clara Theobald is very good as Amy, a voice of reason against Raquel’s wilder side. Tony Curran makes a great villain – devious but capable of getting off some very good lines.
The show ran for six episodes, finishing the first story arc. Unfortunately, it was not picked up for a second season. But it’s available on Netflix and is extremely good. Not quite Misfits (but that’s hard to top), but an excellent supernatural comedy horror show. | null | minipile | NaturalLanguage | mit | null |
El-Ourit Waterfalls
El-Ourit Waterfalls () are located seven kilometers from the city of Tlemcen, near the National Road of Algeria in a mountainous area covered with pine trees. Seven stepped cascades form the natural site of Oued El-Ourit, which remained dry for 40 years before reappearing in 2009.
Category:Waterfalls of Algeria
Category:Geography of Tlemcen Province | null | minipile | NaturalLanguage | mit | null |
Q:
Category of "In cahoots."
If I say "They were in cahoots", 'cahoots' makes most sense as a noun.
There are different kinds of nouns. I'm sure different linguistic systems divide them up differently. For instance, there are nouns that refer to objects (trees, rocks, people), nouns that refer to locations, to categories, to states of being (confusion, death) or to abstract concepts.
What noun category do people reckon 'cahoots' falls into?
Of course, you could probably mount an argument that 'in cahoots' is actually a kind of adjective. After all, if we say "He is in despair", we wouldn't consider 'despair' to be a noun, like a location.
A:
Syntactically, it's a noun, but a restricted one: it only occurs in the plural, and only in the phrase "in cahoots [with]". (The OED gives some examples of its use in the singular, including in the meaning "a confederate"; but I think that is obsolete - the examples given are mid-nineteenth century).
If you want to classify it, it must be an abstract noun, like "despair".
By the way, parts of speech, like "noun", are syntactic categories, not semantic ones. A noun is a word which can take on noun-like roles in a sentence. The classification that you are asking about, though, is primarily semantic.
| null | minipile | NaturalLanguage | mit | null |
A "petit" anime adaptation of Akane's Puchimas! -Petit [email protected] manga has been announced at The [email protected] event at the Namco Bandai Games booth in Tokyo Game Show on Sunday. The four-panel manga depicts the overly hyper daily life of the 765Pro idols of The [email protected] — and mysterious creatures named "Puchidoru" who somewhat resemble the idols.
The theme song of the anime is "La La La Wonderland," and Frontier Works will release the CD on November 28. More information about the anime will be available in the November issue of ASCII Media Works' Dengeki Maoh magazine and on the official website.
Akane launched the original manga in Dengeki Maoh in 2011, and ASCII Media Works will publish the fourth manga volume on October 27.
Source: Dengeki
Update: More information added. | null | minipile | NaturalLanguage | mit | null |
The present invention relates to the field of security identification systems, and relates in particular to systems and methods for verifying the identity of persons in high volume screening applications.
Conventional systems for verifying the identity of persons typically involve either the use of highly skilled screening personnel at a large number of screening points, or involve the use of biometric analysis systems. The use of a large number of highly skilled screening personnel that compare photographic identification documents or cards with the face of the person whose identification is being verified is difficult and expensive to achieve since each screener must be highly skilled in complex personal identification techniques. The use of poorly trained screening personnel presents a dangerous false sense of security. Moreover, even with highly skilled screeners, inconsistencies between procedures used by different screeners may present further difficulties.
The use of biometric analyses standardizes and automates much of the process, but applications using biometric analyses suffer from shortcomings as well. For example, many biometric analysis systems require some human interpretation of the data to be certain in a high percentage of cases, and this interpretation may vary. Moreover, the process of obtaining reliable and consistent biometric information from a large number of persons to be identified remains difficult due to biometric data capturing concerns, particularly with non-contact biometric data capturing. Certain conventional non-contact biometric data capturing systems use video cameras to capture the faces of people in a subject area, or employ non-contact sensors to capture characteristics of parts of a person""s body. Such systems, however, remain inconsistent and insufficiently reliable, at least in part due to variations in how the subject is presented to the video camera or sensor. For facial recognition, poor lighting and poor pose angles present significant difficulties. Difficulties are also presented by having a moving subject with a fixed camera view area, particularly if the subject""s face occupies a small portion of a large and highly varying view area. Other non-contact biometric techniques include iris scanning, which requires that each subject walk up to a capture device, align themselves correctly and have their iris scanned and verified. Contact based biometric systems, such as finger print readers, are generally considered to be less safe from a health standpoint due to having a large number of persons touch the same device over a long period of time.
For example, U.S. Pat. No. 6,119,096 discloses a system and method for automated aircraft boarding that employs iris recognition. The system, however, requires that each passenger be initially enrolled and scanned into the system. U.S. Pat. No. 6,018,739 discloses a distributed biometric personal identification system that uses fingerprint and photographic data to identify individuals. The system is disclosed to capture biometric data at workstations and to send it to a centralized server via a wide area telecommunications network for automated processing. Similarly, U.S. Pat. No. 6,317,544 discloses a distributed mobile biometric identification system with a centralized server and mobile workstations that uses fingerprint and photographic data to identify individuals. The system is disclosed to capture biometric data at workstations and to send it to a centralized server via a wireless network for automated processing. Each of these systems, however, may produce false positive identifications (which may overwhelm a review system) or miss certain identifications due to uncertainties in biometric data capture and/or analysis as discussed above.
There is a need, therefore, for an efficient and economical system and method that provides improved personal identity verification for a large number of persons in a high volume environment.
A security identification system is disclosed for providing information regarding subjects to be identified. In accordance with an embodiment, the system includes a biometric data input unit for receiving biometric data regarding a subject at a remote location, a biometric analysis unit, and a quality assurance unit. The biometric analysis unit is for analyzing the biometric data and comparing it against known biometric data in a database at a central facility. The biometric analysis unit is also for providing match data that is indicative of whether a match exists and whether the match is above a certain correlation threshold. The quality assurance unit is for permitting quality assurance personnel at the central facility to monitor interactions of a screener and a subject at the remote location. | null | minipile | NaturalLanguage | mit | null |
Oil Change
An easy way to keep your vehicle’s engine running smooth and reliably is to do an oil change on a regular basis. Engine oil becomes dirty and breaks down over time. The purpose of engine oil is to lubricate internal moving parts and reduce wear. Most vehicle makes and models suggest an oil change every 3000 – 5000 miles. Your vehicle owner’s manual usually includes specific manufacturer recommended maintenance schedules. If you have trouble finding the recommended schedule for your vehicle, just call us here at Gilroy AutoWorks.
Motor oil protects more functions within an engine than any other component, fluid or material. Some of the key motor oil tasks are to protect the engine by lubricating its moving parts, cool critical engine parts by transferring heat away, pump easily to critical engine parts at low temperatures, keep internal components clean and free from varnish and harmful deposits.
Your car’s filters are important to the longevity of your car and interior comfort. Maximize your car investment by replacing filters regularly. The oil filter traps contaminants, allowing the oil to flow through the engine unrestricted. The fuel filter separates harmful contaminants that may cause problems with carburetors or intricate fuel injectors. | null | minipile | NaturalLanguage | mit | null |
My partner ported her number of Exetel (for business) but her Account Status under 'Service & Usage' still listed as active. Next billing cycles in only 10 days away don't want the account fees to roll over. Ported on Dec 13th, and no Usage shown since then. My mobile and NBN still corrected listed as active.
My partner ported her number of Exetel (for business) but her Account Status under 'Service & Usage' still listed as active. Next billing cycles in only 10 days away don't want the account fees to roll over. Ported on Dec 13th, and no Usage shown since then. My mobile and NBN still corrected listed as active.
Please drop an email to billing@exetel.com.au including the service details and they will check accordingly. | null | minipile | NaturalLanguage | mit | null |
Electromechanical devices of this type are already known, which comprise a first connection for a source of power, a second connection apt to be connected to a load supplied by said source of power and means for controlling the intensity of the current traversing the load, these control means comprising a variable resistance circuit connected between the first and the second connections, as well as mechanical means apt to vary the resistance of the resistance circuit.
In this manner the intensity of the current traversing the load can be made to vary and, in the event this load is a motor, the speed of said motor can be made to vary.
In the case of a device of this type applied to set the speed of the motor of a fan in a motor vehicle, the control means generally comprise a multi-position switch having one control arm apt to co-operate with a given number of terminals each of which is connected to the motor by an electrical connection comprising an electric wire and a resistance of definite value.
By acting on the switch, the arm is made to co-operate with a selected terminal, this making it possible to establish an electrical connection with the motor across the corresponding resistance.
In this manner the speed of the motor can be given a value chosen from among a limited number of values, each of which is defined by an appropriate resistance. For example, the speed of the motor can be set between a zero speed, a low speed, an intermediate speed and a high speed.
In known devices of this type a multiplicity of electrical connections is required, therefore also a large number of electrical wires between the switch and the fan motor.
This makes it necessary to have a great length of wire and may lead to inverted connections and the corresponding installation is disassembled and then reinstalled.
Moreover, inasmuch as the switch is located in the instrument panel of a vehicle, while the fan motor is housed in a box located at a distance from this instrument panel, the electrical wires form a bundle of great length for which a passage between the instrument panel and the fan housing must be provided.
Finally, the terminals or contacts located in the instrument panel are not cooled and can become damaged or yet deteriorate under the effect of the heat released. | null | minipile | NaturalLanguage | mit | null |
Oldani Opens 1st Branch of Michelin-Starred Restaurant in Manila
There are many reasons we have to look forward to the opening of FOO’D by Davide Oldani (chef and owner of Michelin-starred D’O in Milan) at Shangri-La at The Fort this weekend. High on that list would be our now favorable proximity to a plate of his famed risotto Milanese, because no one cooks risotto quite like him—not even your best friend’s nonna. And lest we forget his signature caramelized onion tart topped with 24-month aged Grana Padano warm mousse and cold ice cream, finished with Maldon salt.
IMAGE Courtesy of FOO'D
Cipolla Caramelata
But perhaps what may interest Manila’s dining class the most about his new opening in partnership with Foodee Global Concepts led by the father and son tandem Rikki and Eric Dee—the names behind the successful Todd English Food Hall and Tim Ho Wan—is the chef’s ability to deliver remarkable gastronomic POP creations at accessible price points. The 50-seater restaurant with an adjacent cocktail lounge is, for now, a la carte only offering three and four - course tasting menus that begin at P800. The initial offering consists of the cipolla caremelata, the Spring chicken and prawn with veal jus entree, and the house's special dessert, a lemon curd served with dehydrated meringue, cacao crumble, curry almonds, and lettuce gelato.
IMAGE Courtesy of FOO'D
Milanese D'O
At his restaurant D’O, his brand of Cucina Pop, where he serves seasonal menus that reflect his culinary ingenuity, has gained worldwide fame not only because of its high quality gourmet offerings but also due to the democratic pricing he has been able to achieve. Oldani’s refined technique—learned in part from his mentors Gualtiero Marchesi, Michel Roux, and Alain Ducasse—along with his playful sense of style, as evidenced by his use of self-designed tableware such as wine glasses with uneven rims and a passe-partout, better known locally as a “spork,” has become part of the restaurant’s spirited allure. His winning business model has become so popular among restaurateurs, that it has even been the subject of a Harvard Business School case study.
ADVERTISEMENT - CONTINUE READING BELOW
IMAGE Courtesy of FOO'D
Chef Davide Oldani
Catapulted recently to poster boy fame as an ambassador of Italian cuisine for Expo Milan 2015, Oldani has been cooking at his simple and cozy 40-seat trattoria for over a decade, and his Manila opening marks his first international venture. Despite its off-center location in Cornaredo, a small town outside of central Milan, a table at D’O has been one of the most difficult reservations to secure that side of Italy. In 2014, he opened a café at Milan’s Malpensa airport and last summer, he opened a fancier, Piero Lissoni designed-space, adjacent to his original dining room that has doubled his seating capacity.
Open for lunch and dinner with dinner reservations at 6 p.m. and 8 p.m. only. Ground Floor, Shangri-La at The Fort, Taguig; 950.8492; 0917.7114469 | null | minipile | NaturalLanguage | mit | null |
Not happy: Ron Luffman was served a cup full of salt (Picture: Cascade)
A McDonald’s customer was far from ‘lovin’ it’ after being served a cup filled with salt instead of a milkshake.
Angry Ron Luffman, 49, said he was ‘physically sick’ after swallowing the salt following a trip to a drive-thru restaurant in North Cheam, Surrey.
‘I sucked hard on the straw in my milkshake because they’re usually quite thick and – wallop! – I’ve got about four teaspoons of salt in my mouth,’ he explained.
‘I was violently sick because I’d swallowed that much salt. Where I sucked it up through the straw it went straight to the back of my throat and I couldn’t help but swallow it. I was sick right there.
‘I was very sick and then I haven’t been feeling too clever for the whole weekend – but what if this had happened to a child? This could have killed a kid.’
McDonald’s have launched an investigation into the incident in North Cheam, Surrey (Picture: Google)
The catering business manager called at the London Road McDonald’s with his wife before a visit to their son last Thursday.
‘I was fuming so I went into the restaurant and I opened up the cup to show them … it was a whole cup full of salt,’ he added.
‘I was so angry I poured it out on the counter. The boy who served me was there and he just looked at me and said “it wasn’t me”.
‘I think one of them has done this deliberately. Why would salt be in a drink cup?’
A spokesman for McDonald’s said an investigation has been launched into the incident.
‘The quality of our products and the well-being of our customers is our number one priority. We apologise to Mr Luffman for this genuine error and for any upset caused,’ he said.
‘The restaurant will be asked to review their procedures to ensure that this does not happen again.’ | null | minipile | NaturalLanguage | mit | null |
The man that started it all, at the end of all things. Image : Disney
About 20 minutes into my screening of Avengers: Endgame, I started losing my mind. It was a befuddlement not necessarily caused by what was happening on screen and what it meant for the plot of the film, but because what I was seeing unfold felt like it shouldn’t exist. Or that it arguably can ever exist in another form, ever again.
Once removed from the context of its place as the cap on 11 years of film making, Endgame is a deeply impenetrable movie to an inexperienced viewer. In fact, it’s so deeply enmeshed within that framework of the Marvel Cinematic Universe that even attempting to remove it from such a context feels futile. Who is this blonde woman walking around threatening to kill whatever a Thanos is, an unlucky, potentially first-time watcher of a Marvel movie sitting down for Endgame might ask? Well, you missed out watching the last Marvel movie, which sets up her origin 20 years prior to this scene, and this movie sure as hell won’t explain any of that, or how she got here to you. You need to go watch the post-credits scene of that other movie to understand that.
I think maybe Carol’s name is said once in this movie? Twice? Image : Marvel Studios
Characters fly in and out of scenes, and are brought into the narrative with zero introduction. Things happen based on the sheer, giddy assumption that you remember, and are intimately familiar with, plot details and character beats not just from a film that came out last year, but movies that came out over the last decade. And not just for Easter egg callbacks—although there’s plenty of that too, both to the films before it and the comics that inspired it—but for tangible arcs of Endgame’s entire plot, our heroes jumping across their own cinematic timeline to gather the Infinity Stones from points before they were taken in previous films.
This movie invites you to prominently recall the events of Thor: The Dark World, goddammit! Who’s done that since Thor: The Dark World came out!?
And when it’s not just throwing the smörgåsbord of connections and plot beats at you—at a pace that is frankly alarming for a movie that is three hours long—Avengers: Endgame loves itself, and the Marvel movies that came before, perhaps more than any other movie I’ve seen.
Every inch of the film is laden with knowingly self-indulgent touches, that not only act as indulgence for the characters—Tony Stark gets to say thank you to his father years after he was taken out of his life by tragic circumstance, Thor gets to be proven right years after Age of Ultron about the worthiness of Steve Rogers, and Steve finally gets that date with Peggy Carter he scheduled in The First Avenger—but also the wider meta-narrative of the build-up to this movie itself. For instance, a scene where Thor: Ragnarok characters Korg and Miek play Fortnite, a video game Endgame is currently crossing over with.
This is still weird. Image : Epic Games
Hell, this movie has an extended sequence in which Captain America admires his own ass (not on himself but on a past version of himself)—as an acknowledgement of the wider internet discourse of said ass’s prominence on prior Marvel movie posters and fandom at large—before he proceeds to walk right into a shot-for-shot homage to the set-up for Chris Evans’ favorite fight scene from The Winter Soldier. That moment itself is diffused by Cap calling back to that film’s big twist and also the 2016-2017 comic book event Secret Empire by whispering “Hail Hydra” in the ear of returning minor character Agent Sitwell.
It’s absurd.
All that might sound like I’m complaining about Endgame’s fanservice mania, and the barrier of entry it creates (or rather should create) for viewers who are not already submerged in the Marvel milieu. After all, there was a lot of discussion surrounding the baffling impenetrability of last year’s Avengers: Infinity War in the wake of its release—a movie that, in hindsight, Endgame basically looks at and goes “Oh, you thought that was impenetrable? Ha!” But I’m not—there are legitimate critiques of Endgame to be had that have nothing to do with its massive wall of canon.
Instead, I can’t help but find myself still slack-jawed, days removed from having seen it, at just how much Endgame gets away with on sheer, audacious glee alone. It also helps that it’s clear the film’s barriers did nothing to damage either its critical assessment (it sits at 96 percent consensus on Rotten Tomatoes as of writing, atop a throng of gushing reviews) or its box office chances this past weekend (to the tune of over $1.2 billion dollars around the world). It’s also clear that Avengers: Endgame itself knew that wouldn’t matter.
The Mad Titan sends forth his army in Endgame’s climax. Image : Marvel Studios
The architects behind this movie have spent 11 years and 21 blockbuster movies (21!) laying the groundwork to be able to pull off a film as joyously, indulgently ridiculous as Endgame. It finally, truly captures the wonderfully silly incomprehension of the comic books that inspired it in ways few other comic book movies before it have, because the Marvel Cinematic Universe has spent all this time slowly layering up a host of characters and events to draw upon in one explosive curtain call. Just like its source material has been doing for the best part of a century now, paying off stories in ludicrous, earth-shattering comic book events.
The fuse those movies spent a decade making has been lit, and can’t really be re-lit without building up the stockpile of narrative fireworks all over again. And who else in Hollywood right now could even do that? It is only with the command of a back catalog of films in which to sow the seeds for this overwhelming barrage of fanservice, or the consistent vision of a producer like Kevin Feige, or the unfathomable capitalist might of a studio like Disney—who can gather rival movie studios under its thrall like Thanos gathers Infinity Stones for his gauntlet—that such an undertaking could happen.
There will never be another movie like Avengers: Endgame. There can’t be.
Remember when it was considered a bad idea that this guy could play a superhero? Image : Marvel Studios
Even if the attempt is made—even if it’s one made by Disney and Marvel itself, another decade down the line—it can never match the perfect storm of circumstances that led to this individual moment, because Endgame is the first time such an audacious undertaking has been pulled off in this manner.
Eleven years ago we were all wondering if a controversial actor like Robert Downey Jr. playing a B-tier Marvel character like Iron Man—and who cared about Iron Man, of all superheroes, in those days?—could make for a compelling movie. Now, the sight of Downey’s signature in the end credits of a movie where he bid a final farewell to the role of Tony Stark is enough to make audiences well up with emotion. How can a second attempt at this sort of fanservice-laden payoff over a decade of cinema even remotely have the same impact as the incredulous idea of gathering together all these actors, and all these characters?
It’s an incredible, valiant achievement—one that was completely absurd to watch unfold this past weekend. But there’s a wonder in that absurdity that made doing so a complete delight. Whatever I ultimately end up taking away from Avengers: Endgame long after I’ve had the time to absorb it all, it’s a moment I don’t think I can ever forget.
For more, make sure you’re following us on our new Instagram @io9dotcom. | null | minipile | NaturalLanguage | mit | null |
ST. LOUIS - Jeffrey Teckman, M.D., professor of pediatrics and biochemistry and molecular biology at Saint Louis University, has received a $1.4 million grant from the Alpha-1 Foundation to investigate the natural history and progression of Alpha-1 Antitrypsin Deficiency, an inherited disease that can cause liver damage in children as well as adults.
Jeffrey Teckman, M.D., is the professor of pediatrics and biochemistry and molecular biology at SLU.
The multi-center Adult Clinical and Genetic Linkage Study aims to understand the Alpha-1 liver disease in adults and answer various questions about effective methods of treatment. The study will be conducted at SLU, University of Florida, Gainesville and University of California, San Diego.
"Alpha-1 can cause life-threatening liver disease, and even cancer in some patients. But we can't predict in which patients it will develop or how fast liver damage will progress if it occurs," said Teckman, who serves as the director of the Division of Gastroenterology and Hepatology at SSM Cardinal Glennon Children's Medical Center. "This study will be helpful to understand how quickly it gets worse and what will be the science behind understanding that process."
Alpha-1 liver disease was discovered almost 50 years ago, but researchers have not yet identified many of the basic questions that will lead to possible treatment options. The study will be helpful in providing information about the progression of Alpha-1 liver disease in patients to companies that are looking to develop pharmaceuticals and other treatments.
"This is an important step in building knowledge about the disease," Teckman said. "And this knowledge will help us develop better treatment."
Adrian Di Bisceglie, M.D., chair of the department of internal medicine at Saint Louis University will also be involved with the study.
Teckman has worked with the Alpha-1 community for 15 years. Two years ago, the Alpha-1 Foundation developed a task force dedicated to finding out more about the liver disease. During the committee meetings, Teckman and other researchers identified the need to study a group of adults in order to discover basic questions about Alpha-1 liver disease to drive research for new treatment. Earlier this year, Teckman also published a paper in which he presents an approach for hepatologists to manage adult patients with Alpha-1 deficiency.
This study will have some similarities with The Childhood Liver Disease Research and Education Network (ChILDREN) study, in which Teckman and the others have been monitoring 300 children with the Alpha-1 condition for 10 years, the largest group of kids with Alpha-1 being studied in the world. Each year, some of Teckman's patients travel from various parts of the country, including Florida, Texas, Michigan and Wisconsin, to participate in this study.
Established in 1836, Saint Louis University School of Medicine has the distinction of awarding the first medical degree west of the Mississippi River. The school educates physicians and biomedical scientists, conducts medical research, and provides health care on a local, national and international level. Research at the school seeks new cures and treatments in five key areas: cancer, liver disease, heart/lung disease, aging and brain disease, and infectious disease. | null | minipile | NaturalLanguage | mit | null |
Low dose prednisone therapy in rheumatoid arthritis: a double blind study.
Prednisone, 5 mg taken each morning, was added to other drugs in 18 patients with rheumatoid arthritis. Sixteen patients were given a placebo in this double blind study. After 24 weeks, all patients were given the placebo. Slight functional improvement was noted in the prednisone group during the 24-week period, but deterioration after switching to placebo was sustained for at least 8 weeks. Progression of hand erosions occurred in 1 prednisone-treated patient, and in 4 controls. An asymptomatic vertebral spine compression fracture developed in 2 patients given prednisone; this was the only toxicity noted possibly due to this therapy. Minimal dose prednisone may be useful as "bridge" therapy between nonsteroidal antiinflammatory therapy and use of disease-modifying drugs. | null | minipile | NaturalLanguage | mit | null |
Background
==========
Genetically-altered mouse models are proving powerful tools for studying the genetic regulation of embryonic and placental growth and development \[[@B1]-[@B3]\], and the interaction between genes and the environment on intrauterine and postnatal growth \[[@B4]\]. Advancing knowledge gained from such models is important given the critical importance of intrauterine growth as a risk factor for perinatal and childhood morbitity and mortality \[[@B5]\] and for diverse adult-onset diseases including diabetes, cancer, and hypertension \[[@B6]-[@B8]\]. Factors regulating intrauterine growth are known to differ from those important postnatally, and they remain poorly understood \[[@B9],[@B10]\]. Thus, methods to monitor embryonic and placental growth efficiently and accurately in utero in mice would accelerate progress in this important area.
Body weight is the most common parameter used to quantify growth but it provides no information on whether growth is proportionate or preferentially affects length, girth, or other body proportions. Placental growth is often neglected despite the critical role of this organ in supporting embryonic growth and maternal adaptations to pregnancy. Abnormal placental size is now recognized as an early predictor of poor fetal growth and poor pregnancy outcome in human pregnancy \[[@B11]\]. Furthermore, detection of a decelerating rate of intrauterine growth using ultrasound improves the sensitivity of detection of compromised human fetuses \[[@B12]\] suggesting serial measurements of growth would also be of value when phenotyping mouse models with intrauterine growth abnormalities. Thus there is a pressing need for methods to quantify prenatal growth characteristics as a function of gestation in genetically-altered and/or environmentally-challenged mice.
Most prior work in mice has evaluated prenatal growth using ex vivo embryonic and/or placental weights as measured variables. In human pregnancy, ultrasound is extensively used to quantify fetal and placental growth, and to estimate fetal gestational age and/or body weight based on morphometric measurements. Measurement parameters include gestational sac dimension, crown-rump length, abdominal circumference, biparietal skull diameter, and femur length \[[@B13],[@B14]\]. Recent work in mice showed these parameters can be measured in embryos in utero using 7.5 to 15 MHz ultrasound \[[@B15]-[@B18]\] and can be used to generate prediction equations for gestational age \[[@B16],[@B17]\]. However, information on normal growth trajectories for embryonic parameters is limited and there is no information on placental parameters or on measurement accuracy, and no body weight prediction equations exist for using ultrasound measurements of mouse embryos.
There have been major technological advances in small animal imaging \[[@B19],[@B20]\] including the development of micro-ultrasound \[[@B21]\]. A lateral resolution of \~40 μm is achieved using \~40 MHz ultrasound and this represents an approximate 10-fold improvement over more conventional 15 MHz ultrasound \[[@B22]\]. Micro-ultrasound has been used to quantify growth of the lens of the embryonic eye in mouse embryos from E11.5 to term \[[@B23]\] suggesting that this higher resolution instrumentation might permit growth quantification of other parameters in the embryo and placenta to commence earlier in gestation and provide more precise measurements than previously possible.
In the current study, we used 40 MHz ultrasound to image the postimplantation mouse conceptus and determined (1) feasible age range for measuring specific variables using on-screen digital calipers, (2) normative growth curves and gestation prediction equations, (3) accuracy of ultrasound measurements in comparison with light microscopy, and (4) body weight prediction equations using regression analysis for CD-1 mice and their accuracy when applied to other mouse strains.
Methods
=======
Experiments were approved by the animal care committee of Mount Sinai Hospital and were conducted in accord with guidelines established by the Canadian Council on Animal Care. The normal developmental time-course for growth parameters were obtained in pregnant out-bred mice between 1 and 5 PM (CD-1; Harlan Sprague Dawley, Indianapolis, IN). Mice were on a 12 h light dark cycle, were housed in SPF conditions, and were fed ad-lib (Purina Picolab Rodent Diet 20). Measurements were obtained from transcutaneous, non-invasive ultrasound images obtained from a total of 211 embryos from at least three pregnant mice per gestational day from E7.5 to E18.5. After ultrasound exams, the mouse was killed while still anesthetized, and the embryos and placentas were collected for direct measurement of weight. In some cases, direct measurements of dimensions by light microscopy were made using an eye-piece graticule (Fig. [1](#F1){ref-type="fig"}) to evaluate the accuracy of the ultrasound measurements. In these cases, the locations of embryos in the abdomen were recorded during the ultrasound exams and the corresponding embryos were identified post mortem (144 embryos from 16 pregnant mice between E11.5 and E18.5 of gestation). These were used for pair-wise comparisons of in utero and ex utero measurements.
{#F1}
Day 0.5 of pregnancy (E0.5) was defined as morning on the day a vaginal plug was found after overnight mating. Mice were lightly anesthetized with \~1.5% isoflurane in oxygen by face mask. Hair was removed from the abdomen by shaving, followed by a chemical hair remover. Pre-warmed gel was used as an ultrasound coupling medium. A 30 MHz or 40 MHz transducer operating at 30 frames/s was used to transcutaneously image embryos within the maternal abdomen (Model Vevo 660, VisualSonics Inc., Toronto, ON, Canada). Maternal heart rate and rectal temperature were monitored (Model THM100; Indus Instruments, Houston, TX), and heating was adjusted to maintain rectal temperature between 36 and 38°C.
The electronic calipers of the ultrasound software were used to measure embryonic and placental dimensions on the ultrasound screen (Fig. [1](#F1){ref-type="fig"}, [2](#F2){ref-type="fig"}). The long axis and the largest dimension perpendicular to the long axis were measured and averaged to provide a measurement of the size of the gestational sac (i.e. the fluid-filled structure containing the embryo which is visualized as an anechoic (dark) space bounded by the surrounding echogenic (white) tissue of the parietal yolk sac) (Fig. [2A](#F2){ref-type="fig"}). Eye lens diameter was the average of the largest dimension and the orthogonal dimension (Fig. [2B](#F2){ref-type="fig"}). Femur length was measured on a longitudinal view from the outer edges of the ossified bone (Fig. [2C](#F2){ref-type="fig"}). The CRL was quantified as the maximum distance from the cephalic pole to the caudal pole (Fig. [1A](#F1){ref-type="fig"}). The BPD was measured from the outer border of the transverse axial view of the head in which the central midline echo and the lateral ventricles were visible (Fig. [1B](#F1){ref-type="fig"}). Abdominal circumference (AC) was calculated from the abdominal anteroposterior diameter (APD) and abdominal transverse diameter (ATD) measured from a transverse section of the fetal abdomen at the level of the stomach and the umbilical vein (Fig. [1C](#F1){ref-type="fig"}), where AC = π (ATD + APD)/2. For placental measurements, a transverse image of the placenta was obtained at the insertion site of the umbilical cord and the placental diameter (PD) was measured. Placental thickness (PT) was measured at the centre of the placenta from the chorionic surface to the echogenic calcium deposits in the giant cell layer \[[@B24]\] (Fig. [1D](#F1){ref-type="fig"}).
{#F2}
Results are presented as individual embryo values (Fig. [3](#F3){ref-type="fig"}) or as the values predicted at each gestational age from the regression equations shown in Table [1](#T1){ref-type="table"} and listed in Table [2](#T2){ref-type="table"}. A *p*value of \< 0.05 was considered statistically significant. Non-linear regression analysis was used to determine the relationship between the parameter and gestational age. Regression analysis was used to generate equations relating fetal weight to measured ultrasound parameters. Agreement between ultrasound and light microscopic measurements was quantified using Bland-Altman analysis \[[@B25]\] and was expressed as the 95% confidence interval for the percent difference (100 × (ultrasound - light microscopy)/average of two methods). Equations derived from CD-1 mice were applied to estimate body weight from ultrasound parameters in embryos from different strains, and the agreement between measured body weight and predicted body weight was expressed as the mean absolute percent discrepancy (100 × (absolute value of predicted - measured weight)/measured weight).
{#F3}
######
Prediction equations for growth parameters (in mm) as a function of gestational age (in days)
---------------------------------------------------------------------
Gestational sac (GS):
GS = -9.66 + 1.40(GA)
R^2^= 0.9602
Crown-rump length (CRL):
CRL = -9.42 + 1.09(GA) + 0.0281(GA)^2^
R^2^= 0.9682
Biparietal diameter (BPD):
BPD = 50.47 - 17.14(GA) + 2.07(GA)^2^- 0.103(GA)^3^+ 0.00186(GA)^4^
R^2^= 0.9733
Abdominal circumference (AC):
AC = -55.75 + 7.52(GA) - 0.166(GA)^2^
R^2^= 0.9723
Femur length (FL):
FL = -5.02 + 0.392(GA)
R^2^= 0.8215
Lens diameter (LD):
LD = 2.205 - 0.518(GA) + 0.0401(GA)^2^- 0.000856(GA)^3^
R^2^= 0.9618
Body weight (BW):
BW = 0.5488 - 0.01714(GA) - 0.01180(GA)^2^+ 0.0008279(GA)^3^
R^2^= 0.9906
Placental diameter (PD):
PD = -11.96 + 2.09(GA) - 0.046(GA)^2^- 0.0005(GA)^3^
R^2^= 0.8941
Placental thickness (PT):
PT = 4.10 - 1.14(GA) + 0.115(GA)^2^- 0.0031(GA)^3^
R^2^= 0.7562
Placental weight (PW):
PW = -0.54180 + 0.07887(GA) - 0.002243(GA)^2^
R^2^= 0.8237
---------------------------------------------------------------------
GA, gestational age
######
Predicted fetal measurements at each gestational age using regression equations in Table 1
------------------------------------------------------------
GA\ BW\ GS\ CRL\ BPD\ AC\ FL\ LD\
(days) (g) (mm) (mm) (mm) (mm) (mm) (mm)
-------- ------- ------ ------- ------ ------- ------ ------
7.5 0.84
8.5 2.24 1.88 0.79
9.5 3.64 3.47 1.30
10.5 0.026 5.04 5.12 2.09 4.91 0.20
11.5 0.050 6.44 6.83 3.00 8.78 0.25
12.5 0.108 8.60 3.90 12.31 0.32
13.5 0.204 10.42 4.70 15.52 0.41
14.5 0.343 12.29 5.37 18.39 0.52
15.5 0.531 14.23 5.92 20.93 1.06 0.62
16.5 0.772 16.22 6.39 23.14 1.45 0.73
17.5 1.072 6.89 25.01 1.84 0.83
18.5 1.435 7.55 26.56 2.23 0.93
------------------------------------------------------------
GA, gestational age, BW, body weight, GS, gestational sac; CRL, crown-rump length; BPD, biparietal diameter; AC, abdominal circumference; FL, femur length; LD, lens diameter
Results and Discussion
======================
The gestational sac dimension was the earliest quantitative measure of growth and was consistently measurable from E7.5. It provides a measure of the fluid space surrounding the embryo. Gestational sac dimension increased linearly by 1.40 mm/d from 0.84 mm at E7.5 to 6.44 mm at E11.5 when measurement of this parameter was discontinued (Fig. [3A](#F3){ref-type="fig"} and Table [1](#T1){ref-type="table"}, [2](#T2){ref-type="table"}). By this method, gestational sac dimension was measurable two days earlier than in prior work using 15.5 MHz ultrasound \[[@B16]\]. Both methods yielded similar gestational sac dimensions at E9.5 (4.4 mm vs. 3.64 mm in the current study).
The crown-rump length of the embryo was measurable from E8.5 to E16.5 when the length of most CD-1 embryos exceeded the field of view so were no longer measurable. Crown-rump length increased non-linearly from 1.88 mm at E8.5 to 16.22 mm at E16.5 (Fig. [3B](#F3){ref-type="fig"} and Tables [1](#T1){ref-type="table"}, [2](#T2){ref-type="table"}). At E8.5 the embryonic headfold is at an early stage of development and the embryo has not yet rotated into the embryonic position characteristic of the rest of gestation. Nevertheless, the \'crown-rump length\' measured at this gestation was congruent with the relationship between crown-rump length and gestational age of older embryos (Fig. [3B](#F3){ref-type="fig"}). Crown-rump length was one of the easiest parameters to measure, and regression analysis showed that it was a good predictor of embryonic body weight and of gestational age (Tables [3](#T3){ref-type="table"}, [4](#T4){ref-type="table"}). Prior work using 15 MHz ultrasound showed that crown-rump length could be measured as early as E10.5 in CD-1 embryos \[[@B16]\] or E12.5 in C57Bl/6J embryos \[[@B15],[@B18]\]. A more recent publication indicates that crown-rump length is measurable from E5.5 to E18.5 in CD-1 and C57Bl/6J embryos using 7.5--10 MHz ultrasound but the measurement accuracy was not reported at any gestational age. Crown-rump length in the current study tended to be larger than values predicted using formulas for CD-1 embryos \[[@B16],[@B17]\] or reported in Tables for C57Bl/6 embryos \[[@B15],[@B18]\] in prior work using 7.5 to 15 MHz ultrasound (Fig. [4](#F4){ref-type="fig"}). Nevertheless, we found good agreement between crown-rump length measured by light microscopy ex vivo and ultrasound in vivo (Fig. [5A](#F5){ref-type="fig"}). Overall, there was no significant bias, and the difference between measurements by the two methods was 25% or less (Fig. [6A](#F6){ref-type="fig"}). Thus, measurements using lower resolution ultrasound may underestimate crown-rump length.
![**Comparison of crown-rump length and biparietal diameter measurements with prior work**. Crown-rump length (CRL) and biparietal diameter (BPD) are shown as a function of gestational age. Open symbols show the results obtained for each conceptus in the current study. The solid lines were generated using the regression equations shown in Table 1. Solid symbols show results from prior work. Values were calculated using formulas for CD-1 embryos obtained using 7.5--10 MHz (blue squares; \[[@B17]\]) or 15 MHz (green triangles; \[[@B16]\]) ultrasound or are means reported in Tables for C57Bl/6 embryos (red circles \[[@B18]\], purple diamonds \[[@B15]\]).](1477-7827-6-34-4){#F4}
{#F5}
{#F6}
######
Prediction equations for gestational age (in days) from measured variables (in mm)
------------------------------------------------------------------------------------
Gestational sac (GS):
GA (day) = 6.687 + 1.395(GS) - 0.4391(GS)^2^+ 0.09837(GS)^3^- 0.007091(GS)^4^
R^2^= 0.9683
Crown-rump length (CRL):
GA (day) = 7.622 + 0.5264(CRL) + 0.009440(CRL)^2^- 0.0005539(CRL)^3^
R^2^= 0.9693
Biparietal diameter (BPD):
GA (day) = 8.195 + 0.8689(BPD) + 0.08056(BPD)^2^
R^2^= 0.9648
Abdominal circumference (AC):
GA (day) = 7.645 + 0.8774(AC) - 0.07917(AC)^2^+ 0.004024(AC)^3^- 6.508e^-5^(AC)^4^
R^2^= 0.9698
Femur length (FL):
GA (day) = 12.24 + 3.822(FL) - 0.5103(FL)^2^
R^2^= 0.8287
Lens diameter (LD):
GA (day) = 11.96 - 84.88(LD) + 1470(LD)^2^- 4625(LD)^3^
R^2^= 0.7582
------------------------------------------------------------------------------------
GA, gestational age
######
Prediction equations for body weight (in g) from measured variables (in mm)
-----------------------------------------------------------------------
From crown-rump length (CRL):
BW = -0.696 + 0.0890(CRL)
R^2^= 0.938
From biparietal diameter (BPD):
BW = -34.08 + 32.10(BPD) - 11.130(BPD)^2^+ 1.68(BPD)^3^-0.093(BPD)^4^
R^2^= 0.945
From abdominal circumference (AC):
BW = 4.20 - 0.76(AC) + 0.045(AC)^2^- 0.00078(AC)^3^
R^2^= 0.957
From crown-rump length (CRL) and abdominal circumference (AC):
BW = -0.757 + 0.0453(CRL) + 0.0334(AC)
R^2^= 0.962
-----------------------------------------------------------------------
BW, body weight
Abdominal dimensions were sometimes measurable at E9.5 but were consistently measurable from E10.5 onwards. Abdominal anteroposterior diameter measured by ultrasound in vivo showed good agreement with light microscopic measurement ex vivo (Fig. [5C](#F5){ref-type="fig"}), with no significant bias and a discrepancy of \<21% (Fig. [6C](#F6){ref-type="fig"}). Abdominal anteroposterior and transverse diameters were used to calculate abdominal circumference. Abdominal circumference provides an indicator of soft tissue growth of abdominal organs, primarily the liver \[[@B26],[@B27]\]. Abdominal circumference increased non-linearly with advancing gestation (Fig. [3D](#F3){ref-type="fig"}, Table [1](#T1){ref-type="table"}, [2](#T2){ref-type="table"}). Regression analysis showed that abdominal circumference was a good predictor of embryonic body weight and gestational age (Table [3](#T3){ref-type="table"}, [4](#T4){ref-type="table"}), which is consistent with prior work in human pregnancy.
Biparietal diameter increased from 0.79 mm at E8.5 (when it was measurable in most embryos) to 7.55 mm at E18.5 based on the non-linear regression equation for biparietal diameter as a function of gestational age (Fig. [3C](#F3){ref-type="fig"} and Table [1](#T1){ref-type="table"}). Biparietal diameter was a good predictor of gestational age (R^2^= 0.9648; Table [3](#T3){ref-type="table"}) and body weight (R^2^= 0.945; Table [4](#T4){ref-type="table"}). Biparietal diameters in the current study were generally within the range predicted using formulas published previously for CD-1 embryos (obtained using 7.5 -- 10 MHz \[[@B17]\] or 15 MHz ultrasound \[[@B16]\]) (Fig. [4](#F4){ref-type="fig"}). Whether biparietal diameter was measured by ultrasound in vivo or by a light microscope ex vivo (Fig. [5B](#F5){ref-type="fig"}), bias was not significant and the difference was \<20% (Fig. [6B](#F6){ref-type="fig"}). Biparietal diameter provides prenatal diagnosis of microcephaly in human pregnancy \[[@B28]\] and may reveal asymmetric growth in intrauterine growth restriction. We note that the bias between ultrasound and light microscopy measurements of biparietal diameter tended to be smaller than for soft tissues (i.e. anterioposterior abdominal dimension, placental diameter, and crown-rump length) (+1% versus -6% to -8%) (Fig. [6](#F6){ref-type="fig"}). Although biases were not statistically significant, this trend may be caused by the less distinct tissue boundaries for soft tissues when viewed by ultrasound.
The femur was first detectable within the hind limb at \~E15.5 and increased linearly in length to term at a rate of 0.392 mm/d (Fig. [3E](#F3){ref-type="fig"} and Table [1](#T1){ref-type="table"}, [2](#T2){ref-type="table"}). Prior work also found that the femur was first visualized by ultrasound at this gestational age and suggested it may be useful as a marker for this stage of development \[[@B16]\]. Ossification of the femur was first detected between E14.5 and E15.5 in ex vivo specimens and was primarily localized to the middle of the femur with the extremities of the femur composed of cartilage \[[@B29]\]. Ultrasound-detectable femur length in the current study is 41% to 46% of that determined ex vivo at E15.5 to E18.5 respectively \[[@B29]\], likely because only the middle, ossified region of the femur is detectable by ultrasound. Nevertheless the growth of the femur determined in the current study over this interval (+110%) is similar to that of the whole femur assessed ex vivo (+88%) \[[@B29]\] suggesting that it is a useful non-invasive measure of long bone growth.
The lens, vitreous humor and retina of the eye were visible by ultrasound from E10.5 onwards (Fig. [2B](#F2){ref-type="fig"}) as shown previously using similar ultrasound instrumentation and the same mouse strain \[[@B23]\]. Lens diameter increased non-linearly with gestational age from 0.20 mm at E10.5 to 0.93 mm at E18.5 (Fig. [3F](#F3){ref-type="fig"}, Table [1](#T1){ref-type="table"}, [2](#T2){ref-type="table"}). We note that non-linearity in our data was primarily due to the earliest age point and thus may reflect slower growth during early differentiation of the eye. When linear regression was applied as in prior work, the linear growth rate was \~90 μm/day which is similar to the 70 μm/day previously reported \[[@B23]\]. Lens diameter increases approximately linearly with gestational age in human fetuses from 15 to 40 weeks gestation \[[@B30]\]. In human fetuses, slow ocular growth is associated with delayed cerebral development \[[@B31],[@B32]\]. Thus a measurement of lens diameter may provide a useful phenotyping marker for eye and, indirectly, brain development in mouse models.
Placental diameter and placental thickness were found to increase non-linearly with gestational age (Table [1](#T1){ref-type="table"}, Fig. [7](#F7){ref-type="fig"}). Both measures of placental size increased progressively from E10.5 to \~E14.5 then remained constant to term (Fig. [7](#F7){ref-type="fig"}). A growth plateau in late gestation is in accord with the plateau observed in placental weight measurements (Fig. [8B](#F8){ref-type="fig"}) and contrasts with continued late-gestational increases in fetal body weight (Fig. [8A](#F8){ref-type="fig"}) and umbilical blood flow velocity \[[@B33]\]. The late-gestational plateau in placental growth corresponds to a maturational phase of placental development in which vascularity increases and the thickness of the materno-fetal interhaemal barrier decreases \[[@B34]\] thereby enhancing placental transfer efficiency.
{#F7}
{#F8}
In human pregnancy, ultrasound parameters are routinely used to estimate fetal gestational age and body weight. Thus, we used regression analysis to generate equations to predict gestational age from individual ultrasound parameters (Table [3](#T3){ref-type="table"}). We used CD-1 mice, an out-bred strain often used in reproductive research because it is a reliable and prolific breeder. These equations may be useful in future studies on CD-1 mice to estimate embryonic age when the plug date is unknown. We also used the parameters of crown-rump length, abdominal circumference, and biparietal diameter alone and in combination to generate equations to predict embryonic body weight (Table [4](#T4){ref-type="table"}). We found that crown-rump length and abdominal circumference provided a good prediction of embryonic body weight (Fig. [9A](#F9){ref-type="fig"}) and that there was no significant improvement achieved with the inclusion of biparietal diameter (not shown). We also evaluated the ability of this equation to predict embryonic weights in three other strains of mice with embryos of discrepant size. We used C57Bl/6J and B6CBAF1 mice because they are common background strains for genetically-altered mice, and a hIGFBP1 transgenic model \[[@B35]\] as an example of a genetically-altered mouse model with intrauterine growth restriction. The prediction equation BW = -0.757 + 0.0453 (CRL) + 0.0334 (AC) derived from CD-1 data was used to predict embryonic weights at E17.5 in C57Bl/6J, B6CBAF1, and hIGFBP1 transgenic mice (Fig. [9B](#F9){ref-type="fig"}). The fit tended to diverge from predicted for embryo weights \>0.8 g (Fig. [9B](#F9){ref-type="fig"}). This may be because these weights are largely in the extrapolated range of the equation or, alternatively, because the equation overestimates these weights due to strain differences. Nevertheless, the mean absolute discrepancy for C57Bl/6J, B6CBAF1, and hIGFBP1 transgenic embryos was 12, 16, and 13% respectively (Fig. [9B](#F9){ref-type="fig"}) which was similar to the value of 14% calculated for CD-1 mice (E12.5 -- E16.5; Fig. [9A](#F9){ref-type="fig"}). A body weight prediction equation using data from all four strains was also derived (Table [5](#T5){ref-type="table"}). Again, crown-rump length and abdominal circumference were found to be the best predictors, with no significant improvement afforded by the inclusion of biparietal diameter. We evaluated the fit of this equation (BW = -0.858 + 0.0659(CRL) + 0.0257(AC)) to the measured body weights of the four strains (Fig. [9C](#F9){ref-type="fig"}). The mean absolute discrepancy using this equation was 15% and thus was similar to that obtained using the equation derived from CD-1 data alone.
{#F9}
######
Prediction equations for body weight (in g) from measured variables (in mm) using data from four strains
----------------------------------------------------------------
From crown-rump length (CRL):
BW = -0.778+ 0.0966(CRL)
R^2^= 0.906
From biparietal diameter (BPD):
BW = 12.21 - 7.96(BPD) + 1.67(BPD)^2^- 0.110(BPD)^3^
R^2^= 0.844
From abdominal circumference (AC):
BW = -0.08 - 0.018(AC) + 0.00247(AC)^2^
R^2^= 0.879
From crown-rump length (CRL) and abdominal circumference (AC):
BW = -0.858 + 0.0659(CRL) + 0.0257(AC)
R^2^= 0.918
----------------------------------------------------------------
BW, body weight
The use of 40 MHz ultrasound for phenotypic analysis of the conceptus also has important limitations including the skill required and the relatively high cost of the equipment. In addition, it is often difficult to achieve the optimal view for morphometric measurements and this is an important source of measurement error. Depending on the number of embryos and their location, some live embryos may not be visible (\~10% in our experience \[[@B20]\]) and some may not be in an appropriate orientation for accurate measurement. There is also the possibility that bioeffects associated with anesthesia and/or ultrasound could affect subsequent development of the conceptus. 40 MHz ultrasound under isoflurane anesthesia during organogenesis (E8.5 or E10.5) had no significant effect on birth weight and minimal effects on postnatal growth \[[@B36]\]. However, fetal ultrasound \[[@B37]\] and embryonic exposure to isoflurane \[[@B38]\] can affect biological outcomes so appropriate controls are necessary.
Conclusion
==========
Embryonic and placental growth parameters were quantified using 40 MHz ultrasound generating normal growth curves over parameter-specific gestational intervals. Parameters tested exhibited no systematic errors relative to ex vivo measurements by light microscopy, and embryonic body weights estimated using equations derived from CD-1 mice were similarly accurate in three other mouse strains. We found that in vivo quantification of placental size is adequate to detect the normal cessation of placental growth that occurs at \~E14.5. The capacity to quantify placental growth in vivo is important given the crucial role of the placenta in supporting embryonic growth, and our limited understanding of placental growth control. Thus, micro-ultrasound provides a feasible means for obtaining detailed information on prenatal embryonic and placental growth characteristics in genetically-altered and/or environmentally-challenged mouse models, and may also prove useful for estimating gestational age and/or embryonic body weight in utero.
Competing interests
===================
SLA was a member of the Scientific Advisory Board of VisualSonics from 2003 to 2006 but otherwise has no financial interests in the company.
Authors\' contributions
=======================
JM conceived the study, JM and SLA participated in study design, JM and JCS performed ultrasound imaging, DQ participated in breeding and study coordination, SM performed statistical analysis and prepared graphs and tables, and JM and SLA drafted the manuscript. All authors read and approved the final manuscript.
Acknowledgements
================
The authors thankfully acknowledge operating grant (MOP-12772) and equipment and maintenance grant support (MMA-77833) from the Canadian Institutes of Health Research (CIHR), as well as funding for equipment from the Richard Ivey Foundation. The authors also gratefully acknowledge salary support to JM and JCS from the CIHR Group Grant in Development and Fetal Health (MGC 13299), and to JCS from the Maternal Fetal Medicine Program of the Department of Obstetrics and Gynaecology of the University of Toronto. SLA gratefully acknowledges financial support received as the Anne and Max Tanenbaum Chair in Molecular Medicine at the Samuel Lunenfeld Research Institute. The authors thank John Sun for preliminary statistical analysis of the data, and Dr. Stuart F. Foster for discussion and advice on ultrasound instrumentation and for scientific discussion.
| null | minipile | NaturalLanguage | mit | null |
Is there an academic midlife crisis? Although associate professors have successfully navigated challenging straits to find a permanent faculty position, the irony is that many are even more dissatisfied than they were pretenure. It is true that job satisfaction is lower at midcareer outside of academe as well; however, the midcareer gully is particularly deep for faculty.
Associate professors have invested years of their lives in their careers -- and their colleges and universities have also invested heavily in them. Yet some midcareer faculty will never advance further, and many see themselves at a standstill. Some might dismiss this as the self-indulgent fretting of the tenured elite. But this phenomenon reflects another pernicious side effect of the distressing adjunctification of academia. It is also indicative of inequality among tenured faculty, with job satisfaction particularly low for midcareer women. What explains midcareer malaise?
For some, it results from moving into leadership roles in university cultures that do not reward academic leadership and service. The flowering of programs aimed at junior faculty, including research supports, teaching reductions and mentoring, can make associate professors feel like they are working without a net. Associates at our institution noted that earning tenure was a rude awakening, as they had not anticipated how much greater their workload would become posttenure.
In one focus group, an associate argued, “Because departments try to shield junior faculty from service, and full professors are usually in a better position to say no when asked, associate professors often carry disproportionately heavy service loads compared to their junior and senior colleagues.” Another responded, “Some departments have lost a lot of faculty, so their full professor ranks are thin. Even if these departments are hiring assistant professors, the associates are doing most of the service to protect the junior faculty.”
Increased service loads among tenured faculty members reflect the dramatic decrease in the number of tenured professors on most campuses, as colleges and universities increasingly rely on graduate student instructors as well as non-tenure-line faculty (creating wasted potential, as John Warner notes). On our campus, this has been combined with increased numbers of undergraduate students. Under such conditions, the devaluation of service work leads to perverse incentives.
As one associate remarked, “Having good judgment, being thorough and conscientious means more work, i.e., misdistribution of service hours -- the reward for good work is more work.” Another argued, “There are faculty that earn twice as much as I do, but they are making more work for everyone, since they don’t share in the work that needs to be done.” Faculty members are irritated when their colleagues do not pitch in, and incensed when these faculty members are promoted quickly and feted with honors.
One central challenge reflects a misalignment between workload and evaluation. Many associate professors find themselves increasingly pulled into mentoring and service work, which, while crucial to institutional functioning, does not always build their careers. Associate professors may be frustrated by the immediate demands of service work that materialize upon earning tenure when it is almost exclusively their scholarship that earns them promotion in the long run.
On our campus, we heard these sentiments repeatedly: “There’s a contradiction between the pressure for service at the associate level and the devaluing of service for promotion to full”; “In reality, only research matters when it comes to… promotion, but service and teaching require lots of time”; “The criteria for promotion is research. Associate professors have time for everything but research.” Another referred to associate professorship as “the midcareer service gully that we find ourselves taking an extended stay in.”
To be clear, these faculty members did not opt out of research because they had grown weary of scholarship. In fact, they often felt bitter that they had “to fit research into ‘spare time’ that isn't consumed by committee meetings, teaching undergrads and mentoring grad students.” One associate noted that the high service workload is “actually very counterproductive for the university. Tenured faculty are seasoned researchers; if they are putting all their time into admin rather than research, it is really terrible for the university.”
While faculty expressed surprise by the sheer volume of new service responsibilities, they also puzzled over their lack of preparation in how to conduct that work efficiently. One faculty member noted, “Academia is a whole series of bait and switch. You go to grad school because you are good in college classes and then have to switch and write a dissertation… when you get good [at research], you are asked to do service -- something else I have never been trained to do.”
How can we remedy this malaise at midcareer?
Clear guidelines for promotion that align with the institution’s mission. Tenure criteria are often less ambiguous than those for promotion to full professor. A few research institutions have identified alternative pathways to promotion in the form of exceptional service leadership or scholarly teaching. Mutual mentoring programs and supports such as those developed by the National Center for Faculty Development and Diversity that help faculty members focus their work time on the factors that will be evaluated, such as research productivity. Strategies aimed at lessening service burdens on faculty, such as: more tenure-line faculty hiring, recognizing that relying on adjuncts damages the university broadly, as well as adjunct faculty; course releases for intensive service positions to ensure that they do not derail research agendas; more staff hiring that supports faculty leadership. Greater departmental transparency in service assignments and teaching loads to reduce inequalities in how less-valued activities are distributed. Professional development for midcareer faculty on how to run meetings and complete committee work without reinventing the wheel. Standardized policies that regularly assess promotion timing rather than forcing candidates to self-nominate or wait to be nominated by a superior.
We know from experience that it is possible to survive the malaise that creeps in at midcareer. But colleges and universities can and should anticipate the burdens faced by associate professors and address them directly. There doesn’t have to be a midlife crisis in academia. Investing in midcareer faculty leads to happier faculty members and stronger institutions. | null | minipile | NaturalLanguage | mit | null |
Thursday, September 16, 2010
TI♥T: Being a Weeble
Lots to be grateful for today, and lots of things that I love, most of all ... being surprised by myself. I'm many things, not least of which is resilient. I will totally admit that I get frustrated, discouraged, and annoyed when the best laid plans fall to naught, but I really don't ever stay down for long.
BB2 recently said about a particular situation, "you're a fighter. If anyone can beat this it's you ... when you set your mind to something nothing stops you." I was slightly shocked. I definitely don't think of myself as a fighter, but the boy is more insightful than the average bear, so I thought about it a little more. And while 'Fighter' isn't the term I'd use, I can see why my military manchild might.
When something really matters to me - like, really matters - nothing will stop me. Not considerations of time or money. Not people who think they know better. Not that nagging little voice that thinks I'm just a chubby small town single mom who doesn't have any say in life. Nothing. When BB2 needed help he got it. When I committed to my MA, I finished it. Whatever it takes. And if someone threatens my boys, boy you better look out.
The pacifist in me doesn't like to look too closely at that side, but there's another part of me that feels really proud. First, that I have that strength to call on when I need it. And second, that my BBs know I have that strength to call on when they need it too.
Which brings me back to the title of this post. For those of you too young to remember ...
I'm a Weeble. Being a Weeble is awesome. I bet you're a Weeble too.
PS - I also love unexpected encouraging phone calls in the middle of the day ... just thought that was worth mentioning. XO | null | minipile | NaturalLanguage | mit | null |
IN THE SUPREME COURT OF THE STATE OF IDAHO
Docket No. 38572
STEVEN J. SNIDER and A. ) MARY
SNIDER, husband and wife, )
)
Plaintiffs-Counterdefendants- )
Lewiston, September 2012 Term
Respondents, )
)
2012 Opinion No. 136
v. )
)
Filed: November 15, 2012
RONALD D. ARNOLD and DOROTHY A. )
ARNOLD, husband and wife, )
Stephen W. Kenyon, Clerk
)
Defendants-Counterclaimants- )
Appellants. )
)
)
Appeal from the District Court of the Fourth Judicial District, State of Idaho,
Valley County. Hon. Michael R. McLaughlin, District Judge.
District court decision granting constructive trust property interest, affirmed.
Christ T. Troupis, Eagle, argued for appellants.
Michael G. Pierce, Cascade, argued for respondents.
_______________________
BURDICK, Chief Justice
Ronald (Ron) and Dorothy Arnold appeal the district court’s decision to grant a
constructive trust property interest in favor of Ron’s sister, Mary Snider (Toni) and her husband,
Steve Snider. The property in question is a cabin and accompanying forest service permit for
land located in Valley County, Idaho. Toni and Ron’s father built the cabin and willed it, along
with the permit, to his wife, Bette Arnold. The district court imposed a constructive trust on the
property in favor of the Sniders finding that Bette transferred the property to both the Arnolds
and the Sniders in 1983. The Arnolds appeal the decision, arguing that the Sniders failed to
present clear and convincing evidence of a constructive trust and the district court’s finding that
Bette intended to give the property to both parties was clearly erroneous. We affirm the opinion
of the district court.
1
I. FACTUAL AND PROCEDURAL BACKGROUND
Ron and Dorothy Arnold are the named holders on a Forest Service special use permit for
a cabin and 0.5 acres of land located in Valley County, Idaho. The cabin and permit originally
belonged to Francis Doyle Arnold, Ron and Toni’s father, but he left the property to his wife
Bette in his will. Soon after her husband’s death, Bette signed a permit transfer form dated
January 6, 1983, which terminated her interest in the property and requested that it be transferred
to Ron and Dorothy Arnold and Toni and Steve Snider.
The Sniders, the Arnolds, and the Cascade District Ranger all signed this permit transfer
form, however the circumstances surrounding its signing are disputed with the Arnolds claiming
that the Sniders’ names and signatures were added after Bette signed the form as an
accommodation to the Sniders. Despite both the Arnolds and the Sniders being listed as
permittees on the application, the Forest Service returned the permit in the Arnolds’ names alone
because of a new directive limiting special use permits to one person or entity or to a husband
and wife. Ron claims he knew that this would be the outcome and never represented otherwise to
the Sniders either before or after he submitted the permit application. In contrast, Toni claims,
and the district court found, that Ron made statements to her that they would jointly own the
cabin and permit despite the permit being in the Arnolds’ name alone. The district court also
found that Toni had a confidential relationship with her brother and trusted him to hold title to
the permit for both couples.
For more than 20 years after the Forest Service issued the permit in the Arnolds’ name,
the Arnolds and the Sniders shared the use and expenses of the cabin. Ron took care of the
cabin’s bookkeeping, while the Sniders would inquire about their share of cabin expenses and
reimburse him for specific amounts. The Sniders and the Arnolds divided the available weeks at
the cabin equally amongst them and, on at least one occasion, the Arnolds asked the Sniders if
they could stay into their assigned week.
In 2009, after noticing a change in the couples’ dynamic with respect to the cabin, Toni
confronted her brother. Toni claims that this confrontation was the first time that Ron had ever
told her that he and his wife were the sole owners of the cabin. After further discussions with the
Arnolds failed, the Sniders filed a complaint later that year seeking a declaratory judgment
recognizing their right to a one-half undivided interest in the cabin and permit.
2
Following trial, the district court issued its Findings of Fact, Conclusions of Law, and
Judgment on January 18, 2011, imposing a constructive trust on a one-half interest in the cabin
and permit in favor of the Sniders. The Arnolds now appeal the district court’s findings of fact
that the Sniders proved their constructive trust claim by clear and convincing evidence.
II. STANDARD OF REVIEW
A claim that a trust in real property has arisen by implication or operation of the law must
be proven by clear and convincing evidence. Hettinga v. Sybrandy, 126 Idaho 467, 469, 886 P.2d
772, 774 (1994). “The determination of whether such evidence has been presented is a question
of fact to be determined by the trial court, and that court’s findings will be disturbed only if they
are clearly erroneous.” Id. If substantial and competent, though conflicting, evidence supports a
trial court’s findings of fact, those findings are not clearly erroneous. Weitz v. Green, 148 Idaho
851, 857, 230 P.3d 743, 749 (2010); I.R.C.P. 52(a). “This Court will not substitute its view of the
facts for that of the trial court.” Justad v. Ward, 147 Idaho 509, 511, 211 P.3d 118, 120 (2009).
Instead, it is the province of the trial court to weigh conflicting evidence and to judge the
credibility of witnesses. Argosy Trust v. Wininger, 141 Idaho 570, 572, 114 P.3d 128, 130
(2005).
III. ANALYSIS
The Arnolds raise two issues on appeal. First, whether the district court erred in finding
that the Sniders produced sufficient evidence of a constructive trust to satisfy the clear and
convincing evidence standard. Second, whether the district court’s conclusion that Bette Arnold
intended to transfer her property to both the Sniders and the Arnolds was clearly erroneous.
A. The district court’s determination that the Sniders proved a constructive trust by clear
and convincing evidence is not clearly erroneous.
The Arnolds argue that the Sniders did not prove the elements of their constructive trust
claim by clear and convincing evidence. A constructive trust arises when “legal title to property
has been obtained through actual fraud, misrepresentations, concealments, taking advantage of
one’s necessities, or under circumstances otherwise rendering it unconscionable for the holder of
legal title to retain beneficial interest in property.” Hettinga, 126 Idaho at 470, 886 P.2d at 775
(quoting Witt v. Jones, 111 Idaho 165, 168, 722 P.2d 474, 477 (1986)). Imposition of a
constructive trust is an equitable remedy and does not require that the holder of legal title intend
to create a trust interest in another. Davenport v. Burke, 30 Idaho 599, 608, 167 P. 481, 483
3
(1917). Indeed, a constructive trust arises from the legal title holder’s wrongful actions and not
from any intent to create a trust. Id. A party seeking to impose a constructive trust must prove the
facts alleged to give rise to the trust by clear and convincing evidence. Hettinga, 126 Idaho at
469, 886 P.2d at 774. Whether a party presented sufficient evidence to meet the clear and
convincing standard is a finding of fact that this Court will uphold if substantial and competent
evidence supports it. Id.
The Arnolds argue that the district court’s determination that the Sniders proved their
constructive trust claim by clear and convincing evidence is clearly erroneous because the
Sniders did not present any evidence that the Arnolds used inequitable means to obtain title to
the cabin and permit. They also contend that the Sniders did not present clear and convincing
evidence of an agreement to create a resulting trust. However, because the district court only
imposed a constructive trust, never mentioning resulting trusts in its Findings of Fact,
Conclusions of Law, and Judgment, this part of the Arnolds’ argument will not be addressed. 1
In this case, the district court imposed a constructive trust after finding that (1) Bette
intended to give the cabin and permit to both the Sniders and the Arnolds and (2) Ron took
advantage of his confidential relationship with his sister Toni by representing to her that the
permit would be in his name, but both couples would jointly own it. The Arnolds argue that they
did not gain title to the cabin by any wrongful means and the court’s conclusion that Ron told
Toni he would hold title to the cabin for their mutual benefit was clearly erroneous. They claim
that both Ron’s and Bette’s testimony prove Bette’s intent to transfer the cabin to the Arnolds
alone and that Ron never indicated otherwise to Toni. While Ron’s and Bette’s testimony may
support this claim, the rest of the evidence does not.
There is ample evidence in the record to support the district court’s finding that the
Sniders proved by clear and convincing evidence that Bette intended to transfer the cabin and
permit to both parties and that Ron represented to Toni that they jointly owned the cabin and
permit. First, several disinterested, independent witnesses corroborated the Sniders’ claim that
Ron and Bette made representations concerning the cabin’s joint ownership. Second, the fact that
the permit transfer form Bette signed listed the Sniders and the Arnolds as the transferees
1
Appellants’ Brief deals extensively with an argument concerning resulting trusts and how the Sniders failed to
prove by clear and convincing evidence that the Arnolds ever agreed to create a trust in favor of the Sniders. The
Appellants incorrectly state that the district court’s findings of fact included the conclusion that Arnolds had agreed
to create a trust in favor of the Sniders. However, the court actually found that a constructive trust had been created,
which does not require an agreement, and never mentions resulting trusts.
4
indicates that Bette intended, and the couples understood, that the Arnolds and the Sniders were
to jointly own the cabin and permit. The Arnolds’ claims that the permit transfer form was blank
when Bette signed it and that the Sniders’ names were added afterward as an accommodation to
them make little sense and are contradicted by the transfer form itself. The Sniders’ names are
typed on the line labeled “proposed permittees” below that of the Arnolds on the permit transfer
form, which would suggest that the Sniders’ names were typed into the form at the same time as
that of the Arnolds, not “squeezed” in later as the Arnolds claim. Moreover, Ron’s claim that he
only allowed the Sniders to be named as proposed permittees because he already knew about the
Forest Service’s policy of limiting special permits to one person or entity or to a husband and
wife is contradicted by the Cascade District Ranger’s letter to Ron explaining why the Forest
Service issued the permit in only one name. In this letter the Cascade District Ranger, explained
that the Forest Service had adopted a new directive to replace its previous policy, which had
been vague about issuing permits to multiple parties. This was the same District Ranger who
signed the permit transfer form recommending its approval with both names on it. Finally, the
Sniders’ and the Arnolds’ conduct with respect to the cabin was consistent with that of joint
ownership. The Arnolds and the Sniders shared both the use and expenses of the cabin. The
payments the Sniders made to the Arnolds were not merely contributions as the Arnolds claim,
but checks for specific dollar amounts that often referenced “insurance” or “taxes” in the subject
line.
The district court recognized that there was conflicting testimony in this case, but found
Toni and Steve to be more credible than Ron and Bette. This Court has held that even where the
evidence is conflicting, it may still be substantial and competent, and it is for the district court to
weigh the evidence and judge the credibility of witnesses. Clayson v. Zebe, 153 Idaho 228, ___
P.3d 731, 737 (2012). Therefore, the district court’s findings of fact are to be “liberally construed
on appeal in favor of the judgment entered.” Id. However, liberal construction is not necessary in
this case. The testimony of the Sniders and their witnesses, the behavior of the parties, the fact
that the permit transfer form lists both couples as transferees, and the Cascade District Ranger’s
letter all support the district court’s conclusion that Ron represented to the Sniders that they
jointly owned the cabin and permit. Therefore, this Court affirms the district court’s finding of
fact that the Sniders proved their constructive trust claim by clear and convincing evidence.
5
B. Substantial and competent evidence supports the district court’s finding that Bette
Arnold’s testimony was not credible.
The Arnolds argue that the district court’s finding of fact that Bette intended to transfer
her property to both the Arnolds and the Sniders was clearly erroneous because it is contrary to
what she expressed in her trial testimony and because the court discarded her testimony on
questionable grounds. While the Arnolds repeat some of the arguments about Bette’s intent to
transfer the cabin solely to the Arnolds that the preceding section addresses, they mainly
challenge the district court’s determination that Bette’s testimony is not credible. 2
The district court made the following findings of fact as to Bette’s credibility:
The Court will find Bette Arnold’s testimony is not credible in light of her prior
statements that she was giving the cabin to both of her late husband’s children,
her poor memory in light of her age and the will that she executed along with her
late husband. There was also testimony that Ron Arnold had recently assisted
Bette Arnold with her financial affairs, in 2010, for which she was very grateful
and the Court will find that this has an impact on her credibility as well. The
Court will find that Bette Arnold had no accurate recollection of the conversation
that occurred between herself and Ron Arnold in January of 1983 or what if any
names were on the transfer form.
This Court liberally construes the district court’s credibility determinations because “[i]t
is the province of the trial court to determine the credibility of witnesses, the weight to be given
their testimony, and the inferences to be drawn from the evidence.” Kelley v. Yadon, 150 Idaho
334, 338, 247 P.3d 199, 203 (2011). “It is not our role to reweigh the evidence.” In re Doe 2009-
19, 150 Idaho 201, 209, 245 P.3d 953, 961 (2010). We holds that he district court’s finding that
Bette was not credible is thoroughly explained and supported by substantial and competent
evidence.
C. The Sniders are entitled to attorney fees under Idaho Code §12-121.
The Sniders seek attorney fees on appeal pursuant to I.C. § 12-121. To receive an I.C. §
12-121 award of fees, the entire appeal must have been pursued frivolously, unreasonably, and
2
The Arnolds also argue that this determination deprives Bette of her right to dispose of her property as she pleases,
but do not provide any support for this assertion or why they have standing to raise a claim of right for someone who
is not a party to this case.
6
without foundation. Carrillo v. Boise Tire Co., Inc., 152 Idaho 741, __, 274 P.3d 1256, 1271
(2012) (citing Beus v. Beus, 151 Idaho 235, 242, 254 P.3d 1231, 1238 (2011)). Such
circumstances exist when an appellant has only asked the appellate court to second-guess the
trial court by reweighing the evidence or has failed to show that the district court incorrectly
applied well-established law. City of Boise v. Ada Cnty., 147 Idaho 794, 812, 215 P.3d 514, 532
(2009). Conversely, fees generally will not be awarded when “the losing party brought the appeal
in good faith and where a genuine issue of law was presented.” Id. Here, the Arnolds did not
present any issues of law and merely asked this Court to reweigh the district court’s findings of
fact. Indeed, the Arnolds admit as much in their reply brief by arguing that there are no grounds
for awarding attorney fees because their brief “did dispute findings of fact by the trial court.”
Because the Arnolds brought this appeal unreasonably or without foundation, the Sniders’
request for attorney fees is granted.
IV. CONCLUSION
We affirm the district court’s decision that the Sniders proved their constructive trust
claim by clear and convincing evidence and grant the Sniders request for attorney fees on appeal
under I.C. § 12-121. Costs to the Sniders.
Justices EISMANN, J. JONES, W. JONES and HORTON, CONCUR.
7
| null | minipile | NaturalLanguage | mit | null |
Northwest Bay
Northwest Bay (or Roncière Bay) is a natural bay off the island of Newfoundland in the province of Newfoundland and Labrador, Canada.
References
Category:Bays of Newfoundland and Labrador | null | minipile | NaturalLanguage | mit | null |
Maggiano’s Coupons – $10 Off Your Next Visit With Sign Up
There surely has to be something fishy if a person says he loathes Italian food. Well, the Italian cuisine as a whole has to offer some lip smacking delicacies. And who else to taste some of the best Italian there is on offer other than Maggiano’s Little Italy? Founded in the neighborhood of River North in Chicago, Maggiano’s Little Italy has gone on to carve out for itself, a niche in the food industry and carries the reputation for serving some of the finest Italian, or rather, American-Italian, there is to offer anywhere in the world. In just 10 years, Maggiano’s Little Italy have gone on to open 50 outlets in 20 states in the USA. There must be a reason behind that success for sure. One of them obviously is the quality they have on offer and the variety as well. And the other? Well, some great offers for you and your family to enjoy a great fine dining experience.
Introducing to you Maggiano’s Stuffed Pasta Coupons(this coupon has expired – check the new one below). You can now get $5 off the purchase of every stuffed pasta with every purchase worth a minimum of $14. Not valid with any other offer, only one coupon can be used per table. The coupon does not include discounts on taxes or gratuity. Hurry! Offers valid only till 3/26/14. They weren’t wrong when they said “It’s what’s on the inside that counts!” now, were they? | null | minipile | NaturalLanguage | mit | null |
Philadelphia police are on high alert after reports of threats to some of the city's finest.
Three Philadelphia police districts were named specific targets for terrorists: the 2nd district in Northeast Philadelphia which also houses the Northeast Detective division, the 6th district on the edge of Chinatown, and the 35th at Broad and Champlost in Olney.
The tip was passed to a patrol officer by a woman who flagged him down on the street.
Detectives have investigated the claim, but no credible threat has been uncovered.
"We take all those threats seriously. We investigate them. Right now, we haven't found anything substantive, but we are going to take each and every one of them serious, as we do with threats against the public," Philadelphia Police Commissioner Richard Ross said.
Some police sources say these kinds of threats which are relatively frequent have increased a great deal since last week's deadly attack on Dallas police.
With the Democratic National Convention coming to the Wells Fargo Center later this month, police are gearing up for mass protest demonstrations and potential terrorist strikes.
With those challenges straight ahead, it's a very busy time for at the headquarters of the Delaware Valley Intelligence Center, an agency which monitors, collects, and analyzes data, video, and social media from southeastern Pennsylvania, southern New Jersey, northern Delaware, and down into Maryland.
"We got the DNC coming up so we have to be very much aware of all these things. The bottom line is we don't do this alone either," Ross said. | null | minipile | NaturalLanguage | mit | null |
Q:
C++ macro causing null pointer
I was wondering if someone can explain this macro to me.
#define Q_DECLARE_PRIVATE(Class) \
inline Class##Private* d_func() { return reinterpret_cast<Class##Private
*>(d_ptr); } \
inline const Class##Private* d_func() const { return reinterpret_cast<const
Class##Private *>(d_ptr); } \
friend class Class##Private;
I have an application that uses QT and it crashes with an access violation exception on the last line from the following snippet.
class Q_GUI_EXPORT QWidget : public QObject, public QPaintDevice
{
Q_OBJECT
Q_DECLARE_PRIVATE(QWidget)
(full source here)
and what can cause a null pointer operation in on the last line?
A:
The compiler can explain it best of all:
g++ -E foo.cc
will put foo.cc to stdout after passing through the pre-processor. It lets you see what the compiler sees which (especially with token pasting) is usually less than obvious.
| null | minipile | NaturalLanguage | mit | null |
Q:
'Dot Product' on a Vectors Space over $\mathbb{F}_2$
Let $\mathbb{F}_2$ be the field with 2 elements, and consider $\mathbb{F}_2^n$, the space of all $n$-tuples over $\mathbb{F}_2$. This is an $n$-dimensional vector space over $\mathbb{F}_2$, and we may introduce the following 'dot product' for every pair of vectors $x,y$ in $\mathbb{F}_2^n$ ; if $x=(x_1,\ldots,x_n)$ and $y=(y_1,\ldots,y_n)$, we define
$$\langle x,y\rangle:=x_1y_1+\cdots+x_ny_n=\sum_{i=1}^{n}x_iy_i$$
Clearly this is a symmetric bilinear form, and my question is : when does this form become non-degenerate? More precisely,
For which subspaces $V$ (of $\mathbb{F}_2^n$) does the induced bilinear form $\langle \cdot,\cdot\rangle:V\times V\rightarrow\mathbb{F}_2$ become non-degenerate?
I've been struggling with this problem for quite a while, but still don't see how to approach in the right way. Any advice is welcome.
A:
It will be easier to talk about subspaces on which it becomes degenerate. This means subspaces $V$ containing a nonzero vector $v$ such that $\langle v, w \rangle = 0$ for all $w \in V$. In particular, $v$ must satisfy $\langle v, v \rangle = 0$; such vectors are called null vectors or isotropic vectors, and for this particular bilinear form they are precisely the vectors $v \in \mathbb{F}_2^n$ with an even number of nonzero entries.
Given a nonzero vector $v$, the orthogonal complement
$$v^{\perp} = \{ w \in \mathbb{F}_2^n : \langle v, w \rangle = 0 \}$$
can be explicitly described as follows. If $v$ has nonzero entries in the indices $i_1, \dots i_k$, then $\langle v, w \rangle = 0$ iff among the $i_1, \dots i_k$th entries of $w$ an even number of them are nonzero.
Every degenerate subspace $V$ can be constructed by taking an isotropic vector $v$ and then letting $V$ be any subspace of $v^{\perp}$ containing $v$. This isn't quite as good as a classification, though. It would be nice to be able to count the degenerate subspaces, since there are finitely many of them. One relevant keyword here should be "isotropic Grassmannian."
| null | minipile | NaturalLanguage | mit | null |
1. Field of the Invention
The present invention generally relates to object-oriented programming (OOP), and in particular to OOP systems supporting the C++ and Java programming languages.
2. Background Description
Object-oriented programming languages provide a number of features such as classes, inheritance, multiple inheritance, and virtual inheritance. These object-oriented features have several advantages. Most importantly, they enable the creation of class libraries that can be reused in many different applications. Class libraries are typically shipped independently from applications that use them. Libraries are commonly shipped as a combination of the executable (object) code, in combination with the library""s interface. In order to use a library, a client application calls functions specified in the library""s interface, and includes (links) the library""s object code. This model has the advantage that a library has to be shipped and installed only once, even when multiple applications use it. An additional benefit of this approach is that the library""s source code need not be exposed: Only the library""s external interface needs to be visible.
However, the unavailability of a library""s source code complicates so-called whole-program analysis of its client applications, which rely on the availability of the complete source code of an application. In particular, the unavailability of a library""s source code complicates the problem of determining which methods in the client application are xe2x80x9clivexe2x80x9d (i.e., possibly reached in some execution of the application, which is referred to below as being xe2x80x9creachablexe2x80x9d) or xe2x80x9cdeadxe2x80x9d (i.e., never reached in any execution of the application). The source for this problem is related to the fact that certain methods in the application code may be called indirectly from within the (unavailable) library code by way of a virtual method dispatch.
The prior art has focused on the elimination of unused methods for programs that do not use class libraries. An example of such prior art is Srivastava, xe2x80x9cUnreachable procedures in object oriented programmingxe2x80x9d, ACM Letters on Programming Languages and Systems, 1(4), pp. 355-364, December 1992.
Therefore, there is a need in the art to provide a mechanism for identifying unused methods for programs that use class libraries without requiring access to the source code for such class libraries.
The problems presented above and the related problems of the prior art are solved by the present invention, method and apparatus for finding reachable methods in applications that use class libraries. The present invention analyzes an application A and computes a set of reachable methods in A by determining the methods in A that may be called from another reachable method in A, or from within a class library L used by A without analyzing the classes in L.
The invention may be used as an optimization to reduce application size by eliminating unreachable methods. In the alternative, the invention may be used as a basis for optimizations that reduce execution time (e.g., by means of call devirtualization), and as a basis for tools for program understanding and debugging. | null | minipile | NaturalLanguage | mit | null |
Q:
What happened internally (JVM) when System.gc() or finalize() method called?
What happened internally (JVM) when System.gc() or finalize() method called?
Is this really collect garbage or reduce performance ?
A:
Exactly what happens when you call System.gc() is JVM dependent. The JVM looks at this call as a suggestion that it might be a good time to run the garbage collector, so don't depend on it.
An object's finalize() method is run on an object by the garbage collector when the JVM determines that there are no more reachable references to that object. You shouldn't call it in your code. Keep in mind that finalize() is not called at the time when your program loses that final reference, but at a future time when the garbage collector is run, so don't depend on it happening at a specific point in time (or at all).
A:
If you want to know garbage collection internals, you should read Hotspot Memory Management Whitepaper from Sun.
| null | minipile | NaturalLanguage | mit | null |
Q:
Where can I move my electric panel
March 15, 2018 -- I have lived in my tiny, 1 ½ story house in Boston since 1994, and I want to upgrade my electrical panel from 100 amps to 200 amps. The current panel is located in my basement, which floods every few years. In fact, the constant flooding became so vexing that I moved my washer and dryer upstairs to a small room off of my dining room. I also got rid of my traditional water heater and replaced it with a tankless water heater that is also now located in the same room as the washer and dryer upstairs. May I move my electrical panel to that room, too? The only spot available would be on a wall that is about 3 feet wide between the door and a window that has pretty cotton curtains. Would there be enough clearance? Would the curtains be considered a fire hazard? How about laundry detergent and bleach bottles about 4 to 5 feet away? If not the laundry room, can I put an electrical panel outside? Would I need to build a little side structure? If so, how large would it have to be?
A:
Take a look at the image below. Code requires you have at least 3 feet in front of the panel, 6.5 above, and 30 inches side to side. There is a trick with the 30 inches that it can be measured from either side of the panel, dead center, etc. so you get some wiggle room there. Based on what you've said about your laundry room, it sounds like code-wise it will probably work. (Although bear in mind some regions apply additional codes)
However, you also need to take into account what's in the wall. Between a door and window you'll have king studs and who knows what other load bearing stuff that could interfere with box placement or getting wires to the box. There is also the issue with wires being short when rerouted so now you'd need to make additional splices which could require water-proofing if they are still below flood level.
You can purchase outdoor breaker boxes which are rated NEMA-3-ish which means they are suitable for outdoor use and protect from rain, but as Harper mentioned, they don't protect for dust, bugs, etc. I would also agree with Jim that moving the panel would not be a cheap option. My guess is you could pop some concrete in the basement, dig a hole, and put in a good sump pump with a failure alarm for far less that moving the panel will cost.
| null | minipile | NaturalLanguage | mit | null |
To Reduce Risk Of Recurring Bladder Infection, Try Drinking More Water
Enlarge this image toggle caption Nawarit Rittiyotee/EyeEm/Getty Images Nawarit Rittiyotee/EyeEm/Getty Images
Urinary tract infections cause painful urination and are unfortunately widespread. Scientists estimate that somewhere between 40 percent to more than 50 percent of women will get a UTI in their lifetime, and one in four will get a repeat infection. Left untreated, they can lead to kidney problems.
Cranberry juice is a common at-home preventative measure, but the science behind relying on the bitter fruit is pretty mixed. Some research has shown evidence that compounds in cranberries could help prevent bacteria from infecting the urinary tract lining, but other studies concluded that the juice didn't help people with recurring bladder infections.
But, there may be a simple, old, and drug-free way to reduce these infections: Drink more water — a lot more water.
A study presented at IDWeek earlier this month in San Diego, an annual meeting of infectious disease professionals, suggests that drinking more water is pretty effective at reducing bladder infections in women who are prone to them. And it also resulted in doctors issuing 47 percent fewer prescriptions for antibiotics in these women.
The research was funded by Danone Research. Danone also sells bottled water, like Evian, but Dr. Thomas Hooton, the lead author of the study and the clinical director of the Division of Infectious Diseases at the University of Miami, says that the study's conclusions are not exclusive to Danone's water.
The study specifically looked at 140 premenopausal women in Bulgaria with recurring urinary tract infections, defined as more than three in the previous year, who drank less than a liter and a half of water (about six cups) each day. For an entire year, half the participants upped their daily water intake by one and a half liters, while the other half didn't change their water intake. The women who drank more water cut their UTI rates nearly in half — getting an average of 1.6 infections versus the control group's 3.1 infections.
The research has not yet been submitted for publication.
The idea of drinking more water to prevent UTIs doesn't come as a shock to doctors — it's common advice. Dr. Anthony Schaeffer, a Northwestern University urology professor not involved in the research says the study puts what doctors have known into scientific terms. He adds, "What's nice about the study is that it demonstrates something that sounds logical to be true."
Urinary tract infections occur when bacteria sneaks into the bladder from the urethra. Women have shorter urethras than men, making it easier for bacteria to get in the bladder and putting women at increased risk for infection.
Hooton says although it's simplistic, drinking a lot of water helps flush out the bacteria that can cause an infection. "You're basically clearing bacteria out of the bladder," he explains, as well as reducing the concentration of bacteria in the urine. These two effects reduce the ability of the bacteria to stick to bladder cells, which is thought to cause infection, he adds.
If you end up with a urinary tract infection despite adding water and maybe cranberry juice to your diet, antibiotics can usually treat it. But the World Health Organization has warned that some types of bacteria commonly causing these infections is becoming resistant to antibiotics. The more you take antibiotics, the more likely bacteria in your body will become resistant to those drugs. It's not uncommon to get UTIs multiple times, so the issue of antibiotic resistance is especially risky with this kind of infection.
Last year, U.S. scientists found a UTI-causing germ in a Pennsylvania woman that didn't respond to an antibiotic commonly used as a last resort.
So, how much water should you drink to ward off urinary tract infections? Hooton says because they only looked at a 1.5 liter increase, he can't say exactly.
And while "it seems likely that any increase in hydration would have a beneficial effect" for everyone, Hooton says, the study specifically focuses on women who get three or more urinary tract infections a year.
"On the other hand, we see no downside to advising more fluid intake in healthy women with UTI recurrences, and we would certainly want to advise them to drink more fluids in our counseling to try this as well as other things to avoid antimicrobials," he tells Shots in an email.
Greta Jochem is an NPR science desk intern. Find her on Twitter @greta_h_jochem. | null | minipile | NaturalLanguage | mit | null |
The delivery of medicament through a person's skin utilizing electrophoresis is well known where the drug is one whose molecules are ionic in solution or suspension. The solution or suspension is made subject to an electric field and if the electrode having the same charge as that of the ions is above the solution adjacent the skin which is the site of administration, the ions will be repelled and migrate through the skin into the blood stream.
A variety of problems associated with this technique have limited severly the extent of the use of this type of apparatus. Reference to or disclosure of such apparati is shown in the following U.S. Patents, where it will be noted that there is great emphasis in developing electrodes which are disposable and/or more effective:
______________________________________ 2,493,155 4,141,359 4,250,878 3,163,166 4,166,457 4,273,135 3,289,671 4,239,052 4,367,745 3,677,268 4,243,052 ______________________________________
It will be noted from U.S. Pat. Nos. 3,289,671 and 4,141,359, in particular, that the rate of drug delivery is a function of current flow and that control over current flow is crucial to having the correct amount of medicament applied.
There have also been attempts to provide an apparatus for such electrotherapy which is self-contained, so that the patient can wear the device carrying on normal activities while the drug is being administered. Devices of this type are disclosed in U.S. Pat. Nos. 385,556, 486,902, and 2,784,715.
One problem with such prior art devices was that they were bulky and lacked the necessary drug delivery rate control.
Another significant problem associated with such prior art devices is that the user, in wearing the device, was unable to determine whether the drug was being administered, and more particularly whether the drug was being administered in the proper desired dosage.
Now there is provided by the present invention, an indicator which is formed with a compact electrophoretic drug delivery device so as to positively indicate the flow of the proper dosage of medicament. | null | minipile | NaturalLanguage | mit | null |
Sniffing Out NMDA Receptors in the Olfactory Cortex.
Selective olfactory learning is essential for survival in most newborn mammals. Findings by Franks and Isaacson in this issue of Neuron suggest that early olfactory learning might be selective, in part because olfactory experience downregulates NMDA receptors at primary inputs to the olfactory cortex. | null | minipile | NaturalLanguage | mit | null |
Tag Archives: peppery
Post navigation
From Goose Island Beer Company out of Chicago Illinois comes their “Sofie” 2017 a Belgian Style Farmhouse Ale barrel aged in white wine barrels. The beer pours a cloudy golden colour with a white head. The aroma consists of wheat, grain, peppery, fruit, sweetness and some floral hops. The flavour is of grainy, wheat, citrus, lemon, orange peel, peppery, yeast, vanilla and sweetness. The alcohol content comes in at 6.5% with an IBU of 20. Once again this one was quite enjoyable.
From Bridge Brewing Company in North Vancouver comes their “Santa’s Sac Golden Strong Ale”. The beer pours a golden colour with a white head. The aroma consist of bubblegum, Belgian yeast, citrus and some spices. The flavour is of bubblegum, yeast, candi sugar, sweetness, fruit with some peppery spice. The alcohol content comes in at 10% with an IBU of 30. This brew drinks much like a Belgian Tripel with a strong sweetness. If you are big on that style then make some to pick this bottle up.
From Beau’s All Natural Brewing in Vankleek Hill Ontario conceived collaboratively with Canadian Hip Hop artist K-OS comes their “Golden Vox (Rye Pale Lagered Ale)”. The beer pours a golden colour with a white head. The aroma consists of rye spice, grainy, caramel, citrus and floral hops. The flavour is of huge rye notes, caramel, peppery, citrus, some sweetness, herbal and hops bitterness. The alcohol content comes in at 6% and an IBU of 46. I have a love for Rye in beer and this one delivered. If you see this on the shelve it would be well worth your time to pick up a bottle.
Commercial Description: Rye pale lagered ale is something of a hybrid creation, blending the noticeable citrusy hop character of an American Pale Ale with the spicy elements of rye malt, and adding in the signature crisp finish of a lagered ale. An aging on rye-whiskey-soaked oak adds subtle complexity to this balanced, approachable pale-golden beer.
From Bridge Brewing Company in North Vancouver comes their newest “Lemon Gin Saison”. The beer pours a golden colour with a white head. The aroma consists of yeast, wheat, lemon, lemon peel, spices and a hint of gin. The flavour is of yeast, wheat, lemon, lemon peel, gin, peppery, spices, earth and a herbal finish. The alcohol content comes in at 5.5% with an IBU of 24. This is a really interesting take on a saison with interesting flavours combining with the lemon and gin flavours to make a new experience. Make sure to pick up a bottle and see what you think.
From Winnipeg Manitoba’s Half Pints Brewing Company comes their” Dead Ringer Belgian IPA”. This beer began last year as a test batch growler fill and is now a bomber release. The beer pours a copper/orange colour with an off white head. The aroma consists of pepper, Belgian yeast, wheat, citrus and a mild floral hops. The flavour is of pepper, Belgian yeast, earth, wheat, citrus, citrus rind and hops bitterness. The alcohol content comes in at 6% with an IBU of 49. If you like the Belgian IPA style and find yourself in Manitoba or anywhere else you may be lucky to find it pick up a bottle as you will not be disappointed. | null | minipile | NaturalLanguage | mit | null |
Q:
udev rule parameter for systemd template
Background: I want to start a log script when my usb-uart device connects.
My /etc/udev/rules.d/10-local.rules:
SUBSYSTEM=="tty", ATTRS{idVendor}=="1366", ATTRS{idProduct}=="1015", ATTRS{serial}=="000621000000", SYMLINK+="ttymkw", TAG+="systemd", ENV{SYSTEMD_USER_WANTS}+="offnet-uart-log@$env{ID_SERIAL_SHORT}.service"
My ~/.config/systemd/user/offnet-uart-log@.service:
[Unit]
Description=Start log of UART
[Service]
ExecStart=sh -c "echo %I >> /tmp/systemd.test"
This does not give me the expected value of ID_SERIAL_SHORT. Instead, I get a long sys path:
sys/devices/pci0000:00/0000:00:1c.0/0000:01:00.0/0000:02:02.0/0000:39:00.0/usb3/3-1/3-1.7/3-1.7.2/3-1.7.2:1.0/tty/ttyACM0
When I try to get the properties for this path (I need to remove the leading sys), I can see ID_SERIAL_SHORT:
$ udevadm info --query=property --path /devices/pci0000:00/0000:00:1c.0/0000:01:00.0/0000:02:02.0/0000:39:00.0/usb3/3-1/3-1.7/3-1.7.2/3-1.7.2:1.0/tty/ttyACM0DEVPATH=//devices/pci0000:00/0000:00:1c.0/0000:01:00.0/0000:02:02.0/0000:39:00.0/usb3/3-1/3-1.7/3-1.7.2/3-1.7.2:1.0/tty/ttyACM0
DEVNAME=/dev/ttyACM0
MAJOR=166
MINOR=0
SUBSYSTEM=tty
USEC_INITIALIZED=1633350773062
SYSTEMD_USER_WANTS=offnet-uart-log@.service
ID_BUS=usb
ID_VENDOR_ID=1366
ID_MODEL_ID=1015
ID_PCI_CLASS_FROM_DATABASE=Serial bus controller
ID_PCI_SUBCLASS_FROM_DATABASE=USB controller
ID_PCI_INTERFACE_FROM_DATABASE=XHCI
ID_VENDOR_FROM_DATABASE=SEGGER
ID_MODEL_FROM_DATABASE=DSL6340 USB 3.1 Controller [Alpine Ridge]
ID_VENDOR=SEGGER
ID_VENDOR_ENC=SEGGER
ID_MODEL=J-Link
ID_MODEL_ENC=J-Link
ID_REVISION=0100
ID_SERIAL=SEGGER_J-Link_000621000000
ID_SERIAL_SHORT=000621000000 ### <--- here
ID_TYPE=generic
ID_USB_INTERFACES=:020201:0a0000:ffffff:080650:
ID_USB_INTERFACE_NUM=00
ID_USB_DRIVER=cdc_acm
ID_USB_CLASS_FROM_DATABASE=Miscellaneous Device
ID_USB_PROTOCOL_FROM_DATABASE=Interface Association
ID_PATH=pci-0000:39:00.0-usb-0:1.7.2:1.0
ID_PATH_TAG=pci-0000_39_00_0-usb-0_1_7_2_1_0
ID_MM_CANDIDATE=1
DEVLINKS=/dev/ttymkw /dev/serial/by-id/usb-SEGGER_J-Link_000621000000-if00 /dev/serial/by-path/pci-0000:39:00.0-usb-0:1.7.2:1.0
TAGS=:systemd:
$env{ID_SERIAL_SHORT} in my udev rule does not seem to be replaced with the value of the property.
The man page for udev says that the $env{key} substitution is only available for the NAME, SYMLINK, PROGRAM, OWNER, GROUP, MODE, SECLABEL, and RUN fields.
However, I've seen examples of people using it in ENV{SYSTEMD_USER_WANTS}. It doesn't work for me, apparently.
How can I pass the serial number of my device to the systemd template?
EDIT: I've also tried this, but nope:
SUBSYSTEM=="tty", ATTRS{idVendor}=="1366", ATTRS{idProduct}=="1015", ATTRS{serial}=="000621000000", SYMLINK+="ttymkw", PROGRAM="/bin/systemd-escape -p --template=offnet-uart-log@.service $env{ID_SERIAL_SHORT}", ENV{SYSTEMD_WANTS}+="%c"
A:
The parameter I am looking for is $attr{serial}. I'm not sure why other solutions didn't work when it worked for others, I guess they are obsolete (EDIT: it's probably because my rule file, starting with 10-, is read before the rule file that creates the environment variable ID_SERIAL, starting with 60-). This is working:
udev rule:
SUBSYSTEM=="tty", ATTRS{idVendor}=="1366", SYMLINK+="ttymkw", ENV{SYSTEMD_WANTS}+="offnet-uart-log@$attr{serial}"
Systemd template:
[Unit]
Description=Start log of UART for a Offnet unit
[Service]
ExecStart=/bin/sh -c "/bin/echo %i >> /tmp/asdf.log"
Apparently I don't need the TAG, and I need to use $attr instead of $env.
systemd version is 241.
The Q/A that helped me.
EDIT: a reason for $env not working could be that ID_SERIAL_SHORT is created on a rule on level 60, while my file is 10-local.rules. Thanks @yuwata. (Not verified.)
| null | minipile | NaturalLanguage | mit | null |
The fire has forced thousands to evacuate and left hundreds of buildings destroyed. It is part of a state-wide emergency in California after a second fire continues to blaze in Los Angeles. | null | minipile | NaturalLanguage | mit | null |
MONSEY, New York — The morning after an assailant tore through a rabbi’s house in upstate New York with a machete, slashing at Hanukkah celebrants, residents huddled outside smoking cigarettes, rehashing the attack.
By evening, many Monsey, New York, residents would be dancing through the streets to welcome a Torah in a defiant act of celebration.
More than 100 people were inside the home of Rabbi Chaim Rottenberg on Saturday night for the holiday celebration when the attacker stormed in, wounding five people, two critically.
Get The Times of Israel's Daily Edition by email and never miss our top stories Free Sign Up
Survivors and neighbors returned Sunday morning, gathering outside Congregation Netzach Yisroel next door. One of them had fought off the attacker, others had fled, and everyone knew someone who had been inside.
Children stood on the roof of a car across the street to watch the action as police waved vehicles through. Residents and reporters chatted in a mix of English, Yiddish and Hebrew.
After covering the aftermath of violent incidents in Israel, this reporter found the scene familiar, recalling terror attacks in Jerusalem and rocket strikes in Ashkelon. The cadre of Israeli reporters outside the rabbi’s home seemed like the foreign journalists covering news events in Israel.
Monsey residents described the foreboding, confusion and resignation following the attack on their rabbi’s home. Most members of the insular community were eager to talk, but didn’t want their names or photos published.
“I would say fear — that’s the word,” Josef Gluck, who fought off the attacker, said of the atmosphere.
Gluck confronted the attacker, and later caught his license plate, which led police to an arrest.
“I turned around, saw somebody wielding a big knife,” Gluck told The Times of Israel. “I saw a guy bleeding in the dining room, saw an old guy unconscious in the hallway. He started coming back. I hoped he would run after me and leave the old guy alone. I grabbed a coffee table and threw it at his face.”
“There was one big hero — Hashem,” Gluck said, referring to God.
“God gave me the energy to do it, looking back. I’m not a brave man,” he said.
Chaos, confusion, children screaming
It’s still unclear why the attacker targeted the rabbi’s home, but residents suspect he was heading toward the synagogue next door, which was mostly empty at the time. People were walking out of the rabbi’s home following a candle-lighting ceremony marking the seventh night of Hannukah, making the house a target, they said.
Neighbors and attendees described chaos and confusion as the attack unfolded, with some pointing out Monsey’s extremely low crime rate.
“I was in the house and I heard screaming. In about two minutes I saw people blocking the door to the shul. I heard children screaming,” said a woman who lives on Forshay Road, near the synagogue, who declined to be identified. She was inside her home with two of her children when the commotion caught her attention.
“I saw people trying to get into the shul. My first reaction was people were trapped inside. I had no idea the screaming was coming from the house,” she said.
“We locked the door because we didn’t know what to do. I told my children to come inside.”
Once first responders arrived, she ventured out, filming the chaotic scene on her phone:
“It’s weird. Why this house? I don’t understand,” said a resident who asked to be identified by his nickname, Hershey.
“There’s questions, and I don’t hear any answers yet,” he said.
‘It starts with the Jews’
Bystanders debated whether they, or the building, were targeted. They noted that ultra-Orthodox Jews like themselves are visibly Jewish, but that attacks against Jews in Poway, California, and Pittsburgh, Pennsylvania, targeted non-ultra-Orthodox houses of worship.
It was the second attack against Jews in Monsey in recent weeks, and comes amid a surge in attacks on Jews in the New York City area.
On December 10, two attackers shot up a kosher supermarket in Jersey City, New Jersey, killing three people inside.
Since the New Jersey shooting, there have been 19 anti-Semitic incidents in the US, 16 of them in New York and New Jersey, according to the Anti-Defamation League.
Reactions to the Monsey attack were mixed, with some calling for more weapons in synagogues, others vowing to move to Israel, and the more sanguine saying the spate of attacks would end.
“If you know what’s going on in the colleges, you’re surprised you’re still alive,” said Monsey resident Yaakov Greenberg, referring to anti-Israel sentiment on US campuses. “It starts with the Jews, it ends up with everybody. The Jews are the first ones to get beat up.”
“It’s going out of control. That’s it. It’s like before World War II,” one resident said.
“I send my kids out for school, they have to stand five or ten minutes for the bus. That’s a concern now,” Haim Kohn said, noting that if the attack had occurred on Shabbat, no one would have had a cellphone and been able to call for help.
There was no guard outside the Netzach Yisroel Synagogue, but worshipers confidently pointed out its heavy lock and camera, similar to the ones that staved off a would-be synagogue shooter in Halle, Germany, in October.
Attacks from all sides
For this writer, growing up Jewish in upstate New York, security never crossed my mind. I don’t think we ever locked the synagogue doors when people were inside.
The discussions outside Netzach Yisroel brought to mind unsettling memories of heavily armed French soldiers outside Paris synagogues and other Jewish institutions.
Recent attacks against Jews in the US have come from all sides, complicating the response.
Robert Bowers, who killed 11 at Pittsburgh’s Tree of Life Synagogue in October 2018, and John Timothy Earnest, who is accused of killing one at Chabad of Poway in California, are white supremacists. The two shooters at the Jersey City kosher supermarket were linked to the Black Hebrew Israelites. Many of the recent assaults on Jews in New York City were carried out by other minorities.
“It’s very difficult to pinpoint one motivation. The common outcome is Jews are beaten or killed,” Israel’s consul general in New York, Dani Dayan, said in Monsey. “I hope no Jew anywhere in the world and not in this country will hide his Jewishness.”
New York City Mayor Bill de Blasio said Friday that the city would step up police presence in some Jewish areas of Brooklyn in response to the attacks.
Following the Monsey stabbing, police in New York City arrested a suspect, identified as Grafton Thomas, 37. He pleaded not guilty to five counts of attempted murder and one count of burglary.
What’s the solution?
Residents debated solutions, with some calling for armed guards and increased security, while others said Jews should move to Israel.
“There have to be checkpoints in all public places,” said Ari Silver, 17. “We all need to go to Israel. Israel is secured, every block.”
Others pointed out that there is violence against Jews in Israel also. Several residents showed me photos of bloody fabric strewn inside the rabbi’s house following the attack, which immediately brought to mind the gruesome Har Nof synagogue attack in Jerusalem in 2014, when two terrorists killed four worshipers at morning prayers with a gun, a meat cleaver, and an ax.
Several Monsey residents cited antipathy toward ultra-Orthodox in Israel as a reason to stay in New York.
Kohn said that during a hotel stay in secular Tel Aviv, “everyone was looking at me.” In Manhattan, he said, “no one’s looking in my direction.”
“We’re very strong here. There’s no hatred here,” he said, speaking Hebrew, adding that he thought the quality of life and ability to make a living were better in the US.
A handful of other residents from the area came out in support of Monsey’s ultra-Orthodox Jewish community, bearing signs reading, “Love your neighbor,” and “Stand together against hate.”
“Violence and hate needs love and attention, whoever it’s against, and this is so close to us,” said Daniel Bieber, a secular Jew from the area.
Bieber said there was “not a lot of communication” between the ultra-Orthodox Jews in the area and other residents, but “being neighbors, you are connected, whether you know it or not.”
Rockland Countyhas the largest Jewish population per capita of any US county, with 31.4 percent, or 90,000 Jewish residents.
Some drivers passing by the house applauded the demonstrators for their show of support.
Acknowledging that only a few non-ultra-Orthodox residents came out in support of the community, Elizabeth Hall said, “I can’t speak for other people but it’s important for me to come out and show support for this community.”
A celebration of survival
The synagogue found ample support from down the street, however.
In the mid-afternoon, after the crowds outside the house had dwindled, a procession headed by Chaverim emergency response volunteers in neon vests and police cars with flashing lights slowly rolled through light rain down Forshay.
A nearby synagogue, Beit Midrash Orr Haim, had redirected its pre-planned parade welcoming a new Torah scroll to Rabbi Rottenberg’s home in a show of support.
The crowd, blasting music, dancing and bearing Torah scrolls, mobbed the rabbi at the entrance to his home.
The parade looped in front of the synagogue next door, then headed back down the street to Orr Haim. Women watched from the sidelines, and children wearing cardboard crowns filed down the sidewalk, holding a string to keep them in line in one hand and miniature tiki torches in the other. The men, from several different synagogues and denominations, danced the entire route back, with Rabbi Rottenberg at their center.
“This shows that even after it happened we’ll still continue to do whatever we do,” said a synagogue member outside who identified himself as Haim. “This is every day.”
Gluck, who fought off the attacker, said that on Sunday morning he was “tired, shaken up, but happy, if I can say that. We survived.”
“We’re celebrating the power of light over evil,” he said of Hanukkah. “It makes me want to go home to hug my kids again one more time.”
The celebrants, still dancing and clapping hands, packed into the synagogue, swirling around the new Torah scroll. Outside, children carrying balloon animals ate pink cotton candy, while armed police watched from across the muddy parking lot.
Agencies contributed to this report. | null | minipile | NaturalLanguage | mit | null |
Q:
Css Transform Effect in MongoDB site
I am new to css and learning different type of css styles. I want to learn how the effect used in official MongoDb website. The effect which tracks the mouse position and transforms the boxes. I know how to do the transform in css. But, how can it be done with the mouse position. Thanks for the help.
A:
General overview of how to do it:
Register a mousemove-handler and track your mouse-screen location (see link)
translate mouse screenlocation, to mouse location relative to rectangle:
e.target in mousemove event gives you the rectangle (or some descendent which allows you to get to the rectangle.
given the target element get it's position (top + left using getBoundingClientRect) as well as width and height. These should be easy to lookup
Notice that the mouse at the center of the rectangle doesn't rotate the rectangle. Only when moving to the edges, the rotation starts to get going. This rotational rate-of-change seems to be linear. So:
determine the max rotation that seems nice to have in degrees. Simply test with different numbers in the chrome dev tools or similar: transform: rotateY(0.01deg) rotateX(0.01deg); Say you want to have a max rotation of 25 degrees.
say the rectangle is 100px in width. It's clear to see that each pixel movement from the center to the edge (50 px in total) adds 0.5 degree to the rotation due to the linear rate of change: 25 deg / 50px. So for example moving 20px to the left of the center translates to rotateY(10deg);. Moving 20px to the right results in the mirror rotation (rotateY(-10deg);). NOTE: the positive and negative may need to be flipped.
similarly, moving along the Y-axis changes the rotateX-property.
Once calculated, set the css-property and you're done
| null | minipile | NaturalLanguage | mit | null |
Post by brandsman on Jan 18, 2019 15:57:19 GMT
I have the Dornier Do-27 Q5 that was in Turkey. After many years of doing nothing with it, I am now serious about trying to get it airworthy. The problem is corrosion in the wings. I either need to buy a new set with the higher gross weight or buy new spar caps and slat supports to replace the corroded items in mine.
Does anyone out there have either for sale? The alternative is to go to a different wing, which would of course have to be experimental. | null | minipile | NaturalLanguage | mit | null |
Q:
What does the 20-80A rating on an energy meter mean?
On the energy meter nameplate is a current rating 20-80A, which I can assume has something to do with max current.
I'm particularly interested in the "20" part, though. What does this rating mean? I don't want to assume that this 20 is the minimum current that the meter can measure because it really wouldn't make sense to me. Internet articles aren't really clear on this, so I'm hoping I can get clarity on the matter.
A:
The specifications of the meter only apply on the range between 20A and 80A. Below or above it is less accurate.
Which makes, sense. If you put your multimeter in 600V mode, you're not on the scale to confidently measure 6V.
| null | minipile | NaturalLanguage | mit | null |
1. Introduction {#sec1-ijms-20-03911}
===============
The process of translation is the last stage in the genetic information transfer and it depends upon the correct matching between mRNA codons and corresponding tRNA anticodons within the ribosomal complex. High fidelity of tRNA selection is crucial in the expression of genetic information. On the ribosome, each codon of the mRNA has to be accurately and efficiently recognized by cognate tRNAs among a large repertoire of non-cognate tRNAs. Aminoacylated tRNAs (aa-tRNAs) are delivered to the ribosomal A site as a ternary complex with elongation factor EF-Tu and GTP. Incorrect tRNA can be rejected either before or after GTP hydrolysis. During the initial selection step, the ternary complex of aa-tRNA with EF-Tu--GTP (in procaryotes) binds to the ribosome and forms a readily reversible complex that dissociates rapidly when there is no codon/anticodon match. This step occurs without GTP hydrolysis. Most non-cognate tRNAs are rejected by this first sieve with essentially no cost with respect to GTP hydrolysis \[[@B1-ijms-20-03911]\]. Discrimination of near-cognate ternary complexes is enhanced by a proofreading step that requires a more complex mechanism with the hydrolysis of GTP in EF-Tu. After GTP hydrolysis, EF-Tu undergoes a dramatic conformation change, thereby loosing its affinity for aa-tRNA. The aminoacyl end of aa-tRNA is thus free to move into the peptidyl transferase centre on the 50S subunit (accommodation), where it takes part in peptide bond formation. Alternatively, after GTP hydrolysis, near-cognate aa-tRNA with imperfect base pairing dissociate from the ribosome. Overall, discrimination of correct and incorrect substrates is achieved in two consecutive steps, initial selection and proofreading which are separated by GTP hydrolysis. All these events between the initial binding and accommodation of the cognate aa-tRNA have been dissected into several distinguishable steps (reviewed in \[[@B2-ijms-20-03911],[@B3-ijms-20-03911]\]).
Although the process of tRNA selection on the ribosome seems to be universal, examples of decoding of codon-anticodon pairs that deviate from the canonical process have been described. Dicistroviruses such as cricket paralysis virus (CrPV) contain between their two ORFs, an IRES element called intergenic region (IGR) that mimics the structure of tRNA presenting to the ribosome a pseudo codon-anticodon triplet. The IGR forms a pseudo knot (PKI), which mimics the codon-anticodon nucleotides. It enters the A-site, translocates to the P-site, and initiates translation on the next codon, a non-AUG initiation codon \[[@B4-ijms-20-03911],[@B5-ijms-20-03911]\]. Translation initiation is independent from the sequence of the triplet present in the PKI and can occur with a stop codon \[[@B5-ijms-20-03911]\]. However, when the pseudo codon-anticodon triplet is disrupted by a mutation in the PKI sequence, the IGR is unable to initiate translation on the downstream ORF \[[@B5-ijms-20-03911]\]. In short, the IGR mediates ribosome hijacking in achieving a sophisticated molecular mimicry of tRNA and mRNA. For that, the IGR adopts a modular structure composed of 6 stem-loops and 3 pseudo knots, balanced between rigidity and flexibility in order to optimally interact with the ribosome and elongation factor eEF2 during translocation \[[@B6-ijms-20-03911],[@B7-ijms-20-03911],[@B8-ijms-20-03911],[@B9-ijms-20-03911]\]. It was shown that PKI is recognized by the ribosome in the same way as a cognate mRNA-tRNA codon-anticodon duplex. Stem loops IV and V of the IGR play a significant role during this process by interacting with the head of the ribosome to restrict its movement as observed during canonical translation \[[@B9-ijms-20-03911],[@B10-ijms-20-03911],[@B11-ijms-20-03911]\]. Once PKI has entered the P-site, the contacts with stem loops IV and V are disrupted, leaving the A-site free to accept the first aminoacylated tRNA complexed with elongation factor eEF1A \[[@B12-ijms-20-03911]\]. After a second translocation, the IGR mimics a canonical acceptor stem of an E-site tRNA \[[@B13-ijms-20-03911]\]. Altogether, the data show that PKI of the IGR follows the conventional molecular mechanisms of tRNA discrimination by sensing the codon/anticodon duplex in the A site and the subsequent step of translocation in the P site \[[@B9-ijms-20-03911]\]. Following 80S assembly, the eEF2-mediated translocation of the IGR in the P-site results in an unstable intermediate that is captured by binding of the elongator tRNA in complex with eEF1A. At this step, initiation can occur in the main frame (0 frame) and also after frameshifting in the +1 frame, according to the arrival rate of the first tRNA \[[@B14-ijms-20-03911]\]. Usually, frameshifting during decoding generates much more drastic effects than missense errors that change a single amino acid residue (estimated to be in the range 6 × 10^−4^--5 × 10^−3^) \[[@B15-ijms-20-03911]\]. It occurs when the ribosome recruits an aa-tRNA out of frame with respect to the frame in which it was initiated. The most common of these events require the ribosome to shift to a codon overlapping a codon in the normal frame. A shift of one nucleotide toward the 5′ end of the mRNA generates a (−1) frameshifting, whereas a shift toward the 3′ end generates a (+1) frameshifting. Shifted ribosomes that cannot finish the normal protein. They no longer see the correct codons, and normally rapidly encounter a termination codon. The importance on the protein function is usually consequent because of the sequence change and premature stop. Although the spontaneous frequency of frameshift errors is below missense errors, it can be considerably increased by additional factors such as slippery sequences or ribosomal pausing on hungry codons that modify the codon-anticodon realignment \[[@B16-ijms-20-03911]\]. In addition, some frameshifts are programmed by primary and secondary sequence elements either preceding or following the shift site \[[@B16-ijms-20-03911],[@B17-ijms-20-03911],[@B18-ijms-20-03911]\].
Multiple types of molecules in the translational machinery can promote translational frameshifting, including ribosomal RNA, ribosomal proteins, and translation elongation factors \[[@B16-ijms-20-03911]\]. A common molecule affecting the frame maintenance is the tRNA. Frameshift suppressor tRNAs often harbour alterations of the loop of the anticodon but also normal 7-nt anticodon loops \[[@B19-ijms-20-03911]\]. Changes in the tRNA base modifications such as N1-methylguanosine at position 37, are also able to induce frameshifting \[[@B20-ijms-20-03911],[@B21-ijms-20-03911],[@B22-ijms-20-03911]\]. Recently, a structural study revealed that suppressor tRNASufA6 (tRNA^Pro^ with an expanded anticodon loop) is undergoing a rearrangement of the anticodon loop due to the extra nt at position 37.5 that destabilizes U32, thereby disrupting the conserved U32-A38 base pair \[[@B23-ijms-20-03911]\]. Interestingly, the removal of the m~1~G37 modification of tRNA^Pro^ disrupted U32-A38 pairing in a structurally analogous manner, explaining the frameshifting effects previously observed \[[@B24-ijms-20-03911]\]. Altogether, these data showed that the disruption of the U32--A38 base pair plays a significant role in the loss of grip in the correct frame. Phylogenetic analysis has shown that the 32--38 interaction is a fundamental feature of all tRNAs and is directly correlated to the strength of the codon--anticodon interaction (high vs. low GC base pairs) \[[@B20-ijms-20-03911],[@B21-ijms-20-03911]\]. Modifying the 32--38 interaction dramatically affects tRNA discrimination of cognate vs. near-cognate codons both in vitro and in vivo \[[@B25-ijms-20-03911],[@B26-ijms-20-03911]\].
Much of what we know about frameshifting induced by tRNAs has come from studies on suppressors of tRNA^Gly^~NCC~ and tRNA^Pro^~NGG~. Sequencing of suppressible frameshift mutations showed that they include the sequences CCC-N or GGG-N, resulting from expansion of proline (CCN) or glycine (GGN) codons. This allows the tRNA suppressor to frameshift from the original phase 0 to the shifted phase (+1) while keeping the codon-anticodon pairing. Glycine belongs to the GC-rich 4 codon boxes that establish strong base pairing with their corresponding anticodon. The structures of these tRNAs have been 'tuned down' during evolution to reduce and adjust their binding strength to the mRNA in the ribosome \[[@B27-ijms-20-03911],[@B28-ijms-20-03911]\]. The adjustment structure is obtained by varying nucleotides forming the interaction 32--38 in the anticodon loop. These nucleotides should not form a Watson--Crick base pair or another interaction that would antagonize the canonical conformation of the codon/anticodon triplet in a correct helical orientation in the ribosomal decoding site. Without a selection for the preformed conformation of the anticodon loop, the strong codon*/*anticodon pairs would allow miscoding by binding to other G*/*C-rich near- or even non-cognate aatRNAs.
In eukaryotes, three tRNA^Gly^ isoacceptors are found with GCC, CCC and UCC anticodons. According to the wobble rules, tRNA^Gly^~UCC~ should be able to decode GGA and GGG codons. The tRNA^Gly^~GCC~ isoacceptor should decode GGC and GGU codons. Theoretically, these two tRNA species, that are the most abundant, should be able to decode the entire set of glycine codons, however, an additional tRNA^Gly^ with CCC anticodon is found to decode GGG codons \[[@B29-ijms-20-03911]\]. Nucleotide U34 of tRNA^Gly^~UCC~ appears to be unmodified in higher eukaryotes, suggesting that it may also decode all 4 Gly codons by "superwobbling" \[[@B30-ijms-20-03911]\]. Remarkably among eukaryotic tRNAs reading the 4 and 6 codon boxes, tRNA^Gly^ is the only one that exhibits a G34. Other tRNAs have a A34 that is modified in inosine to decode NNU, NNC and NNA codons (the later inefficiently \[[@B31-ijms-20-03911]\]). Therefore, the decoding ability of G34 and I34 does not drastically differ and the reason of this dichotomy is not yet understood. Recently, an interesting correlation was described between the A34-\>I modification and the proofreading capacity of corresponding aminoacyl-tRNA synthetases (aaRS), the enzymes in charge of tRNA aminoacylation \[[@B32-ijms-20-03911]\]. It was suggested that the proofreading activity would prevent continued sectoring of the genetic code utilizing the anticodon wobble position. The A34-\>I modification, found in tRNAs reading 4-codon boxes, would block its subdivision in two 2-codon boxes and thereby impact the evolution and sectoring of the genetic code \[[@B32-ijms-20-03911]\]. Gly would escape to this trend, perhaps because glycyl-tRNA synthetase is highly specific for Gly and does not required proofreading activity. Therefore, Gly would not be concerned by codon reattribution and tRNA^Gly^ could use a G34 wobble and act as a '2-codon box reader' without the risk of inducing the split of its 4-codon box \[[@B32-ijms-20-03911]\]. In short, it seems that tRNAs^Gly^ bring together several features and properties that make them singular. They decode GC-rich codons, implying an adaptation of the anticodon loop structure to balance the energy of the codon-anticodon helix. They do not exhibit modification of A37, which is usually involved in reading frame maintenance. Many suppressors of tRNA^Gly^ that frameshift in +1 have been be selected \[[@B33-ijms-20-03911]\] (and ref inside) and programmed ribosomal frameshifting on GGG codon in −1 frame is utilised by HIV-1 virus to modulate GagPol synthesis \[[@B34-ijms-20-03911]\]. All these features suggest that tRNAs^Gly^ may play a general and significant role in the phenomenon of programmed ribosomal frameshifting, which regulatory role in both prokaryotes and eukaryotes is becoming increasingly clear \[[@B35-ijms-20-03911],[@B36-ijms-20-03911],[@B37-ijms-20-03911],[@B38-ijms-20-03911]\] (and references therein).
In this context and to further explore the decoding and frameshifting properties of tRNA^Gly^ we performed the present study which combines experimental and bioinformatics approaches to carry out a systematic analysis of the Glycine codon usage in Eukaryotes and relationship with the 3′ adjacent nucleotide (nt+1). We found a clear distribution preference for a G over the 3 other nucleotides immediately after the GGU codon, from which we infer that this nucleotide likely causes an effect on translation. We assessed the effect of the four nucleotides at n+1 position in rabbit reticulocyte extracts by monitoring renilla luciferase activity of constructs programmed with the tetranucleotide GGU(N) in the two frames 0 and +1. To control both codon and anticodon pairings we used the internal ribosome entry site (IRES) from cricket paralysis virus (CrPV) that initiates using a pseudoknot structure mimicking a tRNA paired with the mRNA. We found that nt+1 regulates the frame selection by the IRES. Moreover, a G at +1 improves luciferase activity and favours the frame 0. Altogether, the results suggest that translation is modulated by the first nucleotide of the adjacent codon within the ribosome.
2. Results and Discussion {#sec2-ijms-20-03911}
=========================
2.1. tRNAs^Gly^ Have Unusual Nucleotide 34 Distribution {#sec2dot1-ijms-20-03911}
-------------------------------------------------------
The current 'genomic tRNA data base' contains in the eukaryota domain 139,808 tRNA genes (<http://gtrnadb.ucsc.edu/>) \[[@B29-ijms-20-03911]\]. Analysis of these data confirmed previous observations on the poor usage of G~34~NN anticodons by tRNAs specific of amino acids coded by 3, 4 and 6-codon boxes. Only 3063 sequences have been reported for the following amino acids: Ala, Arg, Ile, Leu, Pro, Ser, Thr and Val, which represents less than 4% of the total number of tRNA sequences ([Table 1](#ijms-20-03911-t001){ref-type="table"}). Remarkably, tRNA^Gly^, which also belongs to the 4-codon box group, clearly escapes this global trend and 6636 sequences harbouring an anticodon G~34~CC are found in the database. In total, 13,347 sequences of tRNA^Gly^ have been reported in eukaryotes and the anticodon distribution is 767 for ACC, 2328 for CCC and 3616 for UCC in addition to the 6636 for GCC. Another surprising aspect of this distribution is the low number of genes for tRNA^Gly^ with ACC anticodons (only 767) compared to the other tRNA specific of the 3, 4 and 6 codon boxes. For instance there are 40,726 sequences exhibiting A34 in tRNAs specific for Ala, Arg, Ile, Leu, Pro, Ser, Thr and Val and only 767 sequences of tRNA^Gly^. It results a spectacular inversion of the usage of G34 versus A34 when comparing tRNA^Gly^ numbers with the other tRNAs specific for Ala, Arg, Ile, Leu, Pro, Ser, Thr and Val ([Figure 1](#ijms-20-03911-f001){ref-type="fig"}). Altogether, the data are suggesting that tRNA^Gly^ prefers G34 rather than A34 that could be potentially modified in I34.
2.2. Usage of Codons Gly in Eukaryotes Does Not Show Any Bias {#sec2dot2-ijms-20-03911}
-------------------------------------------------------------
Next we checked whether sparing A34 in tRNA^Gly^ could result from a special codon usage. We examined the 'Codon Usage Database' of a list of 23 representative eukaryotic organisms including *Candida glabrata, Candida albicans, Saccharomyces cerevisiae, Kluyveromyces lactis, Drosophila melanogaster, Schizosaccharomyces pombe, Leishmania major, Anopheles gambiae, Oryza savita, Zea mays, Arabidopsis thaliana, Papio anubis, Sus scrofa, Strongylocentrotus purpuratus, Rattus norvegicus, Homo sapiens, Mus musculus, Macaca mulatta, Equus caballus, Oryctolagus cuniculus, Xenopus tropicalis, Gallus gallus, Caenorhabditis elegans* \[[@B39-ijms-20-03911]\]. Despite variations among the organisms, we did not observe any special bias in the usage of Gly codons that would explain the presence of G34 ([Figure 2](#ijms-20-03911-f002){ref-type="fig"}).
As mentioned above, three main tRNA^Gly^ isoacceptors are found in eukaryotes, with GCC, CCC and UCC anticodons. According to the wobble rules, tRNA^Gly^~UCC~ should decode GGA and GGG codons whereas tRNA^Gly^~GCC~ isoacceptor should decode GGC and GGU codons. A third tRNA^Gly^ with CCC anticodon is found to specifically decode GGG codons \[[@B29-ijms-20-03911]\] ([Figure 2](#ijms-20-03911-f002){ref-type="fig"}B). Therefore, the decoding of Gly codons by tRNA^Gly^ is perfectly ensured despite the absence of an A34-containing tRNA^Gly^. It is assumed that such tRNA, if existing, would be deaminated on A34 to form inosine with C, U and A pairing properties (however inefficient with A \[[@B31-ijms-20-03911]\]). Inosine has a greater range of potential base pairs than either adenosine or guanosine. However, I•C and I•U pairs are less stable than G•C and G•U pairs, respectively \[[@B40-ijms-20-03911]\]. In eukaryotes, the G34 anticodon-sparing has been observed for a long time with the exceptional disparity of tRNA^Gly^ \[[@B41-ijms-20-03911],[@B42-ijms-20-03911]\]. In the three kingdoms, for an unexplained reason, G34-containing tRNA^Gly^ read the pyrimidine-ending codons (GGU and GGC) and favor G•U wobble versus I•A, I•C or I•U wobble pairs that would be formed if A34-tRNA^Gly^ modified in inosine would exist. Altogether, these observations suggest that the preference given by tRNA^Gly^ for G34 versus A/I34 cannot be explained by decoding idiosyncrasies of the Gly codons or by economical reasons in terms of tRNA anticodon number.
2.3. Bias of Nucleotide +1 after GGU Glycine Codon {#sec2dot3-ijms-20-03911}
--------------------------------------------------
One hypothesis might be that G34 is part of a mechanism of adaptation of tRNA^Gly^ linked to the inherent properties of frameshifting of this tRNA. Many records have described the frameshifting properties of suppressors of tRNA^Gly^~NCC~. They generally frameshift on sequences GGG-N, resulting from expansion of glycine (GGN) codons.
Therefore, we examined the contexts of Gly codons, focusing on nt+1 that could be involved in +1 frameshifting phenomenon. We analysed all the open reading frames (ORF) of the 23 above-mentioned organisms for their distribution in Gly codons and +1 context. Data processing was performed using a home-written Python script. Coding DNA sequences (CDSs) from genomic sequences of 23 eukaryotic species were downloaded from the NCBI site <ftp://ftp.ncbi.nlm.nih.gov/genomes/>. 35,246,252 Gly codons were found in the 23 annotated genomes. The histogram of [Figure 3](#ijms-20-03911-f003){ref-type="fig"} shows the composition of the nt+1 after the four Gly codons, in all the ORFs of the 23 organisms. In the GGU box a clear preference was observed for a G at +1 in 42% of the codons ([Figure 3](#ijms-20-03911-f003){ref-type="fig"}). Normally it is expected to find an equal ratio for the 4 nts with little variation according to the G/C content of the genome. Here, the G preference is specific of the GGU codon and reaches an unusual high value. Although some discrepancies for nt+1 also exist in the other 3 Gly codons, they are less significant ([Figure 3](#ijms-20-03911-f003){ref-type="fig"}). The distribution was examined in each separate organism and the same general pattern of G preference in +1 position of the GGU codons was found with extreme values of 59.7% in *L. major* and 34% in *S. pombe* ([Figure A1](#ijms-20-03911-f0A1){ref-type="fig"} in [Appendix A](#app1-ijms-20-03911){ref-type="app"}).
We also examined the tRNA^Gly^ gene number. The fraction of tRNA^Gly^~GCC~, which decodes GGU codons, varied between 0.29 and 0.80 ([Figure 2](#ijms-20-03911-f002){ref-type="fig"}C) and was well adapted to the Gly codon usage ([Figure 2](#ijms-20-03911-f002){ref-type="fig"}A).
2.4. Decoding and Frameshifting Efficiency on Gly Codons {#sec2dot4-ijms-20-03911}
--------------------------------------------------------
To measure the frame shifting activity on Gly codons we used the second IRES element of CrPV located in the intergenic region (IGR) that initiates using a pseudo knot structure mimicking a tRNA paired with the mRNA. Like the transfer-messenger RNA (tmRNA), the IGR combines features of tRNA and mRNA \[[@B43-ijms-20-03911]\]. However, while tmRNA is involved in the degradation of aberrant mRNAs, the IGR structure is dedicated to translation initiation of the second cistron of the CrPV. A pseudoknot (PKI) of the IGR structurally and functionally mimics the codon-anticodon helix and is recognized by the ribosome in the same way as a cognate mRNA-tRNA codon-anticodon duplex \[[@B44-ijms-20-03911]\]. While tRNAs have low affinity for ribosome in the free form, the IGR binds to the A-site independently of the elongation factor. Then, the pseudo-tRNA is translocated in the P-site, and translation is initiated on the next codon, a GCU in CrPV \[[@B6-ijms-20-03911],[@B7-ijms-20-03911],[@B8-ijms-20-03911]\]. During this process on the ribosome, the IGR undergoes a careful monitoring of its structure, which must perfectly fit with the geometry of a cognate codon/anticodon triplet as found in a tRNA-mRNA complex. For instance, a single mutation that disrupted the pseudo codon-anticodon triplet was shown not to have dramatic consequence on viral protein synthesis. On the other hand, the IGR was perfectly able to start with a stop codon inserted in the pseudo knot \[[@B4-ijms-20-03911],[@B5-ijms-20-03911]\]. Here in this study, the IGR was used as a versatile tool for testing the frameshifting activity induced by the environment of Gly codons. The pseudoknot triplet was reprogrammed with Gly codons and fused with renilla luciferase (R-Luc) ORF in order to initiate in the 0 phase. The insertion of one extra A before the AUG initiation codon of R-Luc induced a +1 frameshift that inactivated R-Luc translation. This construct was used to measure R-Luc activity resulting from the +1 frameshift (+1 frame). By this way we could reprogram the codon and anticodon parts of the IGR in order to explore their reading properties on the ribosome decoding center, and measure the influence of nt+1 on the reading frame maintenance with the R-Luc constructs in 0 and +1 frames.
### 2.4.1. Decoding and Frameshifting Efficiency of the WT IGR {#sec2dot4dot1-ijms-20-03911}
In a first series of experiment, we tested the activity of the IGR with a wild-type PKI with a G in position +1 of the first codon of R-Luc (G+1 hereafter) and compared it with derivatives with the 3 other nucleotides in +1 (A+1, C+1 and U+1). Transcripts of the constructs in 0 and +1 frame of R-Luc were translated in rabbit reticulocyte lysate (RRL) and the resulting luciferase activities were quantified.
We first measured the R-Luc activity of the wild-type (WT) PKI with the complementary sequence AGG/CCU mimicking a tRNA^Pro^~AGG~ annealed to a CCU Pro codon. In parallel, a negative IGR control was constructed with a disrupted PKI exhibiting a GGU codon instead of CCU \[[@B5-ijms-20-03911]\]. The disruption strongly diminished the 0 and +1 frame translation activity to a level of 4% of the activity of the WT IGR in 0-frame ([Figure 4](#ijms-20-03911-f004){ref-type="fig"}). The background was identical in 0 and +1 frame, and could account from the spontaneous cap-independent translation activity typically measured with RRL extracts. This background was subtracted from the measured activities in all the following experiments.
With the WT IGR, a spontaneous frameshifting activity was observed when comparing the activity of R-Luc in 0 and +1 frame. This is consistent with other studies performed on the IGR of other dicistroviruses that showed translation of an overlapping ORFx in the +1 frame \[[@B44-ijms-20-03911]\]. The R-Luc activity in +1 frame reached 7% of that of 0 frame, quite similar to the activity previously reported \[[@B44-ijms-20-03911],[@B45-ijms-20-03911],[@B46-ijms-20-03911]\]. We also observed that the ratio of synthesis of the two frames is sensitive to the Mg^2+^ concentration and translation conditions as described \[[@B47-ijms-20-03911]\]. Optimal Mg^2+^ concentration to add was found to be 1 mM in our activated RRL translation extracts. With 0.5 mM or 2 mM Mg^2+^ the extracts were less active and less specific for frame selection. They were entirely inactive above 2 mM ([Figure A2](#ijms-20-03911-f0A2){ref-type="fig"}).
Then we analysed the impact on translation efficiency of the substitutions of the first nt after the WT CCU Pro codon of PKI. These mutations change the first amino acid and may potentially affect translation initiation efficiency and frame selection. Dicistroviruses are able to initiate with different amino acids. Plautia stali intestine virus (PSIV) starts with Gln (CAA), Israeli acute paralysis virus (IAPV) with Gly (GGC) and many other dicistroviruses start with Ala (GCU/C/A) \[[@B48-ijms-20-03911]\]. Here we generated the 3 constructs of the WT PKI with an A, C or U in +1. The resulting new codons were ACU, CCU and UCU leading to Thr, Pro and Ser changes, respectively. These 3 amino acids are considered to be non-destabilizing residues according to the N-end rule and therefore should not affect differently the half-life of the translated products \[[@B49-ijms-20-03911]\]. However, when comparing the R-Luc activities, we could observe significant variations with the 4 constructs. The most active construct in 0 frame was the WT IGR with G in +1 downstream of non-coding Pro codon of PKI. This result suggests that evolution has already selected the most efficient amino acid to initiate de synthesis of the viral protein. Compared to the WT PKI with a G+1, the other constructs with A+1, C+1 and U+1 exhibited 39%, 15% and 13% of activity, respectively ([Figure 5](#ijms-20-03911-f005){ref-type="fig"}). Therefore the nt in +1 significantly impacts translation initiation despite its location outside of PKI. In the cryo-EM structure of the CrPV IGR in complex with *K. lactis* 80S, an additional base pair is observed between G+1 and the ribosomal base C1273 that is usually interacting with the third base pair of the anticodon during standard decoding \[[@B9-ijms-20-03911]\]. Remarkably, all IGR-IRES sequences obtained to date encode a guanine residue at this position with the only exception being the PSIV-IRES \[[@B48-ijms-20-03911]\]. This conservation correlates with the function of G+1 in mRNA frame selection \[[@B47-ijms-20-03911]\], and the variations of translation efficiency here observed with the 3 variants.
Interestingly, the consequent decreases of activity in 0 frame were not correlated with increases of activity in the +1 frame that would suggest competition for ribosome site selection in the 0 or +1 frame ([Figure 5](#ijms-20-03911-f005){ref-type="fig"}). However, the ratio of R-Luc activity in +1 and 0 frame showed significant variations from 0.07 for the WT IGR to 0.19, 0.51 and 0.25 for the variants with A+1, C+1 and U+1, respectively. These data confirmed that nt+1 is involved in frame selection \[[@B47-ijms-20-03911]\] although the loss of activity in 0 frame was not balanced by an increase of activity in the +1 frame. The molecular mechanism of this frameshifting is not yet clearly understood, but it has been proposed that on the IGR, the ribosome is oscillating between 0 and +1 frames and the frame is locked when the cognate tRNA binds \[[@B14-ijms-20-03911]\]. At this step, the guanine residue in +1 might play a critical role in stabilizing the conformation more suitable for the 0 frame. Therefore, the tRNA arrival rate would dictate the choice of the 0 and +1 frame to translate \[[@B14-ijms-20-03911]\]. This is consistent with the fact that tRNA^Ala^~AGC~ for the 0 frame is an abundant isoacceptor whereas tRNA^Leu^~UAG~ for the CUA codon of +1 frame is a relatively rare isoacceptor \[[@B29-ijms-20-03911]\].
### 2.4.2. Decoding Efficiency of the IGR Programmed with GGU Gly Codon {#sec2dot4dot2-ijms-20-03911}
First, we tested PKI constructs programmed with a GGU Gly codon. As mentioned earlier, GGU codon is decoded by tRNA^Gly^~GCC~. We replaced the CCU codon of the WT PKI by the GGU Gly codon and to preserve the complementarity with the pseudo-anticodon of PKI, we inserted the GCC sequence in the opposite strand ([Figure 6](#ijms-20-03911-f006){ref-type="fig"}). The resulting codon-anticodon minihelix contained an equivalent 'G34•U3′ wobble pairing, a combination never tested in the IGR. Indeed, previous mutagenesis studies established the essential role of the correct base pairing of the tRNA/mRNA mimicry in PKI of the IGR \[[@B4-ijms-20-03911],[@B5-ijms-20-03911]\]. As the IGR mimics a tRNA paired with the mRNA, it is possible to test all the codon/anticodon combinations of interest, including non-canonical base pairing.
As before, the reprogrammed PKI was tested with the 4 nts in position +1 and luciferase activity was assessed in 0 and +1 frame ([Figure 6](#ijms-20-03911-f006){ref-type="fig"}). Of the 4 constructs, GCC/GGU-G was the most efficient with 74% of the R-Luc activity measured with the wild-type AGG/CCU-G construct. Therefore a construct with 'G34•U3′ wobble pair is well recognized by the ribosome in the presence of a G in +1. The 3 other constructs exhibited severe decreases of the activity in 0 frame with 21, 34 and 11% of WT activity for A, C and U in +1, respectively ([Figure 6](#ijms-20-03911-f006){ref-type="fig"}). These results confirmed the critical role of nt+1 for the IGR activity even with a PK reprogrammed with a Gly codon.
### 2.4.3. Decoding Efficiency of the IGR Programmed with Other Gly Codons {#sec2dot4dot3-ijms-20-03911}
In addition to the IGR programmed with the GGU codon, we constructed variants with the other Gly codons. A first variant contained a GGU Gly codon (with G+1) annealed to an ACC anticodon instead of GCC. The (ACC/GGU-G) variant mimics recognition by the absent tRNA^Gly^~A34CC~, which in eukaryotes is specifically replaced by the anticodon with a G34. Here a regular Watson-Crick pairing 'A34-U3′ is expected to form in the ACC/GGU-G variant instead of the 'G34•U3′ wobble pairing found in the GCC/GGU-G construct. The RNA with the Watson-Crick 'A34-U3′ pair was nearly as active as the construct with 'G34•U3′ wobble pair (55% and 65% of the activity of the WT IGR, respectively) ([Figure 7](#ijms-20-03911-f007){ref-type="fig"}). Thus, the absence of tRNA^Gly^~A34CC~ is not due to a fundamental structural or functional defect hampering its function in translation. Nevertheless, the RNA with 'A34-U3′ pair is 10% less active than the 'G34•U3′ whereas the frameshifting activity is increased to 9% (versus 7% for the 'G34•U3′ construct). Therefore, the GCC anticodon forming a wobble 'G34•U3′ with the GGU codon is the most efficient and faithful combination.
Four other constructs were generated to mimic the other codon-anticodon combinations formed during codon Gly decoding. Transcripts GCC/GGC, CCC/GGG, UCC/GGA, and UCC/GGG (all with G in +1) were constructed in order to test initiation on GGC, GGG and GGA codons in the PK, respectively. The 3 first transcripts exhibited 35% of residual activity in 0-frame translation whereas the fourth one, the UCC/GGG variant, had lost nearly all its activity in frame 0, which was below the level of the +1 frame activity. The low activity of the UCC/GGG variant with a 'U34•G3′ wobble pair may be surprising since the GCC/GGU variant with the reverse 'G34•U3′ pair exhibited 65% of the WT activity. This result confirms that G•U and U•G pairs are not isosteric \[[@B50-ijms-20-03911]\] and confer a non-functional geometry to the IGR in the 'U34•G3′ orientation. Usually U34-containg tRNAs utilize diverse modifications to stabilize tautomer conformations suitable for the ribosomal A-site \[[@B51-ijms-20-03911]\]. However here, the transcripts of the IGR are devoid of any modification and therefore the PKI 'anticodon loop' cannot achieve the suitable conformation change. This might explain the drastic effect on the activity of the 0-frame while the frame-shifting activity was kept nearly constant.
Overall, the data collected with the 5 constructs are showing that the presence of two strong G=C pairs in codon positions 1 and 2 do not guarantee the full activity to the IGR. The more active constructs are exhibiting a weak third pair such as a wobble pair in the 'G34•U3′ orientation or an A-U pair. Three G=C pairs are reducing the activity as well as the reverse wobble pair 'U34•G3′.
To confirm this observation, an additional construct GCC-GGA with a non-Watson-Crick pair at position 'G34•A3′ was constructed and tested. The construct was as active as the best Gly construct ([Figure 7](#ijms-20-03911-f007){ref-type="fig"}). G•A pairs are supposed to bring flexibility to RNA structures \[[@B52-ijms-20-03911],[@B53-ijms-20-03911],[@B54-ijms-20-03911],[@B55-ijms-20-03911]\]. Up to six dominant modes of G•A pairing have been reported in RNA molecules comprising ribosomes, riboswitches, ribozymes, tRNAs, mRNAs, etc. \[[@B56-ijms-20-03911]\] and the geometry of a G•A pair was solved at the central position of the codon-anticodon helix in the 70S ribosome \[[@B57-ijms-20-03911]\].
Altogether, the data show that in the Gly codon context, the presence of more than two G=C Watson-Crick pairs in the PK is deleterious for the translation initiation activity. The presence of A-U at the third codon position is tolerated, but a weaker G•U wobble pair or a G•A non-Watson Crick pair is conferring the highest and faithfulness translational activity to the IGR. All these results are consistent with our knowledge about the ribosomal A-site. It recognizes precisely the geometry of codon-anticodon base pair at the first two positions but monitor the third, or wobble position, less stringently, allowing diverse unusual base pairs to interact \[[@B58-ijms-20-03911],[@B59-ijms-20-03911]\].
According to the energies of the codon-anticodon minihelices calculated following the Turner values \[[@B60-ijms-20-03911]\], the Gly amino acid decoded by GGN codons belongs to the 'STRONG' group with high energy (average −4.6 kcal/mole) in their codon-anticodon duplexes \[[@B28-ijms-20-03911]\]. Such high energy represents a risk of miscoding by binding to other GC-rich non-cognate aa-tRNAs. Therefore, the translation apparatus evolved to minimize the differential thermodynamic contributions of the codon-anticodon interactions. It results that the structures of tRNAs harboring too strong base-pairing binding capacity have been 'tuned down' during evolution for optimal and uniform translation. Consequently, the binding of natural tRNAs on the ribosome is very smilar whatever the GC/AU composition of the codon-anticodon duplex \[[@B27-ijms-20-03911]\]. One critical feature that modulates the binding energy of codon-anticodon duplexes is the interaction between bases 32 and 38 in the tRNA anticodon loop. Classical Watson-Crick base pair constraints the anticodon loop structure and antagonize the canonical conformation of the codon-anticodon triplet, thereby weakening the corresponding binding energy. Watson-Crick base pairs in 32--38 are often associated with GC-rich anticodons, whereas weaker non-canonical pairs are found in tRNAs with AU-rich anticodons where they allow optimal anticodon conformation for pairing with the codon. By this way, the differential thermodynamic contributions of all the codon-anticodon interactions is averaged, resulting in a rather uniform binding of tRNAs to the ribosome \[[@B28-ijms-20-03911],[@B61-ijms-20-03911],[@B62-ijms-20-03911]\]. Here in our experiments the high binding energy of Gly codons inserted in the PK couldn't be balanced by a compensatory change in the IGR since it remained unchanged. This may explain that 2 G=C bp already reached an energy limit above which any additional Watson-Crick bp would decrease translation initiation efficiency. Above this limit, the PK probably possess too much energy compared to the external stabilizing grip energy for the ribosome required during translation, resulting in a possible rejection from the ribosomal decoding site.
### 2.4.4. Frameshifting Activity of the IGR Programmed with GGU Codons {#sec2dot4dot4-ijms-20-03911}
During translation, tRNAs move from the A site on the ribosome to the P site and then from the P site to the E site together with the mRNA. While moving, the codon-anticodon interactions remain intact through the A, P and E sites. A critical checkpoint for the maintenance of ribosome fidelity is located in the A-site where the geometry of codon--anticodon helix is tightly monitored by the three universally conserved and essential nts A1492, A1493, and G530 (bacterial numbering) of 16S rRNA \[[@B63-ijms-20-03911],[@B64-ijms-20-03911]\]. This is achieved by intimate interactions with the minor groove of the first two bp of the codon-anticodon helix, thus sensing Watson-Crick base-pairing geometry and discriminating against near-cognate tRNA. The third (wobble) position of the codon is free to accommodate certain non-canonical base pairs. At this level, C1054 of 16S rRNA stacks against base 36 of the tRNA, which also interacts with G530, and ribosomal protein S12.
Additionally, natural modifications located in the anticodon loop (nt 37) and anticodon itself (nt 34), stabilize tRNA-codon interactions and increase decoding fidelity, or expand decoding capacity (nt 34). Downstream of the A-codon, nucleotides +7, +8 and +9 (the A of the AUG being nt+1) of the mRNA are held in place by a combination of hydrogen bonding and continuous aromatic base stacking involving, among others, C1054 from helix 34 of 16S rRNA, further stabilizing the network \[[@B65-ijms-20-03911]\]. Altogether, data suggest that during elongation, the mRNA is stabilized and aligned at the entrance of the decoding center by a network of interactions with the ribosome \[[@B66-ijms-20-03911],[@B67-ijms-20-03911]\].
Recently, a significant variation of this stabilizing network was observed in the cryo-EM structure of the IGR element of CrPV in complex with *K. lactis* ribosome \[[@B9-ijms-20-03911]\]. Instead of the usual interaction between the C1054 (C1273 in *K. lactis*) and codon base 3, a unique pairing is observed with nt+1 of the first translated codon of the viral protein. This exceptional base pair results from the rotation of the base around its glycosidic bond causing the redirection of C1273 towards the first base of the first coding codon of the CrPV RNA \[[@B9-ijms-20-03911]\]. Remarkably, with the exception of the IGR of PSIV \[[@B48-ijms-20-03911]\], all the IGR sequences obtained to date exhibit a guanine residue at this position suggesting that the interaction C1273-G+1 may be mostly conserved in the dicistrovirus family. A sub-class of IGR elements synthesize in addition to the main ORF2 an overlapping hidden polypeptide (ORFx) in the +1 reading frame. Therefore it was proposed that the extra base pair C1273-G+1 might be an important regulatory element downstream of the ribosomal A site that could be involved in the frame selection by the IGR element \[[@B44-ijms-20-03911],[@B45-ijms-20-03911],[@B47-ijms-20-03911]\]. In Israeli Acute Paralysis Virus (IAPV) IGR, the ORFx synthesis is initiated immediately downstream of the IGR, using a mechanism of frame selection probably dictated by the kinetics of tRNA binding in the first 0 or +1 frame codon as measured for the CrPV IGR \[[@B14-ijms-20-03911]\].
Here in response to G+1 substitutions in the wild-type CrPV IGR, a decrease of translation of the 0 frame was observed ([Figure 5](#ijms-20-03911-f005){ref-type="fig"} and [Figure 6](#ijms-20-03911-f006){ref-type="fig"}). Translation of the +1 frame was also decreased but to a lesser extent, resulting in a global loss of fidelity in the frame maintenance as shown by the vertical stacked bar graphs ([Figure 5](#ijms-20-03911-f005){ref-type="fig"}B and [Figure 6](#ijms-20-03911-f006){ref-type="fig"}B). Three constructs (AGG/CCU-C, GCC/GGU-A and GCC-GGU-U) exhibited frameshifting activity higher than 30% of the total R-Luc activity ([Figure 4](#ijms-20-03911-f004){ref-type="fig"}B and [Figure 5](#ijms-20-03911-f005){ref-type="fig"}B).
Therefore, the C1273-G+1 interaction contributes to efficiency and fidelity of the translation process, assisting the PKI element in the presentation of the adjacent first codon in a proper conformation to the first incoming tRNA. The IGR IRES has a dynamic structure that is able to adopt upon ribosome-binding all the conformations of the aminoacyl-tRNA from the initial binding to the fully accommodated stage after translocation into the P-site \[[@B12-ijms-20-03911]\]. Our data and previous reports \[[@B9-ijms-20-03911],[@B12-ijms-20-03911]\] clearly show that nt+1 plays a critical role when interacting with C1273 (C1054 in *E. coli* ribosomal RNA) in a conformation reminiscent of a hybrid tRNA state \[[@B44-ijms-20-03911],[@B45-ijms-20-03911],[@B47-ijms-20-03911]\]. Although this interaction has never been observed in the large number of described ribosomal complexes with tRNAs or ASLs (for a full set of references \[[@B9-ijms-20-03911]\]), one cannot exclude that C1273 (C1054) interacts with G+1 during standard decoding. C1273 may flip from the interaction with G+1 during the initial binding to stacking on the wobble base 34 as previously reported \[[@B50-ijms-20-03911],[@B51-ijms-20-03911]\]. Another evidence of the importance of C1273 (C1054) during ribosome decoding is coming from early genetic studies. Mutants of C1054 with reduced translational accuracy were isolated, causing non-specific read-through of stop codons as well as enhanced +1 and −1 frameshifting \[[@B63-ijms-20-03911]\].
Based on our systematic mutational analyses, the most likely scenario is that ribosomes recruited to the IGR initiate in the 0-frame or shift in the +1 frame depending on the codon-anticodon and downstream +1 nt. The presence of C1273 (C1054) would stabilize the conformation of PKI by interacting with a G in +1. Here evidence is presented which shows that the IGR activity is favored when it is programmed with a U-ending codon (AGG/CCU, GCC/GGU, ACC/GGU) and a G in +1. It includes the Gly GGU codon with G in +1. Our first finding that a G preferentially follows a GGU codon ([Figure 3](#ijms-20-03911-f003){ref-type="fig"}) can now be explained in terms of decoding efficiency and reading frame fidelity in the context of the PKI element of the IGR element. Indeed, although the IGR mimics the tRNA shape, it lacks some critical structural elements such as the base pair interaction between nts 32 and 38 which usually fine-tunes the loop structure and harmonize tRNA affinity for ribosomes \[[@B68-ijms-20-03911],[@B69-ijms-20-03911],[@B70-ijms-20-03911],[@B71-ijms-20-03911]\] and the proofreading step on the ribosome by eEF1A. Additional experiments are now required to validate the conclusions using Gly codons located outside of the PKI in the coding sequence of R-Luc. This will allow testing natural modified tRNAs in the context of competition of a total tRNA extract, including the phenomenon of miscoding by near-cognate tRNAs when that was not the case with the IGR reprogrammed element.
3. Materials and Methods {#sec3-ijms-20-03911}
========================
3.1. Data Processing {#sec3dot1-ijms-20-03911}
--------------------
Data processing was performed using a Python script. Coding DNA sequences (CDSs) from genomic sequences of 23 eukaryotic species were downloaded from the NCBI site <ftp://ftp.ncbi.nlm.nih.gov/genomes/>.
The first part of the script checked all CDSs of each species. It removed CDSs from the non-nuclear genome, annotated as pseudogenes and having a nucleotide length not a multiple of three. CDSs were translated taking into account the genetic code of each species and the translation exceptions like the selenocysteine UGA codon. CDSs were excluded if their protein sequence (i) did not begin with an AUG or an alternative initiator codon, (ii) did not end with a stop codon and (iii) contained a stop codon within their coding phase.From the DNA sequences of the retained CDS set, the second part of the script used a sliding window (window size of 6 bases and step size of 3 bases) to search four nucleotide patterns. These patterns correspond to the four glycine codons, GGU, GGG, GGC and GGA, followed by all base possibilities in position +1 and unknown bases in positions +2 and +3. For example, patterns GGTANN, GGTGNN, GGTCNN and GGTTNN were searched. The occurrence of the four given patterns was counted to calculate the relative percentage of each pattern. The output of the script was a csv file.
3.2. Construction of the IGR-luciferase Reporters {#sec3dot2-ijms-20-03911}
-------------------------------------------------
The PK mutants were constructed by PCR amplification of the CrPV IGR coding template using a sense primer (5′GGATAT[TAATACGACTCACTATA]{.ul}GG*CAAAAATGTGATCTTGCTT*3′) appending the T7 RNA polymerase promoter (underlined sequence) to the IGR structure (italic) and an antisense primer (5′**CGAAGTATCTTGAAATGT***AGC[AGG]{.ul}TAAATTTCTTAGGTTTTT CGACTA[CCT]{.ul}AATCTGAAA*3′) where nts from the IGR are italicized, those forming the pseudo codon/anticodon are underlined and bold nts are complementary to Renilla Luciferase gene (Integrated DNA Technologies, Coralville, IA, USA). To generate the IGR variants, a PCR mixture containing 0.02 ng/µL of CrPV IGR-containing template plasmid, 0.2 µM of sense and antisense primer (Integrated DNA Technologies), 0.2 mM of each dNTP (ThermoFisher, Waltham, MA, USA), 0.04 U/µL of Phusion DNA polymerase (ThermoFisher) and the corresponding buffer at the recommended concentration were subjected to an initial denaturation step of 2 min at 95 °C followed by 25 cycles of: 30 s at 95 °C, 30 s at 55 °C, 1 min at 72 °C, and terminated by a final extension of 10 min at 72 °C. PCR products were fractionated on a 1% agarose Tris-acetate gel and the PCR product was excised from the gel and eluted by PCR Clean-Up System" kit (Promega, Madison, WI, USA) before quantification with a Nanodrop (Thermo Fisher Scientific, Waltham, MA, USA). This PCR product was then used as primer in a second PCR reaction using as template the Renilla Luciferase gene (pRLuc). The second PCR was performed in the same conditions as above but using 0.02 ng/µL of pRLuc, 0.07 µM of the first PCR product (the region of the antisense primer complementary to R-Luc is in bold) and 0.2 µM of RevRLuc primer (5′GAATTATTGTTCATTTTTGAGAAC3′). To measure the luciferase activity resulting from a frameshift of +1 nucleotide, the second PCR amplification was performed on template pRLuc+1, which exhibits one extra A before residue Met 14 of Renilla Luciferase. Finally, the second PCR products were purified on a 1% agarose gel, and quantified as above. IGR-RLuc reporter mRNAs were synthesized from the second PCR product by in vitro transcription using recombinant T7 RNA polymerase as described previously \[[@B72-ijms-20-03911],[@B73-ijms-20-03911]\]. After transcription, unincorporated nucleotides were trapped on a G-25 column. RNA transcripts were then phenol-extracted and ethanol precipitated. RNA pellets were resuspended in water and their concentration was determined by absorbance measurements. [Figure A3](#ijms-20-03911-f0A3){ref-type="fig"} shows the RNA integrity of the constructs used in the study.
3.3. In vitro Translation in Rabbit Reticulocyte Lysates {#sec3dot3-ijms-20-03911}
--------------------------------------------------------
Translation reactions were performed in RRL extracts as previously described \[[@B74-ijms-20-03911]\]. Prior translation, the IGR RNA was heated at 95 °C for 3 min, then cooled to room temperature during 5 min and placed on ice. Translation reactions were incubated at 30 °C for 60 min and included 100 nM of each IGR-reporter mRNA transcript and 10.8 μCi \[^35^S\]Met. Aliquots of translation reactions were analyzed by 15% SDS-PAGE (data not shown) and luciferase activities were measured with the Promega dual-luciferase assay, using a Promega luminometer. [Figure A4](#ijms-20-03911-f0A4){ref-type="fig"} shows the radioactive translation products after separation by SDS PAGE and autoradiography.
4. Conclusions {#sec4-ijms-20-03911}
==============
Here we combined experimental and bioinformatics approaches to analyze the Glycine codon usage with the 3′ downstream nucleotide (nt+1). A clear preference for a G in +1 was detected after the GGU codon. When a G residue was in +1 of an IGR construct reprogrammed with a GGU codon, the translational activity of the reporter R-Luc was improved in the 0 frame and frameshifting activity in the +1 frame dropped to a minimum. As GGU codons are read by tRNA^Gly^~GCC~, our data suggest that G34 together with G+1 is there to prevent +1 frameshifting. Altogether, the results show that translation efficiency of Gly GGU codon by tRNA^Gly^~GCC~ is modulated by the first nucleotide of the adjacent codon, acting simultaneously on the frameshifting activity.
Glycine is a member of a 4-codon box family whose two first nts are forming strong G=C pairings. Commonly, the Gly box is read by up to three different isoacceptors. What is remarkable in this box is that tRNA^Gly^~A34CC~ has been systematically banished from nearly all organisms, being replaced by tRNA^Gly^~G34CC~ with decoding properties for GGC and GGU codons. The other boxes usually exhibit a tRNA~ANN~ that is subsequently deaminated in inosine with extended decoding properties for C, U and A-ending codons. The reason of the exceptional A34 sparing in the Gly box family is not clearly understood but several hypotheses have been proposed. For instance, it was shown that tRNA^Gly^~A34CC~ was an extremely poor substrate for the deaminase enzyme (adenosine deaminase acting on tRNA; ADAT) responsible for I34 formation \[[@B75-ijms-20-03911]\]. This might be due to an unusual structure of the loop. Molecular dynamics (MD) simulations revealed that an A34 could be an important source of structural instability in the anticodon stem-loop of tRNA^Gly^ \[[@B75-ijms-20-03911]\]. Moreover, solution nuclear magnetic resonance (NMR) analyses on different tRNA^Gly^ anticodon arms showed that they do not form the classical U-turn motif seen in tRNA anticodon loops \[[@B76-ijms-20-03911]\]. Together, these results indicate that the singular tRNA^Gly^ anticodon loop structure might be a potential cause for the selection of G34 versus I34 in tRNA^Gly^. An unmodified A34 would only be able to decode U-ending codons while tRNA^Gly^~G34CC~ is able to decode G and U-ending codons. Beyond this idiosyncrasy, it is worth pointing out that evolution has assigned to tRNA^Gly^~G34CC~ and whole tRNA^Gly^ family multiple extra-translational roles, including transcriptional regulation with the T-box regulatory elements \[[@B77-ijms-20-03911]\] and cell wall biosynthesis \[[@B78-ijms-20-03911]\].
The authors wish to thank Eric Westhof for precious discussions.
G.E. and F.M. conceived and supervised the study; A.J., A.T. and L.S. conducted the experiments; Software, L.D.; Data analysis, F.M. and G.E.; G.E. wrote the manuscript; Funding acquisition, G.E. and F.M. All authors read and approved the manuscript.
This work was supported by 'Centre National de la Recherche Scientifique' (CNRS) and funded by 'Agence Nationale pour la Recherche' (ANR) \[H4translation, ANR-17-CE11-0024-01\] and \[Ribofluidix, ANR-17-CE12-0025-01\].
The authors declare no conflict of interest.
ASL
Anticodon Stem Loop
CDS
Coding DNA sequence
CrPV
Cricket Paralysis Virus
IGR
InterGenic Region
IRES
Internal Ribosomal Entry Site
nt
nucleotide
ORF
Open Reading Frame
PKI
Pseudoknot I
R-Luc
Renilla Luciferase
RRL
Rabbit Reticulocyte Lysate
{#ijms-20-03911-f0A1}
{#ijms-20-03911-f0A2}
{ref-type="fig"}; (**B**) RNAs used in [Figure 5](#ijms-20-03911-f005){ref-type="fig"}; (**C**) RNAs used in [Figure 6](#ijms-20-03911-f006){ref-type="fig"}; (**D**) RNAs used in [Figure 7](#ijms-20-03911-f007){ref-type="fig"}.](ijms-20-03911-g0A3){#ijms-20-03911-f0A3}
![Analysis of the IGR-dependent translation products in vitro. For each construct, the 0- and +1-frame products were analysed. The reporter constructs were incubated in RRL translation extracts at 30 °C for 60 min in the presence of \[^35^S\]Met. Translation experiments were performed in untreated RRL containing endogenous lipoxygenase mRNA as well as globin mRNA in large amount (the globin band is not shown). Translation products were visualized by autoradiography after resolving on a 10% SDS PAGE.](ijms-20-03911-g0A4){#ijms-20-03911-f0A4}
{#ijms-20-03911-f001}
{#ijms-20-03911-f002}
{#ijms-20-03911-f003}
{#ijms-20-03911-f004}
{#ijms-20-03911-f005}
{#ijms-20-03911-f006}
{#ijms-20-03911-f007}
ijms-20-03911-t001_Table 1
######
Identity of nucleotide 34 in tRNAs in the 3, 4 and 6 codon boxes \*.
tRNAs Specific for Total Number in Eukarya ^1^ With G34 With A34 With C34 With U34
------------------------------------------- ----------------------------- ---------- ------------ ---------- ----------
Ala, Arg, Ile, Leu, Pro, Ser, Thr and Val 80,060 **3063** **40,726** 14,194 22,077
Gly 13,347 **6636** **767** 2328 3616
^1^ from <http://gtrnadb.ucsc.edu/> \[[@B29-ijms-20-03911]\]; \* Excluding in the 6-codon boxes the tRNAs for the 2-codon boxes.
| null | minipile | NaturalLanguage | mit | null |
Q:
What does it mean to "drink a lot of haterade"?
A friend recently posted on their Facebook status that she has "apparently been drinking lots of haterade lately"[sic]. Does this mean other people are annoyed with her or she's annoyed with other people? What does this phrase mean?
A:
The term is a take-off on an American beverage called "gatorade," which is what we would now call a "power drink." She is drinking "haterade," appears to not mean that she is not only ingesting "hate," but in a heavy dose, like the beverage.
| null | minipile | NaturalLanguage | mit | null |
Improvement of mass spectrometry analysis of glycoproteins by MALDI-MS using 3-aminoquinoline/α-cyano-4-hydroxycinnamic acid.
Protein glycosylation analysis is important for elucidating protein function and molecular mechanisms in various biological processes. We previously developed a glycan analysis method using a 3-aminoquinoline/α-cyano-4-hydroxycinnamic acid liquid matrix (3-AQ/CHCA LM) and applied it to the quantitative glycan profiling of glycoproteins. However, information concerning glycosylation sites is lost; glycopeptide analysis is therefore required to identify the glycosylation sites in glycoproteins. Human epidermal growth factor receptor 2 (HER2) is a glycoprotein that plays a role in the regulation of cell proliferation, differentiation, and migration. Several reports have described the structure of HER2, but the structures of N-glycans attached to this protein remain to be fully elucidated. In this study, 3-AQ/CHCA LM was applied to tryptic digests of HER2 to reveal its N-glycosylation state and to evaluate the utility of this LM in characterizing glycopeptides. Peptide sequence coverage was considerably improved compared to analysis of HER2 using α-cyano-4-hydroxycinnamic acid or 2,5-dihydroxybenzoic acid. Most of the peaks observed using only this LM were localized at the inner or outer regions of sample spots. Furthermore, five of the peptide peaks that were enriched within the inner region were confirmed to be glycosylated by MS/MS analysis. Three glycosylation sites were identified and their glycan structures were elucidated. The reduction in sample complexity by on-target separation allowed for higher sequence coverage, resulting in effective detection and characterization of glycopeptides. In conclusion, these results demonstrate that MS-based glycoprotein analysis using 3-AQ/CHCA is an effective method to identify glycosylation sites in proteins and to elucidate the glycan structures of glycoproteins in complex samples. | null | minipile | NaturalLanguage | mit | null |
---
abstract: |
The aim of this paper is the derivation of an a-posteriori error estimate for a numerical method based on an exponential scheme in time and spectral Galerkin methods in space. We obtain analytically a rigorous bound on the mean square error conditioned to the calculated data, which is numerically computable and uses the given numerical approximation. Thus one can check a-posteriori the error for a given numerical computation without relying on an asymptotic result.
All estimates are only based on the numerical data and the structure of the equation, but they do not use any a-priori information of the solution, which makes the approach applicable to equations where global existence of solutions is not known. For simplicity of presentation, we develop the method here in a relatively simple situation of a stable one-dimensional Allen-Cahn equation with additive forcing.
author:
- 'Dirk Blömker[^1], Minoo Kamrani[^2]'
title: 'Numerically Computable A Posteriori-Bounds for stochastic Allen-Cahn equation'
---
Introduction
============
A-posteriori analysis of deterministic PDE (partial differential equations) is a well developed tool. See for example the book [@Ver:13] or the results for Allen-Cahn and related equations [@BaMuOr:12; @Ba:05; @GeMa:14]. The strength of the method is usually the derivation of error indicators for the refinement of meshes in adaptive schemes. See [@SSST:05] for an example in a stochastic setting.
Also for SPDEs (stochastic PDEs) there are recent results on a-posteriori analysis. The results of [@BuDaWi:11; @KaFrYa:13] use a-posteriori estimates in polynomial or Wiener-chaos expansion, and the results of [@YaDuGu:10; @YaQiDu:12] show a-posteriori mean square error estimates, under the assumption that the whole law of the numerical approximation is known (or at least several moments of it).
In our work we follow a different more path-wise approach. We measure the error in mean square conditioned on the calculated numerical data. Given a single realization of the numerical approximation, without using a-priori information on the solution we show analytic bounds, that can be calculated numerically, and guarantee a-posteriori that the true solution is close to the given realization of the numerical approximation, which was calculated.
Let us remark that the mean square error of our approximation scheme might diverge (see Jentzen & Hutzenthaler [@HuJe1; @HuJe2]). Thus it is not obvious that our conditional mean square error converges, although we obtain a good error estimate in our numerical example. Moreover, we expect quite a large variation for different numerical realizations, which seems to be also visible in our numerical examples.
The general philosophy of a-priori error analysis is to use the true solution, which is plugged into the numerical scheme to calculate the residual. Then using the discrete in time equation given by the numerical scheme, one can derive a discrete equation for the error, which has coefficients depending on the true solution. Using a-priori information of the solution, asymptotic bounds for the error are derived.
In our a-posteriori analysis we use a time-continuous interpolation of the numerical data, which is plugged into the SPDE, in order to derive bounds on the residual. For the error we obtain a PDE which is continuous in time and has coefficients depending on the numerical data. Here we can use now standard a-priori SPDE-type methods to derive error bounds, that depend only on numerical data and the residual, which can be calculated rigorously from the numercial data.
Although for simplicity of presentation, we use a much simpler equation of Allen-Cahn-type, our result is motivated by equations where the global existence of solutions is not known, and thus global a-priori estimates are not available. Typical examples are the three-dimensional Navier-Stokes equation or a somewhat simpler equation from surface growth [@BlRo:15]. For the latter in [@BlNoRo:15; @No:17] a-posteriori analysis was used for the deterministic PDEs to prove numerically the regularity of solutions and thus the global existence and uniqueness.
Here we focus as a starting point for simplicity on an one-dimensional equation of Allen-Cahn type. Here even the asymptotic convergence results of numerical schemes are well known See for example [@LPS:14; @KLMS:11] or [@BJ:16P] for a truncated scheme. Moreover, there is no problem with existence and uniqueness of solutions. See for example [@PrZa:14].
For the spatial discretization we use the spectral Galerkin-scheme, which simplifies the analysis. Moreover, for the time-discretization we use a variant of the exponential scheme introduced by [@JeKlWi:11]. Asymptotically, both exponential discretization schems should be equivalent, but the variant we use is slightly easier to handle in the analysis.
The precise functional analytic set-up and the equation itself is presented in Section \[sec:sett\]. In Section \[sec:SB\] we present analytic results for stochastic terms which we cannot evaluate numerically. One is the infinite-dimensional remainder of the stochastic convolution at discretization times. The second one bounds fluctuations in between discretization times. Here we need to analyze an Ornstein-Uhlenbeck bridge-process, as we now the stochastic convolution at all discretization times.
In the main result we present in Section \[sec:Res\] analytic error estimates for the residual that depend only on the numerically calculated data, the initial condition, and the stochastic terms already bounded in Section \[sec:SB\]. We provide a bound in moments of the $L^4$-norm, which is conditioned on the given numerical data. In Section \[sec:App\] we study the conditional mean square error of the approximation in $L^2$-norm, given the numerical data. Nevertheless, this is a property of the equation and not of the data. We need to quantify the continuous dependence of solutions on additive perturbations like the stochastic convolution or the residual. Due to the relatively simple structure of the equation with a stable nonlinearity and a stable linear part, this is relatively straightforward.
In the final section, we give numerical examples to illustrate the result. Here we use a quite poor discretization given that the solution is very rough and still obtain meaningful error bounds. In more detail we study a finer discretization, where we see that the rigorous error estimate bounds the solution well. One main source of error comes from bounds on terms that appear due to stochastic fluctuations between the discretization points and not by the error at the discrete times where the approximation is calculated.
Setting {#sec:sett}
=======
The following assumptions and definitions are used throughout the paper. Consider the following SPDE on the Hilbert-space $H=L^2([0,\pi])$ which is of the type: $$\label{SPDE}
du = [Au + F(u)] dt + dW\; \qquad u(0) = u_\star\;,$$ subject to Dirichlet boundary conditions on $[0,\pi]$, where $A$ is the Laplacian, $W$ some cylindrical $Q$-Wiener process. Finally, $F$ is the locally-Lipschitz nonlinearity $F(u)=-u^3$.
The Dirichlet Laplacian $A$ is diagonal w.r.t. $e_k(x)=\sqrt{2/\pi}\sin(kx)$, $k\in\mathbb{N}$ and generates an analytic semigroup $\{e^{tA}\}_{t\geq 0}$ on $H$. Moreover, it is a contraction semigroup on any $L^p(0,\pi)$. This follows in $L^2$ as the largest eigenvalue of $A$ is $-1$ and thus $\|e^{tA}\|_{\mathcal{L}(L^2)}\leq e^{-t}$. In $L^\infty$ it is true by the maximum principle $\|e^{tA}\|_{\mathcal{L}(L^\infty)}\leq 1$. Then by the Riesz-Thorin theorem for any $L^p$-space we have for $t>0$ $$\label{e:RT}
\|e^{tA}\|_{\mathcal{L}(L^p)}
\leq \|e^{tA}\|_{\mathcal{L}(L^\infty)}^{(p-2)/p} \|e^{tA}\|_{\mathcal{L}(L^2)}^{2/p}
\leq e^{-2t/p } < 1 \;.$$ Let us remark that by geometric series $I-e^{tA}$ is an invertible operator in $L^p$ with bounded inverse.
For simplicity we assume that the covariance operator $Q$ is also diagonal in the Fourier basis $e_k$, and denote the eigenvalues by $\alpha_k^2$, i.e. $Qe_k=\alpha_k^2e_k$. This is a standard assumption in order to simplify the analysis by working with explicit Fourier series. We comment later on possible generalizations.
In our numerical examples we consider space-time-white noise of order one that corresponds to $\alpha_k=1$ for all $k\in\mathbb{N}$, which is a case of solutions of quite poor regularity with strong fluctuations. Nevertheless we could allow for even rougher noise.
We assume that $\sum_{k\in\mathbb{N}}\alpha_k^2k^{-2+\delta}<\infty$ for some $\delta>0$, which guarantees that the stochastic convolution (or Ornstein-Uhlenbeck process) $$Z(t)=\int_0^t e^{(t-s)A} dW(s) \;,$$ is continuous both in space and time (cf. [@PrZa:14]).
The mild formulation of (\[SPDE\]) is defined by the fixed point equation $$\label{e:mild}
u(t) =e^{At}u_\star + \int_{0}^{t}e^{A(t-s)}F(u(s))ds + Z(t)\;.$$ Here the existence and uniqueness of solutions is standard. See for example [@PrZa:14]. Here we just need for some $p\geq3$ that $u \in C^0([0,T], L^p)$, $\mathbb{P}$-almost sure, in order to formulate the mild solution in $L^p$ and apply fixed point theorem to . For the rest of the paper we just assume that $u_\star$ is such that there is a sufficiently smooth unique mild solution.
Discretization {#sec:defphi}
--------------
Here we define the discretization scheme used throughout the paper. For the discretization in space we use a spectral Galerkin method. Define $H_N$ as the $N$-dimensional space spanned by the first $N$ eigenfunctions $e_1,\ldots,e_N$. Moreover, denote the orthogonal projection onto $H_N$ as $P_N$.
For the discretization in time, we use a fixed step-size $h = T/M >0$ and for a fixed realization $\omega$, using a random number generator, we obtain in principle exact values of $$\{ P_N Z(hk) \}_{k\in{\mathbb{N}}} \;,$$ defined by $$Z_0 = 0\;,
\qquad
Z_{k+1}
= e^{hA} Z_k + X_{k+1}
= \sum_{j=1}^{k+1} e^{h(k+1-j)A} P_N Q^{1/2} X_j$$ with independent and identically distributed $\mathbb{R}^N$-valued Gaussian random variables $$X_{k+1} = P_N\int_{hk}^{h(k+1)} e^{(h(k+1)-s)A} dW(s)
\sim \mathcal{N}\Big(0,P_NQ\int_0^h e^{2sA}ds\;P_N\Big)\;.$$
Given these values $Z_k$ for $Z(hk)$, the numerical method provides a realization of the approximation $$\{ u_k \}_{k=0,\ldots,M} \subset H_N\;,$$ which is defined recursively as $u_0 = P_N u_\star$ and $$u_n = e^{Ah} P_N u_{n-1} + \int_{0}^{h} e^{A(h-s)}ds F_N(u_{n-1})
+ X_{n}\;.$$ We can also write this explicitly as $$u_n = e^{Anh}P_N u_0+\sum_{k=1}^{n}\int_{(k-1)h}^{kh}e^{A(kh-s)}ds F_N(u_{k-1})
+ Z_{n}\;.$$
Moreover, we define the approximation $\varphi:[0,T] \to H_N$ by the linear interpolation of the points $\varphi(hk)=u_k$.
Result
------
The aim of this paper is to bound the conditional mean-square error given the numerical data, i.e, we want to obtain: $$\mathbb{E} [\|u-\varphi\|^2\ | \ \{ X_k \}_{k\in{\mathbb{N}}} ] =
\mathbb{E} [\|u-\varphi\|^2\ | \ \{ Z_k \}_{k\in{\mathbb{N}}} ] \text{ is small}\;.$$ Therefore we do not want to estimate the error in an asymptotic result, but give a bound can be explicitly calculated for the given realization of the approximation.
In Theorem \[thm:main\] we present the main analytic result for this statement. The term ”small” depends on one hand on the the numerical data $Z$ and $X$, and we will evaluate this part only numerically. Thus we can only say that it is small, after we computed it. On the other hand, we have infinite-dimensional parts and random fluctuations between discretization points, which we have to bound analytically, as there is no data available.
The general philosophy is to evaluate as much as possible of the error bounds using the numerical data, and only rely on analytic estimates if no numerical evaluation is possible. As usual we consider in Section \[sec:Res\] first the residual defined by:
\[def:res\] For the approximation $\varphi : [0,T] \to P_N H$ defined in Section \[sec:defphi\] and $t \in [0,T]$ we define the residual $$\label{e:defRes}
\mathrm{Res} (t)= \varphi(t) - e^{At}\varphi(0) - \int_{0}^{t}e^{A(t-s)}F(\varphi(s))ds - Z(t).$$
We identify in the residual all parts depending on the numerical data, which we do not estimate at all, but evaluate explicitly using the numerical data.
At first for the discretization points $t_n=nh$ we have $$\text{Res}(nh) = - \sum_{k=1}^{n}\int_{(k-1)h}^{kh}e^{A(nh-s)} (F(\varphi(s))-P_NF(u_{k-1}))ds - Q_N Z(nh)\;.$$ In Lemma \[lem:Resnh\] we estimate the residual at the discretization points $nh$. As $\varphi((k-1)h+\tau) = u_{k-1} + \frac{\tau}{h} (u_{k}-u_{k-1}) $ for $\tau\in(0,h)$ we can expand the cubic nonlinearity $F$ and evaluate all the integrals above explicitly. Only the infinite $Q_N Z$ has to be estimated.
In order to bound the residual at intermediate times we first rewrite it in Lemma \[lem:resint\] and we present the main bounds on the residual in Theorem \[thm:mainres\].
A crucial term for the Theorem bounding the residual is the OU-bridge process that gives bounds on the stochastic convolution between discretization points. The following Section \[sec:SB\] provides the stochastic bounds on the infinite dimensional remainder of the OU-process and the OU-bridge process.
In view of the approximation result of Section \[sec:App\] which is done by a standard a-priori estimate in $L^2$-spaces, we need the bounds in $L^4$ on the residual, as we rely on the cubic nonlinearity. Moreover, the residual also contains a cubic, so we need $L^{12}$-bounds of the data.
As we want to obtain explicitly computable bounds for the Allen-Cahn equation, we have to rely on the special structure of the equations. Nevertheless the general approach (especially for the residual) can easily be adapted to other equations, and in Section \[sec:out\] we give a few comments on possible generalizations.
Stochastic bounds {#sec:SB}
=================
Here we present analytic results for stochastic terms we cannot evaluate explicitly using numerical data. One is the infinite-dimensional remainder of the stochastic convolution at discretization times. The other one arises from fluctuations in between discretization times, where we need to analyze an Ornstein-Uhlenbeck bridge-process.
OU-process
----------
For the stochastic term $Q_N Z(nh)$ we cannot use any numerical data to evaluate it. Moreover it is infinite dimensional. The main result here is Lemma \[lemBouQ\] below. First we need estimates of a Gaussian in the $L^4$-norm using the expansion in Fourier-series. We use the $L^4$-norm, as this is the norm needed in the $L^2$-approximation result. It should be straightforward to extend this to general $L^p$-spaces or even uniform bounds in space.
Let $\mathcal{Z}\sim\mathcal{N}(0,\mathcal{Q})$ be a Gaussian with a covariance-operator $\mathcal{Q}$ on $H$ such that $\text{tr}(\mathcal{Q})<\infty$. Denote the eigenvalues and eigenfunctions by $\mathcal{Q}e_k=a_k^2 e_k$ and suppose that for all $x$ we have $\sum_{k\in\mathbb{N}} a_k^2 e_k^2(x)<\infty$, then $$\mathbb{E}\|\mathcal{Z}\|_{L^4}^4 = 3 \sum_{k,\ell} a_k^2 a_\ell^2 \int_0^\pi e_k^2(x)e_\ell^2(x) dx \;.$$
By the properties of the covariance operator, we can expand $$\mathcal{Z} = \sum_{{k\in\mathbb{N}}} a_k n_k e_k$$ for a family $\{n_k\}_{k\in\mathbb{N}}$ of independent standard real-valued Gaussians. By assumption, we obtain that for all $x$ the real-valued random variable $$\mathcal{Z}(x)=\sum_{{k\in\mathbb{N}}} a_k n_k e_k(x) \sim \mathcal{N}\Big(0, \sum_{k\in\mathbb{N}} a_k^2 e_k^2(x)\Big)
\text{ in }\mathbb{R}$$ and the sequences above converges in $\mathbb{R}$ in mean square with respect to the probability measure.
Thus we can use the fact that all moments of a centered real-valued Gaussian can be computed using only the second moment, to obtain by Tonelli’s theorem $$\mathbb{E}\|\mathcal{Z}\|_{L^4}^4 = \int \mathbb{E}|\mathcal{Z}(x)|^4 dx = 3\int ( \mathbb{E}|\mathcal{Z}(x)|^2)^2 dx = 3\int ( \sum_{k} a_k^2 e_k^2(x))^2 dx$$ which implies the claim.
Recall that the Fourier-basis $\{e_k\}_{k\in\mathbb{N}}$ with respect to Dirichlet boundary conditions on $[0,\pi]$ is defined by $$e_{k}(x)=\sqrt2 \sin(kx) / \sqrt{\pi}.$$ Here we have for $k=1,2,\ldots$ where $f_k(x)= \sqrt2 \cos(kx) / \sqrt{\pi}$ $$e_{k}^2(x)= \frac2{\pi} \sin^2(kx) = \frac1{\pi} -\frac1{\sqrt{2\pi}}f_{2k}(x) \;.$$ Thus we have for $k,\ell>0$ $$\int_0^{\pi} e_{k}^2(x)e_{\ell}^2(x) dx = \frac1{\pi} + \frac1{2\pi} \delta_{k,\ell}\;.$$ Now we can verify $$\begin{split}
\int_0^{\pi} \sum_{k,\ell} a_k^2a_\ell^2 e_k^2(x) e^2_\ell(x) dx
& = \frac1{\pi} \Big( \sum_{k}a_k^2\Big)^2 + \frac1{2\pi} \sum_{k}a_k^4 \\
& \leq \frac3{2\pi} \Big( \sum_{k}a_k^2\Big)^2 \;.
\end{split}$$ This yields the following lemma:
\[lem:OUL4\] Let $\mathcal{Z}\sim\mathcal{N}(0,\mathcal{Q})$ be a Gaussian on $H$ with a covariance-operator $\mathcal{Q}$ such that $\text{tr}(\mathcal{Q})<\infty$. Let $\mathcal{Q}$ be diagonal w.r.t. the Fourier-basis $e_k$, then $$\mathbb{E}\|\mathcal{Z}\|_{L^4}^4 \leq \frac3{2\pi} (\text{tr}(\mathcal{Q}))^2 = \frac3{2\pi} (\mathbb{E}\|\mathcal{Z}\|_{L^2}^2)^2\;.$$
We finally obtain for our infinite dimensional OU-process $Z$ from the numerical approximation:
\[lemBouQ\] For all $N\in\mathbb{N}$ the sequence $\{Q_N Z(kh)\}_{k=1,\ldots, M}$ is independent of $(Z_k)_{k\in\mathbb{N}}$ and bounded in the $L^4$-norm by $$\sup_{t \geq 0} \mathbb{E} \|Q_NZ(t)\|_{L^4}^4 \leq \frac{3}{8\pi} \Big(\sum_{k>N} \alpha_k^2k^{-2}\Big)^2.$$
A stronger result is proven in [@DBAJ:Galerkin], where we even could take the supremum in time over bounded intervals inside the expectation and thus use $L^\infty$- instead of $L^4$-norms. But the constant in [@DBAJ:Galerkin] is not calculated explicitly.
The bound of Lemma \[lemBouQ\] is still not numerically computable, but given a bounded sequence $\alpha_k$, it is usually straightforward to evaluate (or bound) the series explicitly. See Remark \[rem:mainres\].
We start by using Lemma \[lem:OUL4\], as $Q_N Z(t) \sim \mathcal{N} (0, Q_N Q \int_0^t e^{2sA}ds)$ in $H$, to obtain $$\begin{split}
\mathbb{E} \|Q_NZ(t)\|_{L^4}^4
&\leq \frac{3}{2\pi} ( \mathbb{E} \|Q_NZ(t)\|_{L^2}^2 )^2 \\
&= \frac{3}{2\pi} \Big( \sum_{k>N} \alpha_k^2 \int_0^t e^{-2k^2s}ds \Big)^2\;.
\end{split}$$ This easily implies the claim.
OU-bridge
---------
In order to treat random fluctuations between discretization points, we define for $\tau\in(0,h)$ $$\label{e:defcZ}
\mathcal{Z}_n(\tau) =\int_{nh}^{nh+\tau}e^{A(nh+\tau-s)}dW_{s}\;.$$ First the processes $ \{\mathcal{Z}_n\}_{n\in\mathbb{N}}$ are independent and identically distributed. Denote also the high modes $\mathcal{Z}^{(h)}_n = (I-P_N)\mathcal{Z}_n$ and the low modes $\mathcal{Z}^{(l)}_n = P_N\mathcal{Z}_n$, which are by definition mutually independent.
Moreover, it is easy to see that $\{\mathcal{Z}_n(\tau)\}_{\tau\in[0,h]}$ depends on $ \{Z_k\}_{k\in\mathbb{N}}$ only via $\mathcal{Z}^{(l)}_n(h) = Z_{n+1}-e^{hA}Z_n$. Thus, recalling that $ \{Z_k\}_{k\in\mathbb{N}}$ is a Markov-process we obtain $$\mathbb{E}[\int_0^h\| \mathcal{Z}_n(\tau)\|_{L^4}^4 d\tau | (Z_k)_{k \in \mathbb{N}}]
= \mathbb{E}[\int_0^h\| \mathcal{Z}_n(\tau)\|_{L^4}^4 d\tau | \mathcal{Z}^{(l)}_{n}(h)] \;.$$ This yields the following Lemma:
\[lem:defN\] $$\mathbb{E}[\int_0^h\| \mathcal{Z}_n(\tau)\|_{L^4}^4 d\tau | (Z_k)_{k \in \mathbb{N}} ] = \mathcal{N}(Z_{n+1} - e^{hA}Z_n)$$ where $$\mathcal{N}(z) = \mathbb{E}[\int_0^h\| \mathcal{Z}_0(\tau)\|_{L^4}^4 d\tau | \mathcal{Z}^{(l)}_0(h)=z]$$
Note that this splits into the infinite dimensional remainder and an OU-bridge process on the low modes. For the OU-bridge process by a result of [@Orn:Gold] we know explicitly the law:
\[lem:OUB\] For $t\in[0,h]$ the law of $\mathcal{Z}^{(l)}_0(t)$ given $ \mathcal{Z}^{(l)}_0(h)=z $ with $z\in P_N H$ is a Gaussian with mean $\lambda(t,z)$ and covariance $\tilde{\mathcal{Q}}_t$ with $$\lambda(t,z) = 2 P_N \int_0^t e^{2As}ds \cdot e^{A(h-t)}[I-e^{2hA}]^{-1} A z$$ and $$\tilde{\mathcal{Q}}_t= P_N\frac{Q}{2A} \frac{1-e^{2tA}}{1-e^{2hA}} \left(I - e^{2A(h-t)}\right) \;.$$
We follow the result of [@Orn:Gold], but our setting is much simpler. First all operators involved are diagonal and thus symmetric. Furthermore, they all commute. We can also treat degenerate noise by restricting the results of [@Orn:Gold] to the Hilbert-space given by the range of $Q$, which is in general only a subset of $P_N H$. But then both $Q$ and $A$ are invertible on that space.
First, $$\text{Law}[\mathcal{Z}^{(l)}_0(t)| \mathcal{Z}_0^{(l)}(h)=z] = \mathcal{N}(\lambda(t,z),\tilde{\mathcal{Q}}_t)$$ where by [@Orn:Gold Prop. 2.11] $$\tilde{\mathcal{Q}}_t = P_N Q_t(I-V_t^2)$$ and by [@Orn:Gold Prop. 2.13] $$\lambda(t,z) = P_N K_tQ_h^{-1/2}z$$ with the following operators, $$Q_t= Q \int_{0}^{t}e^{2As}ds , \quad
V_{t}=Q_{h}^{-\frac 12}e^{A(h-t)}Q_{t}^{\frac 12} , \quad
K_t=Q_t^{\frac12}V_{t} = Q_{h}^{-\frac 12}e^{A(h-t)}Q_{t}\;.$$ This implies $$\lambda(t,z) = P_NQ_{h}^{-1}e^{A(h-t)}Q_{t}z = P_N\int_{0}^{t}e^{2As}ds \cdot e^{A(h-t)}\Big[\int_0^h e^{2As}ds \Big]^{-1} z\;.$$ and $$\begin{split}
\tilde{\mathcal{Q}}_t
= & P_NQ_t(I- Q_{h}^{-1}e^{2A(h-t)}Q_{t}) \\
=& P_N Q_t Q_h^{-1}(Q_h - e^{2A(h-t)}Q_{t}) \\
=& P_N Q \frac{1-e^{2tA}}{1-e^{2hA}} \frac12 A^{-1} \left(I - e^{2hA}- e^{2A(h-t)}(1-e^{2tA})\right) \\
=& P_N \frac{Q}{2A} \frac{1-e^{2tA}}{1-e^{2hA}} \left(I - e^{2A(h-t)}\right)\;.
\end{split}$$
The following bound is surely not optimal, but a slight simplification of the exact bound.
\[lem:boundN\] We bound for $z\in P_N H$ $$\mathcal{N}(z) \le h \cdot \mathcal{S}_h(z)$$ where we define $$\mathcal{S}_h(z) = \Big[\frac{2 h }{\sqrt[4]{5}} \|[I-e^{2hA}]^{-1} A z\|_{L^4}
+
\Big(\frac{3}{2\pi}\Big)^{1/4} \left( h^{-1/2} \Sigma_N(h) + \sum_{k=N+1}^\infty \frac{\alpha_k^2 }{2k^2} \right)^{1/2} \Big]^4$$ where $$\Sigma_N(h)
= \sum_{k=1}^N \frac{\alpha_k^2 }{\sqrt8 \cdot k^3} \frac{(8hk^2e^{-2hk^2}+(2hk^2+3)e^{-4hk^2}+2hk^2-3 )^{1/2}}{1-e^{-2hk^2}} \;.$$
We can explicitly calculate an upper bound for $\mathcal{S}_h$ by first using numerical data for $z$, and then for the infinite series we can use $$\sum_{k>N} \frac{\alpha_k^2 }{k^{2}}
\leq \frac{\sup_{k>N}\alpha_k^2}{N} \;.$$
First using Lemmas \[lem:OUB\] and \[lem:OUL4\] and taking into account the infinite-dimensional remainder of the OU-process, that is independent of the OU-bridge, we obtain $$\text{Law}[\mathcal{Z}_0(t)| \mathcal{Z}_0^{(l)}(h)=z] = \mathcal{N}(\lambda(t,z),\tilde{\mathcal{Q}}_t)$$ on $H$ with covariance operator $\hat{\mathcal{Q}}_t$ being diagonal in Fourier space with $$P_N\hat{\mathcal{Q}}_t = \tilde{\mathcal{Q}}_t
\quad \text{and} \quad
(I-P_N) \hat{\mathcal{Q}}_t = Q \int_0^t e^{2sA}ds$$ where $$\mathcal{N}(z)^{1/4}
\leq
\Big(\int_0^h\|\lambda(s,z)\|_{L^4}^4 ds \Big)^{1/4}
+ \Big( \frac{3}{2\pi} \int_0^h \text{trace}\left( \tilde{\mathcal{Q}}_s \right)^2 ds\Big)^{1/4}$$ Now $$\begin{split}
\text{trace}( \hat{\mathcal{Q}}_s ) &= \text{trace}( \tilde{\mathcal{Q}}_s ) + \text{trace}( Q \int_0^t e^{2\eta A}d\eta )
\\&
= \sum_{k=1}^N \frac{\alpha_k^2 }{2k^2} \frac{1-e^{-2sk^2}}{1-e^{-2hk^2}} \left(1 - e^{-2k^2(h-s)}\right)
+ \sum_{k=N+1}^\infty \frac{\alpha_k^2 }{2k^2} \left(1 - e^{-2k^2s}\right)
\end{split}$$ and thus $$\begin{split}
\int_0^h\text{trace}( \hat{\mathcal{Q}}_s )^2 ds
&= \| \text{trace}(\hat{\mathcal{Q}}_s)\|_{L^2(0,h)}^2 \\
& \leq
\Big( \| \text{trace}(\tilde{\mathcal{Q}}_s)\|_{L^2(0,h)} +\| \text{trace}(Q \int_0^\cdot e^{2\eta A}d\eta )\|_{L^2(0,h)} \Big)^2
\end{split}$$ where we bound $$\begin{split}
&\| \text{trace}(\tilde{\mathcal{Q}}_s)\|_{L^2(0,h)} \\
\leq &
\sum_{k=1}^N \frac{\alpha_k^2 }{2k^2} \frac1{1-e^{-2hk^2}} \| (1-e^{-2sk^2})(1 - e^{-2k^2(h-s)})\|_{L^2(0,h)} \\
\leq&
\sum_{k\in\mathbb{N}} \frac{\alpha_k^2 }{2k^2} \frac1{1-e^{-2hk^2}} \frac1{\sqrt{2k^2}} \Big(8hk^2e^{-2hk^2}+(2hk^2+3)e^{-4hk^2}+2hk^2-3 \Big)^{1/2} \\
\leq &
\sum_{k\in\mathbb{N}} \frac{\alpha_k^2 }{\sqrt8 \cdot k^3} \frac{(8hk^2e^{-2hk^2}+(2hk^2+3)e^{-4hk^2}+2hk^2-3 )^{1/2}}{1-e^{-2hk^2}}
=\Sigma_N(h) \;.
\end{split}$$ Moreover, $$\| \text{trace}(Q \int_0^\cdot e^{2\eta A}d\eta )\|_{L^2(0,h)}
\leq \sum_{k=N+1}^\infty \frac{\alpha_k^2 }{2k^2}\| 1-e^{-2k^2t}\|_{L^2(0,h)}
\leq h \sum_{k=N+1}^\infty \frac{\alpha_k^2 }{2k^2}\;.$$ Thus $$\int_0^h\text{trace}( \hat{\mathcal{Q}}_s )^2 ds
\leq
\left(\Sigma_N(h) + h \sum_{k=N+1}^\infty \frac{\alpha_k^2 }{2k^2} \right)^2$$ For the mean value, we obtain from Lemma \[lem:OUB\] using $$\|\lambda(t,z)\|_{L^4} \leq 2t \|[I-e^{2hA}]^{-1} A z\|_{L^4} \;.$$ Thus $$\int_0^h \|\lambda(t,z)\|_{L^4}^4 dt \leq \frac{2^4}{5} h^5 \|[I-e^{2hA}]^{-1} A z\|^4_{L^4} \;.$$
Residual estimates {#sec:Res}
==================
This section is devoted to bounds on the residual, which measures the quality of an arbitrary numerical approximation. First we consider the discretization points $t_n=nh$, and later we focus on the points $nh+\tau$, $\tau \in (0,h)$, which are in between. Recall that for the approximation $\varphi : [0,T] \to P_N H$ defined in Section \[sec:defphi\] and $t \in [0,T]$ we defined the residual in Definition \[def:res\].
At discretization points
------------------------
In the following Lemma we identify all terms in the residual at the discretization points $nh$ that can be calculated explicitly using the numerical data. We define them as $\text{Res}^{\text{dat}}$.
\[lem:Resnh\] The residual $\{\text{Res}(kh)\ :\ k=0,\ldots, M \}$ defined in at discrete times is given as $$\text{Res}(kh) = \text{Res}^{\text{dat}}_k + \text{Res}^{\text{stoch}}_k$$ where $$\text{Res}^{\text{dat}}_k = I_2(k)+I_3(k)$$ given by the recursive scheme $I_j(0)=0$, $$I_2(n)=e^{hA} I_2(n-1) + h Q_N \int_{0}^{1} e^{sAh } \Big[ u_{n}^3
- s 3(u_{n})^2 d_n + s^2 3u_{n}(d_n)^2
- s^3 (d_n)^3\Big] ds$$ and $$I_3(n)= e^{hA} I_3(n-1) + h P_N \int_{0}^{1} e^{sAh} \Big[(u_n^3- u_{n-1}^3)
-3 s d_nu_{n}^2
+3 s^2 d_n^2 u_{n}
- s^3 d_n^3 \Big]ds.$$ Moreover, $$\text{Res}^{\text{stoch}}_n = - Q_N Z(nh)$$ is random and independent of the numerical data.
The value of $\text{Res}^{\text{dat}}$ just depends on the numerical data $u_k$ and $d_k=u_k-u_{k-1}$. Note that the cubic terms depending on $u_k$ and $d_k$ are all in $H_{3N}$ and thus computable. The integrals are all over diagonal matrices and can be calculated explicitly in the numerical evaluation.
We have $$\label{Resnh}
\begin{split}
\text{Res}(nh)
= & -
\sum_{k=1}^{n}\int_{(k-1)h}^{kh} e^{A(nh-s)} Q_N F(\varphi(s)) ds
\\
& -\sum_{k=1}^{n}\int_{(k-1)h}^{kh} e^{A(nh-s)} P_N [(F(\varphi(s))-F(u_{k-1})]\; ds
\\& - Q_N Z(nh)
\\ =: & I_2(n) + I_3(n) - Q_N Z(nh)\;.
\end{split}$$ For the two integrals we use for $s\in[(k-1)h,kh]$ that $\varphi(s)= u_{k-1}+\frac{\tau}{h}d_k$, where $s=(k-1)h+\tau$ with $\tau\in(0,h)$ and $d_k=u_k-u_{k-1}$, which depends only on the numerical data.
For the first integral $I_2$ on the right hand side we note that although it looks infinite dimensional, due to the cubic nonlinearity it is finite dimensional and we can calculate it explicitly: $$\begin{split}
I_2(n) & := -\sum_{k=1}^{n} \int_{0}^{h} e^{A(h(n-k+1)- s)} Q_N F(u_{k-1}+\frac{s}{h}d_k) ds \\
& = -h \sum_{k=1}^{n} \int_{0}^{1} e^{Ah (n-k+ s)} Q_N F(u_{k}-s d_k)ds \\
&= e^{hA} I_2(n-1)-h\int_{0}^{1} e^{Ah s} Q_N F(u_{k}-s d_k)ds\\
&= e^{hA} I_2(n-1) + h Q_N \Big[\int_{0}^{1} e^{As h} ds \cdot u_{n}^3
- \int_{0}^{1} e^{Ahs}s ds \cdot 3(u_{n})^2 d_n \Big] \\
& \qquad +h Q_N\Big[ \int_{0}^{1} e^{Ahs} s^2 ds \cdot 3u_{n}(d_n)^2
- \int_{0}^{1} e^{Ahs} s^3 ds \cdot (d_n)^3\Big]
\end{split}$$
For the next integral $I_3$ in (\[Resnh\]) we can proceed similarly as for $I_2$ $$\begin{split}
I_3(n)
& = \sum_{k=1}^{n} \int_{(k-1)h}^{kh} e^{A(nh-s)} P_N \left[ \varphi(s)^3 - (u_{k-1})^3 \right] ds
\\=
& \sum_{k=1}^{n}\int_{(k-1)h}^{kh} e^{A(nh-s)} P_N \left[ (u_{k-1}+\frac{s-(k-1)h}{h}d_k))^3 - (u_{k-1})^3 \right] ds
\\
= & h \sum_{k=1}^{n}\int_{0}^{1} e^{Ah(n-k+1-s)} P_N \left[(u_{k-1}+s d_k)^3- (u_{k-1})^3\right] ds
\\= & h \sum_{k=1}^{n}\int_{0}^{1} e^{Ah(n-k+s)} P_N \left[(u_{k-1}+(1-s)d_k)^3- (u_{k-1})^3\right] ds\\
=& h \sum_{k=1}^{n}\int_{0}^{1} e^{Ah(n-k+s)} P_N \left[(u_{k}-sd_k)^3- (u_{k-1})^3\right] ds\\
= & e^{hA} I_3(n-1) + h \int_{0}^{1} e^{sAh} P_N \left[(u_{n}-sd_n)^3- (u_{n-1})^3\right] ds \;.
\end{split}$$ By expanding the cubic we have $$\begin{split}
I_3(n)& = e^{hA} I_3(n-1) + h \int_{0}^{1} e^{sAh}P_N ds \cdot (u_n^3- u_{n-1}^3)
-3h \int_{0}^{1} e^{sAh}sds P_N \cdot d_nu_{n}^2\\&
+3h\int_{0}^{1} e^{sAh}P_N s^2 ds \cdot d_n^2 u_{n}
-h \int_{0}^{1} e^{sAh}P_N s^3 ds \cdot d_n^3.
\end{split}$$
Between discretization points
-----------------------------
For the residual at times between the numerical grid points we have for $\tau\in(0,h)$ $$\begin{split}
- &\text{Res} (nh+\tau) \\
= &
e^{A(nh+\tau)}\varphi(0)+\int_{0}^{nh+\tau}e^{A(nh+\tau-s)}F(\varphi(s))ds
+Z(hn+\tau)-\varphi(nh+\tau)
\\= & e^{A(nh+\tau)}\varphi(0)
+\int_{0}^{nh}e^{A(nh+\tau-s)}F(\varphi(s))ds+\int_{nh}^{nh+\tau}e^{A(nh+\tau-s)}F(\varphi(s))ds
\\&+e^{A\tau}Z_n+\int_{nh}^{nh+\tau}e^{A(nh+\tau-s)}dW_{s}-\varphi(nh+\tau)
\\ =&e^{A\tau}\Big[e^{nhA}\varphi(0)+\int_{0}^{nh}e^{A(nh-s)}F(\varphi(s))ds+\int_{nh}^{nh+\tau}e^{A(nh-s)}F(\varphi(s))ds+Z_{n}\Big]
\\&+\int_{nh}^{nh+\tau}e^{A(nh+\tau-s)}dW_{s}-\varphi(nh+\tau)
\\
=& e^{A\tau}\Big[\text{Res}(nh)+u_{n}+\int_{nh}^{nh+\tau}e^{A(nh-s)}F(\varphi(s))ds\Big]
\\&
+\int_{nh}^{nh+\tau}e^{A(nh+\tau-s)}dW_{s}-\varphi(nh+\tau).
\end{split}$$ Therefore by the fact that by linear interpolation $\varphi(nh+\tau)=u_{nh}+\frac{\tau}{h}d_{n+1}$, where $d_{n+1}=u_{n+1}-u_n$ we get $$\label{Res}
\begin{split}
\text{Res}(nh+\tau) = & e^{A\tau}\text{Res}(nh) +(e^{A\tau}-I)u_n
-\frac{\tau}{h}d_{n+1}
\\&+
\int_{nh}^{nh+\tau}e^{A(nh+\tau-s)}F(\varphi(s))ds
+\int_{nh}^{nh+\tau}e^{A(nh+\tau-s)}dW_{s}.
\end{split}$$ Now at some point we cannot evaluate and need to estimate, as due to the $\tau\in(0,h)$, we cannot evaluate the terms numerically explicit.
For the first integral term in the right hand side of (\[Res\]) we have $$\label{e:defI}
I(\tau)=\int_{nh}^{nh+\tau}e^{A(nh+\tau-s)}F(\varphi(s))ds=
-h\int_0^{\frac{\tau}{h}}e^{A(\tau-sh)}(u_n+sd_{n+1})^3ds\;.
$$
In order to bound $I(\tau)$, we use that the semigroup $e^{tA}$ generated by the Dirichlet-Laplacian $A$ is a contraction semigroup on any $L^p(0,\pi)$. See . Thus we obtain
$$\label{e:bouI}
\begin{split}
\|I(\tau)\|_{L^4}
\leq & h \int_0^{\frac{\tau}{h}} \|(u_n+sd_{n+1})^3\|_{L^4}ds \\
= & h \int_0^{\frac{\tau}{h}} \|(u_n+sd_{n+1})\|_{L^{12}}^3ds \\
\leq & h \int_0^{\frac{\tau}{h}} \left(\|u_n\|_{L^{12}} +s \|d_{n+1}\|_{L^{12}} \right)^3 ds \\
\leq & \tau \|u_n\|_{L^{12}}^3
+ \frac32\frac{\tau^2}{h} \|u_n\|_{L^{12}}^2\|d_{n+1}\|_{L^{12}}
\\&
+ \frac{\tau^3}{h^2} \|u_n\|_{L^{12}}\|d_{n+1}\|_{L^{12}}^2
+ \frac14\frac{\tau^4}{h^3} \|d_{n+1}\|_{L^{12}}^3\;.
\end{split}$$
This still contains powers of $\tau$, but as we are going to integrate this over $\tau$, we keep them and estimate later. Let us summarize the result starting from .
\[lem:resint\] For $n\in\{0,\ldots,M-1\}$ and $\tau\in[0,h]$ we have $$\text{Res}(nh+\tau)
= e^{A\tau}\text{Res}(nh) +(e^{A\tau}-I)u_n
-\frac{\tau}{h}d_{n+1}+
I(\tau)
+\mathcal{Z}_n(\tau),$$ with $I$ defined in and bounded in and $\mathcal{Z}_n$ was defined in .
Bounding the residual
---------------------
Now we are going to bound the residual for intermediate times. Let us fix $n\in\{0,\ldots,M-1\}$ and $\tau\in[0,h]$. In view of Lemma \[lem:resint\], we first bound $$\|(e^{A\tau}-I)u_n\|_{L^4} \leq \| \int_0^\tau A e^{As}ds u_n\|_{L^4} \leq \tau \|Au_n\|_{L^4}$$ to obtain $$\label{Resnhtau}
\|\text{Res}(nh+\tau)\|_{L^4}
\leq \|\text{Res} (nh)\|_{L^4} + \tau \|Au_n\|_{L^4} + \frac{\tau}h\|d_{n+1}\|_{L^4}
+ \|I(\tau)\|_{L^4}+\|Z_n(\tau)\|_{L^4}.$$ In order to bound the residual in a conditional $L^4$-moment, we define $$n(s)=n \iff s\in[nh,h(n+1)) \quad \text{and}\quad \tau(s)=s-n(s)h \in[0,h)\;.$$ We fix $t\in[0,T]$ and obtain from (\[Resnhtau\]) by triangle inequality $$\begin{split}
\Big(\mathbb{E}&[\int_{0}^{t} \|\text{Res}(\tau)\|_{L_4}^4 d\tau|(Z_k)_{k \in \mathbb{N}}] \Big)^{1/4}
\\&=
\Big( \mathbb{E}[\int _{0}^{t} \|\text{Res}(n(s)h+\tau(s))\|_{L_4}^4 ds|(Z_k)_{k \in \mathbb{N}}] \Big)^{1/4}
\\&
\leq
\Big(\mathbb{E}[\int_{0}^{t} \|\text{Res} (n(s)h)\|^4_{L^4} ds |(Z_k)_{k \in \mathbb{N}}] \Big)^{1/4}
+ \Big(\int_{0}^{t}\tau(s)^4 \|Au_{n(s)}\|_{L^4}^4 ds \Big)^{1/4}
\\&
+ \Big(\int_{0}^{t}\frac{\tau(s)^4}{h^4}\|d_{n(s)+1}\|^4_{L^4}ds \Big)^{1/4}
+ \Big(\int_{0}^{t}\|I(\tau(s))\|^4_{L^4}ds \Big)^{1/4}
\\&
+ \Big(\mathbb{E}[\int_{0}^{t}\|Z_{n(s)}(\tau(s))\|^4_{L^4} ds |(Z_k)_{k \in \mathbb{N}}\Big)^{1/4}
.
\end{split}$$ We now bound all the terms above separately. Let $m(t)$ be the largest integer, such that $m(t)h \leq t$. From Lemma \[lem:Resnh\] again by triangle inequality, we get $$\begin{split}
\Big(\mathbb{E}&[\int_{0}^{t} \|\text{Res}(n(s)h)\|_{L_4}^4 ds |(Z_k)_{k \in \mathbb{N}}] \Big)^{1/4}
\\& \leq \Big(\int_{0}^{t} \|\text{Res}^{\text{dat}}_{n(s)}\|_{L_4}^4 ds \Big)^{1/4}
+ \Big( \mathbb{E}\int_{0}^{t} \|\text{Res}^{\text{stoch}}_{n(s)}\|_{L_4}^4 ds \Big)^{1/4}
\\&
\leq \Big(h\sum_{n=1}^{m(t)} \|\text{Res}^{\text{dat}}_n\|_{L_4}^4 \Big)^{1/4}
+ \Big(h \sum_{n=1}^{m(t)} \mathbb{E}\|\text{Res}^{\text{stoch}}_n\|_{L_4}^4 \Big)^{1/4}
\\&
\leq
\Big(h\sum_{n=1}^{m(t)} \|\text{Res}^{\text{dat}}_n\|_{L_4}^4 \Big)^{1/4}
+ \Big(\frac{3hm(t)}{8\pi}\Big)^{1/4} \Big( \sum_{k>N} \frac{\alpha_k^2}{k^2} \Big)^{1/2}
\end{split}$$ where we used that $\text{Res}(0)=0$, so that all sums start at $n=1$.
For the next term $$\begin{split}
\Big(\int_{0}^{t}\tau(s)^4 \|Au_{n(s)}\|_{L^4}^4 ds \Big)^{1/4}
\leq &
\Big( \sum_{n=0}^{m(t)}\int_{nh}^{(n+1)h}\tau(s)^4 ds \|Au_{n}\|_{L^4}^4 ds \Big)^{1/4} \\
\leq &
\Big( \sum_{n=0}^{m(t)}\int_{0}^{h}s^4 ds \|Au_{n}\|_{L^4}^4 ds \Big)^{1/4} \\
\leq & \Big( \frac{h^5}{5} \sum_{n=0}^{m(t)} \|Au_{n}\|_{L^4}^4 ds \Big)^{1/4}
\end{split}$$ and similarly $$\Big(\int_{0}^{t}\frac{\tau(s)^4}{h^4}\|d_{n(s)+1}\|^4_{L^4}ds \Big)^{1/4}
\leq \Big( \frac{h}{5} \sum_{n=0}^{m(t)} \|d_{n+1}\|_{L^4}^4 ds \Big)^{1/4} \;.$$ For the integral-term $I$ by $$\begin{split}
\Big(\int_{0}^{t}\|I(\tau(s))\|^4_{L^4}ds \Big)^{1/4}
\leq \Big( h^2 \sum_{n=0}^{m(t)} \Big[
&
\frac12 \|u_n\|_{L^{12}}^3
+ \frac12 \|u_n\|_{L^{12}}^2\|d_{n+1}\|_{L^{12}}
\\&
+ \frac14 \|u_n\|_{L^{12}}\|d_{n+1}\|_{L^{12}}^2
+ \frac1{20} \|d_{n+1}\|_{L^{12}}^3
\Big] \Big)^{1/4} \;.
\end{split}$$ Finally for the Ornstein-Uhlenbeck bridge, we have from Lemma \[lem:boundN\] $$\Big(\mathbb{E}[\int_{0}^{t}\|Z_{n(s)}(\tau(s)) \|^4_{L^4} ds |(Z_k)_{k \in \mathbb{N} ] }\Big)^{1/4}
\leq \Big( h \sum_{n=0}^{m(t)} \mathcal{S}_h(Z_{n+1}-e^{hA}Z_n) ) \Big)^{1/4}\;.$$
Summarizing, we have the following bound:
\[thm:mainres\] With numerical data $\varphi$ from Section \[sec:defphi\] and the residual defined in we have for $t\in[mh,(m+1)h)$ and $m\in\{1,\ldots,M\}$ with $M=T/h$ $$\mathbb{E}[\int_{0}^{t} \|\text{Res}(s)\|_{L_4}^4 ds|(Z_k)_{k \in \mathbb{N}}]
\leq \mathcal{K}_m^4$$ with $$\begin{split}
\mathcal{K}_m =
&
\Big(h\sum_{n=1}^{m} \|\text{Res}^{\text{dat}}_n\|_{L_4}^4 \Big)^{1/4}
+ \Big(\frac{3mh}{8\pi}\Big)^{1/4} \Big( \sum_{k>N} \frac{\alpha_k^2}{k^2} \Big)^{1/2}
\\&
+ \Big( \frac{h^5}{5} \sum_{n=0}^{m} \|Au_{n}\|_{L^4}^4 ds \Big)^{1/4}
+ \Big(h \sum_{n=0}^{m} \mathcal{S}_h(Z_{n+1}-e^{hA}Z_n) \Big)^{1/4}
\\&
+ \Big( h^2 \sum_{n=0}^{m} \Big[
\frac12 \|u_n\|_{L^{12}}^3
+ \frac12 \|u_n\|_{L^{12}}^2\|d_{n+1}\|_{L^{12}}
\\& \qquad\qquad\qquad
+ \frac14 \|u_n\|_{L^{12}}\|d_{n+1}\|_{L^{12}}^2
+ \frac1{20} \|d_{n+1}\|_{L^{12}}^3
\Big] \Big)^{1/4}\;.
\end{split}$$
\[rem:mainres\] The quantity $\mathcal{K}_m$ is almost numerically computable using numerical data. Moreover, we can update the sums in the numerical computation, so that we do not need to calculate them in every step.
The only term that is not yet computable is the sum depending on the $\alpha_k$ for $k>N$, but here one can easily give an upper bound, once the $\alpha_k$ are given, by $$\sum_{k>N} \frac{\alpha_k^2}{k^2} \leq \sup_{k>N}\{\alpha_k^2\} \int_N^\infty k^{-2} dk = \frac{1}N \sup_{k>N}\{\alpha_k^2\}\;.$$
Let us also remark that due to the way we did the estimate, we cannot take the number $N$ of Fourier-modes arbitrarily large. Due to the regularity of the solution $u$, which is not in $H^2$, we cannot expect $\|Au_n\|$ to be bounded for $N\to\infty$. Thus we always need to take $h$ sufficiently small to balance that effect.
We expect that it is possible to give a precise estimate for the asymptotic limit $h\to 0$ and $N\to \infty$ of $h\|Au_n\|$, but here we intend to calculate this explicitly, in order to obtain a better bound without any estimate.
Approximating the error {#sec:App}
=======================
In this section, the arguments crucially depend on the properties of the equation especially on the nonlinear stability. The numerical data only comes into play via the residual. We need to quantify the continuous dependence of solutions on additive perturbations given by the residual. Recall the mild solution of (\[SPDE\]) $$u(t) =e^{At}u_\star+\int_{0}^{t}e^{A(t-s)}F(u(s))ds+ Z(t),$$ and the definition of the residual $$\varphi(t) = e^{At} \varphi(0) + \int_{0}^{t}e^{A(t-s)}F(\varphi(s))ds + Z(t) + \text{Res}(t)\;.$$ Therefore by putting $d(t)=u(t)-\varphi(t)$ we have $$d(t)=u(t)-\varphi(t) = e^{tA}d(0)
+\int_{0}^{t}e^{A(t-s)}(F(u(s)) - F(\varphi(s)))ds-\text{Res}(t)$$ with $d(0)= u_\star-\varphi(0)=Q_Nu_\star $.
Substituting $r =d +\text{Res}$ we obtain $$r(t) = e^{At}d(0) + \int_{0}^{t}e^{A(t-s)} [F(r(s)+\varphi(s)-\text{Res}(s))-F(\varphi(s))]ds,$$ which means $r$ is the solution of the following differential equation $$\partial_t r = Ar +F(r+\varphi-\text{Res})-F(\varphi).$$ Recall that $\text{Res}(0)= 0$ so $r(0)=d(0)=Q_Nu_\star$.
Now we use standard a-priori estimates for the equation for $r$. This yields good estimates, as both the linear part and the nonlinear part are stable, which simplifies the error estimate significantly. $$\label{e:ap}
\frac 12 \frac{\partial}{\partial t}\|r\|^2_{L_2}=\langle Ar,r \rangle-\langle(r+\varphi - \text{Res})^3 - \varphi^3,r\rangle.$$ The following lemma is necessary to bound the cubic. It is not optimal, but sufficient for our purposes.
\[lem:cubic\] For all $r,R,\varphi\in\mathbb{R}$ we have $$[-(r+R+\varphi)^3+\varphi^3]r \leq R^4+3R^2\varphi^2$$
First $$[-(r+R+\varphi)^3+\varphi^3]r = - 3 r \int_{\varphi}^{r+R+\varphi} \zeta^2 d\zeta = - 3 r \int_{0}^{r+R} (\zeta+\varphi)^2 d\zeta \;.$$ Thus the term is non-positive if $r$ and $r+R$ have the same sign (i.e., in the case $r,r+R\in[0,\infty)$ or $r,r+R\in(-\infty,0]$).
In the remaining two cases we have $|R|\leq|r|$, as for $r \leq 0\leq R+r$ we have $R\geq -r \geq 0$ and for $r+R \leq 0\leq r$ we have $0\leq r \leq -R$. Thus we obtain using $ab\leq a^2+\frac14 b^2$ $$\begin{split}
[-(r+R+\varphi)^3+\varphi^3]r =& -r^4-3r^3(R+\varphi)-3r^2(R+\varphi)^2-r[(R+\varphi)^3-\varphi^3]\\
&\leq -\frac34 r^2(R+\varphi)^2-r[(R+\varphi)^3-\varphi^3]\\
&= -\frac34 r^2(R+\varphi)^2 - rR^3 -3rR\varphi(R+\varphi)\\
&\leq - rR^3 +3 R^2\varphi^2\\
& \leq R^4 +3 R^2\varphi^2 \;.
\end{split}$$
Now by Lemma \[lem:cubic\] we obtain from
$$\frac{\partial}{\partial t} \|r\|^2_{L_2}
\leq 2\|\text{Res}\|_{L^4}^4 + 6 \|\text{Res}\|_{L^4}^2 \|\varphi\|_{L^4}^2,$$ and integration yields $$\|r(t) \|^2_{L_2}
\leq \|r(0)\|_{L^2}^2 + 2 \int_0^t\|\text{Res}\|_{L^4}^4 ds + 6\Big(\int_0^t \|\text{Res}\|_{L^4}^4 ds \Big)^{1/2}
\Big(\int_0^t \|\varphi\|_{L^4}^4 ds \Big)^{1/2}$$ From Theorem \[thm:mainres\] we can get the following bound for the error (by using Cauchy-Schwarz) in case $t\in[mh,(m+1)h]$ $$\mathbb{E}[\|r(t) \|^2_{L_2} |(Z_k)_{k\in\mathbb{N}}] \leq \|Q_N u_\star\|^2 + 2 (\mathcal{K}_m)^4
+ 6(\mathcal{K}_m)^2 \Big(\int_0^t \|\varphi\|_{L^4}^4 ds \Big)^{1/2}$$ In order to have a fully numerically computable quantity, we need to take care of the integral. We proceed similarly to $I(\tau)$ and use the equality $ \varphi(t) = u_{n(t)} + \tau(t) h^{-1} d_{n(s)+1}$ to obtain: $$\begin{split}
\int_0^t \|\varphi\|_{L^4}^4 ds
\leq & \int_0^t \| u_{n(s)} + \tau(s)h^{-1} d_{n(s)+1}\|_{L^4}^4 ds \\
= & \sum_{n=0}^{m(t)} \int_0^h \| u_{n(s)} + s h^{-1} d_{n(s)+1}\|_{L^4}^4 ds \\
\leq & h \sum_{n=0}^{m(t)} \Big[ \| u_{n}\|_{L^4}^4
+ 2\| u_{n}\|_{L^4}^3 \|d_{n+1}\|_{L^4}
+ 2\| u_{n}\|_{L^4}^2 \|d_{n+1}\|_{L^4}
\\ & \qquad\qquad
+ \| u_{n}\|_{L^4}^3 \|d_{n+1}\|^3_{L^4}+ \frac15\|d_{n+1}\|^4_{L^4} \Big] \\
\end{split}$$
\[thm:main\] Let $u$ be a mild solution of with initial condition $u_\star$, $\varphi$ the numerical approximation from Section \[sec:defphi\], and $\text{Res}$ the numerical approximation from . For $t\in[mh,(m+1)h)$ and $m\in\{1,\ldots,M\}$ with $M=T/h$ we have for the error $r=u-\varphi+\mathrm{Res}$ that $$\mathbb{E} \left[\|r(t) \|^2_{L_2}| (Z_k)_{k\in\mathbb{N}}\right]
\leq \|Q_N u_\star\|^2 + 2 (\mathcal{K}_m)^4
+ 6 (\mathcal{K}_m)^2 ( \mathcal{I}_m )^{1/2}$$ where the bound on the residual $\mathcal{K}_m$ was defined in Theorem \[thm:mainres\] and $$\begin{split}
\mathcal{I}_m =
h \sum_{n=0}^{m} \Big[ \| u_{n}\|_{L^4}^4
+ 2\| u_{n}\|_{L^4}^3 \|d_{n+1}\|_{L^4}
&+ 2\| u_{n}\|_{L^4}^2 \|d_{n+1}\|_{L^4}
\\ &
+ \| u_{n}\|_{L^4}^3 \|d_{n+1}\|^3_{L^4}+ \frac15\|d_{n+1}\|^4_{L^4} \Big]\end{split}$$.
As we expect $\mathcal{K}_m$ to be small, and the solution of the numerical scheme not, the third term should dominate in the error estimate. This is also confirmed in the numerical example.
Note that we usually neglect the error term coming from the initial condition by assuming that $Q_Nu_\star=0$. Anyway this can be made as small as we wish, by assuming that the initial condition is sufficiently smooth and choosing $N$ large.
Let us also remark that $r$ is not the error $d=u-\varphi$ we are interested in, but as we expect $\text{Res}$ to be small, we neglect this in the discussion of the numerical examples later.
Extensions of the Result {#sec:out}
========================
In this section we discuss a few possible generalizations of our result. As the precise bounds and constants (especially in the approximation result) depend heavily on the structure of the given equation, we presented only the Allen-Cahn equation as an example. Although may methods of the proof (especially the results for the residual) should be straightforwardly adapted to other equations.
**Stable polynomial nonlinearities:** These should be easy to treat with our results. The estimate for the residual only contains more terms, if the nonlinearity is of higher order. But due to the approximation result we have to change all the estimates to $L^{p+1}$ and thus to $L^{(p+1)p}$ if the nonlinearity is a polynomial of odd degree $p$, instead of $L^4$ and $L^{12}$ used for Allen-Cahn.
**Globally Lipschitz nonlinearities:** It is possible to adapt our result to this case, but it is not useful, as the analytic error estimate for the numerical approximation that are already available are quite good.
**General differential operators:** If they are diagonal w.r.t. the Fourier basis, then all estimates needed should be similar. But for general operators none of our estimates for the stochastic convolution and the Bridge process in between discretization points apply directly. These need to be rewritten in such a case.
**General noise:** This possible to treat for additive noise, but it should be more complicated. Various constants in our estimates are not that easy to compute explicitly for general noise. Moreover, the generation of $P_NZ(hk)$ is significantly more involved in the numerical scheme if the covariance of the noise is not diagonal in Fourier space. Thus we restrict ourself in the examples to space-time white noise.
Let us finally remark, that the analysis depends crucially on the spectral Galerkin approximation, that simplifies all estimates a lot. For other numerical methods like finite element methods, the results for the residual has to be rewritten completely. Nevertheless the approximation result in the end does not depend on the numerical method but only on the structure of the equation.
Numerical Experiments {#sec:Num}
=====================
For the numerical result we focus on space-time white noise of strength $1$, which means that all $\alpha_k=1$. Moreover, as both the linear part and the nonlinearity are stable, we expect the solution to be of order $1$ with rare events, where the solution is significantly larger. Nevertheless, we expect solutions to be quite rough.
Due to poor regularity properties, we do not expect the numerical approximation to be very accurate, but still we first tried a relatively poor discretization with $N=128$ Fourier-modes and time-steps $h=10^{-4}$ with a terminal time $T=1$. As expected this did not work that well, and the error is only a little bit smaller than the solution, see Figure \[fig:new\]. Thus we used in our example $$N=256\quad\text{and}\quad h=10^{-6}\;.$$ To simplify the example a little bit, we consider the initial condition $u_0=u_\star = \sin(x) $ so that the projection to the high modes $Q_Nu_\star=0$ vanishes, and we can neglect all error terms arising from the initial condition.
First in Figure \[fig:KM+Error\] we plotted the residual $\mathcal{K}_m^4$ for $m=1,\cdots,1/h$ together with the final error. As expected $\mathcal{K}_m^4$ is small and the error term from Theorem \[thm:main\] is bounded by the error term involving $\mathcal{K}_m^2$ and the numerical data.
In Figure \[fig:comparison\] we plot two terms of the residual $\mathcal{K}_m^4$ , for $m=1,\cdots,1/h$. One of the main terms in $\mathcal{K}_m^4$ which depends on the numerical data is $\text{Res}_n^{dat}$, therefore we plot $h\sum_{n=1}^{m}\|\text{Res}_n^{dat}\|_{L_4}^4 $ in Figure \[fig:Residual\] to see impact of these terms on the residual-bound $\mathcal{K}_m^4$, which seems to be negligible.
Moreover in Figure \[fig:OU-Bridge\] we plot $h \sum_{n=0}^{m} \mathcal{S}_h(Z_{n+1}-e^{hA}Z_n)$, i.e, the term in $\mathcal{K}_m^4$ which arises from the OU-bridge. By comparing Figure \[fig:Km\] and \[fig:OU-Bridge\] we can see the impact of the OU-bridge on $\mathcal{K}_m^4$. This gives a substantial, but not the most dominant term in $ \mathcal{K}_m^4$. We can also see that this error term is almost growing linear. The reason for this is that the part in $\mathcal{S}_h$ that depends on the numerical data $Z_n$ is quite small and the deterministic part of the estimate dominates, which bounds the fluctuations of the OU-bridge between the data points.
The final bound for the error $\mathbb{E} \left[\|r(mh) \|^2_{L_2}| (Z_k)_{k\in\mathbb{N}}\right]$ which is stated in Theorem \[thm:main\] is plotted in Figure \[fig:Average error\] for $10$ simulations. It confirms that the numerical approximation with $N=256$ and $h=10^{-6}$ works well, in contrast to the case $N=128$ and $h=10^{-4}$. See Figure \[fig:new\].
We also see in Figure \[fig:Average error\] and even better in Figure \[fig:new\] that the error is not growing with constant speed, but it has parts where it grows much faster. This effect is also very well visible in Figure \[fig:Residual\], although the effect there is too small to have an impact on $\mathcal{K}_m$. We conjecture that this might be a large deviation effect, that actually might not be that rare due to noise strength of order one.
Let us also point out that we do not expect to have a mean-square error bound without conditioning on the numerical data. Thus both in Figure \[fig:Average error\] and \[fig:new\] we expected a quite large variation for different realizations of the numerical approximation.
To see exactly the impact of each term in $\mathcal{K}_m$ we plotted its value in Figure \[fig:Km Terms\]. Also in Table \[t1\] values of each term at the final time $T=1$ is stated for $4$ simulations.
![$10$ simulations of our bound for $\mathbb{E} \Big(\|r(t)\|^2_{L_2} | (Z_k)_{k\in\mathbb{N}}\Big)$ for $N=256$ and $h=10^{-6}$.[]{data-label="fig:Average error"}](10Simerrornew.eps){width="4in"}
![$10$ simulations of our bound for $\mathbb{E} \Big(\|r(t)\|^2_{L_2} | (Z_k)_{k\in\mathbb{N}}\Big)$ for $N=128$ and $h=10^{-4}$. Only for small times the error estimate seems reasonable. Moreover, the data has quite a variance.[]{data-label="fig:new"}](10Simerror.eps){width="4in"}
![Values of the error terms for one realization $(a)\ \mathcal{K}_m$, $(b)\ \Big(h\sum_{n=1}^{m} \|\text{Res}^{\text{dat}}_n\|_{L_4}^4 \Big)^{1/4},$ $(c)\ \Big(\frac{3mh}{8\pi}\Big)^{1/4} \Big( \sum_{k>N} \frac{\alpha_k^2}{k^2}\Big)^{1/2},$ $(d)\ \Big( \frac{h^5}{5} \sum_{n=0}^{m} \|Au_{n}\|_{L^4}^4 \Big)^{1/4} $, $(e)\ \Big( h^2 \sum_{n=0}^{m} \Big[
\frac12 \|u_n\|_{L^{12}}^3
+ \cdots+ \frac1{20} \|d_{n+1}\|_{L^{12}}^3\Big]\Big)^{1/4}$, $(f)\ \Big(h \sum_{n=0}^{m} \mathcal{S}_h(Z_{n+1}-e^{hA}Z_n)\Big)^{1/4}$ []{data-label="fig:Km Terms"}](KmTermsnew.eps){width="5in"}
\[\]
$\mathcal{K}_m$ $ 0.1027$ $ 0.0996$ $0.1055$ $0.1085$
----------------- ------------ ----------- ----------- -----------
$E_1$ $0.0030$ $0.0012$ $0.0038$ $0.0076$
$E_2$ $ 0.0367$ $0.0367$ $0.0367$ $0.0367$
$E_3$ $0.0014$ $0.00141$ $0.0014$ $0.00141$
$E_4$ $0.0233$ $0.0220$ $ 0.0253$ $0.0246$
$E_5$ $0.03831$ $0.0383$ $0.03830$ $0.0383$
: Values of four simulations of $\mathcal{K}_m$ and each of it’s term at the final time $T=1$, i.e, $m=10^6$. The contribution of error at discretization points is $ E_1=\Big(h\sum_{n=1}^{m} \|\text{Res}^{\text{dat}}_n\|_{L_4}^4 \Big)^{1/4}$ for the part determined by the data and $E_2 = \Big(\frac{3mh}{8\pi}\Big)^{1/4} \Big( \sum_{k>N} \frac{\alpha_k^2}{k^2} \Big)^{1/2}$ for the stochastics on the high modes. The next two error terms $ E_3=\Big( \frac{h^5}{5} \sum_{n=0}^{m} \|Au_{n}\|_{L^4}^4 ds \Big)^{1/4} $ and $ E_4=\Big( h^2 \sum_{n=0}^{m} \Big[
\frac12 \|u_n\|_{L^{12}}^3
+ \cdots+ \frac1{20} \|d_{n+1}\|_{L^{12}}^3\Big] \Big)^{1/4}$ are data controlled terms for error that arises between discretization points. Finally $ E_5=\Big(h \sum_{n=0}^{m} \mathcal{S}_h(Z_{n+1}-e^{hA}Z_n)\Big)^{1/4}$ bounding the stochastic fluctuation in between discretization points is large, but not that large as we would expected it to be. []{data-label="t1"}
[00]{}
A. Alabert, I. Gyöngy, [*On numerical approximation of stochastic Burgers equation*]{}, From stochastic calculus to mathematical finance, Springer, Berlin, 2006, 1–15.
S. Bartels, [*A posteriori error analysis for time-dependent Ginzburg-Landau type equations*]{}, Numer. Math. 99 (2005), no. 4, 557-583.
S. Bartels, R. Müller, O. Christoph, [*Robust a priori and a posteriori error analysis for the approximation of Allen-Cahn and Ginzburg-Landau equations past topological changes*]{}, SIAM J. Numer. Anal. 49 (2011), no. 1, 110-134.
S. Becker, A. Jentzen, [*Strong convergence rates for nonlinearity-truncated Euler-type approximations of stochastic Ginzburg-Landau equations.*]{} ArXiv (2016).
D. Blömker, A. Jentzen, [*Galerkin Approximations for the Stochastic Burgers Equation*]{}, SIAM J. Numer. Anal. 51-1 (2013), 694-715.
D. Blömker, C. Nolde, J.C. Robinson, [*Rigorous Numerical Verification of Uniqueness and Smoothness in a Surface Growth Model*]{}, Journal of Mathematical Analysis and Applications 429(1):311–325, 2015.
D. Blömker, M. Romito, [*Stochastic PDEs and lack of regularity (A surface growth equation with noise: existence, uniqueness, and blow-up)*]{} Jahresbericht der Deutschen Mathematiker-Vereinigung, 117(4):233-286, 2015.
T. Butler, C. Dawson, T. Wildey, [*A posteriori error analysis of stochastic differential equations using polynomial chaos expansions*]{}, SIAM J. Sci. Comput. 33 (2011), no. 3, 1267–1291.
G. Da Prato, J. Zabczyk, [*Stochastic equations in infinite dimensions. 2nd ed.*]{}, vol. 152 of Encyclopedia of of Mathematics and its Applications. Cambridge University Press, Cambridge, (2014).
E.H. Georgoulis, C. Makridakis, [*On a posteriori error control for the Allen-Cahn problem,*]{} Math. Methods Appl. Sci. 37 (2014), no. 2, 173–179.
B. Goldys, B. Maslowski, [*The Ornstein–Uhlenbeck bridge and applications to Markov semigroups*]{} Stoch. Proc. Appl. (2008) 18(10), 1738-1767.
, [*Numerical approximations of stochastic differential equations with non-globally Lipschitz continuous coefficients*]{}, vol. 236, American Mathematical Society, 2015.
, [*Strong and weak divergence in finite time of euler’s method for stochastic differential equations with non-globally lipschitz continuous coefficients*]{}, in Proceedings of the Royal Society of London A: Mathematical, Physical and Engineering Sciences, vol. 467, The Royal Society, 2011, pp. 1563–1576.
A. Jentzen, P. Kloeden, G. Winkel, [*Efficient simulation of nonlinear parabolic Spdes with additive noise*]{}, Annals of Applied Probability. 21(3) (2011), 908–950.
E.A. Kalpinelli, N.E. Frangos, A.N. Yannacopoulos, [*Numerical methods for hyperbolic SPDEs: a Wiener chaos approach*]{}, Stoch. Partial Differ. Equ. Anal. Comput. 1 (2013), no. 4, 606–633.
P.E. Kloeden, G.J. Lord, A. Neuenkirch, T. Shardlow, [*The exponential integrator scheme for stochastic partial differential equations: Pathwise error bounds.*]{} J. Comput. Appl. Math. 235, No. 5, 1245.–1260 (2011).
G.J. Lord, C.E. Powell, T. Shardlow, [*An introduction to computational stochastic PDEs.*]{} Cambridge Texts in Applied Mathematics. Cambridge: Cambridge University Press, (2014).
C. Nolde, [*Global regularity and uniqueness of solutions in a surface growth model using rigorous a-posteriori methods.*]{} PhD-thesis, Universit'’at Augsburg, 2017.
K.-Y. Moon, E. von Schwerin, A. Szepessy, R. Tempone, [*An adaptive algorithm for ordinary, stochastic and partial differential equations.*]{} Recent advances in adaptive computation, 325–343, Contemp. Math., 383, Amer. Math. Soc., Providence, RI, 2005
R. Verfürth, [*A posteriori error estimation techniques for finite element methods,*]{} in “Numerical Mathematics and Scientific Computation.” Oxford University Press, Oxford, 2013.
X. Yang, Y. Duan, Y. Guo, [*A posteriori error estimates for finite element approximation of unsteady incompressible stochastic Navier-Stokes equations,*]{} SIAM J. Numer. Anal. 48 (2010), no. 4, 1579–1600.
X. Yang, R. Qi, Y. Duan, [*A posteriori analysis of finite element discretizations of stochastic partial differential delay equations.*]{} J. Difference Equ. Appl. 18 (2012), no. 10, 1649–1663.
[^1]: Institut für Mathematik Universität Augsburg, 86135 Augsburg, Germany, [e-mail:]{} dirk.bloemker@math.uni-augsburg.de
[^2]: Department of Mathematics, Faculty of Sciences, Razi University, Kermanshah, Iran
| null | minipile | NaturalLanguage | mit | null |
Shortsighted Move: City will regret it if Warren Street buildings are torn down
Frank Ordonez/The Post-Standard TOM QUARTIER, owner of the former WFBL radio station headquarters at 431-33 and 435-39 S. Warren St., has received permission from the city to tear the buildings down.
By Alan Oberst
I was very distressed to read in The Post-Standard about the proposal to demolish additional buildings on Warren Street downtown, especially given their history and noteworthy art deco style.
Syracuse needs to hang on to buildings like this a little longer, so they can be rehabilitated to be vibrant parts of the urban resurgence that is on the way in this new presidential administration, and with the stimulus package signed by the president. Just last month, as covered so well by Sean Kirst, an art deco building in downtown Syracuse -- the remarkable headquarters of National Grid -- played host to a statewide summit on the economics of reuse of older buildings of character, of which the buildings on Warren Street can serve as a textbook example.
A statewide push for the enactment of tax credits for just this purpose is under way and would also make an ideal target for federal stimulus funding. It would be tragic for Syracuse to lose these buildings just when help is on the way, especially as they are part of a striking collection of art deco buildings in the city.
I live in Rochester, and write about urban planning and historic preservation for a Buffalo publication. This year, I have been working on a consulting project in Syracuse and have been thoroughly enjoying getting to know your remarkable downtown. On my very first day, I was struck by the amount of density and historic building stock you have been able to retain in your downtown core. The result is intact block after intact block, and an interesting mix of architectural styles. I love the abundant foot traffic, and the active, street-level retail that has gone extinct in many other Upstate downtowns.
Although not on the same scale, there is a bite of the "Big Apple" in downtown Syracuse. In Rochester, by contrast, much of our downtown core was sacrificed to "urban renewal," a loss of architectural character and authenticity we still struggle to overcome. And in Buffalo, nearly half of the downtown core was sacrificed for parking, much of it on surface lots which "snaggletooth" the streetscape and depress, rather than enhance, the value of the remaining standing structures.
I urge Syracuse leaders to avoid these mistakes at all costs. Please do not allow money to be foolishly spent to remove buildings which, sooner than you think, you'll sorely regret losing. Instead, invest in the fight under way now at the state and federal levels to win the rehabilitation tax credits and stimulus funding which we need to make the numbers add up for reinvesting in our historic building stock.
The recent summit in Syracuse demonstrated conclusively that preservation-minded architects and developers are chomping at the bit to restore and reuse older buildings all over Upstate, if the funding gap can be filled. These projects would immediately add people to payrolls, and inject tax revenues into cash-strapped local governments -- not to mention giving economically distressed communities a boost with visible evidence of renewal.
Leave your fair city a legacy of a vibrant, intact, downtown core -- and exciting projects like Franklin Square and Armory Square -- and spare yourselves the legacy of regret felt in Rochester and Buffalo over shortsighted demolitions. Use your leadership to save your own city's buildings, and, indirectly, help save ours. | null | minipile | NaturalLanguage | mit | null |
1. Field of the Invention
The present invention relates to an ultrasonic receiving apparatus for receiving ultrasonic waves, and further to an ultrasonic imaging apparatus to be used for medical diagnosis or nondestructive inspection by receiving ultrasonic waves using such an ultrasonic receiving apparatus.
2. Description of a Related Art
Conventionally, in an ultrasonic imaging apparatus, generally a one-dimensional sensor array using a piezoelectric element including a piezoelectric ceramic represented by PZT (Pb (lead) zirconate titanate) or a macromolecule piezoelectric element such as PVDF (polyvinyl difluoride) has been used as an element (vibrator) for transmitting and receiving ultrasonic waves. Two-dimensional images in plural cross sections of an object to be inspected are obtained while mechanically shifting a one-dimensional sensor array as described above, and further, by synthesizing these two-dimensional images, a three-dimensional image is obtained.
However, according to this technique, since a time lag is generated in the shifting direction of the one-dimensional sensor array, cross-sectional images at different time points are synthesized resulting in a blurred synthesized image. Accordingly, the technique is not suitable to such a case where images of a living organism as an object are taken in ultrasonic echo observation or the like.
In order to obtain high quality three-dimensional images using ultrasonic waves, a two-dimensional sensor capable of obtaining two-dimensional images without shifting the sensor array is required.
However, although minute processing on elements and wiring to a number of minute elements are required in the case where the two-dimensional sensor array is manufactured using the above-described PZT or PVDF, further miniaturization and integration of elements exceeding the state of the art are difficult. Also, even when the above-described problems are solved, such problems still remain that the cross talk between elements is increased, the SN-ratio is lowered due to increase of electrical impedance caused from minute wirings, electrodes of minute elements get damaged easily, and so on. Therefore, it is difficult to achieve the two-dimensional sensor array using the PZT or the PVDF.
On the other hand, another type of sensor is also known, in which received ultrasonic wave signal is converted into an optical signal and then detected. As for a photo-detection type ultrasonic sensor, a sensor in which a fiber Bragg grating (abbreviated as FBG) is used (see TAKAHASHI et al., National Defense Academy xe2x80x9cUnderwater Acoustic Sensor with Fiber Bragg Gratingxe2x80x9d, OPTICAL REVIEW Vol. 4, No. 6 (1997) p. 691-694), and a sensor in which a Fabry-Perot resonator (abbreviated as FPR) structure is used (see UNO et al., Tokyo Institute of Technology xe2x80x9cFabrication and Performance of a Fiber Optic Micro-Probe for Megahertz Ultrasonic Field Measurementxe2x80x9d, T.IEE Japan, Vol. 118-E, No. 11, ""98) are reported. When a two-dimensional sensor array is manufactured by using an ultrasonic sensor as described above, the following advantages can be obtained, that is, electrical wiring to a number of minute elements is not required and satisfactory sensitivity is obtained.
Further, a photo-detection type ultrasonic sensor having a two-dimensional detection surface is also known. For example, Beard et al., University College London xe2x80x9cTransduction Mechanisms of the Fabry-Perot Polymer Film Sensing Concept for Wideband Ultrasound Detectionxe2x80x9d, IEEE TRANSACTIONS ON ULTRASONICS, FERROELECTRICS, AND FREQUENCY CONTROL, VOL. 46, NO. 6, NOVEMBER 1999 discloses that a polymer film having a Fabry-Perot structure is used for detecting ultrasonic waves. In a film-like ultrasonic sensor as described above, the cost can be reduced since processing on a number of minute elements is not required.
However, the photo-detection type ultrasonic sensor has the following problem, that is, multiple reflection of an ultrasonic wave is generated on a backside of the ultrasonic wave receiving surface.
Herein, taking a photo-detection type two-dimensional plane sensor as an example, the multiple reflection of an ultrasonic wave will be explained. As shown in FIG. 15, an ultrasonic detecting element 100 includes a substrate 101 and an ultrasonic sensing portion 102. In this example, the ultrasonic sensing portion 102 has a Fabry-Perot resonator structure including a total reflection mirror 103, a half mirror 104 and a cavity 105 being formed between the total reflection mirror 103 and the half mirror 104. The member forming the cavity 105 is subjected to a geometrical displacement by being applied with an ultrasonic wave.
While allowing light to enter into the ultrasonic detecting element 100 from the substrate 101 side, an ultrasonic wave is applied to a receiving surface 102a of the ultrasonic detecting element 100. Then, owing to the acoustic pressure changes of the ultrasonic wave, the optical path length L of the cavity 105 changes in accordance with the position of the receiving surface 102a, and the light intensity reflected from the ultrasonic sensing portion 102 changes corresponding to the position thereof. By converting the intensity of the reflected light into the intensity of the ultrasonic wave, the intensity of the ultrasonic wave, which corresponds to the position of the receiving surface 102a, can be detected.
Referring to FIGS. 16 and 17A, the ultrasonic wave propagating from medium and containing information concerning an object to be inspected generates vibration at a point A, and propagates into the inside of the ultrasonic detecting element 100 (ultrasonic wave US1). Then, the ultrasonic wave US1 is reflected at a point B of an interface on the opposite side of receiving surface 102a. At this moment, the ultrasonic wave US1 generates vibration at the point B and returns toward the direction of the receiving surface 102a (ultrasonic wave US2). Further, the ultrasonic wave US2 is reflected at the receiving surface 102a. At this moment, the ultrasonic wave US2 generates vibration at a point C and propagates again to the rear surface of the receiving surface 102a (ultrasonic wave US3). Thus, in the ultrasonic detecting element 100, the reflection is repeated until the propagated ultrasonic wave fades away. Owing to this phenomenon, as shown in FIG. 17B, the signal from the ultrasonic detecting element 100 is mixed with signals generated through the multiple reflection (detection signals at the points C and E) in addition to the signal concerning the object to be inspected (a detection signal at the point A) that is to be normally detected.
The above described multiple reflection of the ultrasonic wave becomes a cause to decrease the SN-ratio in the ultrasonic image, resulting in a decreased image quality. Accordingly, for example, in an ultrasonic receiving apparatus that uses piezoelectric element for transmitting and receiving ultrasonic waves, the ultrasonic wave is attenuated by connecting a backing material including a ferrite core or the like to a piezoelectric element. However, in the photo-detection type ultrasonic receiving apparatus, since it is necessary to take the optical transmissibility into consideration, the backing material same as that of conventional manner can not be used.
The present invention has been achieved in view of the above-described problems. An object of the present invention is, in a photo-detection type ultrasonic receiving apparatus, to increase the quality of the ultrasonic image by reducing the multiple reflection of the ultrasonic wave. A further object of the present invention is to provide an ultrasonic imaging apparatus to be used for medical diagnosis or nondestructive inspection by receiving ultrasonic waves using such an ultrasonic receiving apparatus.
In order to solve the above-described problems, an ultrasonic receiving apparatus according to a first aspect of the present invention comprises an ultrasonic detecting element for modulating light on the basis of a received ultrasonic wave; a backing portion, directly or indirectly connected to the ultrasonic detecting element, for propagating the ultrasonic wave received by the ultrasonic detecting element, the backing portion having optical transmissibility and guiding the light used for detecting the ultrasonic wave; and a photoelectric conversion unit for detecting the light output from the ultrasonic detecting element.
Further, an ultrasonic receiving apparatus according to a second aspect of the present invention comprises an ultrasonic detecting element including an ultrasonic sensing portion which is expanded and contracted by a received ultrasonic wave to change an optical reflectance in accordance with expansion and contraction thereby performing intensity modulation of incident light; an optical transmission path for guiding the light to the ultrasonic detecting element and propagating the ultrasonic wave received by the ultrasonic detecting element; a collimating portion for collimating the light guided by the optical transmission path with respect to the ultrasonic detecting element; and a photoelectric conversion unit for detecting the light reflected from the ultrasonic detecting element.
An ultrasonic imaging apparatus according to a first aspect of the present invention comprises an ultrasonic transmitting unit for transmitting an ultrasonic wave in accordance with a drive signal; a drive signal generating circuit for generating the drive signal to be applied to the ultrasonic transmitting unit; an ultrasonic detecting element for modulating light on the basis of a received ultrasonic wave; a backing portion, directly or indirectly connected to the ultrasonic detecting element, for propagating the ultrasonic wave received by the ultrasonic detecting element, the backing portion having optical transmissibility and guiding the light used for detecting the ultrasonic wave; and a photoelectric conversion unit for detecting the light output from the ultrasonic detecting element.
Further, an ultrasonic imaging apparatus according to a second aspect of the present invention comprises an ultrasonic transmitting unit for transmitting an ultrasonic wave in accordance with a drive signal; a drive signal generating circuit for generating the drive signal to be applied to the ultrasonic transmitting unit; an ultrasonic detecting element including an ultrasonic sensing portion which is expanded and contracted by a received ultrasonic wave to change an optical reflectance in accordance with expansion and contraction thereby performing intensity modulation of incident light; an optical transmission path for guiding the light to the ultrasonic detecting element and propagating the ultrasonic wave received by the ultrasonic detecting element; a collimating portion for collimating the light guided by the optical transmission path with respect to the ultrasonic detecting element; and a photoelectric conversion unit for detecting the light reflected from the ultrasonic detecting element.
According to the first aspect of the present invention, since the ultrasonic wave is attenuated by propagating the received ultrasonic wave to the backing portion, it is possible to avoid the influence due to the multiple reflection of the ultrasonic wave. Also, since the light used for detection is guided by the backing portion having an optical transmissibility, it is possible to reduce the attenuation of the optical signal output from the ultrasonic detecting element and to guide the optical signal to the photoelectric conversion unit without decreasing the SN-ratio.
According to the second aspect of the present invention, it is possible to avoid the influence due to the multiple reflection of the ultrasonic wave by propagating the received ultrasonic wave to the optical transmission path for guiding the light to the ultrasonic detecting element. Also, since the ultrasonic detecting element and the optical transmission path are connected via collimating portion, it is possible to guide the parallel light to the ultrasonic detecting element and to propagate the ultrasonic wave to the optical transmission path such as an optical fiber. | null | minipile | NaturalLanguage | mit | null |
Foreign Corrupt Practices Act
The Department of Justice (DOJ) and the Securities and Exchange Commission (SEC) aggressively investigate and litigate under the Foreign Corrupt Practices Act (FCPA). Any individual or company that engages in overseas business is a potential target under this liberally-interpreted law that penalizes the alleged bribery of foreign officials. Such activity often arises in conjunction with other alleged crimes, including white collar charges, RICO and COCCA charges, and Bank Secrecy Act/anti-money laundering (BSA/AML) crimes.
The Eichner Law Firm has diverse experience in issues where the FCPA plays a role. Internationally, the firm has handled violations enforced by the U.S. Department of the Treasury’s Office of Foreign Assets Control (OFAC) involving illegal exports to foreign countries. Our firm not only handles responses to charges, but we also help individuals and companies avoid violations in the first place through our Internal Compliance Investigations practice area, helping clients implement appropriate anti-bribery and anti-corruption compliance policies, procedures, and controls.
The Eichner Law Firm is uniquely positioned to assist companies and individuals in responding to federal inquiries, examinations, and subpoenas. Our attorneys have built relationships with federal agencies, including the FBI, IRS, and SEC, and also have deep experience in pretrial negotiation, which can prevent a costly trial. Our investigators are not only skilled at comprehensive intelligence gathering, but we also boast David Riordon, a former special agent with the IRS tasked with specifically complex accounting irregularities. The Eichner Law Firm has the necessary team to handle any FCPA charge, including any other related criminal charges that may be brought. | null | minipile | NaturalLanguage | mit | null |
I tried calling you, but your voice mail wasn't working. Please give me a
call back when you have a chance. 3-5536 and ask for me.
Thanks,
Danielle Stephens
Information Risk Management
Enron Net Works
713-345-3238 | null | minipile | NaturalLanguage | mit | null |
Happy new year to everyone in the Bitcoin Cash community! 2019 was a good year for Bitcoin Cash and I'm looking forward to an amazing 2020.
Overall, I think the Bitcoin Cash community should keep their nose to the grindstone, and focus on building and adoption. Our real competition is the US dollar and other fiat currencies. BTC and the Lightning Network are a distraction and will fail on their own.
That said, I have a few additional thoughts on the Lightning Network. My hope is by documenting these in an article now, it will free up mental resources for 2020. If the questions come up, we can simply point to this article and not waste time arguing with shills and trolls.
I have already written five previous articles debunking and criticizing the Lightning Network (1, 2, 3, 4, 5). So why one more?
My earliest articles accurately predicted that LN would centralize into a hub-and-spoke network. This is the only way it can scale, mathematically. Despite all the noise from the trolls, my predictions have already proven to be true.
But the goalposts have already moved. LN is now more widely recognized as the hub-and-spoke model that it is, but proponents still make the claim that it doesn't matter in terms of permissionless, uncensorable money. Their argument is that you can "route around" any Lightning hub that would attempt to censor you.
As I've explained in the previous articles, the big difference between the normal Bitcoin system and Lightning is that ANY miner can put your transaction in a block, whereas with LN, if you want to route around a hub, you'd have to close the channel with them and open a new one with a different hub. This requires an on-chain transaction, which is the very thing that LN tries to avoid.
But let's play devil's advocate and jump to the next logical counter-argument that LN proponents would make. They would say that even if it costs money to switch hubs, game theory would prevent hubs from becoming censors in the first place, since no one would use those hubs.
There's 2 main holes in this argument.
First, hubs will not actually lose business by offering more permissioned solutions. In the BTC-maximalist utopia, everyone is using BTC, but that would necessitate huge fees to make an on-chain transaction. Thus most ordinary people will not even get to touch the base layer. They would be onboarded onto Lightning not by making a BTC transaction, but by signing up for a service. In order to exchange their fiat money for bitcoin-backed Lightning, they would have to go through AML/KYC procedures just like you would do today if you were using an exchange.
AML/KYC on-ramps are a necessary evil today, but at least once you get your money into crypto, you can move around as you please. But this wouldn't be the case on Lightning if the hub can control where you send your money (exchanges already do this today), and it is cost prohibitive to withdraw your funds to the actual blockchain.
But for the sake of argument, even if we imagine that everyone could afford to pay the base layer fee and onboard themselves, we know that most people will trade some amount of privacy for convenience . It is easy to imagine that large hubs could offer perks for good minions that follow whatever policies the hub wants.
The beauty of the Bitcoin system (without Lightning) is that not only is it free to "switch miners", it's also completely automatic. If a miner doesn't include your transaction in a block, and you do absolutely nothing about it, it will just sit in the mempool until another miner picks it up.
Even if there was 0 cost to on-chain transactions, the fact that you have to do anything at all in Lightning to "route around" a hub, makes the system much more conducive to incrementalism, the trading of sovereignty for convenience, and the erosion of permissionless spending.
The second general reason by which "hubs won't censor" is false, is that there is an entirely different set of "rules" that govern the behavior of cartels in Bitcoin mining vs. Lightning.
Mining pools can behave like a cartel, but hashrate providers can easily switch pools. Although pools are powerful, their power comes from network effect, first mover advantage, and so on. The actual hashing power is provided to them by their customers, who are widely distributed.
By contrast, with Lightning, the power of a large hub is from the liquidity they control, which requires owning a lot of money. This cannot be outsourced. Thus, hubs are powerful simply because they are the big fish. And when a group of the big fish form a cartel in this system, there is nothing to "shake them up" that's analogous to hashrate providers switching pools.
A large cartel in Lightning can force users to comply with whatever rules they want, since users rely on them for liquidity. An important caveat here is that a 51%+ cartel of miners can also do this, IF they are willing to reorg blocks and become a monopoly. However, reorgs are generally viewed as malicious already, and they are harder to do because of the fact we just mentioned: that hashrate can switch pools.
Using the lightning network to scale bitcoin has always been a broken idea. Users should educate themselves on why this is so, but then they should avoid wasting too much debating it. Instead, we should focus efforts our on building permissionless peer-to-peer cash for the world. | null | minipile | NaturalLanguage | mit | null |
Father’s Day Guest Columnist Bud Hanley: Dear Matthew, You Are Our Son And You Will Never Be Forgotten: Part 4
Bud Hanley, a registered financial planner, lives with Joy, his wife of 18 years, and their children, Lauren, 11, and Andrew, 6, in Honea Path, South Carolina. The Hanleys, owners of Legacy Financial Group, Inc., a financial and tax planning firm, are active in church and enjoy fishing in a backyard pond with their kids. They lost their son, Matthew, then an infant born prematurely, in 2002, and founded Matthew’s Hope Children’s Ministry the next year in his memory. The charity helps underprivileged children at Christmas and throughout the year, and also offers scholarships to deserving students. Bud has long written letters to all of his kids.
Tomorrow, Bud will share the last of his letters to Matthew. “I promised Matthew as he died in my arms that I would work hard to cause good to come to other people because he lived and that I would use every opportunity God gave me to share His goodness,” Bud says. For further details about Matthew’s Hope, you can reach Bud at budhanley@att.net.
My Matthew,
Today is Saturday and I have experienced a parent’s worst nightmare. I had to bury you today.
On Wednesday, December 18, 2002, your Mommy and I went to NYU Medical Center at 6:30 to begin what would be the hardest day of our lives. It began with Mommy waking up around 5:00 with a temperature of 100.6. Dr. Young had told us that if her temperature was 100.4 or more, he wouldn’t do the procedure.
Mommy was determined to get you all the help she could, so she took two Tylenol and took a cold bath to lower her temperature before we got the hospital at 6:30 . . . When we arrived at the hospital . . . Mommy even put the thermometer on top of her tongue to keep Dr. Young from knowing she had a temperature. Around 7:30, they came for your Mommy to take her down to the operating room. My wait began.
Around 8:30, they brought her back to monitor her One of the nurses touched her and knew she was warm . . . She was having some contractions. Fear struck both of us. We just knew that Dr. Young would cancel the procedure. We had come so far and it sickened us to think that after all we had overcome, we wouldn’t get the help we so desperately wanted for you . . .
After 45 minutes of monitoring, the contractions stopped . . . so at 9:45, they took her back to the operating room again and began the procedure . . . One hour passed, then two. After the third hour passed, I began to get worried.
Then at around 1:00, I received word that the procedure and recovery was over and that I could see her. When I arrived, she was still very groggy and she was complaining of severe pain in her left hip . . . Dr. Young had told us to expect some contractions due to the procedure, so when they started, we weren’t worried about it. This continued, getting progressively worse . . . very painful and more frequent. I realized that my worst fears were coming true.
By 3:00, Mommy was in full-blown labor and we knew that you were coming. I began to pray like I’ve never prayed before . . . By 3:30, we were whisked into the operating room and the miraculous process of preparing for you began. They not only had to prepare the room for your birth, but also a neonatal team had to be assembled to care for you immediately after birth. There had to be 20 or more people there awaiting your arrival.
At 3:44, you were born. Your tiny body emerged from a breech position. The team of doctors desperately began to work with you. As they worked with you, you pee-peed and pooped. This was encouraging to the doctors and to us.
They then took you up to the neonatal intensive care unit and continued to work with you. Mommy had already instructed me to leave her and stay with you wherever they took you and I promised her I would. But they wouldn’t allow me to go with you. They said they would need an hour or so to get you stabilized and get everything done to help you. I reluctantly consented and waited with Mommy . . .
Finally, about 5:00 they came and told us we could see you before they did the next round of x-rays and procedures to check your lung development. When we saw you in the NIC unit, we both cried our hearts out. You were so very tiny and you were having to go through so much to try and live. Your Daddy’s heart was shattered. I would have gladly accepted everything you had to endure if I could have. We spent only a few minutes with you and then we had to leave so they could continue to help you. We returned to the room to wait some more.
Finally about 10:00, Dr. Edith McCarthy, the neonatologist who was in charge of your care came to our room. Her face clearly showed that she was about to give us bad news . , , Until then, I hadn’t even entertained for one second the possibility that you would be anything but fine . . .
As Dr. McCarthy began to speak . . . she told us that there was not enough oxygen getting to your brain and other organs and that the chest x-rays revealed that your little lungs had not developed. She told us that there was only one other thing they could try. It was a high-speed ventilator that may help and it may not. She told us that, due to the high speed, it could violently shake you and could cause bleeding in the brain.
I could not do it.
That’s where we had to stop and leave it all to God.
Mommy and I had to make the decision that no parent should ever have to make. We had to remove the ventilator that was keeping you alive. At around 11:00, we went down to the NIC unit and Dr. McCarthy arranged for a private room for us to be able to hold you and spend some time with you. She had prepared us, saying that you would likely only live a few minutes. They brought you to us and we held you and cuddled you. We talked to you and told you we were with you and that we loved you. We called Papa and Nana, Papa and Grandma and Great Granny. They all spoke their love to you.
I believe you heard them.
As your Papa cried and prayed, he begged God to take his life right then and spare yours. As I heard him pray, I knew that that was a prayer that only a parent could pray. I felt so sorry for all of your grandparents . . . After everyone had spoken to you, I held you close to my face and wept. As I walked with you and rocked you in my arms, I told you how much you meant to me and how I loved you. I told you that it was okay to stop fighting. I was speaking words to my only son that I never dreamed I was capable of speaking . . .
I held you as you left this world.
I believe God allowed you to hear us and you somehow knew of our deep love for you . . . Looking back now, I know we could never have endured the pain without the presence of God in that room . . . | null | minipile | NaturalLanguage | mit | null |
Wheelchairs generally include a seat assembly mounted to a wheelchair frame and two armrests positioned adjacent to and on opposing sides of the seat. These armrests generally provide the occupant support during ingress and egress from the wheelchair, as well as providing comfort and convenience for the occupant by furnishing a fixture upon which they may rest their arms and shift their weight while seated in the wheelchair.
Typically, an armrest includes a generally horizontal frame with an armrest pad supported thereatop, and a pair of spaced-apart armrest posts (i.e., front and rear) extend downwardly from opposite ends of the horizontal frame. Each post is oriented in a substantially vertical manner for ease of mounting, and height adjustment, relative to wheelchair main frame. The wheelchair main frame usually includes a pair of spaced-apart upwardly extending receiving tubes each providing a post receiving bore dimensioned to slidably and telescopically receive the distal ends of the corresponding armrest post portions. Generally, these two-post designs provide more lateral support and stability than a single-post armrest assembly, which are also used in the industry.
While two-post armrests provide adequate mounting stability and support, several problems are inherent. For example, due to RESNA regulations, both the front and rear posts must be securely locked to the wheelchair frame. Such securement is generally accomplished by providing separate manually operable latch mechanisms to releasably latch the respective posts to the wheelchair frame. For those severely impaired persons or those of limited dexterity, manual actuation of the rear latch assembly is often difficult or physically impossible from the seated position.
The front latching mechanism for the front post is generally accessible for operation thereof by the wheelchair occupant. The rear latching mechanism, however, is typically situated behind the seating system rearward of the occupant's shoulders. Moreover, the rear latch mechanism is often obstructed by the wheelchair rear wheel. Accordingly, this arrangement severely increases the difficulty of unlatching the rear latching device and/or removing the armrest from the seated position.
Further, physically impaired persons may encounter difficulty aligning the two posts with the receiving bores when attempting to install the armrest to the wheelchair frame. Often, the posts are slightly skewed which offsets the alignment with the bores.
Moreover, when attempting to adjust the height or remove the armrest from the main frame receiving bores, those with limited physical capabilities may be unable to telescopically extend or retract both of the front and rear posts simultaneously into or out of the corresponding post receiving bores in a smooth, even, unskewed manner. Skewing during adjustment causes the posts to lodge or jam in the corresponding receiving bores, and prevent removal. | null | minipile | NaturalLanguage | mit | null |
Sustainability
& Innovation
Successful innovations
Recticel aims to be the leading global provider of high value added comfort solutions in all its core markets. Our focus is on supporting key worldwide trends such as environment protection, energy conservation, aging and increasing population and water management.
We are proud of our past accomplishments, such as the development of rigid foam applied in high performance thermal insulation panels, and flexible foam developments resulting in comfortable and ergonomic seating and sleeping products. By further coordinating our R&D with important societal challenges, we will maintain our ability to develop products and applications with a positive impact on society. For example:
In our Insulation business line, we have introduced several new products, including a higher performance product with an insulation factor (Lambda) reaching 0.019 W/mK. This new generation of PU boards, developed with Xentro® technology, offers a 13% improvement in thermal insulation and creates important savings in living space.
In March 2017, we introduced our first fiber-bonded foam application for the do-it-yourself market: Simfofit® is an acoustic insulation panel that reduces sound by up to 12dB. In February 2018 we introduced Silentpart®, an acoustic insulation panel for use in systems or lightweight partition walls. Both are made from the production waste of our Flexible Foams plants.
For our Bedding business line, we created an innovative new product branded as GELTEX® inside. It is our division’s largest and most important innovation of the last decade in its application area. The product differentiates itself through a combination of optimal pressure distribution, ideal support and maximum permeability/climate control properties. The development of the GELTEX® inside brand has translated into effective and growing sales.
In January 2018, Recticel launched the new Geltex® foam with CO2polyol on the Cologne IMM trade fair, thus further supporting the introduction of new sustainable technologies in our bedding products.
In our Flexible Foams business line, we have introduced a new generation of acoustic foams. As a result, our Technical Foams division won new contracts for SpaceX Inc., which designs, manufactures and launches advanced rockets and spacecraft. We also developed a new comfort foam, angelpearl®, for our third-party bedding customers.
In our Automotive business line, we have been marketing an important innovation since 2013. The product is branded under the name Colo-Sense® Lite. It is a high-performance skin for automotive interiors applications that enables a weight reduction of 25% in response to OEMs’ constant search for lighter products. The product is not only lighter, but has premium optic and haptic characteristics, with the same quality and durability properties as its predecessor, Colo-Fast®. This innovation has attracted the attention of several premium OEMs and resulted in a series of new contracts.
At the same time, the Colo-Sense® X Lite project was kicked off in our Sustainable Innovation Department as a successor to Colo-Sense® Lite. Compared to Colo-Sense® Lite, it offers up to 20% weight reduction by using less material, up to 50% VOC emission reduction for compliance with the most stringent industry requirements and futher improved flexibility of the material making it less sensitive to deformation, an important logistics advantage thanks to more efficient stacking and optimised transport conditions.
We use cookies to ensure that we give you the best experience on our website. These cookies perform functions like recognizing you each time you visit the site or helping our team to understand which parts of the site you find most interesting and useful. You can read more about the cookies that we use and their purposes.
You are now leaving the Recticel website
Welcome to the website of Recticel
Recticel Cookie Statement
Recticel uses cookies to make your browsing experience easier and more enjoyable and to better match the content of its websites and apps to your needs and preferences. You can choose to block cookies, but some of our websites and (mobile) applications may not work optimally without them. By clicking 'Accept', you explicitly consent to the use of cookies in accordance with this cookie statement. You can revoke your permission at any time by adjusting your cookie settings in your browser.
For more information see the Recticel Privacy Notice, which contains information about your rights if your personal data, including use of cookies, is processed. | null | minipile | NaturalLanguage | mit | null |
Camaragibe River
Camaragibe River is a river in Alagoas state in eastern Brazil. It flows into the Atlantic Ocean in Passo de Camaragibe municipality.
See also
List of rivers of Alagoas
References
Brazilian Ministry of Transport
Category:Rivers of Alagoas | null | minipile | NaturalLanguage | mit | null |
[Debatable questions in the surgical treatment of thoracic aortic aneurysms].
Some controversies in the surgical approach to thoracic aortic aneurysms are discussed. The author recommends: to perform echocardiography in patients with aortic aneurysms for detection of intracardiac pathology which may complicate the postoperative course; to combine thoracic aortography with selective coronary angiography in patients with thoracic aortic aneurysm for diagnosis of coronary artery disease; to operate asymptomatic fusiform aneurysm that measure twice or more the size of the normal aorta; to resect and replace dissections of the ascending aorta during cardio-pulmonary bypass; and to use active shunts during resection of the descending and thoraco-abdominal aneurysm. | null | minipile | NaturalLanguage | mit | null |
Written By BiharWatch on Tuesday, July 15, 2008 | 6:33 AM
On 9th July 2008, the IAEA Secretariat circulated the draft of an Agreement with the Government of India for the Application of Safeguards to Civilian Nuclear Facilities to Members of the International Atomic Energy Agency (IAEA) Board of Governors for their consideration. This was done at the request of the Government of India.
The Chairman of the Board is consulting with Board Members to agree on a date for a Board meeting when the Agreement would be considered.
About the IAEA
The International Atomic Energy Agency (IAEA) serves as the world's foremost intergovernmental forum for scientific and technical co-operation in the peaceful use of nuclear technology. Established as an autonomous organization under the United Nations (UN) in 1957, the IAEA carries out programmes to maximize the useful contribution of nuclear technology to society while verifying its peaceful use.
Dr Manmohan SIngh's statement in the Lok Sabha on Civil Nuclear Energy Cooperation with the United States
August 13, 2007New Delhi
Excerpts of the Prime Minister's statement - this is a preliminary transcript that is yet to be corrected and matched with the official transcription from the Lok Sabha.
I rise to inform this august House that the Government of India has reached agreement with the Government of the United States of America on the text of the bilateral Agreement on Cooperation for Peaceful Uses of Nuclear Energy.
2. This Government has kept Parliament fully in the picture at various stages of our negotiations with the United States. We have never shied away from a full discussion in Parliament on this important issue. I have myself made statements on several previous occasions – on July 29, 2005 soon after my return from Washington; on February 27, 2006 during which I took Parliament into confidence regarding our ongoing discussions with the United States on the Separation Plan; and on March 7, 2006 following the visit of President Bush to India. I also made a detailed statement in the Rajya Sabha on August 17, 2006 conveying certain solemn commitments to which I shall return shortly.
Our Government has adhered scrupulously to Parliamentary traditions and practices. We have in fact gone far beyond any previous Government.
3. After the conclusion of the Agreement we have also briefed many of the parties represented in Parliament on the details of the Agreement.
4. The Agreement is about civil nuclear energy cooperation. It is an Agreement between two States possessing advanced nuclear technologies, both parties having the same benefits and advantages. The significance of the Agreement lies in the fact that when brought into effect, it will open the way for full civil nuclear energy cooperation between India and the United States. We have negotiated this Agreement as an equal partner, precisely because of the achievements of our scientists and technologists in overcoming the barriers placed around us in the past. This is an Agreement based on the principle of mutual benefit.
5. There has been considerable public debate and discussion on various aspects of the Agreement. On August 17, 2006, I had given a solemn commitment to Parliament and to the country regarding what we can agree and cannot agree with the United States to enable civil nuclear energy cooperation with India. I had stressed that it must be within specific parameters, which I had shared with Parliament. This was an unprecedented measure of transparency on our part even in the midst of complex negotiations.
6. I had given Parliament my assurance that the Government will make every effort so that the vision of the Joint Statements of July, 2005 and March, 2006 becomes a living reality. I believe that we have redeemed that pledge. In concluding this Agreement, we have ensured that the autonomy of our strategic programme is fully maintained, and that Dr. Homi Bhabha’s long-term vision remains our guiding principle.
7. With your permission, I wish to draw the attention of this august House to the main features of the Agreement in some detail. It would become evident that the commitments I had made to Parliament, including those on August 17, 2006, have been fully adhered to.
(i) Full Civil Nuclear Cooperation
Ø The concept of full civil nuclear cooperation has been clearly enshrined in this Agreement. The Agreement stipulates that uch cooperation will include nuclear reactors and aspects of the associated nuclear fuel cycle, including technology transfer on industrial or commercial scale. It would also include development of a strategic reserve of nuclear fuel to guard against any disruption of supply over the lifetime of our reactors.
Ø A significant aspect of the Agreement is our right to reprocess US origin spent fuel. This has been secured upfront. We view our right to reprocess as a key element of a closed fuel cycle, which will enable us to make full use in our national facilities of the energy potential of the nuclear fuel used in our reactors. This important yardstick has been met by the permanent consent for India to reprocess.
Ø India will establish a new national reprocessing facility dedicated to reprocessing foreign nuclear material under IAEA safeguards. India and the US will mutually agree on arrangements and procedures under which such reprocessing will take place in the new facility. Consultations on arrangements and procedures will begin within six months of a request by either party and will be concluded within one year. There is no ambiguity with regard to the commitments of both countries.
Ø Any special fissionable material that may be separated may be utilized in national facilities under IAEA safeguards. Thus the interests of our three stage nuclear programme have been protected.
Ø The United States has a longstanding policy of not supplying to any country enrichment, reprocessing and heavy water production facilities. This Agreement provides for such transfers to India only through an amendment. Forward- looking language has been included for dual use transfers of enrichment, reprocessing and heavy water production facilities. We hope transfers will become possible as cooperation develops and expands in the future. It is important to note that no prohibition that is specifically directed against India has been included in the Agreement.
(ii) The Principle of Reciprocity:
Ø The principle of reciprocity, which was integral to the July 2005 Statement, has been fully safeguarded in this Agreement. There is no change in our position that we would accept only IAEA safeguards on our civilian nuclear facilities. This would also be in a phased manner and as identified for that purpose in the Separation Plan, and only when all international restrictions on nuclear trade with India have been lifted. India will not take any irreversible steps with the IAEA prior to this.
(iii) Certification:
Ø This Agreement emphasizes the desire of both countries to cooperate extensively in the use of nuclear energy for peaceful purposes as a means of achieving energy security on a stable, reliable and predictable basis. This Agreement further confirms that US cooperation with India is a permanent one.
There is no provision that states that US cooperation with India will be subject to an annual certification process.
Ø Hon’ble Members may recall that the 18th July 2005 Joint Statement had acknowledged that India be regarded as a state with advanced nuclear technology enjoying the same advantages and benefits as other States with advanced nuclear technology, such as the US. This Agreement makes specific references to India and the United States as States possessing advanced nuclear technology, both parties having the same benefits and advantages, both committed to preventing WMD proliferation.
(iv) Safeguards:
Ø As agreed in the March Separation Plan, India has accepted only IAEA safeguards that will be reflected in an India-specific Safeguards Agreement with the IAEA.
We have not consented to any provision that mandates scrutiny of our nuclear weapons programme or any unsafeguarded nuclear facilities. There are explicit provisions in the Agreement that make it clear that this Agreement does not affect our unsafeguarded nuclear facilities and that it will not affect our right to use materials, equipment, information or technology acquired or developed independently. India and the United States have agreed that the implementation of the Agreement will not hinder or otherwise interfere with India’s nuclear activities including our military nuclear facilities. Nothing in the Agreement would impinge on our strategic programme, our three-stage nuclear power programme or our ability to conduct advanced R&D.
(v) Fuel Supply Assurances:
Ø I would like to reiterate that the March 2006 Separation Plan provided for an India-specific Safeguards Agreement with the IAEA, with assurances of uninterrupted supply of fuel to reactors that would be placed under IAEA safeguards together with India’s right to take corrective measures in the event fuel supplies are interrupted. An important assurance given is the commitment of support for India’s right to build up strategic reserves of nuclear fuel to meet the lifetime requirements of India’s reactors.
Ø This Agreement envisages, in consonance with the Separation Plan, US support for an Indian effort to develop a strategic reserve of nuclear fuel to guard against any disruption of supply for the lifetime of India’s reactors. The Agreement reiterates in toto the corresponding portions of the Separation Plan.
It has endorsed the right of India to take corrective measures to ensure uninterrupted operation of its civilian nuclear reactors in the event of disruption of foreign fuel supply.
Hon’ble Members will agree that these provisions will ensure that there is no repeat of our unfortunate experience with Tarapur.
(vi) Integrity and reliability of our strategic programme, autonomy of decision making and future scientific research and development:
Ø In my statements of March 7 and August 17, 2006, I had assured Parliament that the Separation Plan would not adversely affect our strategic programme, the integrity of the three-stage nuclear programme and the autonomy of our Research and Development activity.
Ø This Agreement does not in any way impact on India’s ability to produce and utilize fissile material for its current and future strategic needs.
Our right to use for our own purposes our independent and indigenously developed nuclear facilities has been fully preserved. The Agreement also provides for non-hindrance and non-interference in our activities involving use of nuclear material, non-nuclear material, equipment, components, information or technology and military nuclear facilities produced, acquired or developed independently for our own purposes.
(vii) Cessation of cooperation:
Ø An elaborate multi-layered consultation process has been included with regard to any future events that may be cited as a reason by either Party to seek cessation of cooperation or termination of the Agreement. Both Parties have agreed to take a number of factors into account in their consultations so that the scope for precipitate or unilateral action is reduced.
Cessation of cooperation can be sought by the US only if it is prepared to take the extreme step of termination of the Agreement. India’s right to take “corrective measures” will be maintained even after the termination of the Agreement.
Ø In the case of termination of this Agreement and cessation of cooperation by either Party, each has the right to seek return of nuclear material and equipment supplied by it to the other. However, before the right of return is exercised, the Agreement commits the parties to consult and to take into account specific factors such as national security, ongoing contracts and projects, compensation at market value, physical protection and environmental issues. India and the United States have agreed to consider carefully the circumstances that may lead to termination, including a party’s concerns about a change in the security environment or a response to similar actions by other states that could impact on national security.
The Agreement stipulates that the two parties recognise that exercising the right of return would have profound implications and consequences for their relations.
Ø From India’s point of view our primary objective is to ensure the uninterrupted operation of our nuclear reactors, in the context of the detailed fuel supply assurances provided in the Separation Plan and these are now reflected in full in the Agreement. The Agreement specifically states in regard to fuel supply assurances and India’s right to take “corrective measures” that there will be no derogation of India’s rights in this regard, including the right to take “corrective measures” to ensure the uninterrupted operation of its reactors. This reflects the balance of obligations consistent with the understandings of the July Statement and the March Separation Plan.
8. Among the significant and innovative features of this Agreement are specific mention of the right to run foreign supplied reactors ‘without interruption’ and to take ‘corrective measures’ in the event of fuel supply disruption. This has been made possible by crafting the provisions in a manner that provide for explicit linkages and interlocking of rights and commitments contained in the Agreement.
9. The Agreement does not in any way affect India’s right to undertake future nuclear tests, if it is necessary in India’s national interest. Let me hence reiterate once again that a decision to undertake a future nuclear test would be our sovereign decision, one that rests solely with the Government. There is nothing in the Agreement that would tie the hands of a future Government or legally constrain its options to protect India’s security and defence needs.
10. If I might sum-up, this Agreement does not in any way inhibit, restrict or curtail our strategic autonomy or capabilities. Our rights to pursue our three-stage nuclear power programme remain undiluted.
In the unlikely event of cessation of cooperation there is no derogation of our rights with regard to corrective measures. Our reprocessing rights are upfront and are permanent in nature. Advanced R&D programmes and IPR Protection are fully safeguarded.
11. As I have said, this is an Agreement for cooperation between India and the US on peaceful uses of nuclear energy. Its genesis is the shared perception between India and the US that both our countries need to address their energy challenges, and address them in a manner that is sensitive to concerns about the environment. For India, it is critically important to maintain our current GDP growth rate of 8 to 10% per annum if our goal of eradicating poverty is to be achieved. The energy implications of this growth rate over the next couple of decades are enormous. Even if we were to exploit all our known resources of coal, oil, gas and hydropower, we would still be confronted with a yawning demand and supply gap.
12. India’s three-stage nuclear power programme holds immense promise for the future. The unique thorium-based technology would become an economically viable alternative over a period of time following sequential implementation of the three stages. We must, in the meantime, explore and exploit every possible source of energy. Nuclear energy is a logical choice for India. Indigenous supplies of uranium are highly inadequate and hence we need to source uranium supply from elsewhere. In a globalised world, technology is always a premium item and we look forward to expanding our horizons in this regard as well. We intend to carry forward our cooperation with other countries in civil nuclear energy, in particular with major nuclear suppliers such as Russia and France.
13. We already have a comprehensive nuclear infrastructure. We have a corps of skilled and technically qualified manpower in this sector. It makes sense for us to leverage this valuable asset. As Hon’ble Members are aware, our target for the year 2020 is 20,000 MW of nuclear power generation. It is quite modest.
However, if international cooperation once again became available, we could hope to double this target.
14. On the basis of the Indo-US bilateral Agreement and the finalisation of an India-specific Safeguards Agreement with the IAEA, which is being taken up shortly, the Nuclear Suppliers Group is expected to adapt its guidelines to enable international commerce with India in civil nuclear energy and all dual use technologies associated with it. This would be the beginning of the end of the technology-denial regimes against India that have been in existence for over three decades.
15. Apart from its direct impact on our nuclear energy programme, this Agreement will have major spin-offs for the development of our industries, both public and private. High technology trade with the US and other technologically advanced countries will expand rapidly.
16. I wish to draw attention to another major gain for India from this initiative.
We will be creating opportunities for our scientists to participate in the international exchange of scientific ideas and technical know-how and to contribute to the global effort to deal with the world-wide challenges of energy security and climate change. This includes the International Thermonuclear Research Reactor or ITER project, in which India has already joined as a full and equal member along with a handful of technologically advanced countries.
17. In discussions on this subject, questions have been raised about Government’s commitment to an independent foreign policy. I have clearly spelt out the Government’s position in this regard in my statements to Parliament in March and August 2006. I had specially underlined that the pursuit of a foreign policy that is independent in its judgement is a legacy of our founding fathers and an abiding commitment of my Government. India is too large and too important a country to have the independence of its foreign policy taken away by any power.
Today, India stands on the world stage as an influential and respected member of the international community. There is independence in our thought and independence in our actions.
18. I would like to reiterate that our engagement today with all global powers like US, Russia, China, EU, UK, France, Germany and Japan is unprecedented. Engagement with West, East, South East and Central Asia has been significantly stepped up with visible results. We are building new frontiers in our ties with Africa and Latin America. In South Asia we seek to develop a peaceful environment, one that is conducive to ambitious developmental targets. I urge those who question our commitment to an independent foreign policy to display the same degree of confidence in India, as others from outside do.
19. Thus, there is no question that we will ever compromise, in any manner, our independent foreign policy. We shall retain our strategic autonomy.
At the same time, we must not forget India’s long-standing commitment to the noble ideas of nuclear disarmament and our refusal to participate in any arms race, including a nuclear arms race. Our commitment to universal, non-discriminatory and total elimination of nuclear weapons remains undiminished. It was this vision of a world free of nuclear weapons which Shri Rajiv Gandhi put before the UN in 1988 and this still has universal resonance.
20. We remain committed to a voluntary, unilateral moratorium on nuclear testing. We are also committed to negotiate a Fissile Material Cut-off Treaty or FMCT in the Conference on Disarmament. India is willing to join only a non-discriminatory, multilaterally negotiated, and internationally verifiable FMCT, as and when it is concluded in the Conference on Disarmament, subject to it meeting our national security interests.
21. Despite changes in government and changes in political leadership we have always tempered the exercise of our strategic autonomy with a sense of global responsibility and with a commitment to the ideals of general and complete disarmament, including global nuclear disarmament. This Government believes that our commitment to these ideals and our efforts to realize them must continue, and continue with even greater vigour, now that we are a nuclear weapon state. The possession of nuclear weapons only increases our sense of responsibility and does not diminish it.
22. Pending global nuclear disarmament, India has maintained an impeccable non-proliferation record. As a responsible nuclear power, India will not be the source of proliferation of sensitive technologies. We stand for the strengthening of the non-proliferation regime as the infirmities in this regime have affected our security interests. We will work together with the international community to advance our common objective of non-proliferation.
23. There are now other landmarks to cross before the goal of India joining the international mainstream as a full and equal partner becomes a reality. We have to finalise an India-specific Safeguards Agreement with the IAEA. Thereafter, the Nuclear Suppliers Group has to agree, by consensus, to adapt its guidelines, we expect without conditions, to enable nuclear commerce with India and to dismantle the restrictions on the transfer of dual use technologies and items to our country. The US Administration is to secure requisite approval from the US Congress. The completion of these next steps will mark the practical realization of this initiative.
24. Our negotiators deserve credit for delivering to the nation an Agreement, which can potentially transform the economic prospects of our country. It is an Agreement that will enable us to meet the twin challenges of energy security and environmental sustainability, and remove the technology denial regimes that have, for decades, been a major constraint on our development.
At the same time, it will bring India the recognition it deserves thanks to the outstanding achievements of our scientists in nuclear and space sciences as well as other high technology areas.
25. This historic initiative has received the steadfast support of President Bush and senior members of his Administration. The strengthening and enhancement of our bilateral relations is an objective that has received his unstinting personal support and commitment. This Agreement is a shining example of how far we have progressed.
26. Finally, Sir, let me end by saying that we have achieved an Agreement that is good for India, and good for the world. I am neither given to exaggeration nor am I known to be self-congratulatory. I will let history judge; I will let posterity judge the value of what we have done through this Agreement. In days to come it will be seen that it is not just the United States but nations across the world that wish to arrive at a new equilibrium in their relations with India. This agreement with the United States will open new doors in capitals across the world. It is another step in our journey to regain our due place in global councils. When future generations look back, they will come to acknowledge the significance of this historic deal.
Thank you, Sir.
---------------------------------------------------------------
Statement of Dr Manmohan Singh in Rajya Sabha on the India- US Nuclear Agreement
August 17, 2006New Delhi
THE PRIME MINISTER (DR. MANMOHAN SINGH): Mr. Chairman, Sir, as I stand before this august House, I would like to share with you and the hon. Members the vision that inspires us and that vision is bequeathed to us by no less than a person than Jawaharlal Nehru, when, on the eve of our Independence he said, "Our task will not be complete so long as we cannot get rid of chronic mass poverty, ignorance and disease which still afflict millions and millions of our country men and country women." In the last sixty years, a great deal has been done to soften the harsh edges of extreme poverty. But, who can deny that we have to do a lot more to reach our cherished goal. Sir, Panditji said in 1947 that it has been the dream of the greatest man of our age, referring to Mahatma Gandhi, to wipe out every tear from every eye and, he then said, that may be a tall order for us. But, that is the inspiration which has to inspire Governments in a country as poor, as under-developed as we are.
Sir, it is my solid conviction that mass poverty can be removed only if we have a fast expanding economy. Even though, I recognise that a fast expanding economy is by itself not a sufficient condition of getting rid of poverty. We need institutional mechanisms to focus, particularly on the needs of the under privileged sections of our society. If India has to grow at the rate of 8 per cent to 10 per cent and, maybe, more, India needs rising amounts of energy. A question has been asked, 'Have I calculated what type of energy mix this country needs and have I worked out the costs of that?' Mr. Chairman, I had some experience of that. Soon after the Pokhran Tests in 1974, I became the Member for finance of the Atomic Energy Commission and, along with colleagues like Dr. Ramanna, Dr.Sethna, Dr. Iyengar, we worked out the role of nuclear energy in meeting the deficit in our energy requirements.
In this context, we must never forget the primary motivation for India's nuclear programme was the production of energy, defence came much later. And, where are we? After six years, our total production of nuclear power is no more than 3,000 MW. People say that we can use coal. We have plenty of coal. Often low-grade coal has high ash content. If you use increased quantities of coal you run into environmental hazards, like, the CO2 and other gas emissions. As for hydrocarbons, you know there is a great insecurity of supplies. We know that the price of hydrocarbons, oil and gas, can go, in a very short period, to hundred dollars a barrel. Therefore, in this environment, prudence demands that we must widen our energy options. I am not saying that nuclear energy will provide the final answer. All I am saying is, as I understood, all development is about widening human choices. And, when it comes to energy security, widening our choices means that we should be able to make effective use of nuclear power. If the need arises. If the economic calculus demands that this is the most cost-effective means.
It is my belief that the nuclear order that prevailed in the world for thirty odd years, which has imposed restrictions on nuclear trade with India -- if this nuclear order is not changed, India's development options, particularly its quest for energy security will face, to put it mildly, a great degree of uncertainty. Mr. Arun Shourie asked me what calculations have I seen. I have seen many calculations in the Department of Atomic Energy. In the eighties when Shri K.C. Pant was the Chairman of the Energy Policy Committee, a detailed study was done and it was shown that if you were talking of generating power and reaching it to place 700 kms away from a coal mine, nuclear energy is the right economic answer. Things can change. And, I think, the Planning Commission has done recent work, and they have also come to the conclusion that having the nuclear option is something which will give us greater degree of security on the energy front. That's the vision that inspires our quest for changing the nuclear order.
We have, of course, security concerns, international security concerns. Nuclear proliferation in our neighbourhood is something which worries us and, therefore, it is quite clear that while we are committed to our civilizational heritage of working untiringly for universal disarmament, we have to recognise that we are living in a world, where this is not going to happen today, tomorrow, or, day after tomorrow. In this uncertain world, the unpredictable world that we live in, we have legitimate security concerns. The nuclear weapon programme, its autonomy, its independence, dependent solely on our own assessment, must remain a cardinal principle of our nuclear policy.
Sir, I do recognize, if you are trying to move away from the status quo, you do run risks. Change is very disruptive. It upsets existing institutions; existing ways of thinking, and status quo has the satisfaction of being rooted in reality. If you are planning for a future and the future is inherently uncertain, you run the risk that you may go wrong. But we live in a world, where change is the only constant. This country has to be prepared to think big about its future and if that is the vision, that is the mission, then, I sincerely believe the path that we have identified is the right path. I am not saying that I know whether we will succeed or not.
In fact, if I had been allowed to initiate this debate, I would have outlined the risks that we face and, maybe, at the end of it the whole House would have said that this is what things should be and this is what our approach should be. I was not given that opportunity even though I offered, in both the Houses, that I was willing to make a suo moto statement setting out our vision, goals, risks and uncertainties that we face and how we will tackle those risks and uncertainties.
Sir, my thoughts go back to the year 1991. Shri Yashwant Sinha handed me a bankrupt economy with foreign exchange reserves of no more than two weeks. I had to improvise within one week a programme to rescue this economy. Within one month I had to come with a Budget which required far-reaching changes in the way we were taught to think about our economic problems. On that occasion also, in 1992, when I rose to present my second Budget, all Opposition, the Right and Left, rose and said that I should be impeached because I have prepared this budget in consultation with Washington and that I was an American agent. I have lived with that sort of thing. And, therefore, it does not surprise me that today all sorts of adjectives were used. I am strong or weak, history will determine that. But, I do wish to share with this House that I do recognise the risks that reform undertakings run into in all modern societies.
I was reading Machiavelli recently. I should like to quote a paragraph from 'The Prince': " It must be considered that there is nothing more difficult to carry out, nor more doubtful of success, nor more dangerous to handle, than to initiate a new order of things. For the reformer has enemies in all those who profit by the old order, and only lukewarm defenders in all those who would profit from the new order. This lukewarmness arises partly from the fear of their adversaries, who have the laws in their favour; and partly from the incredulity of mankind, who do not truly believe in anything new until they have the experience of it. Thus it arises that on every opportunity for attacking the reformer, his opponents do so with the zeal of partisans, the others only defend him half-heartedly, so that between them he runs a great danger."
Therefore, I am aware of the risks that I do incur. Mr. T.T. Krishnamachari once told me that there are tigers on the prowl on the streets of Delhi. I am aware of the risks but for India's sake, I am willing to take those risks.
Mr. Chairman, you forgive me if I become a little sentimental on this occasion. I was born in a very poor family on the other side of Punjab. I was the first one in the family who went to High School. My father left his class in the eighth standard and became a freedom fighter in Nabha and Jaito morchas that were launched at that time. I may not have been in politics, but I have in my blood the feelings of a freedom fighter's family. I may be late comer into politics, but I have the privilege of belonging to a Party which fought for India's freedom. The Party which produced great leaders like Mahatma Gandhi, Jawaharlal Nehru, Indira Gandhi, Sardar Patel, Maulana Abdul Kalam Azad, Khan Abdul Ghaffar Khan, Rajiv Gandhi, etc. That is the heritage of which any Party must be proud.
When I stand before this House, I cay say in all faithfulness that in these two years and three months that this nation has entrusted me with the job of the Prime Minister, I did not seek it; it came my way, but it has been my effort to do my very best to serve the vital interests of this nation.
This commitment I made in 1991. In my first Budget Speech I said, "No power on earth can stop an idea whose time has come". I had then said, "The emergence of India, as a major pole of the global economy is one such idea whose time has come." And, I said: "I will dedicate myself to that task." I was criticised by the Right, by the Left, names were used, epithets, 15 years down, who will today say that what I did then was wrong. This Nation stands tall, proud, fast-growing and if India had not launched, if we had not launched the programmes of reforms, I shudder to think, how India would have faced the Asian crisis of the mid 90's. So, Sir, I speak with some experience, even though, I may be novice in politics. I do not have the skills of Jaswant Singhji, Yashwant Sinha, or, Arun Shourieji, but I do wish to say to our countrymen that the service of India, as Jawahar Lal Nehru used to say, means a service of teeming millions who suffer day and night and that is the vision, that is the mission which inspires me and will guide me for whatever is left of my life. No power on earth can take away that privilege from me. I will discharge my duties to this country, to the last ounce of my blood. Sir, I now come to the subject matter of discussion today.
At the outset, I would like to convey my gratitude to all the Hon’ble Members who have participated in this debate. I am grateful for this opportunity to clarify some of the issues arising from the discussion. I will do so in a non partisan spirit and I have every reason to believe that after I have finished that I will be able to carry the whole House with me. Our Government has never shied away from a full discussion in Parliament on this important issue. On three previous occasions on July 29, 2005, February 27, 2006 and March 7, 2006, I had made detailed statements and discussed this important subject in this august House. Once again, several issues have been raised during the current discussions and I wish to take this opportunity to respond to them. I also intend to cover developments since my last Suo Motu statement of March 7 this year.
2. Two types of comments have been made during the discussion in the House. The first set of issues pertains to the basic orientation of our foreign policy. Some Hon’ble Members have observed that by engaging in discussions with, and allegedly acquiescing in the demands made by the United States, we have compromised the independent nature of our foreign policy.
3. The second set of issues pertain to deviations from the July 18 Joint Statement and the March 2 Separation Plan. Many of the points raised by the Hon’ble Members have also been aired outside Parliament, notably also by some senior members of the scientific establishment. Overall, a listing of the important concerns include the following: that the India-US Nuclear initiative and more particularly the content of the proposed legislation in the US Congress, could undermine the autonomy of our decision-making; limit the options or compromise the integrity of our strategic programme; and adversely affect the future of our scientific research and development. To sum up, this would suggest that India’s strategic nuclear autonomy is being compromised and India is allowing itself to be pressurized into accepting new and unacceptable conditions that are deviations from the commitments made by me to Parliament in July 2005 and in February and March this year.
4. I recognize that many of these concerns are borne out of genuine conviction that nothing should be done that would undermine long standing policies that have a bearing on India’s vital national security interests. I fully share and subscribe to these sentiments. I would like to assure the Hon’ble Members that negotiations with the US regarding the civilian nuclear deal have not led to any change in the basic orientation of our policies, or affected our independent judgment of issues of national interest. Last year during my visit to the US, I addressed the National Press Club in the full glare of the media. A question was put to me regarding what I thought about the US intervention in Iraq. In the full public glare of the media I said that it was a mistake. I said the same to President Bush when he visited India. I said India does not find favour with regime change.
5. The thrust of our foreign policy remains the promotion of our national interest. We are unswerving in our commitment to an independent foreign policy. We do recognize the complexities present in an increasingly inter-dependent and multi-polar world. While we recognize that the United States is a pre-eminent power and good relations with the U.S. are in our national interest, this has not in any way clouded our judgment. There are many areas of agreement with the United States, but at the same time there are a number of areas in which we have differences and we have not shied away from making these known to the US, as also expressing them in public. Currently, we are engaged not only with the US but other global powers like Russia, China, the EU, UK, France and Japan. We are also focusing on ASEAN, as well as countries in West Asia, Africa and Latin America. More importantly, we are devoting proportionately larger time and effort in building relations with countries in our immediate neighbourhood like Nepal, Bhutan, Sri Lanka, Bangladesh, Myanmar, and Pakistan. Our relations with all these countries are determined by the dictates of our enlightened national interest and we have not allowed any other country, including the United States, to influence our polices. This will not change as long as I am Prime Minister.
6. I would, hence, again reiterate in view of the apprehensions expressed, that the proposed US legislation on nuclear cooperation with India will not be allowed to become an instrument to compromise India’s sovereignty. Our foreign policy is determined solely by our national interests. No legislation enacted in a foreign country can take away from us that sovereign right. Thus there is no question of India being bound by a law passed by a foreign legislature. Our sole guiding principle in regard to our foreign policy, whether it is on Iran or any other country, will be dictated entirely by our national interest.
7. Let me now turn to some of the concerns that have been expressed on the second set of issues regarding possible deviations from assurances given by me in this august House on the July 18, 2005 Joint Statement and the March 2, 2006 Separation Plan. I would like to state categorically that there have neither been nor will there be any compromises on this score and the Government will not allow such compromises to occur in the future.
8. Hon’ble Members will recall that during President Bush’s visit to India in March this year, agreement was reached between India and the United States on a Separation Plan in implementation of the India-United States Joint Statement of July 18, 2005. This Separation Plan had identified the nuclear facilities that India was willing to offer, in a phased manner, for IAEA safeguards, contingent on reciprocal actions taken by the United States. For its part, the United States Administration was required to approach the US Congress for amending its laws and the Nuclear Suppliers’ Group for adapting its Guidelines to enable full civilian nuclear cooperation between India and the international community.
9. The US Administration had thereafter approached the US Congress to amend certain provisions of the United States Atomic Energy Act of 1954, which currently prohibit civil nuclear cooperation with India. The US House of Representatives International Relations Committee passed a Bill on the subject on 27th June 2006. The House of Representatives passed the Bill as approved by its International Relations Committee on July 27.
10. The Senate Foreign Relations Committee passed its version of the Bill on June 29, 2006. The US Senate is now expected to vote on this version of the Bill some time in September. We have concerns over both the House and Senate versions of the Bill. Since the two Bills are somewhat different in content, according to US practice they will need to be reconciled to produce a single piece of legislation. After adoption by both the House and the Senate, this would become law when the US President accords his approval. The final shape of the legislation would, therefore, be apparent only when the House and the Senate complete the second stage of assent/adoption.
11. Meanwhile, the US Government has approached the Nuclear Suppliers’ Group to adapt its guidelines to enable full civil nuclear cooperation between India and the International community. In March this year, the NSG at its plenary meeting in Brazil held a preliminary discussion on this issue. The matter will be further discussed by the Nuclear Suppliers’ Group later this year. On our part, we have separately raised this issue with several countries and urged them to lift the existing restrictions on nuclear supplies to India. I myself have raised this issue with the Heads of State or Government of Russia, France, UK, Japan, Germany, Brazil, Norway, Iceland and Cyprus, among others.
12. In view of the concerns voiced by the Hon’ble Members, I shall try to address each of these concerns in some detail. I shall, however, begin by affirming that our approach is guided by the understandings contained in the July 2005 Joint Statement and the March 2006 Separation Plan. What we can agree with the United States to enable nuclear cooperation must be strictly within these parameters.
13. The key provisions to which references have been made in Parliament and outside are the following:
(i) Full Civil Nuclear Cooperation : The central imperative in our discussions with the United State on Civil Nuclear Cooperation is to ensure the complete and irreversible removal of existing restrictions imposed on India through iniquitous restrictive trading regimes over the years. We seek the removal of restrictions on all aspects of cooperation and technology transfers pertaining to civil nuclear energy ‑ ranging from nuclear fuel, nuclear reactors, to re-processing spent fuel, i.e. all aspects of a complete nuclear fuel cycle.
This will be the surest guarantee of India’s acceptance as a full and equal partner of the international nuclear community, even while preserving the integrity of our three stage nuclear programme and protecting the autonomy of our scientific research and development. We will not agree to any dilution that would prevent us from securing the benefits of full civil nuclear cooperation as amplified above.
(ii) Principle of Reciprocity : I had earlier assured the House that reciprocity is the key to the implementation of our understanding contained in the July 2005 Statement. I stand by that commitment. When we put forward the Separation Plan, we again made it clear to the United States that India could not be expected to take on obligations such as placing its nuclear facilities under safeguards in anticipation of future lifting of restrictions. India and the United States have held one round of discussions on a proposed bilateral cooperation agreement. India and the IAEA have held technical discussions regarding an India-specific Safeguards agreement. Further discussions are required on both these documents. While these parallel efforts are underway, our position is that we will accept only IAEA safeguards on the nuclear facilities, in a phased manner, and as identified for that purpose in the Separation Plan only when all nuclear restrictions on India have been lifted. On July 29 last year, I had stated that before voluntarily placing our civil nuclear facilities under IAEA safeguards, we will ensure that all restrictions on India have been lifted. There has been no shift in our position on this point.
(iii) Certification : The draft Senate Bill requires the US President to make an annual report to the Congress that includes certification that India is in full compliance of its non‑proliferation and other commitments. We have made it clear to the United States our opposition to these provisions, even if they are projected as non‑binding on India, as being contrary to the letter and spirit of the July Statement. We have told the US Administration that the effect of such certification will be to diminish a permanent waiver authority into an annual one. We have also indicated that this would introduce an element of uncertainty regarding future cooperation and is, not acceptable to us.
(iv) India as a State possessing Advanced Nuclear Technology : Hon’ble Members may recall that the July Statement, had acknowledged that India should be regarded as a State with advanced nuclear technology enjoying the same advantages and benefits as other states with advanced nuclear technology, such as the US. The July Statement did not refer to India as a Nuclear Weapons State because that has a particular connotation in the NPT but it explicitly acknowledged the existence of India’s military nuclear facilities. It also meant that India would not attract full‑scope safeguards such as those applied to Non‑Nuclear Weapon States that are signatories to the NPT and there would be no curbs on continuation of India’s nuclear weapon related activities. In these important respects, India would be very much on par with the five Nuclear Weapon States who are signatories to the NPT. Similarly, the Separation Plan provided for an India‑specific safeguards agreement with the IAEA with assurances of uninterrupted supply of fuel to reactors together with India’s right to take corrective measures in the event fuel supplies are interrupted. We have made clear to the US that India’s strategic programme is totally outside the purview of the July Statement, and we oppose any legislative provisions that Mandate scrutiny of either our nuclear weapons programme or our unsafeguarded nuclear facilities.
(v) Safeguards Agreement and Fuel Assurances : In this respect too, it is worth emphasizing that the March 2006 Separation Plan provides for an India‑Specific Safeguards Agreement with the IAEA, with assurances of uninterrupted supply of fuel to reactors that would be placed under IAEA safeguards together with India’s right to take corrective measures in the event fuel supplies are interrupted. We, of course, have the sovereign right to take all appropriate measures to fully safeguard our interests. An important assurance is the commitment of support for India’s right to build up strategic reserves of nuclear fuel over the lifetime of India’s reactors. We have initiated technical discussions at the expert level with the IAEA on an India‑Specific Safeguards Agreement. Both the Bilateral Nuclear Cooperation Agreement with the United States and the India-Specific Safeguards Agreement with the IAEA would be only within the parameters of the July Statement and the March Separation Plan. There is no question of India signing either a Safeguards Agreement with the IAEA or an Additional Protocol of a type concluded by Non‑Nuclear Weapons States who have signed the NPT. We will not accept any verification measures regarding our safeguarded nuclear facilities beyond those contained in an India-Specific Safeguards Agreement with the IAEA. Therefore there is no question of allowing American inspectors to roam around our nuclear facilities.
(vi) Integrity and reliability of our strategic programme – autonomy of decision-making and future scientific research and development: In my statement of March 7, 2006, I had assured Parliament that the Separation Plan would not adversely affect our strategic programme. I reiterate that commitment today. The Separation Plan has been so designed as to ensure adequacy of fissile material and other inputs for our strategic programme, based on our current and assessed future needs. The integrity of our 3‑Stage nuclear programme will not be affected. The autonomy of our Research and Development activity, including development of our fast breeder reactors and the thorium programme, in the nuclear field will remain unaffected. We will not accept interference by other countries vis-à-vis the development of our strategic programme. We will not allow external scrutiny of our strategic programme in any manner, much less allow it to be a condition for future nuclear cooperation between India and the international community.
(vii) Moratorium on production of fissile material: Our position on this matter is unambiguous. We are not willing to accept a moratorium on the production of fissile material. We are only committed to negotiate a Fissile Material Cut-off Treaty in the Conference on Disarmament in Geneva, a commitment which was given by the previous government. India is willing to join only a non‑discriminatory, multilaterally negotiated and internationally verifiable FMCT, as and when it is concluded in the Conference on Disarmament, again provided our security interests are fully addressed.
(viii) Non‑discriminatory Global Nuclear Disarmament: Our commitment towards non-discriminatory global nuclear disarmament remains unwavering, in line with the Rajiv Gandhi Action Plan. There is no dilution on this count. We do not accept proposals put forward from time to time for regional non‑proliferation or regional disarmament. Pending global nuclear disarmament, there is no question of India joining the NPT as a non‑nuclear weapon state, or accepting full‑scope safeguards as a requirement for nuclear supplies to India, now or in the future.
(ix) Cessation of Future Cooperation : There is provision in the proposed US law that were India to detonate a nuclear explosive device, the US will have the right to cease further cooperation. Our position on this is unambiguous. The US has been intimated that reference to nuclear detonation in the India-US Bilateral Nuclear Cooperation Agreement as a condition for future cooperation is not acceptable to us. We are not prepared to go beyond a unilateral voluntary moratorium on nuclear testing as indicated in the July Statement. The same is true of other intrusive non‑proliferation benchmarks that are mentioned in the proposed US legislation. India’s possession and development of nuclear weapons is an integral part of our national security. This will remain so.
14. Hon’ble Members will appreciate the fact that an international negotiation on nuclear energy cooperation particularly when it involves dismantling restrictive regimes that have lasted for over three decades is a complex and sensitive exercise. What we are attempting today is to put in place new international arrangements that would overturn three decades of iniquitous restrictions. It is inevitable, therefore, that there would be some contradictory pulls and pressures. This does not mean that India will succumb to pressures or accept conditionalities that are contrary to its national interests.
15. I had personally spoken to President Bush in St. Petersburg last month on this issue, and conveyed to him that the proposed US legislation must conform strictly to the parameters of the July 18, 2005 Statement and the March 2, 2006 Separation Plan. This alone would be an acceptable basis for nuclear cooperation between India and the United States. India cannot, and is not prepared to, take on additional commitments outside this agreed framework or allow any extraneous issues to be introduced. I have received an assurance from the US President that it was not his intention to shift goalposts, and that the parameters of the scope of cooperation would be those contained in the July 2005 Joint Statement and the March 2006 Separation Plan. A White House Statement of Administration Policy of July 26, 2006 recognizes some, though not all, of India’s concerns, and conveyed that the Administration has voiced them with the Congress.
16. I can assure you that there is no ambiguity in our position in so far as it has been conveyed to the US. The US is aware of our position that the only way forward is strict adherence to July Statement and March Separation Plan. I am hopeful that the bilateral India‑US Civil Nuclear Cooperation Agreement when concluded will take into account the issues raised here. However, I must be honest and frank that I cannot predict with certainty the final form of the US legislation or the outcome of this process with the NSG, which consists of 45 countries with divergent views. We are hopeful that this will lead in a direction wherein our interests are fully protected and that there is a complete lifting of restrictions on India that have existed for three decades. Such an outcome if it materializes will contribute to our long‑term energy security by enabling a rapid increase in nuclear power. It would lead to the dismantling of the technology denial regimes that have hampered our development particularly in hi‑tech sectors. I will have wide consultations including with the members of the Atomic Energy Commission, the nuclear and scientific communities and others to develop a broad based national consensus on this important matter. I wish to inform members of the House that I have invited members of the Atomic Energy Commission on the 26th August for a meeting. That same day I have also invited the group of distinguished scientists who have expressed concerns to meet me.
17. Finally, I would only like to state that in keeping with our commitments to Parliament and the nation, we will not accept any conditions that go beyond the parameters of the July 18, 2005 Joint Statement and the March 2, 2006 Separation Plan, agreed to between India and the United States. If in their final form the US legislation or the adapted NSG Guidelines impose extraneous conditions on India, the Government will draw the necessary conclusions, consistent with the commitments I have made to Parliament.
[Prime Minister also gave the following responses to points raised by the Left parties ]
1. Whether the deal will give “full” civilian nuclear technology and lift all existing sanctions on dual use technology imposed on India for not signing the NPT.
Response: The objective of full civil nuclear cooperation is enshrined in the July Statement. This objective can be realized when current restrictions on nuclear trade with India are fully lifted. In accordance with the July Statement, US has initiated steps to amend its legislation and to approach the NSG to adapt its guidelines. We seek the removal of restrictions on all aspects of cooperation and technology transfers pertaining to civil nuclear energy – ranging from supply of nuclear fuel, nuclear reactors, reprocessing spent fuel, i.e., all aspects of complete nuclear fuel supply. Only such cooperation would be in keeping with the July Joint Statement.
2. Cannot accept restrictions on Indian foreign policy to be imposed such as on Iran, irrespective of whether it is in the policy section or in the sense of the House section of the legislation.
Response: Government is clear that our commitments are only those that are contained in the July Joint Statement and in the Separation Plan. We cannot accept introduction of extraneous issues on foreign policy. Any prescriptive suggestions in this regard are not acceptable to us.
Our foreign policy is and will be solely determined by our national interests. No legislation enacted in a foreign country can take away from us this sovereign right.
3. Signing of IAEA safeguards in perpetuity for the civilian programme to take place after the US Congress had approved a “123 Nuclear Cooperation Agreement”. All restrictions on India to be lifted before we sign the IAEA safeguards.
Response: I had conveyed to Parliament on July 29, 2005 on my return from Washington that before placing any of our nuclear facilities under IAEA safeguards, we will ensure all restrictions on India have been lifted. Under the Separation Plan agreed to with the United States, India has offered to place under IAEA safeguards 14 of its reactors presently operating or under constructions between 2006 and 2014. The nuclear facilities listed in the Separation Plan will be offered for safeguards only after all nuclear restrictions have been lifted on India. This would include suitable amendments to the US legislation to allow for such cooperation, the passing of the bilateral agreement with India and the adaption of the NSG guidelines. It is clear that India cannot be expected to take safeguards obligations on its nuclear facilities in anticipation of future lifting of restrictions.
4. Guarantees on fuel as agreed in the March 2006 statement.
In case the US reneges on supply of fuel, they will ensure continuity through other members of the Nuclear Suppliers Group (NSG).
Response: Separation Plan includes elaborate fuel supply assurances given by the United States. Understandings in the Separation Plan also provide for contingency of disruption of fuel supplies to India. In such a case, the United States and India would jointly convene a group of friendly supplier countries (Russia, France and United Kingdom) aimed at restoring fuel supplies to India. An important assurance is the commitment of support for India’s right to build strategic reserves of fuel over the life time of its nuclear reactors. In the event of disruption of fuel supplies despite the assurances, India will have a right to take corrective measure to ensure the operation of its nuclear reactors.
5. India will work for an FMCT and for nuclear disarmament with all nuclear weapon states, in line with the Rajiv Gandhi Plan or Delhi Declaration in tandem.
Response: Our support for global nuclear disarmament remains unwaivering. Prime Minister Rajiv Gandhi had put forward an Action Plan in the 1988 UNGA Special Session on Disarmament. We remain committed to the central goal of this Action Plan, i.e., complete elimination of nuclear weapons leading to global nuclear disarmament in a time-bound framework. India has agreed to negotiations in the Conference on Disarmament in Geneva for a Fissile Material Cut-off Treaty. There has been no change in our position on this matter.
6. In the original deal, there is no provision for US inspectors, only provision for IAEA inspectors. The draft US Bills contains such provisions.
Response: In the Separation Plan, we have agreed to offer for IAEA safeguards nuclear facilities specified in the Separation Plan for that purpose. The nature of safeguards will be determined by an India specific safeguards agreement with the IAEA. This will be applied to the safeguarded nuclear facilities in India. Therefore, there is no question of accepting other verification measures or third country inspectors to visit our nuclear facilities, outside the framework of the India specific safeguards agreement.
7. An India-specific protocol and not an Additional Protocol as per IAEA Standard Modified Protocol.
Response: In the Separation Plan, we have agreed to conclude an India specific safeguards agreement with the IAEA. The question of an Additional Protocol will arise only after the India specific safeguards agreement is in place. As a country with nuclear weapons, there is no question of India agreeing to a Safeguards agreement or an Additional Protocol applicable to non-nuclear weapon states of the NPT.
8. References to Iran in the House Bill.
Response: We reject the linkage of any extraneous issue to the nuclear understanding. India’s foreign policy will be decided on the basis of Indian national interests only.
9. Reference to Proliferation Security Initiative in the House and Senate Bills.
Response: The Proliferation Security Initiative (PSI) is an extraneous issue as it is outside the framework of the July 18 Joint Statement. Therefore, we cannot accept it as a condition for implementing the July Statement. Separately, the Government has examined the PSI.
We have certain concerns regarding its legal implications and its linkages with the NPT. We also have concerns with amendments to the suppression of Unlawful Activities at Sea Treaty under the International Maritime Organisation.
10. The Jackson-Vanik Amendment linking the granting of MFN status to USSR to Jewish emigration is an example relevant to the current debate.
Response: We have studied the proposed US legislation very carefully, including the so-called binding and non-binding provisions. The non-binding provisions do not require mandatory action, but at the same time, have a certain weight in the implementation of the legislation as a whole. We have conveyed our concerns to the US Administration in this respect. Jackson-Vanik Amendment was binding on the Administration and cannot be cited as a precedent for non-binding references in the current bills. A more accurate example than the Jackson-Vanik Amendment is the set of provisions accompanying the renewal of MFN status to China, that included references to China’s human rights, China’s political and religious prisoners, protection of Tibetan heritage and freedom of political expression.
11. Role of Parliament in approving foreign policy.
Response: India follows a Parliamentary model, as specified in our Constitution, wherein treaty making powers rest with the Executive. However, we have kept Parliament fully in the picture regarding various stages of our negotiations with the United States. Broad based domestic consensus cutting across all sections in Parliament and outside will be necessary. We will work towards that objective by addressing various concerns as fully as possible.
[Prime Minister also gave the following responses to points raised by the group of nuclear scientists]
1. “India should continue to be able to hold on to her nuclear option as a strategic requirement in the real world that that we live in, and in the ever-changing complexity of the international political system. This means that we cannot accede to any restraint in perpetuity on our freedom of action. We have not done this for the last 40 years after the Non-Proliferation Treaty came into being, and there is no reason why we should succumb to this now. Universal nuclear disarmament must be our ultimate aim, and until we see the light at the end of the tunnel on this important issue, we cannot accept any agreement in perpetuity.”
Response: We are very firm in our determination that agreement with United States on Civil Nuclear Energy in no way affects the requirements of our strategic programme. We are fully conscious of the changing complexity of the international political system. Nuclear weapons are an integral part of our national security and will remain so, pending the global elimination of all nuclear weapons and universal non-discriminatory nuclear disarmament. Our freedom of action with regard to our strategic programmes remains unrestricted. The nuclear agreement will not be allowed to be used as a backdoor method of introducing NPT type restrictions on India. Our offer to put nuclear facilities under safeguards in perpetuity is conditional upon these facilities securing fuel from international sources for their life time. If the fuel supply assurances as enumerated in Separation Plan are disrupted, then India will have the right to take corrective measures to ensure the continued operation of these reactors.
2. ‘After 1974, when the major powers discontinued cooperation with us, we have built up our capability in many sensitive technological areas, which need not and should not now be subjected to external control. Safeguards are understandable where external assistance for nuclear materials or technologies are involved. We have agreed to this before, and we can continue to agree to this in the future too, but strictly restricted to those facilities and materials imported from external sources.’
Response: Sensitive nuclear technology facilities have not been covered in the Separation Plan. Therefore, there is no question of putting them under safeguards or under external controls. Even with regard to nuclear facilities that have been included in Separation Plan, safeguards will be applied in phases between 2006 and 2014. These safeguarded facilities will be eligible for and will receive fuel materials and technology from international sources. If such supplies cease, then India will be free to protect its interests through corrective measures. That will be spelt out clearly in the India specific safeguards agreement.
3. ‘We find that the Indo-US deal, in the form approved by the US House of Representatives, infringes on our Independence for carrying out indigenous research and development in nuclear science and technology. Our R&D should not be hampered by external supervision or control, or by the need to satisfy any international body. Research and technology development are the Sovereign rights of any nation. This is especially true when they concern strategic national defence and energy self-sufficiency.’
Response: Our independence for carrying out independent research and development in nuclear science and technology will remain unaffected. There will be no external supervision of our R&D since none of the sensitive R&D facilities which handle nuclear material have been included in the Separation Plan. Nothing in the Separation Plan infringes on our sovereign right to conduct research and technology development concerning our national defence and energy self-sufficiency. Government is committed to preserve the integrity of the three stage nuclear power programme, including utilization of our vast thorium resources. Certain nuclear facilities including centers such as TIFR, Variable Energy Cyclotron Centre, Saha Institute of Nuclear Physics etc., have been designated as civilian in the Separation Plan. As these facilities will not handle nuclear material, there is no question of safeguards being applied to them. We expect these centers to participate as full partners in international collaboration project.
4. ‘While the sequence of actions to implement the cooperation could be left for discussion between the two governments, the basic principles on which such actions will rest is the right of Parliament and the people to decide. The Prime Minister has already taken up with President George Bush the issue of the new clauses recommended by the US House of Representatives. If the US Congress, in its wisdom, passes the bill in its present form, the ‘product’ will become unacceptable to India, and diplomatically, it will be very difficult to change it later. Hence, it is important for our Parliament to work out, and insist on, the ground rules for the nuclear deal, at this stage itself.’
Response: I had taken up with President Bush our concerns regarding provisions in the two bills. It is clear that if the final product is in its current form, India will have grave difficulties in accepting the bills. US has been left in no doubt as to our position. The ground rules for our discussions are clear. These are the parameters of the July Statement and the March Separation Plan and commitments given by me to Parliament in the three Suo Moto Statements and my reply to today’s discussions will be the guiding principles of our position. Parliament has been kept fully informed at every stage of the discussions. In their final form, if US legislation or the NSG guidelines impose extraneous conditions on India, the Government will draw the necessary conclusions consistent with my commitments to Parliament.
In my Statement on February 27, 2006, I had provided an assurance that this august House will be informed of developments in our discussions with the United States on separation of our civilian and military nuclear facilities. I now inform this august House of developments since my suo motu statement of 27 February.
The President of the United States, His Excellency Mr. George W. Bush visited India between March 1-3, 2006. His visit provided our two countries an opportunity to review progress made in deepening our strategic partnership since the Joint Statement issued during my visit to Washington last July. Our discussions covered the expansion of our ties in the fields of agriculture, economic and trade cooperation, energy security and clean environment, strengthening innovation and the knowledge economy, issues relating to global safety and security and on deepening democracy. Expanded cooperation in each of these areas will have a significant impact on India’s social and economic development. The full text of the Joint Statement issued during President Bush’s visit is placed on the Table of the House.
I have pleasure in informing the House that during President Bush’s visit, as part of the process of promoting cooperation in civilian nuclear energy, agreement was reached between India and the United States on a Separation Plan. Accordingly, India will identify and separate its civilian and military nuclear facilities and place its civilian nuclear facilities under IAEA safeguards. Sir, I place on the Table of the House the Separation Plan that has been drawn up by India and agreed between India and the United States in implementation of the India-United States Joint Statement of July 18, 2005.
I would like to outline some salient elements of the Separation Plan:
i) India will identify and offer for IAEA safeguards 14 thermal power reactors between 2006-14. There are 22 thermal power reactors in operation or currently under construction in the country. Fourteen of these will be placed under safeguards by 2014 in a phased manner. This would raise the total installed thermal power capacity in Megawatts under safeguards from 19% at present to 65% by 2014. I wish to emphasize that the choice of specific nuclear reactors and the phases in which they would be placed under safeguards is an Indian decision. We are preparing a list of 14 reactors that would be offered for safeguards between 2006-14.
ii) We have conveyed that India will not accept safeguards on the Prototype Fast Breeder Reactor (PFBR) and the Fast Breeder Test Reactor (FBTR), both located at Kalpakkam. The Fast Breeder Programme is at the R&D stage. This technology will take time to mature and reach an advanced stage of development. We do not wish to place any encumbrances on our Fast Breeder programme, and this has been fully ensured in the Separation Plan.
(iii) India has decided to place under safeguards all future civilian thermal power reactors and civilian breeder reactors, and the Government of India retains the sole right to determine such reactors as civilian. This means that India will not be constrained in any way in building future nuclear facilities, whether civilian or military, as per our national requirements.
(iv) India has decided to permanently shut down the CIRUS reactor, in 2010. The fuel core of the Apsara reactor was purchased from France, and we are prepared to shift it from its present location and make it available for placing under safeguards in 2010. Both CIRUS and Apsara are located at the Bhabha Atomic Research Centre. We have decided to take these steps rather than allow intrusive inspections in a nuclear facility of high national security importance. We are determined that such steps will not hinder ongoing Research and Development.
(v) Reprocessing and enrichment capabilities and other facilities associated with the fuel cycle for our strategic programme have been kept out of the Separation Plan.
(vi) One of the major points addressed in the Separation Plan was the need to ensure reliability of fuel supplies, given our unfortunate past experience with regard to interruption in supply of fuel for Tarapur. We have received commitments from the United States for the reliable supply of fuel to India for reactors that will be offered for safeguards. The United States has also reaffirmed its assurance to create the necessary conditions for India to have assured and full access to fuel for such reactors. Under the July 18 Joint Statement, the United States is committed to seeking agreement from its Congress to amend domestic laws and to work with friends and allies to adjust the practices of the Nuclear Suppliers Group to create the necessary conditions for India to obtain full access to the international market for nuclear fuel, including reliable, uninterrupted and continual access to fuel supplies from firms in several nations. This has been reflected in the formal understandings reached during the visit and included in the Separation Plan.
(vii) To further guard against any disruption of fuel supplies for India, the United States is prepared to take other additional steps, such as :
a) Incorporating assurances regarding fuel supply in a bilateral U.S.?India agreement on peaceful uses of nuclear energy which would be negotiated.
b) The United States will join India in seeking to negotiate with the IAEA an India-specific fuel supply agreement.
c) The United States will support an Indian effort to develop a strategic reserve of nuclear fuel to guard against any disruption of supply over the lifetime of India’s reactors.
d) If despite these arrangements, a disruption of fuel supplies to India occurs, the United States and India would jointly convene a group of friendly supplier countries to include countries such as Russia, France and the United Kingdom to pursue such measures as would restore fuel supply to India.
In light of the above understandings with the United States, an India-specific safeguards agreement will be negotiated between India and the IAEA. In essence, an India-specific safeguards agreement would provide: on the one hand safeguards against withdrawal of safeguarded nuclear material from civilian use at any time, and on the other permit India to take corrective measures to ensure uninterrupted operation of its civilian nuclear reactors in the event of disruption of foreign fuel supplies. Taking this into account, India will place its civilian nuclear facilities under India-specific safeguards in perpetuity and negotiate an appropriate safeguards agreement to this end with the IAEA. In the terms of the Separation plan, there is hence assurance of uninterrupted supply of fuel to reactors that would be placed under safeguards together with India’s right to take corrective measures in the event fuel supplies are interrupted. The House can rest assured that India retains its sovereign right to take all appropriate measures to fully safeguard its interests.
During my Suo Motu Statements on this subject made on July 29, 2005 and on February 27, 2006, I had given a solemn assurance to this august House and through the Honorable members to the country, that the Separation Plan will not adversely effect our country’s national security. I am in a position to assure the Members that that this is indeed the case. I might mention:
i) that the separation plan will not adversely effect our strategic programme. There will be no capping of our strategic programme, and the separation plan ensures adequacy of fissile material and other inputs to meet the current and future requirements of our strategic programme, based on our assessment of the threat scenarios. No constraint has been placed on our right to construct new facilities for strategic purposes. The integrity of our Nuclear Doctrine and our ability to sustain a Minimum Credible Nuclear Deterrent is adequately protected. Our nuclear policy will continue to be guided by the principles of restraint and responsibility.
ii) The Separation Plan does not come in the way of the integrity of our three stage nuclear programme, including the future use of our thorium reserves. The autonomy of our Research and Development activities in the nuclear field will remain unaffected. The Fast Breeder Test Reactor and the Prototype Fast Breeder Reactor remain outside safeguards. We have agreed, however, that future civilian Thermal power reactors and civilian Fast Breeder Reactors would be placed under safeguards, but the determination of what is civilian is solely an Indian decision.
As I mentioned in my Statement on February 27, the Separation Plan has been very carefully drawn up after an intensive internal consultation process overseen by my Office. The Department of Atomic Energy and our nuclear scientific community have been associated with the preparation of the Separation Plan. The Chairman of the Atomic Energy Commission and the Principal Scientific Adviser to the Government of India were actively involved closely at every stage. I am in a position to assure the Hon’ble members that we have not permitted information of national security significance to be compromised in any way during the negotiations.
I believe that the significance of the July 18, 2005 Statement is the prospect it offers for ending India’s nuclear isolation. It will open up prospects for cooperation not only with the US but with countries like Russia, France and other countries with advanced nuclear capabilities, including those from the NSG. The scope for cooperation in the energy related research will vastly expand, so will cooperation in nuclear research activities. India will be able to join the international mainstream and occupy its rightful place among the top countries of the nuclear community. There would be a quantum jump in our energy generating capacity with a consequential impact on our GDP growth. It also ensures India’s participation as a full partner in cutting edge multilateral scientific effort in the nuclear field such as ITER and Generation IV Initiative.
Sir, successful implementation of the July 18 Joint Statement requires reciprocal actions by the United States as well as India. Steps to be taken by India will be contingent upon actions taken by the US. For our part, we have prepared a Separation Plan that identifies those civilian facilities that we are willing to offer for safeguards. The United States Government has accepted this Separation Plan. It now intends to approach the US Congress for amending its laws and the Nuclear Suppliers Group for adapting its Guidelines to enable full civilian cooperation between India and the international community. At the appropriate stage, India will approach the IAEA to discuss and fashion an India-specific safeguards agreement, which will reflect the unique character of this arrangement. Since such a safeguards agreement is yet to be negotiated it will be difficult to predict its content, but I can assure the House that we will not accept any provisions that go beyond the parameters of the July 18, 2005 Statement and the Separation Plan agreed between India and the United States, on March 2, 2006.We are hopeful that this process will move forward in the coming weeks and months.
I would request Hon’ble Members to look at this matter through the larger perspective of energy security. Currently, nuclear energy provides only three per cent of our total energy mix. Rising costs and reliability of imported hydrocarbon supplies constitute a major uncertainty at a time when we are accelerating our growth rate. We must endeavor to expand our capabilities across the entire energy spectrum ? from clean coal and coal-bed methane, to gas hydrates and wind and solar power. We are actively seeking international partnerships across the board and are members of many international initiatives dedicated to energy. Indeed, at the end of my talks with President Bush, we announced Indian participation in two more programmes: the Future-Gen programme for zero emission thermal power plants and the Integrated Ocean Drilling Programme for gas hydrates.
The House will appreciate that the search for an integrated policy with an appropriate mix of energy supplies is central to the achievement of our broader economic or social objectives. Energy is the lifeblood of our economy. Without sufficient and predictable access, our aspirations in the social sector cannot be realized. Inadequate power has a deleterious effect in building a modern infrastructure. It has a direct impact on the optimal usage of increasingly scarce water resources. Power shortage is thus not just a handicap in one sector but a drag on the entire economy.
I believe that the needs of the people of India must become the central agenda for our international cooperation. It is precisely this approach that has guided our growing partnership with the United States. I would, in particular, draw attention to the launching of the Knowledge Initiative in Agriculture with a three year financial commitment to link our universities and technical institutions and businesses to support agricultural education, research, capacity building, including in the area of bio-technology. Our first Green Revolution benefited in substantial measure from assistance provided by the US. We are hopeful that the Knowledge Initiative on Agriculture will become the harbinger of a second Green Revolution in our country.
Sir, India and the United States have much to gain from this new partnership. This was the main underlying theme of our discussions during the visit of President Bush. The resumption of civilian nuclear energy cooperation would demonstrate that we have entered a new and more positive phase of our ties, so that we can finally put behind us years of troubled relations in the nuclear field. I am confident that this is a worthy objective that will receive the full support of this House.
----------------------------------------
PM’s reply to the Lok Sabha debate on India's vote at the IAEA on Iran’s Nuclear Programme
March 6, 2006New Delhi
Mr. Speaker Sir,
Hon’ble Members have raised several points in the debate following my suo motu statement on our vote at the IAEA on Iran’s nuclear programme. I respect the views voiced by Hon. Members on this important issue and I thank them for contributing to the debate in this august House.
Several members have made the point that our foreign policy should be guided by national interests, and that our positions on such issues should not be based on the position of other countries. My friends, Shri Gurudas Dasgupta and Shri Subroto Bose made these points, as did Shri Kharabela Swain. There can be no two opinions that Government should not take predetermined positions, or positions at the behest of other nations. No one can dispute that it is Government’s duty to take a position on such matters after a dispassionate examination of the facts, keeping in mind our national interests. I respectfully submit that in the present case, the Government has done precisely this. We have considered the facts and have exercised our independent judgment before taking a position. This is also the very essence of the policy of Non Alignment, which my friend Shri Rupchand Pal exhorted us to follow.
Let me recapitulate the essential facts of the matter :
Ø Iran has the legal right to develop peaceful uses of nuclear energy, but it also has certain obligations and responsibilities, based on the Safeguards Agreement which it voluntarily undertook with the IAEA
Ø It was in recognition of the existence of several unanswered questions that Iran agreed to start the process of assisting IAEA with investigations into several past activities.
Ø An important part of this process was the voluntary suspension by Iran of all enrichment and reprocessing activity in November 2004.
Ø However, since last August, Iran has renewed production of Uranium Hexafluoride, and since then, of uranium enrichment.
Ø Unresolved question regarding centrifuge imports and designs to make uranium metallic hemispheres remain. The origin of such procurement is an issue of direct concern for us.
Under these circumstances, our position was based on these facts, which emerged from an objective investigation by the IAEA, and through information disclosed by Iran itself.
Mr. Speaker Sir,
There is also the question that several Hon. Members raised regarding the IAEA Board of Governors’ meeting today. Shri Chandrappan and Shri Owaisi spoke of this. I should inform Members that it is as yet not clear in what manner this issue will be taken up by the Board of Governors today. The Resolution adopted by the IAEA Board of Governors last month mentions certain steps that Iran and the IAEA will be taking. Discussions are taking place in Vienna on this matter. The Government’s approach will be based on our consistent policy of promoting efforts for a resolution of issues through dialogue and discussions. I would like to assure Hon. Members that Government will take into account the sentiments expressed in this House in this context.
Some points were also made regarding options that could have been explored by the international community. There have also been discussions between Iran and Russia in this regard. We remain hopeful that solutions acceptable to all sides will be found. We do not favour confrontation, rhetoric or coercive measures as these only exacerbate tensions in the region and beyond. India has consistently stated that all sides must work to find mutually acceptable compromise solutions, and that confrontation should be avoided at all costs. For this to be possible, time must be given for diplomacy to work. I think there is consensus in Parliament and in our country that confrontation is not in the interests of India or of our region. Whenever the matter is taken up, we will work with all like-minded countries, including those from the NAM, for a mutually acceptable resolution of the issue.
Mr. Speaker Sir,
Several Hon. Members, including Maj Gen Khanduri expressed concerns regarding our relations with Iran, and the effect of these developments on this important relationship. As I said in my suo motu statement, our Government is committed to widening, deepening and expanding our diverse and mutually beneficial ties with Iran. Only recently, my colleague the Minister of State for External Affairs, Shri E Ahammed, visited Tehran. He had meetings with the President of Iran, H.E. Mr. Ahmadinejad, as well as several Ministers of the Government of the Islamic Republic of Iran. Shri Ahammed emphasized our desire to remain engaged with Iran on all issues of mutual interest. Our desire to further deepen the friendly and productive ties between our two countries was fully reciprocated.
Government will continue to monitor the situation closely, and will deal with the Iran issue with the seriousness that it merits.
In dealing with this issue, we will pay due attention to our relationship with Iran, the need to maintain peace and stability in the Gulf region and safeguarding our own security.
I reiterate that this House can rest assured that we will also take into account the sentiments expressed in the House.
Thank you.
-----------------------------------------------------
PM's opening remarks at the Joint Press Conference with US President Bush
March 2, 2006New Delhi
Ladies and Gentlemen of the Press,
President Bush and I have completed very cordial and productive discussions this morning. We reviewed the status of our cooperation, including the agenda that we set on July 18, 2005. The Joint Statement that will be shared with all of you today contains a number of announcements and initiatives that underline the significant progress in our relationship.
Many of the areas that our cooperation now covers are central for India’s national development. They include energy, agriculture, science & technology, trade & investment, high-technology, health and a clean environment. This is an ambitious agenda, one that is befitting our growing strategic partnership. When implemented, they will make a real difference to the lives of our people.
The President and I had an opportunity to review the global situation in our talks. As you are all aware, India and the United States are working together increasingly on global issues. This is not just good for our two countries but also benefits the international community as we can complement each others capabilities and share responsibilities. President Bush is admired for his strong position on terrorism and I was particularly pleased that we agreed on the need to root out terrorism, of which India has been a major victim.
We discussed the progress made in the implementation of our understanding on Civil Nuclear Cooperation of July 18, 2005. I conveyed to the President that India has finalized the identification of civilian facilities to which we had committed. I was pleased to hear from the President that he now intended to approach the US Congress to amend US laws, and the Nuclear Suppliers Group to adjust its guidelines. We will be starting discussions with the IAEA in regard to fashioning, an appropriate Safeguards Agreement and subsequently and Additional Protocol. You will appreciate I cannot say more now while Parliament is in session.
Before concluding, I would like to express my warm appreciation for the personal interest shown and leadership role that President Bush has played in transforming our ties. I have met the President a number of times and on each occasion, I have admired his vision, his resolve and his commitment to our bilateral relations. Our discussions today make me confident that there are no limits to the Indo-US partnership.
May I invite you, Mr. President, to make your remarks?
---------------------------------------------------------------
PM’s opening remarks to the Indo- US CEO’s Forum
March 2, 2006New Delhi
Mr. President, Ladies and Gentlemen,
I have already welcomed President George Bush and Mrs Bush on this their frist visit to India. I would now like to welcome the US CEO’s who have traveled to Inda for this meeting.
The President and I have just concluded our official discussions and I am sure he shares my pleasure in being able to meet with the CEO’s group. The establishment of this group last year was an important initiative aimed at creating a parallel track in which the private sectors of the two countries could interact and lay out a road map for cooperation.
I would like to thank the two Co-Chairs Mr. William Harrison and Mr. Ratan Tata and their colleagues for the work done in preparing the report which they will now present.
I have been briefed on the main recommendations and I am happy to say that some of the recommendations are already reflected in the decisions which the President and I have taken today. I will have more to say on the other recommendations a little later.
I now invite President Bush to share his thoughts and initiate the discussion.
---------------------------------------
PM’s speech at the banquet for President Bush
March 2, 2006New Delhi
President Bush, Madame First Lady, Ladies and Gentlemen,
I am delighted to welcome you and your distinguished delegation to India. We are pleased to have you in our midst.
It is our privilege to return your warm hospitality at the White House. The people of India have great regard and affection for the American people, as they have had for centuries. Ours has long been a two-way relationship. Long years ago, the Father of our Nation, Mahatma Gandhi, acknowledged the influence of Henry David Thoreau when he launched a movement for civil disobedience against foreign rule. In our own generation, a great son of the United States, Martin Luther King, acknowledged the influence of Gandhiji, when he launched a non-violent struggle for civil liberties and racial equality.
Mr. President;
Close to half a century ago President Eisenhower said on a visit to India: “We who are free – and who prize our freedom above all other gifts of God and nature – must know each other better; trust each other more; support each other.” Today those words have a new resonance.Your people and ours have come to regard democracy and peaceful political mobilization as legitimate and civilised instruments of social change. Our passionate commitment to democracy and human rights, our respect for equality of all before the law and our regard for freedom of speech and faith place us on the same side of history.
Today, in India, we are engaged in a Himalayan adventure of pursuing development, improving the quality of life and modernizing one of the world’s oldest civilizations. We seek to provide a social and economic environment at home that will unleash the creativity and enterprise of every Indian, thus enabling our people to live a life of dignity, fulfillment and self-respect. The United States has long been a partner in our journey of progress. I am therefore happy that on this visit you will renew an old association between our countries in the field of agriculture. Our farmers greatly benefited from American help in the past, and they will now do so again through the knowledge initiative that you will launch.
In India, we admire the creativity and enterprise of the American people, your excellent institutions, the openness of your economy and your ready embrace of diversity. These have attracted the brightest Indian minds, thereby creating a bridge of understanding that transcends distance and differences between us. Tomorrow, you will meet young Indians who fuel the engines of our knowledge economy. Your own country has made it possible for the talent and abilities of our people to become more visible to all.
Mr. President,
We seek a world free of poverty, ignorance, disease and the threat of terrorism. The United States and India must work together in all possible forums to these ends. We must fight terrorism wherever it exists, because terrorism anywhere threatens democracy everywhere.
India seeks a neighbourhood of peace and prosperity. Our sub-continent of ours has been home to all the great religions of the world. It is a powerhouse of human creativity, where knowledge is worshipped as the gift of our creators. With wisdom and farsightedness, we South Asians can transform not just this region, but the whole world. In our journey of modernization and development, social change and empowerment, we see the United States as a partner, a friend and a well-wisher.
In particular, Mr. President, we see you as a true friend of India. I have always been touched by your warm praise for India and the Indian people. We sincerely acknowledge your deep personal commitment to a closer economic and strategic partnership between our two countries. Indeed, I recall that at our very first meeting you paid tribute to our efforts to achieve economic and social salvation in the framework of an open society and an open economy. I was deeply touched by your admiration for Indian democracy and our commitment to pluralism and modernism.
We in India greatly appreciate the firm stand you took against the upsurge of protectionist forces in your country and the farsighted approach you adopted on the issue of outsourcing. In taking this stand you have not only cemented closer relations between our two countries but also helped America retain its edge in the global market.
Madame First Lady, my wife and I recall with gratitude your warm hospitality at your home. You have a deep and abiding interest in learning and education. I hope you will return to India to spend time with our students and teachers and discover a new India in the making. I am truly sorry that the President is not taking you to Taj Mahal this time! I hope he will be more chivalrous the next time you are here!
I now request you to join me in a toast:
To the continued good health and happiness of the President and First Lady;
To ever-lasting friendship between our great nations.
Thank you.
--------------------------------------------------------------------
PM’s statement in Parliament on Civil Nuclear Energy Cooperation with United States
February 27, 2006New Delhi
“I rise to inform this august House of the status of discussions with the United States on civil nuclear energy co-operation. Substantive aspects of this are reflected in the Joint Statement of July 18, 2005 that US President Bush and I agreed upon during my visit to Washington DC last year. I would like to use this occasion to outline the context and core elements of the Joint Statement, before detailing the status of the ongoing negotiations.
Hon’ble Members are aware that our effort to reach an understanding with the United States to enable civil nuclear energy cooperation was based on our need to overcome the growing energy deficit that confronts us. As India strives to raise its annual GDP growth rate from the present 7-8% to over 10%, the energy deficit will only worsen. This may not only retard growth, it could also impose an additional burden in terms of the increased cost of importing oil and natural gas, in a scenario of sharply rising hydrocarbon prices. While we have substantial reserves of coal, excessive dependence on
coal-based energy has its own implications for our environment. Nuclear technology provides a plentiful and non-polluting source of power to meet our energy needs. However, to increase the share of nuclear power in our energy mix, we need to break out of the confines imposed by inadequate reserves of natural uranium, and by international embargos that have constrained our nuclear programme for over three decades.
Established through the vision of Pandit Jawaharlal Nehru and sustained by the commitment of scientists like Dr. Homi Bhabha, our nuclear programme is truly unique. Its uniqueness lies in the breadth of its overarching vision: of India mastering a three-stage nuclear programme using our vast thorium resources, and mastering more complex processes of the full nuclear fuel cycle. Consequently, our civilian and strategic programmes are deeply intertwined across the expanse of the nuclear fuel cycle. There are hardly any other countries in a similar situation. Over the years, the maturation of our nuclear programme, including the development of world-class thermal power reactors, has made it possible to contemplate some changes. These are worth considering if benefits include gaining unhindered access to nuclear material, equipment, technology and fuel from international sources.
However, international trade in nuclear material, equipment and technologies is largely determined by the Nuclear Suppliers’ Group (NSG)—an informal group of 45 countries. Members include the United States, Russia, France and the United Kingdom. India has been kept out of this informal arrangement and therefore denied access to trade in nuclear materials, equipment and various kinds of technologies. It was with this perspective that we approached negotiations with the United States on enabling full civilian nuclear energy cooperation with India. The essence of what was agreed in Washington last July was a shared understanding of our growing energy needs. In recognition of our improved ties, the United States committed itself to a series of steps to enable bilateral and international cooperation in nuclear energy. These include adjusting domestic policies, and working with allies to adjust relevant international regimes. There was also a positive mention of possible fuel supply to the first two nuclear power reactors at Tarapur. US support was also indicated for India’s inclusion as a full partner in the International Thermonuclear Experimental Research Project and the Generation IV International Forum.
But more importantly, in the Joint Statement, the United States implicitly acknowledged the existence of our nuclear weapons programme. There was also public recognition that as a responsible State with advanced nuclear technologies, India should acquire the same benefits and advantages as other States which have advanced nuclear technology, such as the United States. The Joint Statement offered the possibility of decades-old restrictions being set aside to create space for India’s emergence as a full member of a new nuclear world order.
On our part, as Hon’ble Members may recall from my suo motu statement on July 29 last year, we committed ourselves to separating the civilian and strategic programme. However this was to be conditional upon, and reciprocal to, the United States fulfilling its side of the understanding. I had stressed that reciprocity was the key and we expected that the steps to be taken by India would be conditional upon and contingent on action taken by the United States. I had emphasized then—and I reiterate today—that no part of this process would affect or compromise our strategic programme.
I now come to the negotiations that have taken place in the past few months. While these have been principally with the US, there have been discussions with other countries like Russia, UK and France as well. At the political level, I have maintained contact with President Chirac of France, President Putin of Russia, Prime Minister Blair of the UK. I have also raised this subject with the Heads of State/Government of Norway, Republic of Korea, Netherlands, Czech Republic and Ireland - all members of the NSG. I also met President Bush in New York last September and discussed implementation of the July 18 statement. In the same period, several American Congressional leaders and policy-makers have visited India in the past few months, many of whom met me. We have amply clarified our objective in pursuing full civil nuclear energy cooperation for our energy security and to reassure them of India’s impeccable non-proliferation credentials.
At the official level, we have constituted two groups comprising key functionaries concerned with strategic and nuclear matters. They included the Department of Atomic Energy, the Ministry of External Affairs, the Armed Forces and my Office. These two groups were respectively mandated to draw up an acceptable separation plan, and to negotiate on this basis. The directive given to both groups was to ensure that our strategic nuclear programme is not compromised in any way, while striving to enlarge avenues for full civil nuclear energy cooperation with the international community. The negotiations by our officials have been extensive and prolonged. These have focused on four critical elements: the broad contours of a Separation Plan; the list of facilities being classified civilian; the nature of safeguards applied to facilities listed in the civilian domain; and the nature and scope of changes expected in US domestic laws and NSG guidelines to enable full civilian nuclear energy cooperation with India.
Hon’ble Members may be assured that in deciding the contours of a separation plan, we have taken into account our current and future strategic needs and programmes after careful deliberation of all relevant factors, consistent with our Nuclear Doctrine. We are among very few countries to adhere to the doctrine of ‘No first Use’. Our doctrine envisions a credible minimum nuclear deterrent to inflict unacceptable damage on an adversary indulging in a nuclear first strike. The facilities for this, and the required level of comfort in terms of our strategic resilience have thus been our criterion in drawing up a separation plan. Ours is a sacred trust to protect succeeding generations from a nuclear threat and we shall uphold this trust. Hon’ble Members may therefore be assured that in preparing a Separation Plan, there has been no erosion of the integrity of our Nuclear Doctrine, either in terms of current or future capabilities.
The Separation Plan that is being outlined is not only consistent with the imperatives of national security, it also protects our vital research and development interests. We have ensured that our three-stage nuclear programme will not be undermined or hindered by external interference. We will offer to place under safeguards only those facilities that can be identified as civilian without damaging our deterrence potential or restricting our R&D effort, or in any way compromising our autonomy of developing our three stage nuclear programme. In this process, the Department of Atomic Energy has been involved at every stage, and the separation plan has been drawn up with their inputs.
Therefore, our proposed Separation Plan entails identifying in phases, a number of our thermal nuclear reactors as civilian facilities to be placed under IAEA safeguards, amounting to roughly 65% of the total installed thermal nuclear power capacity, by the end of the separation plan. A list of some other DAE facilities may be added to the list of facilities within the civilian domain. The Separation Plan will create a clearly defined civilian domain, where IAEA safeguards apply. On our part, we are committed not to divert any nuclear material intended for the civilian domain from designated civilian use or for export to third countries without safeguards.
Negotiations are currently at a delicate stage. In our dialogue with our interlocutors, we have judged every proposal made by the US side on merits, but we remain firm in that the decision of what facilities may be identified as civilian will be made by India alone, and not by anyone else.
At the same time, we are not underestimating the difficulties that exist in these negotiations. There are complex issues involved. Several aspects of the nuclear programme lend themselves in the public discussions to differing interpretations, such as the Fast Breeder Programme or our fuel-cycle capabilities such as re-processing and enrichment requirements. The nature and range of strategic facilities that we consider necessarily outside safeguards constitute yet another example. We have however conveyed to our interlocutors that while discussing the Separation Plan, there are details of the nature and content of our strategic requirements that we cannot share. We will not permit information of national security significance to be compromised in the process of negotiation.
It is essential to recall that the July 18 Statement was not about our strategic programme. It was intended to be the means to expand our civilian nuclear energy capacities and thereby to help pave the way for faster economic progress. In seeking to achieve this objective, we appreciate the need for patience to remove misperceptions that abound. I reiterate that India has an exemplary record on non-proliferation and this will continue to be so. All in all, one major achievement so far is that a change is now discernible in the international system. We believe that when implemented, the understandings reflected in the Joint Statement will give India its due place in the global nuclear order. The existence of our strategic programme is being acknowledged even while we are being invited to become a full partner in international civil nuclear energy cooperation.
I must emphasize that the nation is justly proud of the tremendous work of our nuclear scientists and the Department of Atomic Energy in mastering all the key aspects of the full nuclear fuel cycle, often under difficult circumstances. The tremendous achievements of our scientists in mastering the complete nuclear fuel cycle - the product of their genius and perseverance – will not be frittered away. We will ensure that no impediments are put in the way of our research and development activities. We have made it clear that we cannot accept safeguards on our indigenous Fast Breeder Programme. Our scientists are confident that this technology will mature and that the programme will stabilize and become more robust through the creation of additional capability. This will create greater opportunities for international cooperation in this area as well. An important reason why the US and other countries with advanced nuclear technologies are engaging with India as a valued partner is precisely because of the high respect and admiration our scientists enjoy internationally, and the range and quality of the sophisticated nuclear programme they have managed to create under the most difficult odds. This gives us confidence to engage in these negotiations as an equal partner.
As I said, many aspects of the proposed separation plan are currently under negotiation. It is true that certain assurances in the July 18 Statement remain to be fulfilled – the supply of imported fuel for Tarapur I and II, for one. Some elements, such as US support for India’s participation in the ITER programme, have materialized. The issue of the nature of safeguards to be applied to facilities designated civilian also remains pending resolution. I seek the indulgence of this House not to divulge every single detail of the negotiations at this time. However, this august House can be assured that the limits are determined by our overarching commitment to national security and the related issue of the autonomy of our nuclear programme. Our Government will take no step that could circumscribe or cast a shadow over either.
I am aware that concerns have been raised over information being shared with outsiders, but not with our own citizens. Members may be assured that nothing that could compromise our nuclear deterrent has been shared with anyone. On this aspect there is no reason for concern or doubt.
As I said at the outset, our approach is defined by the need to utilize the window of opportunity before us, to find a solution to our energy deficit. We have also been guided by the need to dismantle international restrictions, which, when achieved, could unleash our scientific talent and increase commercial potential in the nuclear and related sectors. The nation will be kept informed, through this august House.”
------------------------------------------------------
PM’s Suo Motu Statement on Iran
February 17, 2006New Delhi
Taking into account the concerns that have been raised about India’s vote on the Iran nuclear issue at the meeting of the Governing Board of the International Atomic Energy Agency in Vienna, on February 5, 2006, I rise to apprise this august House of the facts of this matter.
Let me begin by affirming that India’s vote on the IAEA resolution does not, in any way, detract from the traditionally close and friendly relations we are privileged to enjoy with Iran. Indeed, India-Iran ties, as we have repeatedly emphasized, are civilizational in nature. We intend to further strengthen and expand our multifaceted ties with Iran to mutual benefit.
Let me also state that the importance of India’s relations with Iran is not limited to any single issue or aspect. This relationship is important across a wide expanse of cooperation, both bilateral and multilateral. We also cooperate on regional issues. We value this relationship and intend to do what we can to nurture our bilateral ties. Let me reiterate in this context that we are committed to the proposed Iran-Pakistan-India gas pipeline. The economics of this project is currently under professional investigation by internationally reputed consultants. This is a necessary step in taking the pipeline project forward.
On the specific issue of Iran’s nuclear programme, let me reiterate what I have said publicly on several occasions. As a signatory to the NPT, Iran has the legal right to develop peaceful uses of nuclear energy consistent with its international commitments and obligations. It is incumbent upon Iran to exercise these rights in the context of safeguards that it has voluntarily accepted upon its nuclear programme under the IAEA.
These rights and obligations must also be seen in context of developments since 2003, when IAEA began seeking answers to a number of questions arising from Iran’s nuclear activities, some of which were undeclared to the IAEA in previous years. Subsequently, in context of these demands, Iran did extend cooperation to the IAEA in investigations of its some of these activities.
In November 2004, Iran agreed with the EU-3 (France, Germany, and the UK) to voluntarily suspend all enrichment and reprocessing activities until questions relating to its past nuclear activities were clarified by the IAEA. However, since August last year, Iran has renewed production of uranium hexafluoride and thereafter, has resumed uranium enrichment.
Successive reports of the Director General of the IAEA have noted that while Iran’s cooperation has resulted in clarifying a number of questions, there remain many unresolved questions on key issues. These include the use of centrifuges imported from third countries, and designs relating to fabrication of metallic hemispheres. Hon’ble Members are aware that the source of such clandestine proliferation of sensitive technologies lies in our own neighbourhood, details of which have emerged from successive IAEA reports. This august House will agree that India cannot afford to turn a blind eye to security implications of such proliferation activities.
The objectives of upholding Iran’s rights and obligations and our security concerns arising from proliferation activities in our extended neighbourhood have shaped our position. Therefore, our approach has been consistently in favour of promoting all efforts to find a solution, based on acceptable mutual compromises, in which Iran’s interests and the concerns of the international community would be addressed. We have consistently worked to promote a consensus in the IAEA towards this end. This has been the logic of our stand at the IAEA Board of Governors Meetings both in September 2005 and earlier this month.
I might remind Hon’ble Members that it is only on these two occasions that the Resolution that resulted has not been a consensus one, and a vote has been necessary. Despite that, in the latest vote this month, the Resolution not only had the support of all P-5 countries including Russia and China, but also of important NAM and developing countries such as Argentina, Brazil, Egypt, Ghana, Singapore, Yemen and Sri Lanka.
The resolutions passed in September last year and earlier this month underlined the need for time to be given for diplomatic efforts to continue. The recent resolution of February 5 asks the Director General of IAEA to inform the UN Security Council of the status of negotiations with Iran, and the steps that Iran needs to take to address these questions. It calls for continued diplomatic efforts including through exploration of the option provided by Russia, which we have supported. Hon’ble Members are aware that Russia had offered to locate a joint venture project on Russian soil to address Iranian needs for enriched uranium, provided Iran suspends its enrichment programme to increase international confidence regarding the unresolved questions of the last two decades. Russia and Iran are currently in discussions on the subject, and we remain hopeful of a positive outcome. It is our hope and belief that the issues that have arisen can still be resolved through discussion and dialogue.
Mr. Speaker, Sir,
I have set out the background in which we have taken a position at the IAEA. I would like to reiterate our unshakeable conviction that such a sensitive issue, which concerns the rights and international obligations of sovereign nation and a proud people can only be addressed through calm, reasoned diplomacy and the willingness on all sides to eschew confrontation and seek acceptable compromise solutions. We are therefore deeply concerned by escalating rhetoric and growing tensions and the possibility of a confrontation over this issue. This is a matter of concern for us as tensions in this region ¾ where our vital political, economic and security interests are involved ¾ affects us directly. The region hosts 3.5 million Indian citizens whose welfare is a major concern of my Government.
We therefore call upon all concerned to exercise restraint, demonstrate flexibility and continue with dialogue, to reach an amicable solution. As I mentioned, there will be another meeting of the IAEA Board in March this year at which a full and regular report will be presented by the IAEA Director-General. In the days to come, we will support diplomatic efforts in this regard, drawing upon our friendly relations with all the key countries involved.
The Government is conscious of the need to balance several important considerations in this regard. We have a strong and valuable relationship with Iran which we would like to take forward in a manner that is mutually beneficial. We have great respect and admiration for the Iranian people with whom our fraternal ties go back several millennia. We have every intention of ensuring that no shadow is cast on these bonds.
In the overall context that I have outlined in detail, I am confident that this august House will agree that the stance taken by this Government has been consistent and in keeping with our own well considered and independent judgment of our national interests. I am confident that this policy will receive the support of this House and our nation. | null | minipile | NaturalLanguage | mit | null |
[Studies on genus Pleurotus. VIII. Interaction between mycelial growth and yield].
This project studies the relationship between mycelial growth rate and production of basidiomata of 19 Pleurotus strains. Firstly, monosporic cultures were isolated of five strains from the following species: Pleurotus djamor (3), Pleurotus ostreatus (1) and Pleurotus pulmonarius (1). These were self-crossed in order to obtain 25 infraspecific dikaryons from which their mycelial growth rate was estimated. The parent strains and the 14 fastest growing crosses were cultivated in the pilot plant on barley straw with the following data recorded: days of incubation, primordia initiation, number of harvests, biological efficiency (BE), production rates (PR) and size of the basidiomes. The BE's fluctuated between 16.8 to 75.6% and the PR's between 0.34 to 1.68%. Most of the basidiomata presented a pileus diameter of 5-15 cm. With the exception of one cross with P. djamor, no increase was observed in the productivity and size of the carphophores of the crosses with respect to the parent strains, suggesting that the rapid mycelial growth rate of the strains was not reflected in the development of the fruiting bodies. | null | minipile | NaturalLanguage | mit | null |
The Hainan black goat, also known as the Hainan East goat, is a local goat breed that has long been bred in the unique natural ecological environment of Hainan Province of China. It has the advantages of being resistant to high temperature, humidity, and various diseases, with tender and delicious meat without uncomfortable flavor, making it a popular choice among consumers \[[@r1]\]. Currently, research on black goats is mainly focused on improving their production performance and meat quality by changing the feed nutrient composition. Adding n-3 polyunsaturated fatty acid (PUFA) rich oil to the feed can significantly increase the number of preovulatory follicles and ovulation rate, and also mediate the improvement of kidding rate \[[@r2]\]. Similarly, melatonin can increase the oocyte viability in juvenile goat, as it can increase the number and quality of embryos \[[@r3]\].
Proteomics studies assess the protein characteristics on a large scale, including the expression level, posttranslational modifications, and protein-protein interactions. This emerging technology has improved our understanding of the dynamic changes in the life of proteins. The isobaric tags for relative and absolute quantitation (iTRAQ) technology can simultaneously use isotope-based reagents to label eight polypeptide samples. The labeled polypeptide samples are mixed in equal volumes and analyzed by liquid chromatography separation and tandem mass spectrometry (LC-MS/MS), and the first and second stage mass spectrum information of each peptide are obtained. In the first-order MS, the same peptides from different samples show the same mass-to-charge ratio. In the second-order MS, the mass-to-charge ratios of peptide fragment ions and the signal intensities of the eight iTRAQ reporter ions indicate the peptide sequence information, and the relative expression of the peptide in different samples. The identified proteins and their differential expression in each sample can be identified through bioinformatics analysis \[[@r4], [@r5]\].
Since its development, iTRAQ technology has been widely used in quantitative proteomics research because of its unique advantages. Using the serum of locoweed-poisoned and healthy rabbits for quantitative protein analysis by iTRAQ, Zhang *et al*. \[[@r6]\] have found that locoweed may damage the rabbit's nerve cells to reduce its immunity. Wei *et al*. \[[@r7]\] ethave used iTRAQ technology to measure the protein expression in the serum of Wistar rats exposed to different concentrations of sodium fluoride, and found that differentially expressed proteins mainly belonged to complement and coagulation cascades, inflammatory responses, and complement activation pathways, indicating that inflammation and immune response may play a key role in the mechanism of fluorosis. Ren *et al*. \[[@r8]\] have used iTRAQ technology to study the changes in protein expression in sheep liver caused by overgrazing. They found that the reduction in animal growth caused by overgrazing was associated with changes in the liver proteome, especially in proteins involved in nitrogen compound metabolism and immunity.
Hainan black goats usually attain sexual maturity at 4--6 months of age, and first breed at 7--8 months of age. They normally produce a single kid per year and sometimes three kids in two years. The reproductive performance and milk yield are relatively low. It is well-known that proteins in serum change with the shift of age, physiological state, and nutritional conditions, which directly reflect the pathological and physiological condition of an individual. In addition, serum collection is convenient and causes less stress on the goats. It avoids killing the experimental goats, which will be used for continuous observation and sampling. To date, research on the reproduction of Hainan black goats has not been reported. In this study, we used iTRAQ proteomics technology to analyze the protein expression in the Hainan black goat serum during the anestrous, estrus, gestation, and lactation periods. Our aim was to explore the changing patterns of differentially expressed proteins during the reproductive cycle of Hainan black goats, and to provide basic data for their breeding.
Materials and Methods {#s1}
=====================
Ethical statement for animal care
---------------------------------
All procedures were approved by the animal care and use committee of Hainan University (HU 20170912). All efforts were made to minimize the suffering of animals during the sampling process and sacrifice.
Sample collection
-----------------
In this study, we divided the breeding cycle of the ewes into four stages: anestrous period (from the end of lactation to the next estrus), 1--2 days of estrus period (follicular phase), 3--4 months of gestation period, and a month of lactation period. Twelve healthy one-and-a-half-year-old Hainan black goats, well-developed in Hainan black goat Breeding Base were selected. Each period contained three individuals as the biological repeats. The blood samples were collected from the jugular veins of experimental animal, and allowed to stand for 2 h without violent shocks. After the blood coagulated and serum separated out, the samples were centrifuged at 4390 × *g* for 10 min, the supernatant was removed, marked, and placed in --80°C refrigerator for later use.
Experiment process
------------------
In this study, the extracted serum proteins were assessed for quality, and then pretreated with alkylation, enzymolysis, and salt removal. Peptides were labeled with iTRAQ tags and separated by liquid chromatography, the end of separation was connected to the mass spectrometer. The raw data of the mass spectrometry was converted, searched in the database, and assessed for quality. The qualified samples were further analyzed using bioinformatics ([Fig. 1](#fig_001){ref-type="fig"}Fig. 1.Experimental flowchart.).
Protein extraction and quality control
--------------------------------------
Proteins were extracted using the Protominer kit (BioRad, Hercules, CA, USA), and protein concentration and sample integrity were assessed by the Bradford assay (Amresco, Burlington, NC, USA), and polyacrylamide gel electrophoresis (BBI, Shanghai, China).
Sample marking and loading
--------------------------
To 100 μg of protein solution, 2.5 μg of Trypsin enzyme (Promega, Madison, WI, USA) was added, and incubated at 37ºC for 4 h; then, Trypsin enzyme was supplemented once again, and incubated at 37ºC for 8 h. The enzymatic peptides were desalted and vacuum-dried using Strata X column (Phenomenex, Los Angeles, CA, USA). Fifty microliters of isopropanol (Fisher Scientific, Waltham, MA, USA) was added, the samples were vortexed, and then centrifuged at 4000 r/min for 5 min. The peptide samples were dissolved in 0.5 M TEAB (SCIEX, Framingham, MA, USA), and added to the corresponding iTRAQ tagging reagents (SCIEX); different iTRAQ tags were used for different samples (SCIEX). The samples were allowed to stand for 2 h at room temperature. The separation was performed by LC-20AD nanoliter liquid chromatograph (Shimadzu, Kyoto, Japan), and the Triple TOF 5600 mass spectrometer (SCIEX) was attached to the end.
Mass spectrometry detection
---------------------------
The liquid-phase separated peptides were subjected to mass spectrometry, with parameters set as follows: the ion source (SCIEX) spray voltage was 2300 V, and nitrogen pressure was 30 psi. The spray gas was 15, and spray interface was at 150ºC. The high-sensitivity mode was used for scanning. The cumulative time of the first-level mass spectrum scan was 250 msec, and the scanning mass range was 350--1500 Da. According to the ionic strength in the first-order spectrum from high to low, select the top 30 with the intensity exceeding 150 cp for fragmentation and scan the secondary information. The screening criteria were as follows: the m/z range was 350--1250 Da; the number of charges was 2--5; dynamic exclusion of parent ions was set such that in half of the peak time (about 12 sec) and the fragmentation of the same parent ion was not more than 2 times. The cumulative scan time of the secondary mass spectrometer was 100 msec. For the iTRAQ type of data acquisition, the fragmentation energy selection was adjusted according to the iTRAQ reagent, and the ion transmission efficiency of the second quadrupole Q2 at 100 Da was 100%. The product time was 100 msec.
Bioinformatics analysis
-----------------------
The original MS data was converted into MGF format by the Proteo Wizard tool msConvert software (<http://proteowizard.sourceforge.net/>). The MGF file was compared with Mascot software (<http://www.matrixscience.com/>) and protein sequence database to obtain the final protein identification result.
iTRAQ data was quantified using IQuant software \[[@r9]\]. The 1% FDR (false discovery rate) filtration was initially performed at the spectrum/peptide level to obtain significant spectra and peptides lists. Based on the parsimony principle \[[@r10]\], peptides were used for protein assembly to generate a series of protein groups. In order to control the false positive rate of protein detection, the protein level was again filtered with FDR 1%, the strategy used was Picked protein FDR \[[@r11]\].
The GO (Gene Ontology) functional annotation was performed by Blast2go software, and all identified proteins were compared with the corresponding non-redundant (NR) protein database (ftp://ftp.ncbi.nlm.nih.gov/genomes/Capra_hircus/protein/protein.fa.gz) to obtain the corresponding GO function. In the GO enrichment analysis of differentially expressed proteins, the hypergeometric test was used to find significantly enriched GO items, by comparing the differentially expressed protein to all the proteins identified. Pathway enrichment analysis of differentially expressed proteins was similar to GO enrichment analysis.
Results {#s2}
=======
iTRAQ identification
--------------------
Samples that passed the quality control test were analyzed by LC-MS/MS, and a total of 1,011,548 secondary spectrograms were generated. A total of 5745 peptides and 1213 proteins were identified under the "1% FDR" filtration standard ([Table 1](#tbl_001){ref-type="table"}Table 1.Overview of protein identificationSample nameTotal spectraSpectraUnique spectraPeptideUnique peptideProteinCapra_hircus_1338816226542077638313563722Capra_hircus_2335614235802176239843760746Capra_hircus_3337118279582494443163983825Total10115487419267482574554651213 and [Supplementary files 1--3](https://www.jstage.jst.go.jp/article/jrd/65/5/65_2018-105/_supplement/_download/65_2018-105_1.zip): online only). Three repeat groups identified 722, 746, and 825 proteins, and the number of proteins identified in all three groups was 442 ([Fig. 2](#fig_002){ref-type="fig"}Fig. 2.Venn diagram of protein quantitation. Three different colors represent three biological repeats, blue represents repeat 1, red represents repeat 2, and green represents repeat 3.).
In this study, the four stages of the reproductive cycle were compared with each other to identify differentially expressed serum proteins. The distribution of coefficient of variance (CV) in the three replicate experiments ([Fig. 3](#fig_003){ref-type="fig"}Fig. 3.Distribution of coefficient of variance (CV) in the repeated experiments. The X axis represents the CV distribution range, the Y axis represents the number of proteins in the corresponding CV range, and the right side of the figure is the number of accumulated proteins in each CV range. a\~f represent the repetition test CV distribution for the four stages of the reproductive cycle: a. anestrous period-*vs.*-estrus period; b. anestrous period-*vs.*-gestation period; c. anestrous period-*vs.*-lactation period; d. gestation period-*vs.*-estrus period; e. lactation period-*vs.*-estrus period; f. lactation period-*vs.*-gestation period.) was found to be concentrated in the range of 0 to 30%, and the cumulative number of proteins below 30% of CV distribution was 74%, 83%, 77%, 79%, 78%, and 86%, indicating good repeatability of the data.
Proteins that showed significant differential expression were screened using the values of fold change \> 1.2 and Q-value \< 0.05. The number of differentially expressed proteins was highest in the anestrous and gestation periods, with 63 upregulated and 138 downregulated proteins, and the lowest number of differentially expressed proteins in the anestrous period compared with the lactation period was a total of 106 proteins (46 upregulated and 60 downregulated). Compared with the estrus period, 101, 93, and 66 proteins were upregulated, and 69, 79, and 75 proteins were downregulated during the gestation, lactation, and anestrous periods, respectively. The number of proteins that were up- and downregulated in the lactation period compared to the gestation period was 58 and 101 proteins, respectively ([Table 2](#tbl_002){ref-type="table"}Table 2.List of differently expressed proteinsCompare groupUpregulatedDownregulatedAll-regulatedanestrous period-*vs.-*estrus period6675141anestrous period-*vs.-*gestation period63138201anestrous period-*vs.-*lactation period4660106gestation period-*vs.-*estrus period10169170lactation period-*vs.-*estrus period9379172lactation period-*vs.-*gestation period58101159 and [Supplementary files 4--9](https://www.jstage.jst.go.jp/article/jrd/65/5/65_2018-105/_supplement/_download/65_2018-105_1.zip): online only).
Bioinformatics analysis
-----------------------
The GO analysis ([Fig. 4](#fig_004){ref-type="fig"}Fig. 4.Gene oncology (GO) annotation bar chart. The histograms are GO annotations for the three GO classifications, the Y axis represents the GO entry, and the X axis represents the number of proteins annotated with the corresponding GO entry. Different colors in the figure represent different GO classifications, with red representing a biological process, green representing a cellular component, and blue representing a molecular function.) mainly includes three parts: cellular component, molecular function, and biological process. The cell component was divided into 17 groups, mainly into cell, cell part, organelle, and organelle part; the molecular function was divided into 17 groups, mainly related to the binding and catalytic activity; the biological process was divided into 26 groups, mainly related to single-organism process, cellular process, biological regulation, regulation of biological process, multicellular organismal process, response to stimulus, and metabolic process.
All the identified proteins were compared with the COG database to obtain the corresponding COG annotation results. The COG annotation results ([Fig. 5](#fig_005){ref-type="fig"}Fig. 5.COG annotation bar chart. The Y axis represents the COG entry and the X axis represents the number of proteins annotated with the corresponding COG entry.) showed that the functions of the proteins concentrated mainly on posttranslational modification, protein turnover, chaperones, and general function prediction.
Pathway enrichment analysis of differentially expressed proteins ([Fig. 6](#fig_006){ref-type="fig"}Fig. 6.Significantly enriched pathway chart. The Rich Factor (RF) for the X axis represents the number of differently expressed proteins annotated to the pathway divided by the total identified proteins annotated to the pathway; and the higher the value, the greater the proportion of differently expressed proteins that are annotated to the pathway. Sizes of the dot in the figure represent the number of differently expressed proteins annotated to the pathway. a\~f represent the KEGG pathway significant enrichment analysis of the differently expressed proteins during the four reproductive stages: a. anestrous period-*vs.*-estrus period; b. anestrous period-*vs.*-gestation period; c. empty pregnant phase-*vs.*-lactation period; d. gestation period-*vs.*-estrus period; e. lactation period-*vs.*-estrus period; f. lactation period-*vs.*-gestation period.) showed that the pathway annotated with the maximum number of differentially expressed proteins was the complement and coagulation cascade, between the anestrous and estrus period, the anestrous and gestation period, the gestation and estrus period, the lactation and estrus period, and the lactation and gestation period. Comparing the anestrous with lactation period revealed that most differentially expressed proteins were concentrated in the metabolic pathway. The pathways annotated with the largest Rich Factor (RF) were the Fanconi anemia pathway (anestrous and estrus period), adipocytokine signaling (anestrous and gestation period), arachidonic acid metabolism (anestrous and lactation period), p53 signaling (gestation and estrus period, lactation and gestation period), and prolactin signaling pathway (lactation and estrus period). These results suggested that the protein expression in the serum of Hainan black goats at different stages of reproduction was mainly associated with immunity and nutrient metabolism.
Analysis of differential protein expression and function revealed seven proteins that were directly associated with reproduction. These proteins were identified as pre-SAA21, ANTXR2, vWF, SFRP3, β4GalT1, pre-IGFBP2 and Ran. SFRP3 increased significantly during the estrus period compared with the anestrous period. Compared with the estrus period, there were three differentially expressed proteins during the gestation period: pre-SAA21 (upregulated), ANTXR2 (downregulated), and Ran (downregulated). The expression of pre-IGFBP2 was significantly decreased during the anestrous period compared with the lactation period. The expression of β4GalT1 was higher in the estrus period than the anestrous period, and lower during the lactation period than the gestation period. The expression of vWF was significantly downregulated during gestation compared with the estrus period and upregulated during the lactation period compared with the gestation period (see [Table 3](#tbl_003){ref-type="table"}Table 3.List of protein molecular functions annotated with reproduction stageDescriptionDifferential expression stageMean ratioRatioQ valuePREDICTED: serum amyloid A21 precursorgestation period-*vs.-*estrus period ↑1.761.929\|1.376\|1.9720.004\|0.121\|0.001PREDICTED: anthrax toxin receptor 2gestation period-*vs.-*estrus period ↓0.650.570\|0.657\|0.7130.160\|0.013\|0.063PREDICTED: von Willebrand factorgestation period-*vs.-*estrus period ↓0.740.784\|0.872\|0.5720.001\|0.001\|0.001lactation period-*vs.-*gestation period ↑1.281.265\|1.043\|1.5470.001\|0.071\|0.001PREDICTED: secreted frizzled-related protein 3anestrous period-*vs.-*estrus period ↓0.720.670\|0.826\|0.6530.027\|0.016\|0.009PREDICTED: beta-1,4-galactosyltransferase 1lactation period-*vs.-*gestation period ↓0.520.595\|-\|0.4410.065\|-\|0.002anestrous period-*vs.-*estrus period ↓0.560.579\|-\|0.5420.117\|-\|0.004PREDICTED: insulin-like growth factor-binding protein 2 precursoranestrous period-*vs.-*lactation period ↓0.840.934\|0.647\|0.9470.284\|0.001\|0.819PREDICTED: GTP-binding nuclear protein Rangestation period-*vs.-*estrus period ↓0.480.505\|-\|0.4620.016\|-\|0.001 for a detailed list of the seven proteins).
Discussion {#s3}
==========
In this study we used iTRAQ proteomics technology to analyze the protein expression in the breeding cycle of Hainan black goats. The data showed that the pathway enriched for maximum RF in estrus ewes compared with empty pregnant ewes was the Fanconi anemia (FA) pathway. The function of the FA pathway is mainly to repair the covalent cross-linking between dsDNA in the DNA damage response (DDR) \[[@r12]\]. In addition, FA proteins are involved in selective autophagy of pathogens and subcellular particles, regulating inflammation and genotoxic stress \[[@r13]\]. This implies that the defensive abilities against external environment stimulation and exogenous substances should be improved during the estrus period. The pathway enriched for maximum RF in gestation period compared with estrus period, and lactation period compared with gestation period was the p53 signaling pathway, with RF of 0.67 and 0.44, respectively. This suggested that changes in protein expression may be associated with regulating cell proliferation, embryonic development, and preparing for childbirth. It has been reported that maintaining p53 pathway protein level plays an important role in embryonic normal development and embryonic stress response; and abnormal activation of p53 signaling can lead to embryonic lethality \[[@r14], [@r15]\]. Deng *et al*. \[[@r16]\] have found that the interaction of p53 and sestrins proteins can coordinate AMPK and TORC1 signaling to determines parturition timing. KEGG annotation of the pre-IGFBP2 protein revealed that it participates in the p53 pathway, cellular senescence, and transcriptional misregulation in cancer. IGFBP generally regulates cell proliferation, differentiation, and apoptosis by interacting with insulin-like growth factor (IGF) or by acting independently \[[@r17],[@r18],[@r19]\]. Srividya *et al*. \[[@r20]\] have found that IGFBP3 plays an important role in the development of preantral follicles to mature follicles. In this study, pre-IGFBP2 showed a lower serum level during the anestrous period than during the lactation period. It may participate in the p53 signaling pathway, which induces self-repairing of the body by mediating cell proliferation and apoptosis. Furthermore, posttranslational processing may play a role in generating IGFBP2 for regulating follicle development and ovulation during the next estrus.
The pathways annotated with the highest number of differentially expressed proteins in each stage of the reproductive cycle are the complement and coagulation cascade, 36 (anestrous *vs.* estrus period), 30 (gestation *vs.* estrus period), 22 (lactation *vs.* gestation period) respectively. Complement and coagulation play an important role in limiting the innate response towards bleeding and infection at the injury site \[[@r21]\]. Liu *et al*. \[[@r22]\] demonstrated that the glutathione S-transferase and serpin families are involved in glutathione metabolism, TGF-beta signaling, and complement and coagulation cascades, which can reduce oxidative stress and inflammatory response, and improve immunity. A large number of proteins in this study, belonging to the complement and coagulation cascades, were involved in enhancing the resistance of ewes to inflammatory and infectious diseases. Three of the seven screened proteins, namely, β4GalT1, pre-SAA21, and vWF were immune-related. Glycosylation is an important protein modification process. β4GalT is an enzyme, specifically responsible for catalyzing galactosylation, and plays an important role in the cell-matrix interaction, nervous system development, immunity and inflammation, and tumor development \[[@r23],[@r24],[@r25]\]. Zhao *et al*. \[[@r24]\] have found that β4GalT1 affects the galactosylation of carbohydrates, and regulates the biosynthetic process of selectin ligands to mediate inflammatory cell adhesion and migration. The GO annotation and KEGG analysis results in this study indicated that β4GalT1 was mainly involved in the biological processes of galactose metabolism and lactose biosynthesis, acute inflammatory response, and in angiogenesis associated with wound healing. The level of β4GalT1 in the estrus period was higher than that in the anestrous period. It may regulate physiological processes, such as estrus and ovulation, via regulating the biosynthesis and metabolism of carbohydrates in the Hainan black goats. It may also regulate the immune system to mediate the adhesion and migration of inflammatory cells. However, to elucidate the detailed mechanisms, further research is required. The secretion levels of β4GalT1 in the serum samples of lactating ewes decreased significantly compared with gestating ewes, possibly owing to the preparation of subsequent lactation. A large amount of β4GalT1 is involved in the biosynthesis of galactose, which is one of the main components of milk. Serum amyloid A (SAA) is an acute phase reactive protein that usually binds to high-density lipoproteins. Ather *et al*. \[[@r26]\] have suggested that SAA may serve as a candidate biomarker for the development of inflammation. In this study, iTRAQ technology revealed that the secretory level of pre-SAA21 (SAA21 is a subtype of SAA) increased significantly during the gestation period compared with the estrus period. GO and KEGG analysis showed that pre-SAA21 mainly participated in three pathways of protein processing, associated with the endoplasmic reticulum, phagosome formation, and antigen processing and presentation. As ewes enter the gestation period, their appetite increases, and the metabolism becomes more vigorous. The reason for the increased secretion of pre-SAA21 may be to stimulate the immune response and improve the body's immunity and antiviral ability. vWF is a polysaccharide protein secreted by endothelial cells and megakaryocytes that plays an important role in hemostasis. It can combine with collagen fibers to promote blood platelet adhesion to the injured part; it can also combine with factor VIII to protect it from hydrolysis by proteases \[[@r27], [@r28]\]. A study \[[@r29]\] has shown that the expression level of vWF is associated with bacterial translocation, inflammation, and procoagulant imbalance. The serum level of vWF decreased in ewes during gestation compared with the estrus period, indicating that pregnant ewes had poor resistance to bacteria, viruses, and other foreign substances; thus bacterial translocation was more likely to occur. Preventive measures, such as adding anti-inflammatory drugs to feed should be taken to improve the disease-resistance ability of the pregnant ewes. After the kids were born, the ewes entering the lactation period experienced a tremendous change in physiology and metabolism, as well as in stress, which affected the health to a certain extent. Significantly higher serum vWF levels observed during lactation than those during the gestation period might be due to the fact that the body needs to improve its ability to resist invasion of foreign substances and maintain internal environmental stability, thereby preventing the occurrence of mastitis.
The functions of ANTXR2 and SFRP3 are related to cell proliferation. A previous study \[[@r30]\] has shown that ANTXR2 regulates directional mitosis by interacting with both RhoA and F-actin proteins, and directional mitosis plays an important role in embryogenesis and organogenesis \[[@r31]\]. Li *et al*. \[[@r32]\] have also revealed that directional mitosis contributes to trabecular morphogenesis and regional specification. The GO and KEGG analysis of ANTXR2 in this study showed that ANTXR2 is mainly involved in the PI3K-Akt signaling pathway, ECM-receptor interaction, and the protein digestion and absorption pathway. PI3K-Akt signaling regulates not only proliferation, differentiation, and apoptosis, but also glucose transport and other cellular functions. ANTXR2 secretion decreased in the goat serum during the gestation period compared with the estrus period. It may be that ANTXR2 plays a crucial role in early embryonic development, organogenesis, histogenesis and other physiological processes by mediating directional mitosis.
SFRP can inhibit the activity of Wnt protein through competitive binding with the frizzled receptor (FZD) on the cell surface, thereby inhibiting abnormal cell division and proliferation \[[@r33]\]. The main biological function of Wnt proteins is to regulating the cell proliferation, apoptosis, adhesion, and migration \[[@r34],[@r35],[@r36],[@r37]\]. A previous study \[[@r35]\] has shown that SFRP1 can inhibit cell proliferation and migration, and promote apoptosis of colorectal cancer cells. In this study, we revealed that the level of secreted SFRP3 was upregulated at the estrus stage compared with that at the gestation stage; and GO annotation showed that the molecular functions of SFRP3 were PDZ domain binding, Wnt-activated receptor activity, and Wnt-protein binding. SFRP3 may mediate the Wnt signaling pathway to regulate proliferation of granulosa cells during follicular development. The proliferation, differentiation, and hormone secretion function of granulosa cells in the ovary are closely associated with the development and maturation of oocytes.
The GTP-binding nuclear protein, also known as Ras-associated nuclear protein (Ran), is a member of the Ras superfamily. Ran participates as a "molecular switch" in the cell cycle by binding to GTP or GDP, and plays an important role in nucleocytoplasmic transport, spindle assembly, and nuclear envelope formation \[[@r38], [@r39]\]. Nagai *et al*. \[[@r40]\] have found that downregulation of Ran results in a decrease in the cytoplasmic and nuclear accumulation of imported proteins, thereby accelerating cell aging in normal cells. In this study, the metabolism of ewes strengthened after entering the gestation period. In addition, it is necessary to provide various nutrients for the growth and development of the fetus. The ewe's demand for carbohydrates, proteins, and other nutrients is greatly increased. According to the GO and KEGG analysis, Ran is mainly involved in RNA transport and ribosome biosynthesis. Analyzing the reason behind the observed decrease in the gestation period compared to the estrus period suggested that a high level of Ran may participate in the biosynthesis of ribosomes to regulate protein synthesis and metabolism. This implies that we should pay attention to the comprehensive and reasonable nutrition in the feeding and management of pregnant ewes, and if necessary, appropriate supplements should be added.
In summary, we analyzed the expression profile of the serum proteome of Hainan black goats during different breeding periods (anestrous, estrum, gestation, and lactation periods) using iTRAQ technology. We detected several changes in immunity, inflammation, cell proliferation, apoptosis, adhesion, migration, and nutrient metabolism during the different breeding periods, which might be associated with the low fertility. pre-SAA21, ANTXR2, vWF, SFRP3, β4GalT1, pre-IGFBP2, and Ran were identified as candidate proteins that mediate the physiological state of the Hainan black goat. However, the possible reason for the small change observed in protein expression might be due to the presence of feedback regulation mechanisms in the secretion system of functional proteins *in vivo*. Upon reaching a certain threshold in the serum, a corresponding mechanism may exist to regulate the further secretion of protein to avoid damage caused by overexpression. The functions of these differentially expressed proteins remain largely unknown, and further research is required to clarify their roles in the goat breeding cycle, which may help to improve the fertility of Hainan black goats.
This study was financially supported by the key technology research and integration application of large-scale healthy breeding of Hainan black goats (Grant No. ZDKJ2016017) and research and application of meat key gene screening and molecular assistant breeding of the special wild boar in Hainan Province (Grant No. ZDYF2017059).
| null | minipile | NaturalLanguage | mit | null |
Sunday, February 23, 2014
The American Constitution and Ayn Rand's "Inner Contradiction"
After about six months of publication, my book is #87 of the top 100 in the following Amazon Kindle category: Books> Legal Theory & Systems> Judicial Systems.
I almost didn't write the following, because how immodest it may appear But there's too much at stake here, so I have. This is a very important book. There is nothing like it. It can influence contemporary political thinking in the United States.
As those of you who know me and/or my legal and other work, I did not write this book to make money. I wrote it for another kind of profit: To make the case about what has been wrong with the American constitutional/legal system from Day One--in the hope that recognition of the disease might lead to a cure, or at least an amelioration of symptoms.
At the risk of repeating myself, here are the Preface and Introduction to The American Constitution and Ayn Rand's "Inner Contradiction." [Notes have been omitted.]
**********
Preface
Like many other Americans, for years I’ve been deeply
concerned about our nation’s future. My fears have been exacerbated in the past
three years because of the often lawless, anti-American, recklessly incompetent
reign of Barack Obama. Worse, his presidency will continue for another year.
Even worse, he might be reelected.
In light of that possibility, consider a recent report in The Weekly Standard of a survey
commissioned by the American Revolution Center, which found that nearly 83
percent of Americans failed a simple test of knowledge about the founding of
the United States of America.
Many of our fellow citizens believe that the founding
principles of this nation are passé, that the Declaration of Independence’s
ringing endorsement of republican institutions, individual
rights, and limited governmentis outdated, that the
Constitution’s creation of a representative republic belongs to a time gone by,
and that the Bill of Rights is not a restraint on government but rather a
source of newly found, invented “rights.”
Along with this woeful ignorance, and largely because of it,
the Constitution of the United States of America and the Bill of Rights—rooted
in republican institutions, individual rights and limited government—are under
an unprecedented attack by Barack Obama and his far left Democratic Party,
aided and abetted by the complicit mainstream media, unions, academia, and
entertainment industry. To say nothing of many courts, including the Supreme
Court of the United States
in more than a few cases.
Employing and
legitimizing the exercise of statist power, the Supreme Court of the United States
has facilitated state legislatures and Congress in their sacrifice of
individual rights to the common good, and made a mockery of the Founders’
creation of a limited government.
But with a few notable exceptions there is hardly any
knowledgeable, explicit and principled defense of our Constitution and Bill of
Rights to be found anywhere.
Not on radio, television, or in Hollywood. Not in the press. Not at the
grassroots. Certainly not in academia. Nor, sadly, emanating from many
Republicans, Conservatives, and Libertarians. Most of the media’s pontificating
so-called constitutional experts, especially those on national television,
usually do more harm than good because they spread disinformation that is
neither knowledgeable nor principled. And note, for example, the Republican
presidential candidates’ pitiful and embarrassing “debates.”
While many Tea Party activists and other patriots have been
valiantly fighting for core constitutional values, many of them are disarmed
because they’ve been taught little about American constitutional law. In order
to defend the Constitution and the Bill of Rights, everyone fighting for America today
needs to know much more about these two documents than most of them know.
Those who are committed to fighting for America’s future are
obligated to acquire at least a basic understanding of the Constitution’s
origins and birth, its written text, the manner in which it has been
deliberately violated, and the consequences of how it has been deliberately misinterpreted
by its enemies.
Because of the importance of our struggle, about eighteen
months ago I put aside most of my writing and legal work to offer a
twenty-hour, ten-lecture Internet course on American constitutional law(Those
unfamiliar with my credentials and my commentaries on legal and political
issues can peruse my blog, http://www.henrymarkholzer.blogspot.com,
and my website, http://www.henrymarkholzer.com.)
The Internet course was successful, but some of the listeners expressed
disappointment that the lectures weren’t available in a permanent text form.
They are now.
The entire twenty hours of lectures have been transcribed, and
I have edited them for a less extemporaneous, more polished presentation, and
added new material.
The result of my labors is this book: The American Constitution and Ayn Rand's "Inner Contradiction. Because
my goal is to maximize readership—especially during the months before the
November 2012 election—The American
Constitution and Ayn Rand's "Inner Contradiction is priced at $4.99. It
is now available on most digital readers, including Kindle. [Note: it is now $2.99 on Kindle.]
If you find The
American Constitution and Ayn Rand's "Inner Contradiction worthwhile,
I have two requests. One is that you inform everyone you know about this
project, and ask them to do the same. This goes double for all Tea Partiers,
because most of them have their own lists containing the names of like-minded
folks. Second, please write a positive review on Kindle and as many other
places as possible.
Introduction
I’ve written this book for two reasons. First, to provide
patriotic Americans with an overview of the Constitution’s most important
provisions as interpreted by the Supreme Court of the United States.At the same time, I want to demonstrate something unknown to
virtually all Americans: that foundational to every political, social, economic
and legal system are ethical principles, and that from our nation’s earliest
days to the present there has been an ethical leitmotif running through the
Court’s most important decisions affecting individual rights and limited
government. Not all their decisions, but many—and some of the most important
ones.
As to that leitmotif, that recurring theme, a short version
of my personal journey to its discovery will be useful.
In law school, I studied English common law and its
influence on the American legal system. What I learned was a revelation. I came
to realize that from the days of the common law to my days in law school in the
late 1950s, the principles of individual rights and limited government had
consistently been sacrificed to what was perceived as “the common good.” I
learned, as we shall see in Chapter 1, that the ink was barely dry on the Bill
of Rights when the new federal government began to violate individual rights
and renege on the constitutional promise of limited government. (The states had
done so even before the Bill of Rights was enacted.)
In almost every law school course (especially Constitutional
Law) dealing with the power of the government and its delicate (and usually
adverse) relationship to individuals (especially constitutional law, it quickly became apparent to me that
much of the blame for violating those rights and repudiating that promise fell
on state and federal courts in general and the Supreme Court of the United
States in particular—the latter, ironically, the supposed guardian of the
Constitution.
The problem wasn’t with any particular court at any
particular time, or even with whether particular judges were “liberals” or
“conservatives.” The problem was that the state and federal judiciaries consistently
upheld the constitutionality of laws enacted by legislatures and approved by
executive branches that violated the principles of individual rights and
limited government.
From the time I graduated in 1959 until 1972 I practiced
privately, specializing in constitutional law. I represented, among others:
defectors fleeing communism for freedom in the West; physicians choking on
government over-regulation, who couldn’t properly serve their patients; young
men resisting the draft and the nightmare of Vietnam; “gold bugs” seeking to
protect their assets from government-induced inflation and other schemes to
destroy wealth; political candidates struggling against First
Amendment–strangling campaign finance laws; publishers defying censorship;
asylum-seekers battling the then-INS; homeowners trying to preserve their
neighborhoods from do-gooder housing-integration federal judges; and students
on the wrong end of affirmative action programs.
In general, I represented constitutionalists challenging,
and defending themselves against, the explosion of government power that
violated the principles of individual rights and limited government.
In 1972, while continuing my full-time law practice, I
became a full-time law professor.
For many of those years of practicing, teaching and writing,
a recurring question bedeviled me: What
subverted America’s
founding principles of individual rights and their necessary corollary, limited
government?
I found the answer to that question—and the leitmotif of
this book—in an eight-word sentence written by the late Ayn Rand: “America’s ‘inner contradiction’ was the
altruist-collectivist ethics."
**********
Amazon reviews, even simple blurbs, continue to be welcome--especially
in this political climate, where more and more politicians (e.g., Cruz,
Paul, Ryan) openly acknowledge some influence from Ayn Rand on their
thinking.
Search This Blog
About Me
In college (BA, NYU, 1954), I studied Russian and political science and later served in Korea with United States Army Intelligence. After law school (JD, NYU, 1959) for some 55 years I practiced constitutional and appellate law. From 1972 to 1993 I taught at Brooklyn Law School, where I am now professor emeritus. My courses included Constitutional Law, Appellate Advocacy, National Security, and First Amendment. A bibliography of my writing can be found at my blog of June 29, 2012. See also www.henrymarkholzer.com. | null | minipile | NaturalLanguage | mit | null |
Macromolecular transport across endothelial monolayers.
We studied the macromolecular size-selective transport characteristics of polycarbonate (PC) filters with defined pore radius (rp; 15,000 to 400 A) as well as 2,000 A rp PC filter-bovine pulmonary artery endothelial cell (EC) monolayer sandwich under zero hydrostatic pressure conditions using fluorescein isothiocyanate-hydroxyethyl starch (FITC-HES, 16 A less than ae less than 100 A), and 2-methoxy-2,4-diphenyl-3(2H) furanone-bovine serum albumin (MDPF-BSA, ae = 35.5 A). We surprised to find substantial convective solute transport (solute drag) across the filter-endothelial sandwich. This effect was increased by large rp (15,000 A) filters and prevented by 400 A rp filters. Positive hydrostatic pressure across 2,000 A rp filters increased convective solute transport and negative pressure prevented this effect. High, medium and low permeability monolayers on 2,000 A filters progressively attenuated the solute drag effect seen across these filters without cells. The decline in monolayer permeability was associated with an increased filter area covered by cells; approximately 50 and 95% as well as greater than 99%, respectively. Although significant restricted diffusion was seen across low permeability monolayers, this pattern was distinct from that measured in single frog capillaries. Restricted diffusion by low permeability monolayers under conditions that produce solute drag document the significant barrier effects of high confluence endothelial monolayers, in vitro. These data show that solute transport across endothelial monolayers is due to diffusion+convective solute drag. The degree of the solute drag effect across the filter-endothelial sandwich is a direct function of monolayer confluence. | null | minipile | NaturalLanguage | mit | null |
Parents warned about Salt and Ice Challenge at Schools
Schoolboy left with horrific burn injuries after taking part in dangerous 'salt and ice' craze
If you have a child at a secondary school then this is one dangerous craze you should know about, so you can warn them not to take part.
The "salt and ice challenge"
The latest craze is called the “salt and ice challenge”. It involves children being dared to place salt on their skin along with an ice cube and holding it there for as long as possible. What they may not realise is that the salt and ice together creates a reaction which can actually very quickly cause third-degree injuries similar to frostbite as the temperature rapidly falls far below that of ice.
This silly craze has left one schoolboy from Swansea with severe burns on his hand. The youngster's burns were so serious that there was a debate about whether he should get a skin graft.
However, doctors decided against it because the unidentified pupil retained full motor skills in his hand.
Despite this, the burn is so deep it has burnt all the nerve endings.
“He has absolutely no feeling on the burn at all,” said the boy’s mum.
“It is so deep that it has burnt all the nerve endings. He has some feeling in the red part around the edge but nothing on the burn itself.”
The schoolboy’s mum was so upset with this incident, that she has released images of her son’s hand to try and highlight the dangers and bring it to the attention of as many parents as possible, so they can warn their children and prevent it from happening again. | null | minipile | NaturalLanguage | mit | null |