Datasets:

Josephgflowers

/

Par-Four-Fineweb-Edu-Fortified

like 4

EARTH SCIENCE LESSONS, WORKSHEETS, Earthquakes: The Rolling Earth This is a multi-page unit on earthquakes, with questions at the end. Exploring the Environment: Volcanoes This is the first page of four with detailed information on volcanoes. This is a multi-page unit on volcanoes, with questions at the end. Students learn about volcanoes and create a model. Earthquakes: Getting Ready for the Big One Students learn about different types of earthquake waves, examine the impact on buildings, and discuss construction choices that can help minimize earthquake damage. Students learn about the three types of volcanoes and their distinct features. Students learn about the prediction of volcanic eruptions and levels of damage caused by the eruptions. Students learn about how scientists use evidence about dinosaurs to determine what they looked like and how they behaved. Students learn about the history of dinosaur research and the work that paleontologists do. Dinosaurs in Argentina Students learn about dinosaur excavations in Argentina. Students learn about “living fossils” and discuss why they have survived. Students learn about Mesozoic era dinosaurs and discuss how dinosaurs from each period adapted to their environments. When Dinosaurs Ruled Students learn about dinosaurs from all three eras of the Mesozoic age and discuss the relationship between plant and animal life. The Earth’s Layers This is a multi-page unit on the Earth’s layers, with questions at the end. This is a multi-page unit on prehistoric Earth, with questions at the end. Celebrate the Earth! An Earth Week Unit This page has one week of lessons for Earth Day, including units on geography, ecology, and resource conservation. Earth’s Changing Surface Students learn about caves, speleothems, stalactites, and stalagmites. Protecting Our Planet Students discuss ways in which humans impact the environment and ways we can improve this. Students learn about land formations and how they are shaped by water and erosion. Birth of the Earth Students learn about the birth of the Earth and milestones in its history. Earth’s Dramatic History Students learn about Earth’s history and various organisms that have populated it through the ages. Students learn about landslides and how scientists predict where they might occur. Reading Satellite Images Students learn about how satellite images are made. This is a multi-page unit on minerals, with questions at the end. This is a multi-page unit on rocks, with questions at the end. This is a multi-page unit on igneous rocks, with questions at the end. This is a multi-page unit on metamorphic rocks, with questions at the end. This is a multi-page unit on sedimentary rocks, with questions at the end. Telling the Story of a Rock Students tell the story of a rock, with a song, poem, play, or other. Students learn about sedimentary rock formation and evolution. Students learn about the properties of minerals and gemstones.

http://www.instructorweb.com/resources/earthscience.asp

Yet many students don’t see themselves as being capable of creating anything. Parents can help kids break through such thinking by believing in them. And it’s important to show students practical ways to be inventive when they need to be. One junior high school inventor says she learned how to invent by taking these steps: - Find a problem you think you can fix with an invention. - Write down the problem and why it needs to be solved. - Brainstorm possible solutions. Don’t be concerned about whether you can do them. - Organize your thoughts. Select the best three ideas based on which you think would be the most effective. - Decide on the one you are most capable of doing. Make different sketches of it. - Do experiments on your idea. Write all information and data in a log book. - Choose the experiment that turned out the best. Do the experiment again to see if you get the same results. - Run tests on the product. - Make improvements if needed. Give it a name. - If your product is a model of what the real thing should be, make the real thing. Once the product is the best it can be, your child might want to consider getting it patented. She can ask a teacher how to apply for a patent. Copyright © Parent Institute

http://www.schoolfamily.com/school-family-articles/article/10268-show-your-adolescent-how-to-become-a-real-inventor

Even at this early age, your child should feel confident about using technology in the classroom. They’ll be taught how to use technology to develop ideas and record creative work and be encouraged to make their own minds up about how best to use technology to support their learning. How will my child use technology? During Key Stage 1, your child will begin to use technology to: - write clearly and improve grammar, punctuation and sentence structure in the stories they write - use graphics packages to explore ideas and present work in different formats using simple tools such as the pen, brush, fill, and spray - search for information held on a CD-ROM or the internet - use menus, indexes and key words to search for pictures and gather information - create, test and store basic instructions to control the movements of a floor robot in order to develop their understanding of programmed devices - answer questions by selecting and using different types of software - ask questions that can be answered with yes or no responses and work with a prepared file on a branching database program to practise their questioning skills - enter and store information using some of the different types of electronic information resources that are available. What types of technology are we talking about? Schools differ in the ways they teach ICT: some will teach dedicated ICT lessons, others will teach ICT skills in lessons as the need arises. Your chance to get involved Why not sign up to our campaign and support Next Generation Learning? The more people support us, the more we can achieve.

http://webarchive.nationalarchives.gov.uk/20110130163038/http:/www.nextgenerationlearning.org.uk/Parents/Resources/Your-child-and-technology-Key-Stage-1/

Made in the 1952 detonation of the first thermonuclear bomb, the element fermium has since sat in a corner of the periodic table where few tools of chemistry reach. Now a team has captured a piece of its spectrum–the wavelengths of light it absorbs–making it the heaviest element ever to be so measured. The researchers rushed their scant sample of the short-lived element from a nuclear reactor in the US to Germany, where they probed it with lasers, just atoms at a time. Appearing in the 25 April PRL, their findings shed light on the energies of fermium’s electrons and provide a way for theorists to test their calculations for even heavier and more elusive elements. The available energy levels for electrons in an atom determine both what kind of bonds it forms and what other elements it reacts with. Fermium is element 100–six doors past plutonium in the periodic table–and calculating the energies of its 100 electrons is a tricky business. Einstein’s relativity comes into play for the fast-moving electrons of such an atom, changing the rules that usually indicate which orbitals are most stable. With most elements, researchers learn about the electron energy levels by detecting the wavelengths of light that atoms either emit or absorb as they switch from one quantum state to another. But collecting enough light takes either a lot of time or a lot of atoms. After almost two years of work, researchers at Oak Ridge National Laboratory in Tennessee had produced just a few billionths of a gram of pure fermium. Twenty hours later half of it would be gone, and it would continue to decay en route to Germany, where the spectrum was to be measured. There would be few atoms to work with, and the German team would have to work fast. To measure the absorption of light in such a meager sample, a team led by Hartmut Backe and Norbert Trautmann of the University of Mainz used a trick: if an atom absorbed, they turned it into an ion (an electrically charged atom) and then detected it with sensitive commercial ion counters. For each test wavelength, the team shot a laser pulse at their sample and simultaneously pulsed it with a second laser. The second pulse was energetic enough to strip away an electron and turn an atom into an ion, but only if the atom absorbed the first pulse at the same time. For most test wavelengths, the detectors registered no fermium ions, but at two wavelengths, the detectors counted about 100 per second. To detect ions at this rate, the researchers had to illuminate about a million atoms per second, but in chemistry, a million is barely an appetizer. “It’s an astonishingly small number of atoms they had to work with,” says University of Calgary chemist Michael Seth. The team calculated the wavelengths of different possible quantum states and found two which matched the wavelengths that produced ions. While some experts see the match as persuasive, others are cautious, largely because such calculations usually are not very accurate. If theorists truly have a handle on heavy-atom calculations, says Seth, then probing more of the spectrum will reveal matches to the other quantum states. Norman Edelstein of the Lawrence Berkeley National Laboratory in California is hopeful that the new technique will produce more spectra in this previously inaccessible corner of the periodic table. Oliver Baker is a freelance science writer based in Davis, CA.

http://physics.aps.org/story/v11/st18

It has been said that without the media, there would have been no Civil Rights Movement. This course will explore that theory and examine the powerful role the media played in shaping the events of the Civil Rights Movement. Media coverage -- both black and mainstream -- of key civil rights cases, such as the murder of Emmett Louis Till, will be analyzed, as well as the Southern journalists who defended blacks in the 1950s and 1960s. The course will also cover the assassination of Medgar Evers in 1963, the Freedom Rides of 1961, and the often untold story of how women and children helped shape the movement. This course will NOT be about Martin Luther King Jr. and Rosa Parks; though they are seen as icons of the Civil Rights Movement, the movement was much more than these two people. - Credits: 3 - Offered every other fall

http://sbu.edu/academic_resources.aspx?id=18410

Science is at the core of the curriculum at Teddington School. Students follow the new Programme of Study at KS3 with a greater emphasis on How Science Works (HSW), the relevancy of Science, and how Science can impact on everyday life. HSW develops skills and lays the foundation for success at KS4. It has five key elements, and across a range of contexts and practical situations students will be: - Thinking: using ideas and models to explain the world around them. - Understanding: explaining the economic, ethical, social and cultural implications of science - Communicating: presenting scientific ideas and understanding how scientists communicate. - Investigating: planning, carrying out and gathering evidence from a wide range of experiments. - Using: gathering information from a variety of sources, taking into account errors or bias, to explain their ideas. Throughout the course students will develop their Personalised Learning and Thinking Skills and will be assessed on not only their subject knowledge, but the skills outlined above. There are many opportunities for further Science learning during KS3 and KS4 in the form of after-school activities, science film competitions, NPL water rockets competitions, educational visits and visiting speakers especially during Science Week in March. The Science department also values the opportunities that the curriculum enhancement days provide. In the past we have organised educational outreach talks from the Science Museum, students have taken part in a ‘whodunnit’ forensic activity, Mission to Mars experience as well as investigating the properties of liquid nitrogen and making their own educational Science films. Our KS4 students have been provided with the opportunity for extended practical work linked to a component of their GCSE course(s), some of the year 11 students’ have also taken part in a science ‘speed dating’ activity where they interviewed a number of science ambassadors. We have also used this extended period of study to visit the Science Museum, Natural History Museum as well as the Royal Observatory in Greenwich. The improved 14 – 19 curriculum offers all learners a pathway to success by allowing everyone the opportunity to choose the direction that best suits their interests. The pathways in Science are individually tailored to a pupils needs and will not only stimulate their interests in science, but also challenge them to achieve their potential whether they chose from GCSE Core Science and GCSE Additional Science, separate sciences to vocational BTEC courses and from a range of assessment models from key examinations to project based assignments. In January 2011, the Science department was graded as being overall “outstanding” following an HMI subject survey inspection. Key Stage 3 (Years 7, 8 and 9) During year 7, students are taught in mixed ability groups at the start of the term. In September all students will be assigned a NC level after completion of a baseline test and feedback from their feeder primary school, their progress will be monitored against this baseline evidence. Setting will then occur during late September following their attainment in this test in conjunction with their KS2 Science assessment information. In years 8 and 9, students are set according to ability using key data such as end of topic tests and key standardised exams. However, setting is flexible and regularly reviewed following standardised examinations throughout the year. KS3 students are taught a combined curriculum where they cover 3 units a term in all three disciplines of Biology, Chemistry and Physics and the How Science Works components are incorporated into each unit. Students in years 7 – 9 follow schemes of work using the new framework text books from ‘Collins KS3 course’. Homework will be set mainly from the Collins KS3 homework book but other homework could be set depending on the curriculum covered in the lesson and this could range from extended project style homework, independent research tasks to revision checklists before a main end of unit test. Key Stage 4 (Years 10 and 11) Students are set by ability in both years 10 and 11. In year 10 students are placed in groups according to their teacher assessments in year nine and reviewed in the light of end of key stage exam results. In year 10, the majority of students study the AQA Core Science GCSE, in year 11 the majority of students will then study the AQA Additional Science GCSE. Students are only entered for the Higher or Foundation Paper in January of their final year, following mock examinations in December and after consultation with parents. Some students will choose to study the three separate GCSEs in Biology, Chemistry and Physics. The criteria for choosing triple award Science over the CORE Science and ADDITIONAL Science qualification is that you are either in the more able set or higher second set (level 5-7) and you will need to achieve a minimum of level 6 in the end of KS3 examination. You will have a keen interest in Science and want to pursue Science as a career choice. This course will make up 20% of your entire timetable so is more suited to the ‘more able’ students who clearly enjoy learning about the scientific concepts and practical investigations and possess a real passion for the subject.. The minimum requirement for entry on this course is to achieve a high level 6 (6a / 6b) in the end of KS3 examinations and end of unit examinations. Some students will be chosen to study an alternative vocational course either in years 10 or 11. This course is the Edexcel BTEC extended certificate in Applied Science which is the equivalent to 2 GCSE passes. Further information about the AQA GCSE Core Science, Additional Science and Triple Science is below. The documents include the key dates for 2011 – 2012. All students are provided with a revision guide to supplement their studies. Students are also encouraged to use these books for independent study. We also sell the CGP revision guides and past papers in the department, your son/daughter needs to ask their science teacher if required for revision prior to the main exams. The AQA Core Science GCSE and Additional Science GCSE provide a firm foundation for students wishing to pursue Advanced levels in college or vocational courses.

http://www.teddington.richmond.sch.uk/SCIENCE

In the early 1800s, shortly after the start of the industrial era, carbon dioxide began to skyrocket, while temperature remained flat. Temperature began to spike only about 30 years ago. In contrast, temperature changes preceded carbon dioxide changes at Vostok until the beginning of the industrial era. Scientists believe these natural changes in carbon dioxide were a feedback response to initial, small changes in temperature, and that those changes – along with other responses – amplified the original temperature shifts. The other responses included changes in the levels of other greenhouse gases, primarily methane; changes in the area covered by polar ice sheets and sea ice, which reflect sunlight back into space and cool the planet; changes in the levels of dust and airborne aerosols, which also cool by reflecting sunlight (the “parasol effect”); and changes in the mix of grassland, desert, and forest, which affect the reflectivity of the land. The history of these factors is known. Besides the information about greenhouse-gas levels from the trapped air bubbles at Vostok, a sediment core from the bottom of the Red Sea indicates changes in sea level, which in turn give an approximation of ice sheet area. (The ice sheets grew and thereby drained the oceans during cold times; they melted to refill them during warm times.) Using these and other geological records, Hansen can calculate Earth’s temperature at any given time in the past 420,000 years. He plugs in the data for greenhouse levels, sea level, and so on to produce a temperature estimate for the corresponding time. And as he showed his audience last December, these calculations match temperatures as recorded by the deuterium and hydrogen in Vostok’s ice quite precisely over the entire 420,000-year span. Global-warming deniers like to complain that scientists base their predictions on faulty computer models. But Hansen’s calculations show that we don’t need a computer to know how temperature will respond to a given change in the greenhouse – or a change in dustiness, or forest cover, or the amount of ice on the Arctic Ocean. Solid geological field data give us everything we need – and provide a check for computer models. And lend credibility to Hansen’s predictions. Besides demonstrating his firm grasp of the power of these various factors to change temperatures, this remarkable matching of theory to real-world data also tells us just how ornery the climate beast may be: the orbital changes that paced the ice ages were incredibly small. They had little effect on the total amount of sunlight reaching Earth in a single year – only its distribution over seasons and latitudes. Nevertheless, these minute redistributions led to swings in temperature of about 5 ºC and variations in sea level of more than 100 meters. Greenhouse-gas levels, on the other hand, are more like a knob controlling the brightness of the sun. And the turning up of the rheostat that humanity has accomplished by adding about a trillion tons of carbon dioxide to the atmosphere thus far in the industrial era dwarfs the redistributions in sunlight that once switched the planet back and forth between glacials and interglacials. We are poking the climate beast in a way it has not been poked in the entire era of cyclical ice ages – at least two million years. As Hansen told his audience last December, “Humans now control global climate, for better or worse.”

http://www.technologyreview.com/featuredstory/406011/the-messenger/page/3/

The first sugar cane plantation was on the island of Kauai in the town of Kola in 1835. The plantation was originally run by kamakas, or Hawaiians. During the first year, the plantation has twenty five acres of sugar cane. There were twenty houses built for the Hawaiian workers. There was a house for the superintendent. There was also a carpenter's shop, a mill, dam, a sugar house, a boiling house and a sugar mill. At first, the owners did not pay the workers with money. They were paid with coupons or scripts in which they could redeem for merchandise at the plantation store. The workers were given bagos, metal shaped disks, with stamped numbers on them for identification. In the 1850s there was a huge expansion of the sugar industry. This was because in the United States, there was a larger demand for sugar. Gold was discovered in California in 1848 and the beginning of the Civil War were the causes for this demand. After this, the Reciprocity Treaty granted Hawaii to export sugar to the United States tax free. This created huge profits for the sugar cane planters in Hawaii. There was a shrinkage in the labor force because the Hawaiians began to acquire diseases brought by foreigners. Thus, the plantation workers attempted to look for other labor forces from places with a similar climate to Hawaii's. The plantation workers first sought workers from China. The Chinese already had experience refining sugar. For the most part, only males came because the plantation owners assumed that after the contract, they would return to China. However, many did not return to China. The demand for labor still was high. Thus, the owners began to look to other sources. They recruited labor from Portugal, Japan, Korea and the Philippines. They limited the number of workers from each ethnic group so they would be better able to control the bodies of the workforce. Typically, the labor contract agreement required twenty six days of work a month, and the contract was for three year. The men were paid about $7 and the women were paid $5 month. However, each ethnic group would work under a different pay scale and rate. They typical work day would start at five in the morning. If the worker did not leave the house at 5:30, a policeman was sent to the home to go and get the worker. Work began at 6:00 a.m. There was a half an hour break for lunch. Work ended at 4:30 in the afternoon. Workers could be fined for tardiness and misconduct. The fine was up to fifty cents and/or about two days pay out of their paychecks. The steam whistle blew at 8:00 p.m. for lights out. The plantation manager's house was usually at the top of the hill. It was naturally a larger home, with verandahs, which overlooked the plantation. The lunas (supervisors) lived below the managers. The laborers lived in the lower flat lands. They usually had dormitory barracks or identical wooden framed houses. The houses were often cramped and unsanitary. By living with the same group of cultural people who spoke the same language, workers soon started to raise families, and improved their surroundings. They landscaped their yard with flowers, fruit trees and vegetables. There were community facilities like the furo (bath house) and tofuya (bean curd shops). Site Map Citations Activity Guestbook Contact Us About Us Enchanted Lake

http://library.thinkquest.org/TQ0310120/plantationlife/plantation.htm

Sloat Mill, Sloat, California, ca. 1940 Image Courtesy of Plumas County Museum, Quincy, CA Economic opportunity motivated millions of early 20th Century African Americans to leave the segregated South. Most of the people of the Great Migration found better jobs and better pay in northern factories in World War I and western defense industries in World War II. However, at least a few thousand migrants pursed improved employment opportunities in tiny western lumber mill towns. Not all of the black migrants had been sharecroppers – tens of thousands had industrial experience in southern pine mills. This experience provided another option for African Americans when combined with another economic reality, the demise of southern forests and the opening of high quality and vast quantities of western lumber. By the 1920s the southern lumber industry neared the end result of decades of “cut-out and get-out” logging philosophy. At the same time improved transportation and mechanization provided western forest products to eastern markets. A number of southern lumber companies recognized this reality and invested in western mills. Powell Lumber Company of Lake Charles, Louisiana was one such company. In late 1926 Powell Lumber purchased two existing mills in northern California, about fifteen miles apart. Those mills became the Quincy Lumber Company. One of the mills, located in Sloat, California, about 75 miles west of Reno, Nevada, was truly a company town–the purchase included a saw mill, box factory, company store, and segregated company housing. The other mill formed the imposing eastern boundary of Quincy, about 15 miles west of Sloat, then a town of less than 1,000. Though not a company town in that all of the facilities were owned by Powell Lumber, the mill complex did include housing that came to be known as “the Quarters,” home to the firm’s black employees. Unfortunately, this investment was poorly timed. The Quincy mill sat silent during most of the 1930s and only the Sloat box factory operated during the same period. However, by 1937 lumber industry fortunes in Northern California dramatically reversed and so did the need for labor. During its run Quincy Lumber employed hundreds of men, mostly white and black migrants from Louisiana and Arkansas, made their way to this fairly remote area of Northern California. Whatever initial recruiting the company did was quickly replaced by family networks. When winter closed the forests men returned to the South where they spread the news of good paying jobs. In spring more men and families joined the growing communities. A 1929 map of the Quincy complex shows approximately six buildings as “colored employee dwellings.” The 1938 update of the same map shows an expansion to nearly forty buildings. A 1939 map of Sloat labeled “Shacks Occupied by Colored People” includes about forty-five buildings. At its height in 1940, the 400 African Americans in Quincy comprised 40% of the town’s population. Another 350 in neighboring Sloat comprised about 20% of that community’s residents. By all accounts Quincy Lumber gave equal pay to its white and black employees and many African American men worked in skilled positions nearly impossible to gain the southern mills. This was in contrast to Southern mills where black workers received on average about 50% of the pay of white employees for comparable jobs. Union membership in the West by both white and black workers may have accounted for the pay equality. The black workers of Quincy and Sloat brought their families and soon established community institutions such as churches and fraternal orders. Starlight Missionary Baptist Church was founded in Quincy. The men there also created a Masonic chapter and the women had the Order of the Eastern Star. Though segregated housing was the norm, little else was divided by race. After two years of resistance from white locals, African American children began attending local schools in 1940. Their presence generated for the time and place scenes of remarkable integration. In fact by the Spring of 1954, a black senior, John Clark, was elected student body president at Quincy High School. White adults entertained at “the Sump,” a black club in the Quincy Hotel. Local African Americans often spent their leisure hours in the Quarters at B&B’s Club owned by Ben and Alberta Conston. Alberta remembered Ben starting the barbecue each morning before heading to his mill job. An African American couple in Sloat created the Waymon Sales Restaurant which generated a reputation for great food and service long after it closed. In 1947 the colored Red Sox baseball team integrated the local baseball league at the same time Jackie Robinson broke into major league baseball. A white Louisiana native remarked on the degree of integration in Quincy and Sloat saying openly what many blacks and white residents already knew, that such intermingling would not have been possible in Lake Charles, Louisiana. While the introduction of hundreds of African Americans into Sloat and Quincy was not without problems, the white and black citizens achieved degrees of integration rarely seen in other parts of the United States at that time. Economic benefits bound black and white workers to the Quincy Lumber Company and the company with the community. Many elderly black and white people speak with great admiration of the Quincy Lumber Company, both groups proudly calling Quincy and Sloat home.

http://blackpast.org/?q=perspectives/working-quincy-mill-african-american-lumber-mill-workers-northern-california-1926-1955

Much of a 4th grade writing curriculum focuses on developing writing specifically so that it has clarity and structure as well as uses reasons, facts and details to support and strengthen students’ writing. Fourth graders are taught to organize their writing and ensure that it has a flow and groups together related components. In addition, as students are taught to think more deeply about concepts, they are encouraged to write in deeper ways as well, by writing more than just facts but also expressing ideas, making connections, and providing details and emotions when appropriate. In order to build writing skills, your 4th grader: - Writes opinion pieces which express a point of view and which have an introduction, a conclusion, reasons and facts to support the opinion and groups together related ideas. - Writes informative/explanatory pieces which present information on a topic, use facts and details, group together related topics, and provides and introduction and conclusion. - Writes narrative pieces which use specific details, descriptions and dialogue to convey a real event and includes an introduction and conclusion. - Plans, revises and edits his writing. - Uses technology to publish, research and communicate with others under the proper guidance of an adult or teacher. - Types with beginning accuracy and ability. (For example, types one page of text within one sitting). - Completes research projects by taking notes, organizing them and presenting them. Texts and resources used are also listed. - Writes for both long (over weeks) and shorter (one sitting, or a day or two) periods of time. - Ask Why: When your child expresses his opinion or states his ideas about something, ask him why he thinks that or how he knows it to be true. This will help him learn to support his opinion with reasons and/or facts. Do the same when you express your opinion or ideas about something. - Practice Typing: Encourage your child to practice his typing skills. Use typing games or make up your own games such as giving your child a word to spell and timing how fast he can type it. - Email with your Child: Set up an email account for your child and write emails to each other describing your days to each other. Include details, conversations, thoughts and emotions you had. This can be done in addition to generally encouraging (and supervising) your child’s use of technology -- helping him use it for research, writing and communicating with others. As always, be cautious of your child’s technology use by monitoring and supervising how much it is used and with whom he communicates. - Practice Note Taking: When you and your child go somewhere like a museum or on a trip, or even when you or child just talks about something interesting or of importance, pretend to be reporters and take notes. Both you and your child can take notes and then use those notes to later describe what you learned. You can even relay your “reports” as a newscaster would on a news show. Recommended Products for Your Child Ages 8-10

http://www.scholastic.com/parents/resources/article/writing-4th-grade

|Alternative Techniques - For Teaching about HIV/AIDS in the Classroom (Peace Corps, 1994, 205 pages)| · To assist in reviewing basic AIDS information and attitudes needed to break the chain of infection · Upper level primary students, secondary students · 10 persons to full classroom · Chalk, Blackboard, question cards · Draw a Tic-Tac-Toe grid on the blackboard where each square in the grid corresponds to a question either by letter (A-I) or by number (1-9). · Divide group into two teams; X and O · Play tic-tac-toe where a correct answer allows a team to mark an X or an O in the grid (See Directions for Tic Tac Toe I) · Team one chooses a number and receives the question card marked with that number. · A team member must read the card and the other team members must answer the question. · Play until a team has three Xs or Os in a row · Continue playing until you use up all of your questions · Questions may take the form of True/False, Yes/No, or Fill-in for answers · Draw upon the following for questions: 1. Myths and Facts about AIDS 2. What are the risks for AIDS Students need to be aware of what behaviors put you at risk for HIV infection. Use the following categories: - definitely a risk - probably a risk - probably not a risk - definitely not a risk 3. The story of AIDS, i.e. basic information of AIDS transmission and prevention

http://www.nzdl.org/gsdlmod?e=d-00000-00---off-0mhl--00-0----0-10-0---0---0direct-10---4-------0-1l--11-en-50---20-help---00-0-1-00-0--4----0-0-11-10-0utfZz-8-00&cl=CL1.1&d=HASH5dd38fd2e65eae6d400a3a.7.10&gt=1

Graphene grains in several different shapes, controlled by hydrogen. | Courtesy of Oak Ridge National Laboratory A team of Oak Ridge National Laboratory (ORNL) and New Mexico State University researchers have developed a new approach to growing graphene (one-atom thick carbon sheets) that can help advance next-generation electronics including batteries, transistors and computer chips. Growing graphene usually involves a process called chemical vapor deposition method that produces irregularly shaped grains. Little was known about the exact process, but researchers knew they would have to gain a better understanding before they could produce high-quality graphene films. Now, this team found that hydrogen dictates graphene grain shape and size – allowing for greater control. ORNL scientist Ivan Vlassiouk explained, “Hydrogen not only initiates the graphene growth, but controls the graphene shape and size. In our paper, we have described a method to grow well-defined graphene grains that have perfect hexagonal shapes pointing to the faultless single crystal structure.” Using their new recipe, Vlassiouk and his colleagues have created a way to reliably produce graphene on a large scale. Greater control of grain size and shape may result in improved functionality of this material in transistors, semiconductors and potentially hundreds of other electronic devices. Check out more on why hydrogen might be the key ingredient here.

http://www.ocrwm.doe.gov/articles/graphene-hydrogen-and-next-generation-electronics

(Editor’s Note: This story was originally published June 10, 2010) And we thought we knew Earth’s mountains. Nope. Scientists at the International Polar Year conference in Norway this week revealed startling new images of the Gamburtsev Mountain Range of Antarctica, a huge and mysterious “ghost range” buried beneath more than a mile of ice. The images are the result of radar technology, and reveal a dramatic landscape of rocky summits, deep river valleys, and liquid, not frozen, lakes, all hidden beneath the ice. The range itself rivals the Alps in size and cover an area that is roughly the size of New York State. “What we’d shown before was an estimate based on gravity data — a little bit of a coarse resolution tool,” said Robin Bell, a senior research scientist at Columbia’s Lamont-Doherty Earth Observatory in New York. “What we showed at this meeting was the radar data. It’s like going from using a big, fat sharpie to using a fine-tipped pencil.” Flying twin-engine light aircraft the equivalent of several trips around the globe and establishing a network of seismic instruments across an area the size of Texas, a U.S.-led, international team of scientists in 2009 not only verified the existence of the mountain range, which is thought is to have caused the massive East Antarctic Ice Sheet to form, but also has created a detailed picture of the rugged landscape. “Our seven-nation team has produced detailed images of last unexplored mountain range on Earth,” said Michael Studinger, of also of Columbia University’s Lamont-Doherty Earth Observatory and the co-leader of the U.S. portion of the Antarctica’s Gamburtsev Province (AGAP) project. “As our two survey aircraft flew over the flat white ice sheet, the instrumentation revealed a remarkably rugged terrain with deeply etched valleys and very steep mountain peaks.” The Gamburtsev Mountain Range (also known as the Gamburtsev Subglacial Mountains) is a subglacial mountain range located in Eastern Antarctica. The range was discovered by the Third Soviet Antarctic Expedition in 1958 and is named for Soviet geophysicist Grigoriy A. Gamburtsev. It is unknown how the mountains were formed, though the current speculated age of the range is over 34 million years and possibly 500 million years. Current models suggest that the East Antarctic ice sheet was formed from the glaciers that began sliding down the Gamburtsev range at the end of the Eocene. The introduction of the new images stole the spotlight at the International Polar Year Conference in Oslo, Norway. At what was said the biggest polar scientists meeting ever held, the participating scientists were expected to present their latest findings about the climate change in polar regions. The changes in the polar region, the polar ecosystem, the human dimension of change and linkage between polar regions and global ecological systems, were the main topics at the conference. VIDEO: Australian television news report Mountains hidden beneath Antarctic ice revealed OurAmazingPlanet via MSNBC.com, June 10, 2010 Underground Antarctic Mountains Revealed Softpedia.com, June 10, 2010 Norway hosts largest-ever polar science conference Xinhuanet.com, June 9, 2010 Dispatches from the Bottom of the Earth: An Antarctic Expedition in Search of Lost Mountains Encased in Ice Scientific American, Nov. 12, 2008 Antarctica’s Ghost Mountains Excite Scientists Russia-ic.com, Oct. 16, 2008 Gamburtsev Mountain Range Confirmed Beneath Antarctic Ice geology.com, February 2009

http://newsdesk.org/2010/09/scientists-unmask-ghost-mountains-of-antarctica-at-last/

This section contains a number of memory improvement techniques. These techniques are extremely effective because they are a reflection of how memory works. The important thing is to understand the underlying principles. This will help you to get more out of your memory. This is a good one to start off with as it shows you the basic principles of memory. You use imagination and association to create a chain of information in your mind. With a little practise you will be able to make the chain as long as you like. Click here for How to Remember a Long List of Items Difficulty remembering names is a very common characteristic of dyslexia. Forgetting people's names can make you feel like you are being rude and ignorant. However by using the principles of memory and a bit of practise you'll soon have the problem under control. Click here for How to Remember Names. Being a good speller requires a level of memory management skills. There are many different ways you can use your memory to improve your spelling. You have to be confident and believe that you can learn to spell any word. Click here for How to Remember Any Word. The important thing to understand is that these techniques work so well because they are a reflection of how memory functions. Understanding the main principles will help you develop and manage your memory in a more effective way. Click here for loads more memory help.

http://www.beatingdyslexia.com/memory-improvement-techniques.html

|During the ten-year Census of Marine Life, researchers captured images of the diverse creatures inhabiting Earth's oceans. Please see the slideshow below for a sample. In 2010, as the United States conducted its latest decadal population census, marine scientists completed their first census to discover the abundance, diversity, and distribution of organisms living in Earth's oceans. Launched in 2000, the Census of Marine Life evolved into a $650 million project involving more than 2,700 researchers from 670 institutions and 80 nations. Some 540 expeditions assessed different slices of the ocean—from polar seas, coastal zones, and the open ocean to seamounts and other seafloor habitats—and recorded life ranging from large fish to bacteria. Nearly 30 million observations of thousands of species were made and archived in the newly created Ocean Biogeographic Information System (OBIS) database, the world’s largest open-access, online repository of marine life data. At least 1,200 new species were discovered; some 5,000 other potentially new species remain to be studied and officially named. The idea for the census germinated in a discussion at Woods Hole Oceanographic Institution (WHOI) in the summer of 1996 between Fred Grassle, a biologist formerly at WHOI and now at Rutgers University, and Jessie Ausubel, vice president of programs of the Alfred P. Sloan Foundation and adjunct scientist at WHOI. The Sloan Foundation provided $75 million to launch the program, and scientists specializing in diverse marine animals organized themselves into subgroups, using a broad range of methods and technology to carry out the census work. WHOI scientists were key contributors, helping to guide explorations of life in various ocean habitats. WHOI biologists Peter Wiebe and Larry Madin, for example, were on a steering committee for the Census of Marine Zooplankton (CMarZ), a project aimed at assessing the diversity of zooplankton from seafloor to surface, including tiny shrimplike crustaceans, swimming snails and worms, and gelatinous animals that spend their lives drifting through the water, often far from shore. Estimated to total more than 7,000 species, zooplankton are vital parts of ocean food webs. CMarZ was co-led by Ann Bucklin, a biologist at the Marine Sciences and Technology Center at the University of Connecticut and a visiting investigator at WHOI. WHOI researcher Nancy Copley coordinated the CMarZ effort among different countries. Scientists confirmed 66 new species discovered during CMarZ, and many more collected animals await analysis to determine if they also are new species. Scientists collaborating with CMarZ participated in more than 80 research cruises from 2004 to 2009, funded by agencies in their respective countries. Using techniques that ranged from scuba diving and nets to technologically advanced deep-diving remotely operated vehicles, they collected, photographed, and identified the animals. Wiebe co-led a landmark cruise across the tropical Atlantic Ocean, during which researchers collected more than1,000 kinds of zooplankton, including many species never seen before. While at sea, taxonomists identified the organisms under microscopes while other researchers sequenced their genes to create unique DNA “bar codes” to identify species. “Genetic bar codes are a big step forward,” Wiebe said. “We are providing the stepping-stones so future generations can use the results of this project as a benchmark to measure at a glance how ecosystems are changing in the future.” Madin led a 2007 expedition to explore the Celebes Sea, east of Borneo, and collected samples of what turned out to be a new genus of animals nicknamed “squidworms.” Life in chemical-fueled ecosystems Meanwhile, another group of scientists, called ChEss for “chemosynthetic ecosystems,” focused on seafloor animals that obtain energy from chemicals rather than sunlight. Such ecosystems exist at hot geysers of chemical-laden water called hydrothermal vents, as well as other locations where chemicals seep from the seafloor, and whale falls, or remnants of whale carcasses slowly releasing chemicals. The ChEss project focused on setting up web-based data pages for species from deep-water chemosynthetic systems and developing a long-term international field program for exploring vents and seeps, said WHOI marine geochemist Chris German, head of the National Deep Submergence Facility and co-leader of ChEss. “We selected priority sites for exploration on the seafloor and mid-ocean ridge,” German said. “We came up with a plan for about a half a dozen sites around the planet where it would be really interesting to know what was living around the hot springs.” Using remotely operated and autonomous underwater vehicles and advanced imaging systems, ChEss scientists explored Earth’s hardest-to-reach places. German led an expedition in 2010 to the Mid-Cayman Rise, using WHOI’s hybrid robotic vehicle Nereus to explore the region for the first time and finding evidence for the deepest-known hydrothermal vents. Since 2002, scientists have logged information on more than 500 species and described more than 200 new deep-sea species. In 2005, scientists diving in the WHOI-operated submersible Alvin found a white crab with long, hairy arms on the seafloor 1,000 miles from Tahiti, which they dubbed the “yeti crab.” It turned to out to be not just a new species but part of a new family on the tree of life. “I think the biggest result was that we got researchers together, to communicate and examine holistic problems,” said WHOI deep-sea biologist Tim Shank, who is a member of the ChEss International Steering Committee. “That has given us leaps in understanding.” Revealing seamount biodiversity Shank was also part of the secretariat for Global Census of Marine Life on Seamounts, or CenSeam, which began in 2005 to gather existing information from the international community of scientists studying life on undersea mountains. Seamounts are common around the globe, yet fewer than 200 of the estimated 100,000 seamounts have been studied. Many support productive ecosystems in less productive regions of the ocean. They also are also highly vulnerable to overexploitation and physical damage by fishing and mining practices. Shank said that much of the information already collected on seamounts was scattered in different places. “For seamounts, a lot of international work was being done, and species being collected in different ways and species lists being made,” he said. “So the first goal of CenSeam was to pull information from old data, to get it together and translated. For our group, there were so many nations, so diverse, and so many back collections.” Data analysis and standardization are large parts of the program, and the integrated seamount database CenSeam established will help to align research done in different places and make possible comparisons of biodiversity at seamounts in different regions. Other CenSeam goals were to learn what factors drive the species diversity on seamounts and how the communities function, and to delineate the impacts human activities have on seamount communities. Rather than try to sample all the world’s seamounts—an impossible task, given the resources available—CenSeam scientists want to guide future seamount sampling to fill gaps in knowledge of regions and types of seamounts. “The Census of Marine Life means different things to different people,” said Shank. “While a species list was something we did for the ChEss project, we didn’t have that for seamounts, and didn’t try to do it. We had so many diverse researchers all over the world, and it was our goal to enable them to be connected and exposed to each other, to be open and informative.” “The scientific community now knows it can work together internationally, and there is little doubt that future collaborations will follow,” said Paul Snelgrove of Memorial University of Newfoundland, who is leader of the Census Synthesis Group. Scientists involved in the Census feel an urgency about continuing this work, he said, since global climate change may be causing declines in some species and altering ecosystems. Posted: December 17, 2010

http://www.whoi.edu/oceanus/viewArticle.do?id=87048&archives=true

Han Yu’s “Memorial on the Buddha’s Bones,” in conjunction with his pro-Confucian essay “The Original Tao,” came to be viewed by later generations of Chinese as the polemical foundation for the Confucian revival known as Neo-Confucianism. Neo-Confucianism became the dominant social-political discourse from the twelfth through the nineteenth centuries. In 819 ce, Emperor Xianzong of the Tang Dynasty held a ceremony in which finger bones reputed to be relics of the Buddha were publicly displayed. Although their provenance is unclear, in 558 the relics were enshrined in a special underground chamber of a stupa (a dome-shaped Buddhist shrine) built at the Dharma Gate Temple in Shaanxi Province. The relics were said to have the power to protect the surrounding area and to bestow good fortune on those who venerated them. Because the imperial family was responsible for the empire’s well-being, such ceremonies also underscored the power of the ruling family. During the Tang Dynasty... Stones inscribed with the writings of Confucius, Temple of Confucius, Beijing (Library of Congress) View Full Size

http://www.milestonedocuments.com/documents/view/han-yus-memorial-on-the-buddhaaposs-bones

One-year-olds are building a foundation for language. They absorb the language around them and are steadily building their vocabularies. They understand common phrases and simple directions used in routine situations. They have great difficulty with pronunciation, and familiar adults almost always need to "translate" for others. During this year, communication skills typically progress from grunting and pointing to speaking single words and experimenting with simple word combinations. At 12 months, understands 50 words; at 15 months, 120 words; at 16 months, 170 words; at 18 months, 200 or more words. Between 12 and 15 months, acquires about one word every other day. During a "spurt" between 16 and 23 months, children typically acquire one or two words per day. At 12-14 months, learns words when adults name objects that are nearby or in hand. By 14 or 15 months, points to objects further away for adults to name. Vocabulary words include many nouns (names of things), some verbs (e.g., kiss, kick, open, sleep), some descriptive words (e.g., cold, full, all gone, broken), some pronouns (e.g., he, me, mine) and some location words (e.g., down, in). Understands a few common phrases used in routine situations (e.g., "Do you want more?", "Give me a kiss.", "Let's go bye-bye."). Understands simple directions used in routine situations (e.g., "Stop that.", "Spit it out.", "Please hold still.", "Sit down.", "Stand up.") Understands only the simplest explanations in routine contexts. Perceives individual speech sounds in native language. Is less able now than at 6 months of age to discriminate individual sounds in other languages, and this sensitivity will continue to decrease. Distinguishes between commenting and questioning intonation (patterns of pitch changes in speech), and between a positive and negative tone of voice. At 12 months, the average child says up to three words and may also communicate by grunting, nodding, pointing, etc. At 15 months, the average child says 14 words. At 16 months, the average child says 40 words. At 18 months, the average child says 68 words. At 23 months, the average child says about 200 words. Over- and under- extends meanings. For example, a child calls a cow "horsie" or does not use "shoe" to label footwear that is not a common shoe (i.e., boot or sandal). From 12 months to 24 months, words are rarely spoken correctly in the adult manner. Has great difficulty with pronunciation. Parents and caregivers almost always need to "translate" for others Up to about 18 months, children express themselves with single words, using different vocal sound changes to show what they mean. Around 18 months, children typically experiment with combining words to form phrases and sentences. Such communications consist of a few words, and are lacking parts of speech (e.g., "Mommy sock?" for "Is this Mommy's sock?", "Daddy go." for "Daddy is going bye-bye.").

http://www.pbs.org/parents/childdevelopmenttracker/one/language.html

Waves form when the wind blows over a body of water . In the open ocean waves look like a series of swells. When a wave gets near the shore the wave bottom drags against the seafloor while the top keeps moving. The wave gets narrower and higher and eventually topples over crashing onto the beach face. When you watch a wave, it looks like the water is rushing forward. Would it surprise you to learn that it is hardly moving at all? When a wave passes, the water moves around in a circle. The wave crest is at the top of a circle and the wave trough is at the bottom of a circle. The circles get smaller and smaller the deeper you go. - Wave movement - Water particle motion - Negligible water movement below/wavelength Friction between wind and water cause very small ripples to appear. The wind pushes against the ripples and they grow larger and larger forming waves.

http://www.onegeology.org/eXtra/kids/earthProcesses/waves.html

To practice the skill of reasoned decision making, and to encourage students to anticipate the consequences of their choices. Students should get into the habit of considering alternatives and their consequences. The concept of trade-offs should show up in many parts of the curriculum. In this lesson, students practice balancing different interests involved in solving social problems, looking for the most realistic solution based on the advantages and disadvantages. They also consider the concept of compromise. Preview the site used in the lesson, Little Planet Times, and print out pages ahead of time, if necessary. To introduce the notion of social trade-offs, begin by having students engage in some form of classroom decision making, perhaps related to a classroom rule, outing, or pet. Students should look at all of the possible options, as well as the consequences of each. Have students look at the advantages and disadvantages of each option, and discuss the notion of compromise. Ask questions such as: - Is there a solution that would allow many people to get what they want? - Would you need to give up one thing in order to get something else? This article tells the tale of a town council meeting at which the Little Planet Creatures have gathered to vote on whether or not to tear down a local hill. The hill is preventing one of the councilmembers from arriving to meetings on time, as he must struggle to climb up the large hill. The councilmembers are divided on the issue, trying to balance the needs of their friend with the potential impact on the environment. Divide the class into four teams and assign each team one of the four concilmembers. Pass out the Councilmember Information Sheet. Ask students to use this student sheet to gather information about their councilmember. Once students have gotten this information, bring the class back together to do some role playing so students will have a chance to discuss the issue. In addition to the questions included in the article, ask students: - What are some of the possible consequences of tearing down the hill? - What might happen to the animals that live in the area? - The creatures on the council all have very different opinions. Is there something that they can do so that many people get what they want? You could assess students' decision making and reasoning skills by having them participate in a class debate. Students could send a message to the Little Planet Times by clicking on the "write" link toward the bottom of the text. By doing so, their recommendations, along with other students’ recommendations, will be posted on the site. Geoguide: Dams, from National Geographic, allows students to contemplate why—and how—people build dams, and explore the good and bad impacts a dam may have on a community. Students can practice their decision-making skills even more by going to Amazon Interactive: Coffee and Conservation, from Education Web Adventures. In this activity, students can become Quichua farmers who must choose what to plant on their land. They can find out if the decisions they make are able to sustain their family.

http://sciencenetlinks.com/lessons/making-good-decisions/

Dominance Hierarchies on the Reef Although dominance hierarchies were first studied in domestic chickens -- hence the term "pecking order" -- many different kinds of animals, fish included, fight among themselves to see who is boss. In the wild, these dominance hierarchies are usually formed between conspecifics, but in aquariums a hierarchy can often develop between the inhabitants, regardless of their species. Why do fish establish dominance hierarchies? Hierarchies develop when individual fish attempt to stake a claim for a share of the resources, which in most cases means food. The largest and most aggressive fish are capable of out-competing others so they take a disproportionate chunk for themselves, leaving the others to squabble for what is left. Royal grammas (Gramma loreto) live in groups on the undersides of reef ledges and feed on drifting plankton. The best spots for gathering plankton are always held by dominant individuals in the group, who aggressively defend their place against subordinate fish. Although fighting for an elevated place in the hierarchy can be costly in the short run, the dominant fish gain their rewards over time, growing faster than lower-ranked fish and maturing sooner into breeding adults. However, subordinate fish also benefit from being in the group. Damselfish at the bottom of the pecking order grow comparatively slowly, but are less likely to be captured by predators because of the safety of being in a group. How do fish decide on their place in the hierarchy? Fish decide an order of precedence through aggression and direct competition from the dominant individuals at the top of the hierarchy down to the weaker subordinate fish at the bottom. Dominance is usually determined by size, age, and experience: larger fish boss small ones, older fish dominate younger ones, and fish that have been living in a particular locale for a period outrank newcomers. But for otherwise equal fish, the hierarchy may be decided by a great deal of displaying and even out-and-out fighting, although this is by no means the only method they use. Simply by watching others fight, fish can decide whether they have any real chance against the combatants. If they decide that one or other of the fighters is a real bruiser, they can save themselves from injury by signaling submissiveness to these fish in future. Perhaps the best predictor of a fish's position in a dominance hierarchy is its size, but even among closely matched fish the order is usually established extremely quickly, often within 24 hours. What about hierarchies based on their members' sexes? A number of coral reef fish live in breeding groups where the sexes assume different positions in the dominance hierarchy. For example, some cleaner wrasses form so-called linear hierarchies, where each individual occupies a step on the ladder, dominant to those below it but subordinate to any above. (The alternative is the "despotic hierarchy," sometimes seen in eels, where a single dominant individual aggressively rules the roost over all others, who are each of approximately equal rank). In cleaner wrasses, the hierarchy is topped by a single dominant male and the other fish in the pecking order are all females, whereas in clownfish, the reverse is true; the female is at the top of the pile and the males form the remainder of the hierarchy.

http://infolific.com/pets/coral-reef-life/dominance-hierarchies-on-the-reef/

The following are the steps in the replication of DNA. This video is a summary of DNA Replication. In the initiation step, several key factors are recruited to an origin of replication. This origin of replication is unwound, and the partially unwound strands form a "replication bubble", with one replication fork on either end. Each group of enzymes at the replication fork moves away from the origin, unwinding and replicating the original DNA strands as they proceed. A helicase, which unwinds and splits the DNA ahead of the fork. Thereafter, single-strand binding proteins (SSB) swiftly bind to the separated DNA, thus preventing the strands from reuniting. A primase, which generates an RNA primer to be used in DNA replication. A DNA holoenzyme, which in reality is a complex of enzymes that together perform the actual replication. After the helicase unwinds the DNA, single-strand binding protein is used to hold the DNA strands apart. RNA primase is then bound to the starting DNA site. At the beginning of replication, an enzyme called DNA polymerase binds to the RNA primase, which indicates the starting point for the replication. DNA polymerase can only synthesize new DNA from the 5’ to 3’ (of the new DNA). Because of this, the DNA polymerase can only travel on one side of the original strand without any interruption. This original strand, which goes from 3’ to 5’, is called the leading strand. The complement of the leading strand, from 5’ to 3’, is the lagging strand. Molecular Visualizations of DNA Replication. Each time the helicase unwinds additional DNA, a (potentially) new DNA polymerase needs to be added. As a result, the DNA of the lagging strand is replicated in a piecemeal fashion. Another enzyme, DNA ligase, is used to connect the so-called Okazaki fragments. Coupled leading strand and lagging strand synthesis is achieved by the action of the polIII holoenzyme. When the polymerase reaches the end of replication, there is another problem due to the antiparallel structure. The RNA primer on the leading strand occupies a small portion of the DNA, which is not exposed to polymerase and terefore is not copied. As a result, there would be a gap on the newly duplicated DNA at the original leading strand on the 5’ end of non-circular (viz. eukaryotic) chromosomes. The solution is quite simple. The sticking out 3’ end consists of noncoding DNA called the telomere, which can be simply cut off. Before the DNA replication is finally complete, enzymes are used to proofread the sequences to make sure the nucleotides are paired up correctly. If mistake or damage occurs, an enzyme called nuclease will remove the incorrect DNA. DNA polymerase will then fill in the gap. A chemical equation can be written that represents the process: (DNA)n + dNTP ↔ (DNA)n+1 + PPi The average human chromosome contains an enormous number of nucleotide pairs that are copied at about 50 base pairs per second. Yet, the entire replication process takes only about an hour. This is because there are many replication origin sites on a eukaryotic chromosome. Therefore, replication can begin at some origins earlier than at others. As replication nears completion, "bubbles" of newly replicated DNA meet and fuse, forming two new molecules. With multiple replication origin sites, a question is: how does the cell know which DNA has already been replicated and which still awaits replication? To date, two replication control mechanism have been identified: one positive and one negative. For DNA to be replicated, each replication origin site must be bound by a set of proteins called the origin recognition complex. These remain attached to the DNA throughout the replication process. Specific accessory proteins, called licensing factors, must also be present for initiation of replication. Destruction of these proteins after initiation of replication prevents further replication cycles from occurring. This is because licensing factors are only produced when the nuclear membrane of a cell breaks down during mitosis. Measurement of DNA replication can be done using conditional mutants. Mutants that grow at 30°C but not at 42°C are collected. These mutants should incorporate nucleotides into DNA at 30° but not at 42°C. Protein synthesis should not be affected. There are two outcomes for a graph of incorporation of labelled nucleotides into DNA vs time: Quick stop indicates the mutation is in a DNA synthesis factor. Slow stop indicates the mutation is possibly in an initiation factor. (dnaA).

http://www.molecularstation.com/wiki/DNA_replication

|Reviewers Comments: | Farm to Table & Beyond is a comprehensive curriculum that teaches students about the different components of the global food system and how parts of the system interact with and influence each other. The curriculum is divided into six units. The first unit is taken from the Growing Food curriculum and introduces the students to food science. Students investigate corn (and corn products) and grapes, and make grape juice. The second unit looks at the systems of getting food from a farm to the table, including food manufacturing, packaging and transporting. The third unit focuses closer on how food changes as it goes from farm to table, looking at food processing and preserving, such as drying, salting and pickling. In the fourth unit, students look at the environmental impacts of food and the food system, such as pollution. The fifth unit discusses methods to reduce food-related waste. The sixth and final unit serves as a review and focuses on using the information from the first five units to make ecologically sound food choices. The curriculum is designed to promote student exploration and inquiry. Throughout the modules, students are challenged to ask questions and theorize the answers. Educators are encouraged to set up full class and small group discussions, and have students present their work to the class. Students keep journals called LiFE Logs, reflecting on what they learned and answering open-ended questions. This method, used in this and other LiFE curricula, is called QuESTA: Questioning, Experimenting, Searching, Theorizing, and Applying to life. This diverse curriculum includes a variety of learning experiences and activities to help students explore the answers to scientific questions. Creative methods of learning are used to engage students including timelines, learning stations, the jigsaw method (cooperative learning), and relating to the curriculum to current events and other subjects. Educators are encouraged to help students create a ‘farm to table’ expo to share what they are learning with other students and classes, and ideas are provided for science projects and experiments that could be used for the expo. It would be helpful for an educator to have a background in science education or agriculture, but not required as background information and teacher notes are provided for each of the lessons. Lessons should be reviewed thoroughly before being taught. All activities require advance preparation. Most lessons do not require additional materials, outside what is generally found in the classroom. Lesson time is not provided for any of the lessons. There are a variety of lesson resources, readings, experiments and activities to support each of the lessons and their objectives. Sample class discussions are provided for the educator, and background information on new concepts is provided for both the educator and the student, separately. Student pages, which are designed to be copied for use as handouts are provided. Several student pages include basic, often humorous illustrations to help promote student understanding and make the page more engaging. Student pages also include some charts and graphic representations. Some lessons include basic recipes (nutrition information for recipes is not included). It would be helpful to have student handouts and materials on a CD or in an electronic format for ease in duplicating. Student progress can be assessed with completed activity sheets and logs. There is also a pre-assessment (lesson 4) and post-assessment (lesson 30) included. This curriculum is designed for students in grades 5 or 6 and includes a matrix that maps Farm to Table & Beyond to the National Science Education Standards and Benchmarks for Science Literacy. Lessons and activities could be also be used in social studies, cooking and home economics classes. It is designed to be completed in a series in its entirety, but different lessons and activities could be used on their own with some modification.

http://snap.nal.usda.gov/foodstamp/resource_finder_details.php?id=490

Key Pageshome | |Help on Slideshows| By Amanda Bauer Neoclassicism really began in the United States under the influence of Thomas Jefferson. From the beginning of the new nation, Jefferson and others decided that Classical architectural forms (including from the Roman Republic) would be best for the new American Republic. This association was deemed especially fitting because the American constitution and governmental organization was based on Greco-Roman institutions (such as the Senate). American governmental buildings and monuments built in the Neoclassical tradition, then, are symbolic representations of democracy, freedom, and the Republic in America. The peripheral colonnade includes Corinthian columns similar to those used in government buildings of the Greco-Roman tradition, including at the Roman senate and at the Pantheon (see below). Detail of the Corinthian columns at the Providence Courthouse, including ornate acanthus leaves. Pantheon (Rome, 125 BCE). Corinthian columns from the portico of the Pantheon, which are extremely similar to the columns of the courthouse. This column (approximately 100 feet in height) was erected on November 11, 1929 as a memorial for the citizens of Providence who served in World War I. It was designed by the architect Paul Cret. Paul C. Jennewein sculpted the low-relief frieze surrounding the base and possibly the crowning figure, which is identified as either an embodiment of Victory or Peace. Multiple aspects of this column have been taken from the Greco-Roman tradition. The erection of a column to commemorate victory in battle was a tradition of the Roman emperors such as Emperor Trajan's Column of Trajan (see below) which was erected to commemorate his victory in the Dacian Wars. Column of Trajan (Apollodorus of Damascus, 113 BCE) Base relief of the Providence War Monument. Western side of the base relief of the Providence War Monument. The winged central figure could be Victory, who was first personified as a winged female figure in Greece (see "Nike adjusting her sandal"). "Nike adjusting her sandal" (Athenian Acropolis, ca. 410 BCE). This is obviously a much higher relief than the base of the War column, but Nike (the Goddess of Victory) is also represented on the monument. Eagle from the relief of the Providence War Monument. In the 1780s, the Continental Congress thought it important to assert the identity of the new union with a single symbol which would also be used as the symbol of the American Republic. The committee chose the American bald eagle, an adaptation of the ancient personfication of Zeus. The eagle was also decreed the symbol of the Senate and People of Rome in 102 BCE. Eagles are therefore a Neoclassical symbol representing traditions of authority (because it is associated with Zeus, king of the Greek gods) and government and democracy (because it was the symbol of the Roman senate). See Roman coin below. Roman Coin (4th c. CE) Providence City Hall The City Hall was actually adapted from the French Neoclassical style which was popular beginning in Henri II's reign. The facade of the building includes one row of Doric columns, the second of Corinthian, and the third of Ionic (therefore showing all three orders on one facade). Detail of Ionic columns of Providence City Hall facade. Rhode Island State House Construction on the State House was begun in 1896 and finished on June 11, 1904. It is one of the best examples of Neoclassical architecture in Providence. Many buildings in the U.S. such as this are based on the United States capital (see below). The facade was built in the Corinthian order. United States Capitol (Pierre Charles L'Enfant, Washington D.C.; originally constructed finishing in 1800). For his first project, Jefferson took inspiration from the Maison Carrée for the Virginia Statehouse. Jefferson’s hope was that his statehouse would inspire other pubic buildings in the new Republic and create an American architecture solidly based on the classical traditions of Greece and Rome. L’Enfant planned Washington in this style, and though the rectangular Maison Carée is not used in this case, the dome and frontal colonnade, facade, and pediment are all similar to Classical buildings such as the Pantheon (see below). Pantheon (Rome, 125 BCE) Detail of Corinthian columns on the facade of the Rhode Island State House. This personification of Justitia (Justice) was one of four Classical paintings on the ceiling inside the State House. The other three paintings were female personifications of "Educatio" (Education), Litera ("Literature"), and Commercium (Commerce), all in Greco-Roman garb and earing olive wreaths. Our modern day depictions of Jusitita (also known as Lady Justice) are actually a hybrid of Greco-Roman mythological figures. Justitia's attributes parallel those of the Hellenic deity Themis (seen here), the embodiment of divine order, law and custom, in her aspect as the personification of the divine rightness of law. It was actually Themis' daughter Dike who was first thought to carry scales. Inside the Dome of the Rhode Island Statehouse. As was mentioned above, the dome was taken from Classical architecture, as well as the coffered ceilings (see Pantheon dome). Inside the Dome of the Pantheon (Rome, 125 BCE). "Portrait of George Washington" (From the Rhode Island State House). Again, Classical forms are surrounding one of the most important members of our nation's history. The painting is surrounded by a Geometric meander, and above Washington is another eagle (the importance of which was mentioned above). Posted at Nov 04/2007 08:51PM: Keffie: Great thematic investigation of the (Neo)Classical roots of the American Republic! You made great connections using strong art historical and architectural foundations to your discussion. Posted at Nov 05/2007 01:07AM: Harry Anastopulos: I really like that you've chosen to start off your view of Neo-Classical Providence through the lens of American Greek Revival's history. Your images are extremely crisp as well as numerous...you've certainly covered a lot of Providence here and made some very specific connections (as provided by images of their Classical counterparts in the ancient world) with the Greek Past. Posted at Nov 05/2007 06:04PM: elise: I like the fact that you looked at some of the decoration inside of the state house as well, rather than focusing exclusively on the exterior architecture of Providence. Posted at Nov 09/2007 12:11AM: Carissa Racca: I really enjoyed your project, particularly the connections you make about the Greek and Roman Republic versus our Republic. Your knowledge of the subject is conveyed extremely well. It makes me appreciate these structures even more in a way. Not only were they aesthetically beautiful, but they were also erected in public spheres where they could be enjoyed by all. Posted at Nov 09/2007 07:30PM: Michael Bohl: I really like how you juxtaposed pictures from Providence with pictures from Rome and other original buildings, it really helped get the message across. I also like how you looked at elements inside the buildings rather than just the exterior. It is evident you did a lot of research. Posted at Nov 17/2007 01:16PM: Kellie Slater: Love the project. I really like all the pictures and their explanations are superb. Before reading your project I didn't know that the eagle was associated with Zeus... interesting and good to know I suppose. Overall great overview of neoclassical influences in Providence. Posted at Dec 13/2007 06:45PM: Rachel Griffith: This was a great topic (and well-exectuted too). Neoclassical architecture is so much a part of modern government buildings but one that we rarely stop to think about the true extent of or the symbolism behind.

http://proteus.brown.edu/greekpast/4530

Fallacies are defects in an argument other than false premises which cause an argument to be invalid, unsound or weak. Fallacies can be separated into two general groups: formal and informal. A formal fallacy is a defect which can be identified merely be looking at the logical structure of an argument rather than any specific statements. Formal fallacies are only found only in deductive arguments with identifiable forms. One of the things which makes them appear reasonable is the fact that they look like and mimic valid logical arguments, but are in fact invalid. Here is an example: 1. All humans are mammals. (premise) 2. All cats are mammals. (premise) 3. All humans are cats. (conclusion) Both premises in this argument are true, but the conclusion is false. The defect is a formal fallacy, and can be demonstrated by reducing the argument to its bare structure: 1. All A are C 2. All B are C 3. All A are B It does not really matter what A, B and C stand for we could replace them with wines, milk and beverages. The argument would still be invalid and for the exact same reason. Sometimes, therefore, it is helpful to reduce an argument to its structure and ignore content in order to see if it is valid. Informal fallacies are defects which can be identified only through an analysis of the actual content of the argument rather than through its structure. Here is an example: 1. Geological events produce rock. (premise) 2. Rock is a type of music. (premise) 3. Geological events produce music. (conclusion) The premises in this argument are true, but clearly the conclusion is false. Is the defect a formal fallacy or an informal fallacy? To see if this is actually a formal fallacy, we have to break it down to its basic structure: 1. A = B 2. B = C 3. A = C As we can see, this structure is valid, therefore the defect cannot be a formal fallacy identifiable from the structure. Therefore, the defect must be an informal fallacy identifiable from the content. In fact, when we examine the content, we find that a key term, rock, is being used with two different definitions (the technical term for this sort of fallacy is Equivocation). Informal fallacies can work in several ways. Some distract the reader from what is really going on. Some, like in the above example, make use of vagueness or ambiguity to cause confusion. Some appeal to emotions rather than logic and reason. Categorizing fallacies can be done in a number of different methods. Aristotle was the first to try and systematically describe and categorize fallacies, identifying thirteen fallacies divided into two groups. Since then many more have been described and the categorization is more complicated. Thus, while the categorization used here should prove.

http://atheism.about.com/od/logicalarguments/a/fallacy.htm

(PhysOrg.com) -- Researchers at Yale University have succeeded in building a new kind of laser based on the way brightly colored birds show their colors. Building on the new approach to creating laser beams, whereby holes are drilled in a material in such a way as to trap light inside for a long enough period of time to create the laser light they are after, researchers Hui Cao, Heeso Noh and their colleagues describe in a paper they've published in Physical Review Letters, how they've emulated the way birds use air holes to display their colors. In traditional lasers, light is bounced back and forth (trapped) between mirrors with a so-called gain material between them that amplifies the light until it is of sufficient strength to pass through one end of the semi-transparent mirror, producing the beam. More recently however, optics researchers have found that another way to hold on to the light is to drill air holes in a material that causes the light to become trapped as it moves between the holes. The air holes in the material can be placed either in a clear ordered fashion, producing just one strong wavelength, or in random fashion which allows for multiple wavelengths but isnt very efficient; something that grows in importance as the laser power desired grows and uses more energy when it is produced. The new technique falls somewhere in-between, in that at first glance the air holes appear to be random, but upon closer inspection, turn out to be ordered after all. This is where the brightly colored birds come in; nature has given them feathers with air pockets that at first glance appear to be randomly spaced, but under closer scrutiny its revealed that there is in fact, order underneath; the result is some light is trapped and bounced around inside and between them, allowing the amount of light to build up before ultimately escaping and giving the birds their brilliant hues. To recreate the effect in the lab, the research team drilled holes in a 190 nanometer slice of gallium arsenide, a particularly good plastic for lasers, 235 to 275 nanometers apart, and which also had a layer of quantum dots that shine brilliantly when struck with just one photon. As suspected, when the wafer was lit up, it produced a laser of about 1,000 nanometers, which made it far more efficient than random lasers; after more tests were made it was found that the wavelength produced could be changed by altering the amount of space between the holes. Though its not yet clear how the new type of laser will be used, it does seem likely the new approach will be used to help bring down the costs of lasers, and perhaps more importantly, the amount of energy needed to rum them. Explore further: Optics: Statistics light the way More information: -- Control of Lasing in Biomimetic Structures with Short-Range Order, Phys. Rev. Lett. 106, 183901 (2011) DOI: 10.1103/PhysRevLett.106.183901 We demonstrate lasing in photonic amorphous structures that mimic the isotropic nanostructures which produce noniridescent color in nature. Our experimental and numerical studies reveal that lasing becomes most efficient at certain frequencies, due to enhanced optical confinement by short-range order. The optimal lasing frequency can be tuned by adjusting the structure factor. This work shows that lasing in nanostructures may be effectively improved and manipulated by short-range order.

http://phys.org/news/2011-05-lasing-technique-brightly-birds.html

A research team from the University of Florida and the US Geological Survey suggests the lack of genetic diversity in manatee populations may have an impact on the marine mammals’ survival long term. Even though the population is growing, the animal is still considered endangered. Researchers used skin samples collected from the tails of 362 manatees to determine genetic maps. Results revealed a moderate level of inbreeding within the Gulf Coast study population. The impact of a lower genetic variation means, in the case of manatees, they may be less able to overcome environmental threats which promote disease or encourage increased inbreeding due to a limited number of breeding-age partners. In order to survive, the manatees will have to adapt. Manatees, also known as sea cows, are large, fully aquatic, primarily herbivorous marine mammals. They measure up to 10 feet long, weigh as much as 1,200 pounds, and have paddle-like flippers and tail. Females tend to be larger and heavier than the males. Manatees typically breed once every two years. Gestation lasts about 12 months. They don’t have natural enemies and can live as long as 60 years. These aquatic animals have short snouts, widely spaced eyes, and no incisors or canines. Manatees have sets of cheek teeth which are replaced throughout their lifespan; old ones are ejected as new ones grow in. They have a large, flexible, prehensile upper lip used to gather food and eat. This specialized upper lip is also used for social interaction and communication. Manatees are the only animal known to have a vascularized cornea. Prior to this study, the US Fish and Wildlife Service considered reclassifying the statue of manatees from endangered to threatened on the conservation status scale. The change in rating is currently under debate. [Image via Shutterstock]

http://www.inquisitr.com/518390/lack-of-diversity-in-genetics-may-threaten-manatees-study/

Neuroblastoma is a malignant (cancerous) tumor that develops from nerve tissue. It usually occurs in infants and children. Causes, incidence, and risk factors Neuroblastoma can occur in many areas of the body. It develops from the tissues that form the sympathetic nervous system (the part of the nervous system that controls body functions, such as heart rate and blood pressure, digestion, and levels of certain hormones). Most neuroblastomas begin in the abdomen in the adrenal gland or next to the spinal cord, or in the chest. Neuroblastomas can spread to the bones (face, skull, pelvis, shoulders, arms, and legs), bone marrow, liver, lymph nodes, skin, and around the eyes (orbits). The cause of the tumor is unknown. Neuroblastoma is most commonly diagnosed in children before age 5. The disorder occurs in approximately 1 out of 100,000 children and is slightly more common in boys. In most patients, the neuroblastoma has already spread when it is first diagnosed. The first symptoms are usually fever, a general sick feeling (malaise), and pain. There may also be loss of appetite, weight loss, and diarrhea. Other symptoms depend on the site of the tumor, and may include: - Bone pain or tenderness (if the cancer spreads to the bones) - Difficulty breathing or a chronic cough (if the cancer spreads to the chest) - Enlarged abdomen (from a large tumor or excess fluid) - Flushed, red skin - Pale skin and bluish color around the eyes - Profuse sweating - Rapid pulse (tachycardia) Brain and nervous system problems may include: Signs and tests Signs vary depending on the location of the tumor. - Examination of the abdomen with the hands (palpation) may reveal a lump. - The liver may be enlarged, if the tumor has spread to the liver. - Adrenal gland tumors can cause high blood pressure and a fast heart rate. - Lymph nodes may be swollen. X-ray or imaging tests are done to locate the main (primary) tumor and to see where it has spread. These include: Other tests include: - Biopsy of tumor - Bone marrow biopsy - CBC showing anemia or other abnormality - Coagulation studies, erythrocyte sedimentation rate - Hormone tests (blood tests to check levels of hormones such as epinephrine and other catecholamines) - MIBG scan - Urine 24-hour test for catecholamines, homovanillic acid (HVA), and vanillymandelic acid (VMA) Treatment varies depending on: - The location of the tumor - How much and where the tumor has spread - The patient's age In certain cases, surgery alone is enough. Often, though, other therapies are needed. Anticancer medications (chemotherapy) may be recommended if the tumor has spread. Radiation therapy may also be used. High-dose chemotherapy, followed by autologous stem cell transplantation, is being studied for use in children with very high-risk tumors. The outcome varies. In very young children with neuroblastoma, the tumor may go away on its own, without any treatment. Or, the tissues of the tumor may mature and develop into a non-cancerous (benign) tumor called a ganglioneuroma, which can be surgically removed. In other cases, the tumor spreads quickly. Response to treatment also varies. Treatment is often successful if the cancer has not spread. If it has spread, neuroblastoma is much harder to cure. Younger children often do better than older children. Tumors with certain genetic characteristics may be harder to cure. Children treated for neuroblastoma may be at risk for getting a second, different cancer in the future. Calling your health care provider Call your health care provider if your child has symptoms of neuroblastoma. Early diagnosis and treatment improves the chance of a good outcome. Dome JS, Rodriguez-Galindo C, Spunt SL, Santana VM. Pediatric Solid Tumors. In: Abeloff MD, Armitage JO, Niederhuber JE, Kastan MB, McKenna WG, eds. Clinical Oncology. 4th ed. Philadelphia, Pa; Churchill Livingstone Elsevier; 2008:chap 99. The information provided herein should not be used during any medical emergency or for the diagnosis or treatment of any medical condition. A licensed medical professional should be consulted for diagnosis and treatment of any and all medical conditions. Call 911 for all medical emergencies. Links to other sites are provided for information only -- they do not constitute endorsements of those other sites. ©1997-2013 A.D.A.M., Inc. Any duplication or distribution of the information contained herein is strictly prohibited. Sign Up for Free Newsletters Ask Your Doctor the RIGHT Questions! the most from your doctor visit. Emailed right to you! The Ask Your Doctor email series may contain sponsored content. 18+, US residents only please. Explore Original Articles About... Get the MOST from QualityHealth - Top Searches - 1. Arthritis Management: Nature Heals - 2. 5 Digestive To-Dos - 3. Men: Should You Shave It or Leave It? - 4. Today's Top Fitness Trends - 5. Sugar and Osteoarthritis : The Link - 6. Can't Afford Your Hospital Bills? - 7. Stay Energized All Day Long - 8. Phobias: Who Has Them and Why? - 9. What If Your EpiPen Fails? - 10. 5 Costly Medical Billing Mistakes - 1. Ice Falls Can Cause Serious Injuries - 2. Can Inactivity Act Like a Disease? - 3. Kale Snack Recipe for Diabetics - 4. How Running Affects Arthritis - 5. Sugar and Your Immunity System - 6. Do Weight Loss Supplements Work? - 7. 5 Super Foods for Spring - 8. The Hazards of Reusable Bags - 9. How to Avoid Ingrown Hairs - 10. Health Tip: Constantly Change Shoes - 1. 4 Common Treatments for Epilepsy - 2. What Does a Urogynecologist Do? - 3. GERD Without Heartburn? It's Possible - 4. Graston Technique: Can It Work on You? - 5. Music Therapy Can Help Autism - 6. 8 Ways to Fight MS-Related Fatigue - 7. Can You Still Bleed After Menopause? - 8. Be Your Own Health Care Advocate - 9. Why Is Syphillis on the Rise? - 10. Ideal Weight vs. Happy Weight The material on the QualityHealth Web site is for informational purposes only, and is not a substitute for medical advice, diagnosis, or treatment provided by a physician or other qualified health provider. See additional information.

http://www.qualityhealth.com/health-encyclopedia/multimedia/neuroblastoma

Evidence of String Theory: Gamma Ray Bursts Among the various phenomena in the universe, two types produce large amounts of energy and may provide some insight into string theory: gamma ray bursts (GRBs) and cosmic rays. Exactly what causes a gamma ray burst is disputed, but it seems to happen when massive objects, such as a pair of neutron stars or a neutron star and a black hole (the most probable theories), collide with each other. These objects orbit around each other for billions of years, but finally collapse together, releasing energy in the most powerful events observed in the universe, depicted in this figure. The name gamma ray bursts clearly implies that most of this energy leaves the event in the form of gamma rays, but not all of it does. These objects release bursts of light across a range of different energies (or frequencies — energy and frequency of photons are related). According to Einstein, all the photons from a single burst should arrive at the same time, because light (regardless of frequency or energy) travels at the same speed. By studying GRBs, it may be possible to tell if this is true. Calculations based on Amelino-Camelia’s work has shown that photons of different energy that have traveled for billions of years could, due to (estimated and possibly over-optimistic) quantum gravity effects at the Planck scale, have differences of about 1 one-thousandth of a second (0.001s). The Fermi Gamma-ray Space Telescope (formerly the Gamma-ray Large Area Space Telescope, or GLAST) was launched in June 2008 as a joint venture between NASA, the U.S. Department of Energy, and French, German, Italian, Japanese, and Swedish government agencies. Fermi is a low-Earth orbit observatory with the precision required to detect differences this small. So far, there’s no evidence that Fermi has identified Planck scale breakdown of general relativity. To date it’s identified a dozen gamma ray–only pulsars, a phenomenon that had never been observed before Fermi. (Prior to Fermi, pulsars — spinning and highly magnetized neutron stars that emit energy pulses — were believed to emit their energy primarily through radio waves.) If Fermi (or some other means) does detect a Planck scale breakdown of relativity, then that will only increase the need for a successful theory of quantum gravity, because it will be the first experimental evidence that the theory does break down at these scales. String theorists would then be able to incorporate this knowledge into their theories and models, perhaps narrowing the string theory landscape to regions that are more feasible to work with.

http://www.dummies.com/how-to/content/evidence-of-string-theory-gamma-ray-bursts.html

Acids and Bases This acid and bases activity will follow the introductory lecture (20 min) on acids and bases and the relation to pH. Students will then be broken into small groups of 6 and given a list of five solutions to rank in order of most acidic to most basic. The instructor will be available to direct students as needed. Students will then present their ranking either on the board or using an audience response system. Students will: 1)understand the pertinent terms, 2) use the resources to do the task: textbook, class notes, eachother, and instructor, 3)successfully rank the solutions. Instructor will get the feedback that mastery has been achieved for this concept. Context for Use This activity is designed for use in an introductory conceptual level chemistry lecture of 72 students. An audience response system with ranking capability will be needed. Description and Teaching Materials A list of solutions to be ranked most acidic to most basic. This can be hard copy, written on the board, or projected. Teaching Notes and Tips Anticipate 20 minutes of lecture, 15 minutes to disseminate list of solutions and have students compete and rank, 5 minutes to report results, 10 minutes to discuss results and modify. Groups will turn in the original list ranked with all of the students names on it. If correct it will be worth some # of points to be added to the next exam. References and Resources

http://serc.carleton.edu/sp/pkal/mnscu/activities/28423.html

The American Civil Rights Movement (1955–1968) refers to the reform movements in the United States aimed at abolishing racial discrimination against African Americans and restoring suffrage in Southern states. This article covers the phase of the movement between 1954 and 1968, particularly in the South. By 1966, the emergence of the Black Power Movement, which lasted roughly from 1966 to 1975, enlarged the aims of the Civil Rights Movement to include racial dignity, economic and political self-sufficiency, and freedom from oppression by whites. Many of those who were most active in the Civil Rights Movement, with organizations such as SNCC, CORE and SCLC, prefer the term "Southern Freedom Movement" because the struggle was about far more than just civil rights under law; it was also about fundamental issues of freedom, respect, dignity, and economic and social equality. After the disputed election of 1876 and the end of Reconstruction, White Americans in the South resumed political control of the region under a one-party system of Democratic control. The voting rights of blacks were increasingly suppressed, racial segregation imposed, and violence against African Americans mushroomed. This period is often referred to as the "nadir of American race relations," and while it was most intense in the South to a lesser degree it affected the entire nation. The system of overt, state-sanctioned racial discrimination and oppression that emerged out of the post-Reconstruction South and spread nation-wide became known as the "Jim Crow" system, and it remained virtually intact into the early 1950s. Systematic disenfranchisement of African Americans took place in Southern states at the turn of the century and lasted until national civil rights legislation was passed in the mid-1960s. For more than 60 years, they were not able to elect one person in the South to represent their interests. Because they could not vote, they could not sit on juries limited to voters. They had no part in the justice system or law enforcement, although in the 1880s, they had held many local offices, including that of sheriff. African-Americans and other racial minorities rejected this regime. They resisted it and sought better opportunities through lawsuits, new organizations, political redress, and labor organizing (see the American Civil Rights Movement 1896-1954). The National Association for the Advancement of Colored People (NAACP) was founded in 1909 and it struggled to end race discrimination through litigation, education, and lobbying efforts. Its crowning achievement was its legal victory in the Supreme Court decision Brown v. Board of Education (1954) that rejected separate white and colored school systems and by implication overturned the "separate but equal" doctrine established in Plessy v. Ferguson. Since the situation for blacks outside the South was somewhat better (in most states they could vote and have their children educated, though they still faced discrimination in housing and jobs), from 1910-1970, African Americans sought better lives by migrating north and west in the millions, a huge population movement collectively known as the Great Migration. Invigorated by the victory of Brown and frustrated by its lack of immediate practical effect, private citizens increasingly rejected gradualist, legalistic approaches as the primary tool to bring about desegregation in the face of "massive resistance" by proponents of racial segregation and voter suppression. In defiance, they adopted a combined strategy of direct action with nonviolent resistance known as civil disobedience, giving rise to the African-American Civil Rights Movement of 1955-1968. During the period 1955-1968, acts of civil disobedience produced crisis situations between protesters and government authorities. The authorities of federal, state, and local governments often had to respond immediately to crisis situations which highlighted the inequities faced by African Americans. Forms of civil disobedience included boycotts, beginning with the successful Montgomery Bus Boycott (1955-1956) in Alabama; "sit-ins" such as the influential Greensboro sit-in (1960) in North Carolina; and marches, such as the Selma to Montgomery marches (1965) in Alabama. Noted legislative achievements during this phase of the Civil Rights Movement were passage of Civil Rights Act of 1964, that banned discrimination in employment practices and public accommodations; the Voting Rights Act of 1965, that restored and protected voting rights; the Immigration and Nationality Services Act of 1965, that dramatically opened entry to the U.S. to immigrants other than traditional European groups; and the Civil Rights Act of 1968, that banned discrimination in the sale or rental of housing. Churches, the centers of their communities, and local grassroots organizations mobilized volunteers to participate in broad-based actions. This was a more direct and potentially more rapid means of creating change than the traditional approach of mounting court challenges. The Montgomery Improvement Association—created to lead the boycott—managed to keep the boycott going for over a year until a federal court order required Montgomery to desegregate its buses. The success in Montgomery made its leader Dr. Martin Luther King a nationally known figure. It also inspired other bus boycotts, such as the highly successful Tallahassee, Florida, boycott of 1956-1957. In 1957 Dr. King and Rev. John Duffy, the leaders of the Montgomery Improvement Association, joined with other church leaders who had led similar boycott efforts, such as Rev. C. K. Steele of Tallahassee and Rev. T. J. Jemison of Baton Rouge; and other activists such as Rev. Fred Shuttlesworth, Ella Baker, A. Philip Randolph, Bayard Rustin and Stanley Levison, to form the Southern Christian Leadership Conference. The SCLC, with its headquarters in Atlanta, Georgia, did not attempt to create a network of chapters as the NAACP did. It offered training and leadership assistance for local efforts to fight segregation. The headquarters organization raised funds, mostly from northern sources, to support such campaigns. It made non-violence both its central tenet and its primary method of confronting racism. In 1959, Septima Clarke, Bernice Robinson, and Esau Jenkins, with the help of the Highlander Folk School in Tennessee, began the first Citizenship Schools in South Carolina's Sea Islands. They taught literacy to enable blacks to pass voting tests. The program was an enormous success and tripled the number of black voters on St. John Island. SCLC took over the program and duplicated its results elsewhere. One of Martin Luther King's strategies was to challenge mainstream America on moral grounds to end the racial abuse and segregation in the South. The medium of television was particularly effective at conveying the news about the conditions of the quality of life for African Americans in the South. The news broadcasts and documentary film making were the first forms for presenting these stories. Later in the 1970s, the film "Roots" by Alex Haley was said to be a turning point in mainstream America's ability to relate to the stresses and particularities of African American history. On December 1, 1955, Rosa Parks (the "mother of the Civil Rights Movement") refused to get up out of her seat on a public bus to make room for a white passenger. She was secretary of the Montgomery NAACP chapter and had recently returned from a meeting at the Highlander Center in Tennessee where nonviolent civil disobedience as a strategy had been discussed. Parks was arrested, tried, and convicted for disorderly conduct and violating a local ordinance. After word of this incident reached the black community, 50 African-American leaders gathered and organized the Montgomery Bus Boycott to protest the segregation of blacks and whites on public buses. With the support of most of Montgomery's 50,000 African Americans, the boycott lasted for 381 days until the local ordinance segregating African-Americans and whites on public buses was lifted. Ninety percent of African Americans in Montgomery took part in the boycotts, which reduced bus revenue by 80%. A federal court ordered Montgomery's buses desegregated in November 1956, and the boycott ended in triumph. (W. Chafe, The Unfinished Journey, A young Baptist minister named Martin Luther King, Jr., was president of the Montgomery Improvement Association, the organization that directed the boycott. The protest made King a national figure. His eloquent appeals to Christian brotherhood and American idealism created a positive impression on people both inside and outside the South. Little Rock, Arkansas, was in a relatively progressive southern state. A crisis erupted, however, when Governor of Arkansas Orval Faubus called out the National Guard on September 4 to prevent the nine African-American students who had sued for the right to attend an integrated school, Little Rock Central High School. The nine students had been chosen to attend Central High because of their excellent grades. On the first day of school, only one of the nine students showed up because she did not receive the phone call about the danger of going to school. She was harassed by White Americans outside the school, and the police had to take her away in a patrol car to protect her. Afterwards, the nine students had to carpool to school and be escorted by military personnel in jeeps. Faubus was not a proclaimed segregationist. The Arkansas Democratic Party, which then controlled politics in the state, put significant pressure on Faubus after he had indicated he would investigate bringing Arkansas into compliance with the Brown decision. Faubus then took his stand against integration and against the Federal court order that required it. Faubus' order received the attention of President Dwight D. Eisenhower, who was determined to enforce the orders of the Federal courts. Critics had charged he was lukewarm, at best, on the goal of desegregation of public schools. Eisenhower federalized the National Guard and ordered them to return to their barracks. Eisenhower then deployed elements of the 101st Airborne Division to Little Rock to protect the students. The students were able to attend high school. They had to pass through a gauntlet of spitting, jeering whites to arrive at school on their first day, and to put up with harassment from fellow students for the rest of the year. Although federal troops escorted the students between classes, the students were still teased and even attacked by white students when the soldiers weren't around. One of the Little Rock Nine, Minnijean Brown, was expelled for spilling a bowl of chili on the head of a white student who was allegedly harassing her in the school lunch line. Only one of the Little Rock Nine, Ernest Green, got the chance to graduate; after the 1957-58 school year was over, the Little Rock school system decided to shut public schools completely rather than continue to integrate. Other school systems across the South followed suit. The Civil Rights Movement received an infusion of energy with a student sit-in at a Woolworth's store in Greensboro, North Carolina. On February 1, 1960, four students Ezell A. Blair Jr. (now known as Jibreel Khazan), David Richmond, Joseph McNeil, and Franklin McCain from North Carolina Agricultural & Technical College, an all-black college, sat down at the segregated lunch counter to protest Woolworth's policy of excluding African Americans. These protesters were encouraged to dress professionally, to sit quietly, and to occupy every other stool so that potential white sympathizers could join in. The sit-in soon inspired other sit-ins in Richmond, Virginia; Nashville, Tennessee; and Atlanta, Georgia. As students across the south began to "sit-in" at the lunch counters of a few of their local stores, local authority figures sometimes used brute force to physically escort the demonstrators from the lunch facilities. The "sit-in" technique was not new— as far back as 1942, the Congress of Racial Equality sponsored sit-ins in Chicago, St. Louis in 1949 and Baltimore in 1952. In 1960 the technique succeeded in bringing national attention to the movement. The success of the Greensboro sit-in led to a rash of student campaigns throughout the South. Probably the best organized, most highly disciplined, the most immediately effective of these was in Nashville, Tennessee. By the end of 1960, the sit-ins had spread to every southern and border state and even to Nevada, Illinois, and Ohio. Demonstrators focused not only on lunch counters but also on parks, beaches, libraries, theaters, museums, and other public places. Upon being arrested, student demonstrators made "jail-no-bail" pledges, to call attention to their cause and to reverse the cost of protest, thereby saddling their jailers with the financial burden of prison space and food. In 1960 activists who had led these sit-ins formed the Student Nonviolent Coordinating Committee (SNCC) to take these tactics of nonviolent confrontation further. Student Nonviolent Coordinating Committee Founded ~ Civil Rights Movement Veterans Freedom Rides were journeys by Civil Rights activists on interstate buses into the segregated southern United States to test the United States Supreme Court decision Boynton v. Virginia, (1960) 364 U.S. that ended segregation for passengers engaged in inter-state travel. Organized by CORE, the first Freedom Ride of the 1960s left Washington D.C. on May 4, 1961, and was scheduled to arrive in New Orleans on May 17. During the first and subsequent Freedom Rides, activists traveled through the Deep South to integrate seating patterns and desegregate bus terminals, including restrooms and water fountains. That proved to be a dangerous mission. In Anniston, Alabama, one bus was firebombed, forcing its passengers to flee for their lives. In Birmingham, Alabama, an FBI informant reported that Public Safety Commissioner Eugene "Bull" Connor gave Ku Klux Klan members 15 minutes to attack an incoming group of freedom riders before having police "protect" them. The riders were severely beaten "until it looked like a bulldog had got a hold of them." Mob violence in Anniston and Birmingham temporarily halted the rides until SNCC activists arrived in Birmingham to resume them. In Montgomery, Alabama a mob charged another bus load of riders, knocking John Lewis unconscious with a crate and smashing Life photographer Don Urbrock in the face with his own camera. A dozen men surrounded Jim Zwerg, a white student from Fisk University, and beat him in the face with a suitcase, knocking out his teeth. The freedom riders continued their rides into Jackson, Mississippi, where they were arrested for "breaching the peace" by using "white only" facilities. New freedom rides were organized by many different organizations. As riders arrived in Jackson, they were arrested. By the end of summer, more than 300 had been jailed in Mississippi. The jailed freedom riders were treated harshly, crammed into tiny, filthy cells and sporadically beaten. In Jackson, Mississippi, some male prisoners were forced to do hard labor in 100-degree heat. Others were transferred to Mississippi State Penitentiary at Parchman, where their food was deliberately oversalted and their mattresses were removed. Sometimes the men were suspended by "wrist breakers" from the walls. Typically, the windows of their cells were shut tight on hot days, making it hard for them to breathe. Eventually, public sympathy and support for the freedom riders forced the Kennedy administration to order the Interstate Commerce Commission (ICC) to issue a new desegregation order. When the new ICC rule took effect on November 1st, passengers were permitted to sit wherever they chose on the bus; "white" and "colored" signs came down in the terminals; separate drinking fountains, toilets, and waiting rooms were consolidated; and lunch counters began serving people regardless of skin color. The student movement involved such celebrated figures as John Lewis, the single-minded activist who "kept on" despite many beatings and harassments; James Lawson, the revered "guru" of nonviolent theory and tactics; Diane Nash, an articulate and intrepid public champion of justice; Bob Moses, pioneer of voting registration in Mississippi—the most rural and most dangerous part of the South; and James Bevel, a fiery preacher and charismatic organizer and facilitator. Other prominent student activists included Charles McDew; Bernard Lafayette; Charles Jones; Lonnie King; Julian Bond (associated with Atlanta University); Hosea Williams; and Stokely Carmichael (who later changed his name to Kwame Ture). After the Freedom Rides, local black leaders in Mississippi such as Amzie Moore, Aaron Henry, Medgar Evers, and others asked SNCC to help register black voters and build community organizations that could win a share of political power in the state. Since Mississippi ratified its constitution in 1890, with provisions such as poll taxes, residency requirements, and literacy tests, it made registration more complicated and stripped blacks from the rolls. After so many years, the intent to stop blacks from voting had become part of the culture of white supremacy. In the fall of 1961, SNCC organizer Robert Moses began the first such project in McComb and the surrounding counties in the Southwest corner of the state. Their efforts were met with violent repression from state and local lawmen, White Citizens' Council, and Ku Klux Klan resulting in beatings, hundreds of arrests and the murder of voting activist Herbert Lee. White opposition to black voter registration was so intense in Mississippi that Freedom Movement activists concluded that all of the state's civil rights organizations had to unite in a coordinated effort to have any chance of success. In February of 1962, representatives of SNCC, CORE, and the NAACP formed the Council of Federated Organizations (COFO). At a subsequent meeting in August, SCLC became part of COFO. In the Spring of 1962, with funds from the Voter Education Project, SNCC/COFO began voter registration organizing in the Mississippi Delta area around Greenwood, and the areas surrounding Hattiesburg, Laurel, and Holly Springs. As in McComb, their efforts were met with fierce opposition — arrests, beatings, shootings, arson, and murder. Registrars used the literacy test to keep blacks off the voting roles by creating standards that highly educated people could not meet. In addition, employers fired blacks who tried to register and landlords evicted them from their homes. Over the following years, the black voter registration campaign spread across the state. Similar voter registration campaigns — with similar responses — were begun by SNCC, CORE, and SCLC in Louisiana, Alabama, southwest Georgia, and South Carolina. By 1963, voter registration campaigns in the South were as integral to the Freedom Movement as desegregation efforts. After passage of the Civil Rights Act of 1964, protecting and facilitating voter registration despite state barriers became the main effort of the movement. It resulted in passage of the Voting Rights Act of 1965. James Meredith won a lawsuit that allowed him admission to the University of Mississippi in September 1962. He attempted to enter campus on September 20, on September 25, and again on September 26, only to be blocked by Mississippi Governor Ross R. Barnett, who proclaimed that "no school will be integrated in Mississippi while I am your Governor." After the Fifth U.S. Circuit Court of Appeals held both Barnett and Lieutenant Governor Paul B. Johnson, Jr. in contempt, with fines of more than $10,000 for each day they refused to allow Meredith to enroll, Meredith, escorted by a force of U.S. Marshals, entered the campus on September 30, 1962. White students and other whites began rioting that evening, throwing rocks at the U.S. Marshals guarding Meredith at Lyceum Hall, then firing on the marshals. Two people, including a French journalist, were killed; 28 marshals suffered gunshot wounds; and 160 others were injured. After the Mississippi Highway Patrol withdrew from the campus, President Kennedy sent the regular Army to the campus to quell the uprising. Meredith was able to begin classes the following day, after the troops arrived. The SCLC, which had been criticized by some student activists for its failure to participate more fully in the freedom rides, committed much of its prestige and resources to a desegregation campaign in Albany, Georgia, in November 1961. King, who had been criticized personally by some SNCC activists for his distance from the dangers that local organizers faced—and given the derisive nickname "De Lawd" as a result—intervened personally to assist the campaign led by both SNCC organizers and local leaders. The campaign was a failure because of the canny tactics of Laurie Pritchett, the local police chief, and divisions within the black community. The goals may not have been specific enough. Pritchett contained the marchers without violent attacks on demonstrators that inflamed national opinion. He also arranged for arrested demonstrators to be taken to jails in surrounding communities, allowing plenty of room to remain in his jail. Prichett also foresaw King's presence as a danger and forced his release to avoid King's rallying the black community. King left in 1962 without having achieved any dramatic victories. The local movement, however, continued the struggle, and it obtained significant gains in the next few years. The Albany movement proved to be an important education for the SCLC, however, when it undertook the Birmingham campaign in 1963. The campaign focused on one goal—the desegregation of Birmingham's downtown merchants, rather than total desegregation, as in Albany. It was also helped by the brutal response of local authorities, in particular Eugene "Bull" Connor, the Commissioner of Public Safety. He had long held much political power, but had lost a recent election for mayor to a less rabidly segregationist candidate. Refusing to accept the new mayor's authority, Connor intended to stay in office. The campaign used a variety of nonviolent methods of confrontation, including sit-ins, kneel-ins at local churches, and a march to the county building to mark the beginning of a drive to register voters. The city, however, obtained an injunction barring all such protests. Convinced that the order was unconstitutional, the campaign defied it and prepared for mass arrests of its supporters. King elected to be among those arrested on April 12, 1963. While in jail, King wrote his famous Letter from Birmingham Jail on the margins of a newspaper, since he had not been allowed any writing paper while held in solitary confinement by jail authorities. Supporters pressured the Kennedy Administration to intervene to obtain King's release or better conditions. King eventually was allowed to call his wife, who was recuperating at home after the birth of their fourth child, and was released on April 19. The campaign, however, was faltering because the movement was running out of demonstrators willing to risk arrest. SCLC organizers came up with a bold and controversial alternative, calling on high school students to take part in the demonstrations. More than one thousand students skipped school on May 2 to join the demonstrations, in what would come to be called the Children's Crusade. More than six hundred ended up in jail. This was newsworthy, but in this first encounter, the police acted with restraint. On the next day, however, another one thousand students gathered at the church. When they started marching, Bull Connor unleashed police dogs on them, then turned the city's fire hoses water streams on the children. Television cameras broadcast to the nation the scenes of water from fire hoses knocking down schoolchildren and dogs attacking individual demonstrators. Widespread public outrage forced the Kennedy Administration to intervene more forcefully in the negotiations between the white business community and the SCLC. On May 10, the parties announced an agreement to desegregate the lunch counters and other public accommodations downtown, to create a committee to eliminate discriminatory hiring practices, to arrange for the release of jailed protesters, and to establish regular means of communication between black and white leaders. Not everyone in the black community approved of the agreement— the Rev. Fred Shuttlesworth was particularly critical, since he had accumulated a great deal of skepticism about the good faith of Birmingham's power structure from his experience in dealing with them. The reaction from parts of the white community was even more violent. The Gaston Motel, which housed the SCLC's unofficial headquarters, was bombed, as was the home of King's brother, the Reverend A. D. King. Kennedy prepared to federalize the Alabama National Guard but did not follow through. Four months later, on September 15, Ku Klux Klan members bombed the Sixteenth Street Baptist Church in Birmingham, killing four young girls. Other events of the summer of 1963: On June 11, 1963, George Wallace, Governor of Alabama, tried to block the integration of the University of Alabama. President John F. Kennedy sent enough force to make Governor Wallace step aside, allowing the enrollment of two black students. That evening, JFK addressed the nation on TV and radio with a historic civil rights speech. The next day Medgar Evers was murdered in Mississippi. The next week as promised, on June 19, 1963, JFK submitted his Civil Rights bill to Congress. A. Philip Randolph had planned a march on Washington, D.C., in 1941 in support of demands for elimination of employment discrimination in defense industries; he called off the march when the Roosevelt Administration met the demand by issuing Executive Order 8802 barring racial discrimination and creating an agency to oversee compliance with the order. Randolph and Bayard Rustin were the chief planners of the second march, which they proposed in 1962. The Kennedy Administration applied great pressure on Randolph and King to call it off but without success. The march was held on August 28, 1963. Unlike the planned 1941 march, for which Randolph included only black-led organizations in the planning, the 1963 march was a collaborative effort of all of the major civil rights organizations, the more progressive wing of the labor movement, and other liberal organizations. The march had six official goals: "meaningful civil rights laws, a massive federal works program, full and fair employment, decent housing, the right to vote, and adequate integrated education." Of these, the march's real focus was on passage of the civil rights law that the Kennedy Administration had proposed after the upheavals in Birmingham. National media attention also greatly contributed to the march's national exposure and probable impact. In his section "The March on Washington and Television News," William Thomas notes: "Over five hundred cameramen, technicians, and correspondents from the major networks were set to cover the event. More cameras would be set up than had filmed the last Presidential inauguration. One camera was positioned high in the Washington Monument, to give dramatic vistas of the marchers". By carrying the organizers' speeches and offering their own commentary, television stations literally framed the way their local audiences saw and understood the event. The march was a success, although not without controversy. An estimated 200,000 to 300,000 demonstrators gathered in front of the Lincoln Memorial, where King delivered his famous "I Have a Dream" speech. While many speakers applauded the Kennedy Administration for the efforts it had made toward obtaining new, more effective civil rights legislation protecting the right to vote and outlawing segregation, John Lewis of SNCC took the Administration to task for how little it had done to protect southern blacks and civil rights workers under attack in the Deep South. After the march, King and other civil rights leaders met with President Kennedy at the White House. While the Kennedy Administration appeared to be sincerely committed to passing the bill, it was not clear that it had the votes to do it. But when President Kennedy was assassinated on November 22, 1963, the new President Lyndon Johnson decided to use his influence in Congress to bring about much of Kennedy's legislative agenda. In the summer of 1964, COFO brought nearly 1,000 activists to Mississippi — most of them white college students — to join with local black activists to register voters, teach in "Freedom Schools," and organize the Mississippi Freedom Democratic Party (MFDP). Many of Mississippi's white residents deeply resented the outsiders and attempts to change their society. State and local governments, police, the White Citizens' Council and the Ku Klux Klan used arrests, beatings, arson, murder, spying, firing, evictions, and other forms of intimidation and harassment to oppose the project and prevent blacks from registering to vote or achieving social equality. Three civil rights workers, James Chaney, a young black Mississippian and plasterer's apprentice; and two Jewish activists, Andrew Goodman, a Queens College anthropology student; and Michael Schwerner, a CORE organizer from Manhattan's Lower East Side, were murdered by members of the Klan, some of them members of the Neshoba County sheriff's department, on June 21, 1964 (see Mississippi civil rights workers murders for details). From June to August, Freedom Summer activists worked in 38 local projects scattered across the state, with the largest number concentrated in the Mississippi Delta region. At least 30 Freedom Schools with close to 3,500 students were established, and 28 community centers set up. Over the course of the Summer Project, some 17,000 Mississippi blacks attempted to become registered voters in defiance of all the forces of white supremacy arrayed against them — only 1,600 (less than 10%) succeeded. But more than 80,000 joined the MFDP. Though Freedom Summer failed to register many voters, it had a significant effect on the course of the Civil Rights Movement. It helped break down the decades of isolation and repression that were the foundation of the Jim Crow system. Before Freedom Summer, the national news media had paid little attention to the persecution of black voters in the Deep South and the dangers endured by black civil rights workers. When the lives of affluent northern white students were threatened and taken, the full attention of the media spotlight turned on the state. The apparent disparity between the value which the media placed on the lives of whites and blacks embittered many black activists. Perhaps the most significant effect of Freedom Summer was on the volunteers themselves, almost all of whom — black and white — still consider it one of the defining periods of their lives. Blacks in Mississippi had been disfranchised by statutory and constitutional changes since the late 1800s. In 1963 COFO held a Freedom Vote in Mississippi to demonstrate the desire of black Mississippians to vote. More than 80,000 people registered and voted in the mock election which pitted an integrated slate of candidates from the "Freedom Party" against the official state Democratic Party candidates. In 1964, organizers launched the Mississippi Freedom Democratic Party (MFDP) to challenge the all-white official party. When Mississippi voting registrars refused to recognize their candidates, they held their own primary. They selected Fannie Lou Hamer, Annie Devine, and Victoria Gray to run for Congress and a slate of delegates to represent Mississippi at the 1964 Democratic National Convention. The presence of the Mississippi Freedom Democratic Party in Atlantic City, New Jersey, was inconvenient, however, for the convention organizers. They had planned a triumphant celebration of the Johnson Administration’s achievements in civil rights, rather than a fight over racism within the Democratic Party. All-white delegations from other Southern states threatened to walk out if the official slate from Mississippi was not seated. Johnson was worried about the inroads that Republican Barry Goldwater’s campaign was making in what previously had been the white Democratic stronghold of the "Solid South", as well as support which George Wallace had received in the North during the Democratic primaries. Johnson could not, however, prevent the MFDP from taking its case to the Credentials Committee. There Fannie Lou Hamer testified eloquently about the beatings that she and others endured and the threats they faced for trying to register to vote. Turning to the television cameras, Hamer asked, "Is this America?" Johnson offered the MFDP a "compromise" under which it would receive two non-voting, at-large seats, while the white delegation sent by the official Democratic Party would retain its seats. The MFDP angrily rejected the "compromise." The MFDP kept up its agitation within the convention, even after it was denied official recognition. When all but three of the "regular" Mississippi delegates left because they refused to pledge allegiance to the party, the MFDP delegates borrowed passes from sympathetic delegates and took the seats vacated by the official Mississippi delegates. They were then removed by the national party. When they returned the next day to find that convention organizers had removed the empty seats that had been there the day before, they stayed to sing freedom songs. The 1964 Democratic Party convention disillusioned many within the MFDP and the Civil Rights Movement, but it did not destroy the MFDP itself. The MFDP became more radical after Atlantic City. It invited Malcolm X, of the Nation of Islam, to speak at one of its conventions and opposed the war in Vietnam. On December 10, 1964, Dr. Martin Luther King, Jr. was awarded the Nobel Peace Prize, the youngest man to receive the award; he was 35 years of age. SNCC had undertaken an ambitious voter registration program in Selma, Alabama, in 1963, but by 1965 had made little headway in the face of opposition from Selma's sheriff, Jim Clark. After local residents asked the SCLC for assistance, King came to Selma to lead several marches, at which he was arrested along with 250 other demonstrators. The marchers continued to meet violent resistance from police. Jimmie Lee Jackson, a resident of nearby Marion, was killed by police at a later march in February. On March 7,1965, Hosea Williams of the SCLC and John Lewis of SNCC led a march of 600 people to walk the 54 miles (87 km) from Selma to the state capital in Montgomery. Only six blocks into the march, however, at the Edmund Pettus Bridge, state troopers and local law enforcement, some mounted on horseback, attacked the peaceful demonstrators with billy clubs, tear gas, rubber tubes wrapped in barbed wire and bull whips. They drove the marchers back into Selma. John Lewis was knocked unconscious and dragged to safety. At least 16 other marchers were hospitalized. Among those gassed and beaten was Amelia Boynton Robinson, who was at the center of civil rights activity at the time. The national broadcast of the footage of lawmen attacking unresisting marchers seeking the right to vote provoked a national response as had scenes from Birmingham two years earlier. The marchers were able to obtain a court order permitting them to make the march without incident two weeks later. After a second march to the site of Bloody Sunday on March 9, however, local whites murdered another voting rights supporter, Rev. James Reeb. He died in a Birmingham hospital March 11. On March 25, four Klansmen shot and killed Detroit homemaker Viola Liuzzo as she drove marchers back to Selma at night after the successfully completed march to Montgomery. Eight days after the first march, Johnson delivered a televised address to support of the voting rights bill he had sent to Congress. In it he stated: But even if we pass this bill, the battle will not be over. What happened in Selma is part of a far larger movement which reaches into every section and state of America. It is the effort of American Negroes to secure for themselves the full blessings of American life. Their cause must be our cause too. Because it is not just Negroes, but really it is all of us, who must overcome the crippling legacy of bigotry and injustice. And we shall overcome. Johnson signed the Voting Rights Act of 1965 on August 6. The 1965 act suspended poll taxes, literacy tests and other subjective voter tests. It authorized Federal supervision of voter registration in states and individual voting districts where such tests were being used. African Americans who had been barred from registering to vote finally had an alternative to taking suits to local or state courts. If voting discrimination occurred, the 1965 act authorized the Attorney General of the United States to send Federal examiners to replace local registrars. Johnson reportedly told his concern to associates that signing the bill had lost the white South for the Democratic Party for the foreseeable future. The act had an immediate and positive impact for African Americans. Within months of its passage, 250,000, one quarter of a million, new black voters had been registered, one third of them by federal examiners. Within four years, voter registration in the South had more than doubled. In 1965, Mississippi had the highest black voter turnout—74%—and led the nation in the number of black public officials elected. In 1969, Tennessee had a 92.1% turnout; Arkansas, 77.9%; and Texas, 73.1%. Several whites who had opposed the Voting Rights Act paid a quick price. In 1966 Sheriff Jim Clark of Alabama, infamous for using cattle prods against civil rights marchers, was up for reelection. Although he took off the notorious "Never" pin on his uniform, he was defeated. At the election, Clark lost as Blacks voted to get him out of office. Blacks' regaining the power to vote changed the political landscape of the South. When Congress passed the Voting Rights Act, only about 100 African Americans held elective office, all in northern states of the U.S. By 1989, there were more than 7,200 African Americans in office, including more than 4,800 in the South. Nearly every Black Belt county (where populations were majority black) in Alabama had a black sheriff. Southern blacks held top positions within city, county, and state governments. Atlanta elected a black mayor, Andrew Young, as did Jackson, Mississippi—Harvey Johnson—and New Orleans, with Ernest Morial. Black politicians on the national level included Barbara Jordan, who represented Texas in Congress, and Andrew Young was appointed United States Ambassador to the United Nations during the Carter administration. Julian Bond was elected to the Georgia Legislature in 1965, although political reaction to his public opposition to U.S. involvement in Vietnam prevented him from taking his seat until 1967. John Lewis represents Georgia's 5th congressional district in the United States House of Representatives, where he has served since 1987. Rev. James Lawson invited King to Memphis, Tennessee, in March 1968 to support a strike by sanitation workers. They had launched a campaign for union representation after two workers were accidentally killed on the job. A day after delivering his famous "Mountaintop" sermon at Lawson's church, King was assassinated on April 4, 1968. Riots broke out in more than 110 cities across the United States in the days that followed, notably in Chicago, Baltimore, and in Washington, D.C. The damage done in many cities destroyed black businesses. It would take more than a generation for those areas to recover. Some still have not. Rev. Ralph Abernathy succeeded King as the head of the SCLC and attempted to carry forth King's plan for a Poor People's March. It was to unite blacks and whites to campaign for fundamental changes in American society and economic structure. The march went forward under Abernathy's plainspoken leadership but did not achieve its goals. During the years preceding his election to the presidency, John F. Kennedy's record of voting on issues of racial discrimination had been scant. Kennedy openly confessed to his closest advisors that during the first months of his presidency, his knowledge of the civil rights movement was "lacking". For the first two years of the Kennedy Administration, attitudes to both the President and Attorney-General, Robert F. Kennedy, were mixed. Many viewed the Administration with suspicion. A well of historical cynicism toward white liberal politics had left a sense of uneasy disdain by African-Americans toward any white politician who claimed to share their concerns for freedom. Still, many had a strong sense that in the Kennedys there was a new age of political dialogue beginning. The naiveté of the Kennedy brothers was demonstrated in Robert Kennedy's declaration in 1962 that, "[T]he Irish were not wanted here. Now an Irish Catholic is President of the United States. There is no question about it, in the next forty years a Negro can achieve the same position." Although observers frequently assert the phrase "The Kennedy Administration" or even, "President Kennedy" when discussing the legislative and executive support of the Civil Rights movement, between 1960 and 1963, many of the initiatives were actually the result of Robert Kennedy's passion. Through his rapid education in the realities of racism, Robert Kennedy underwent a thorough conversion of purpose as Attorney-General. Asked in an interview in May 1962, "What do you see as the big problem ahead for you, is it Crime or Internal Security?" Robert Kennedy replied, "Civil Rights. The President came to share his brother's sense of urgency on the matters to such an extent that it was at the Attorney-General's insistence that he made his famous address to the nation.. When a white mob attacked and burned the First Baptist Church in Montgomery, Alabama, where King held out with protesters, the Attorney-General telephoned King to ask him not to leave the building until the U.S. Marshals and National Guard could secure the area. King proceeded to berate Kennedy for "allowing the situation to continue". King later publicly thanked Robert Kennedy's commanding the force to break up an attack which might otherwise have ended King's life. The relationship between the two men underwent change from mutual suspicion to one of shared aspirations. For Dr King, Robert Kennedy initially represented the 'softly softly' approach that in former years had disabled the movement of blacks against oppression in the U.S. For Robert Kennedy, King initially represented what he then considered an unrealistic militancy. Some white liberals regarded the militancy itself as the cause of so little governmental progress. King regarded much of the efforts of the Kennedys as an attempt to control the movement and siphon off its energies. Yet he came to find the efforts of the brothers to be crucial. It was at Robert Kennedy's constant insistence, through conversations with King and others, that King came to recognize the fundamental nature of electoral reform and suffrage—the need for black Americans to actively engage not only protest but political dialogue at the highest levels. In time the President gained King's respect and trust, via the frank dialogue and efforts of the Attorney-General. Robert Kennedy became very much his brother's key advisor on matters of racial equality. The President regarded the issue of civil rights to be a function of the Attorney-General's office. With a very slim majority in Congress, the President's ability to press ahead with legislation relied considerably on a balancing game with the Senators and Congressmen of the South. Indeed, without the support of Vice-President Johnson, who had years of experience in Congress and longstanding relations there, many of the Attorney-General's programs would not have progressed at all. By late 1962, frustration at the slow pace of political change was balanced by the movement's strong support for legislative initiatives: housing rights, administrative representation across all US Government departments, safe conditions at the ballot box, pressure on the courts to prosecute racist criminals. King remarked by the end of the year, "This administration has reached out more creatively than its predecessors to blaze new trails [in voting rights and government appointments]. Its vigorous young men have launched imaginative and bold forays and displayed a certain élan in the attention they give to civil rights issues." From squaring off against Governor George Wallace, to "tearing into" Vice-President Johnson (for failing to desegregate areas of the administration), to threatening corrupt white Southern judges with disbarment, to desegregating interstate transport, Robert Kennedy came to be consumed by the Civil Rights movement. He carried it forward into his own bid for the presidency in 1968. On the night of Governor Wallace's capitulation, President Kennedy gave an address to the nation which marked the changing tide, an address which was to become a landmark for the change in political policy which ensued. In it President Kennedy spoke of the need to act decisively and to act now: "We preach freedom around the world, and we mean it, and we cherish our freedom here at home, but are we to say to the world, and much more importantly, to each other that this is the land of the free except for the Negroes; that we have no second-class citizens except Negroes; that we have no class or caste system, no ghettoes, no master race except with respect to Negroes? Now the time has come for this Nation to fulfill its promise. The events in Birmingham and elsewhere have so increased the cries for equality that no city or State or legislative body can prudently choose to ignore them." Assassination cut short the life and careers of both the Kennedy brothers and Dr. Martin Luther King, Jr. The essential groundwork of the Civil Rights Act 1964 had been initiated before John F. Kennedy was assassinated. The dire need for political and administrative reform had been driven home on Capitol Hill by the combined efforts of the Kennedy administration, Dr. King and other leaders, and President Lyndon Johnson. In 1966, Robert Kennedy undertook a tour of South Africa in which he championed the cause of the anti-Apartheid movement. His tour gained international praise at a time when few politicians dared to entangle themselves in the politics of South Africa. Kennedy spoke out against the oppression of the native population. He was welcomed by the black population as though a visiting head of state. In an interview with LOOK Magazine he said: "At the University of Natal in Durban, I was told the church to which most of the white population belongs teaches apartheid as a moral necessity. A questioner declared that few churches allow black Africans to pray with the white because the Bible says that is the way it should be, because God created Negroes to serve. "But suppose God is black", I replied. "What if we go to Heaven and we, all our lives, have treated the Negro as an inferior, and God is there, and we look up and He is not white? What then is our response?" There was no answer. Only silence." Many in the Jewish-American community supported the Civil Rights Movement and Jews were more actively involved in the civil rights movement than any other white group in America. Many Jewish students worked in concert with African Americans for CORE, SCLC, and SNCC as full-time organizers and summer volunteers during the Civil Rights era. Jews made up roughly half of the white northern volunteers involved in the 1964 Mississippi Freedom Summer project and approximately half of the civil rights attorneys active in the South during the 1960s. Jewish leaders were arrested with Rev. Dr. Martin Luther King, Jr. in St. Augustine, Florida, in 1964 after a challenge to racial segregation in public accommodations. Abraham Joshua Heschel, a writer, rabbi and professor of theology at the Jewish Theological Seminary of America in New York was outspoken on the subject of civil rights. He marched arm-in-arm with Dr. King in the 1965 March on Selma. Brandeis University, the only nonsectarian Jewish-sponsored college university in the world, created the Transitional Year Program (TYP)in 1968, in part response to Rev. Dr. Martin Luther King's assassination. The faculty created it to renew the University's commitment to social justice. Recognizing Brandeis as a university with a commitment to academic excellence, these faculty members created a chance to disadvantaged students to participate in an empowering educational experience. The program began by admitting 20 black males. As it developed, two groups have been given chances. The first group consists of students whose secondary schooling experiences and/or home communities may have lacked the resources to foster adequate preparation for success at elite colleges like Brandeis. For example, their high schools do not offer AP or honors courses nor high quality laboratory experiences. Students selected had to have excelled in the curricula offered by their schools. The second group of students includes those whose life circumstances have created formidable challenges that required focus, energy, and skills that otherwise would have been devoted to academic pursuits. Some have served as heads of their households, others have worked full-time while attending high school full-time, and others have shown leadership in other ways. King was becoming more estranged from the Johnson Administration. In 1965 he broke with it by calling for peace negotiations and a halt to the bombing of Vietnam. He moved further left in the following years, speaking of the need for economic justice and thoroughgoing changes in American society. He believed change was needed beyond the civil rights gained by the movement. King's attempts to broaden the scope of the Civil Rights Movement were halting and largely unsuccessful, however. King made several efforts in 1965 to take the Movement north to address issues of employment and housing discrimination. His campaign in Chicago failed, as Chicago Mayor Richard J. Daley marginalized King's campaign by promising to "study" the city's problems. In 1966, white demonstrators holding "white power" signs in notoriously racist Cicero, a suburb of Chicago, threw stones at King and other marchers demonstrating against housing segregation. King was injured in this attack. While the Ku Klux Klan was not as prevalent as it was in the South, other problems prevailed in northern cities. Urban black neighborhoods were among the poorest in most major cities. Unemployment was much higher than in white neighborhoods, and crime was frequent. African Americans rarely owned the stores or businesses where they lived and mostly worked menial or blue-collar jobs for a fraction of the pay that white co-workers received. African Americans often made only enough money to live in dilapidated tenements that were privately owned or poorly maintained public housing. They also attended schools that were often the worst academically in the city and that had very few white students. Worst of all, black neighborhoods were subject to police problems that white neighborhoods were not at all accustomed to dealing with. The police forces in America were set up with the motto "To Protect and Serve." Rarely did this occur in any black neighborhoods. Rather, many blacks felt police only existed to "Patrol and Control." The racial makeup of the police departments, usually largely white, was a large factor. In black neighborhoods such as Harlem, the ratio was only one black officer for every six white officers, and in majority black cities such as Newark, New Jersey only 145 of the 1322 police officers were black. Police forces in Northern cities were largely composed of white ethnics, mainly Irish, Italian, and Eastern European officers who would routinely harass blacks with or without provocation. One of the first major race riots took place in Harlem, New York, in the summer of 1964. A white Irish-American police officer, Thomas Gilligan, shot a 15-year-old black named James Powell for allegedly charging at him with a knife. In fact, Powell was unarmed. A group of black citizens demanded Gilligan's suspension. Hundreds of young demonstrators marched peacefully to the 67th Street police station on July 17, 1964, the day after Powell's death. Gilligan was not suspended. Although this precinct had promoted the NYPD's first black station commander, neighborhood residents were tired of the inequalities. They looted and burned anything that was not black-owned in the neighborhood. This unrest spread to Bedford-Stuyvesant, a major black neighborhood in Brooklyn. That summer, rioting also broke out in Philadelphia, for similar reasons. In the aftermath of the riots of July 1964, the federal government funded a pilot program called Project Uplift, in which thousands of young people in Harlem were given jobs during the summer of 1965. The project was inspired by a report generated by HARYOU called Youth in the Ghetto. HARYOU was given a major role in organizing the project, together with the National Urban League and nearly 100 smaller community organizations. Permanent jobs at living wages, however, were still out of reach of many young black men. In 1965, President Lyndon B. Johnson signed the Voting Rights Act, but the new law had no immediate effect on living conditions for blacks. A few days after the act became law, a riot broke out in the South Central Los Angeles neighborhood of Watts. Like Harlem, Watts was an impoverished neighborhood with very high unemployment. Its residents had to endure patrols by a largely white police department. While arresting a young man for drunk driving, police officers argued with the suspect's mother before onlookers. The conflict triggered a massive destruction of property through six days of rioting. Thirty-four people were killed and property valued at about $30 million was destroyed, making the Watts riot one of the worst in American history. With black militancy on the rise, increased acts of anger were now directed at the police. Black residents growing tired of police brutality continued to rebel. Some young people joined groups such as the Black Panthers, whose popularity was based in part on their reputation for confronting abusive police officers. Riots occurred in 1966 and 1967 in cities such as Atlanta, San Francisco, Oakland, Baltimore, Seattle, Cleveland, Cincinnati, Columbus, Newark, Chicago, New York City (specifically in Brooklyn, Harlem and the Bronx), and worst of all in Detroit. In Detroit, a comfortable black middle class had begun to develop among families of blacks who worked at well-paying jobs in the automotive industry. Blacks who had not moved upward were living in much worse conditions, subject to the same problems as blacks in Watts and Harlem. When white police officers shut down an illegal bar on a liquor raid and arrested a large group of patrons, furious residents rioted. One significant effect of the Detroit riot was the acceleration of "white flight," the trend of white residents moving from inner-city neighborhoods to predominantly white suburbs. Detroit experienced "middle class black flight" as well. Cities such as Detroit, Newark, and Baltimore now have less than 40% white population as a result of these riots and other social changes. Changes in industry caused continued job losses, depopulation of middle classes, and concentrated poverty in such cities. They contain some of the worst living conditions for blacks anywhere in America. As a result of the riots, President Johnson created the National Advisory Commission on Civil Disorders in 1967. The commission's final report called for major reforms in employment and public assistance for black communities. It warned that the United States was moving toward separate white and black societies. Fresh rioting broke out in April 1968 after the assassination of Dr. Martin Luther King, Jr. Riots erupted in many major cities at once, including Chicago, Cleveland, Baltimore, and Washington, D.C., where damage was especially severe. Affirmative Action altered the hiring process of more black police officers in every major city. Blacks make up a proportional majority of the police departments in cities such as Baltimore, Washington, New Orleans, Atlanta, Newark, and Detroit. Civil rights laws have reduced employment discrimination. The conditions that led to frequent rioting in the late 1960s have receded, but not all the problems have been solved. With industrial and economic restructuring, tens of thousands of industrial jobs disappeared since the later 1950s from the old industrial cities. Some moved South, as has much population, and others out of the US altogether. Civil unrest broke out in Miami in 1980, in Los Angeles in 1992, and in Cincinnati in 2001. At the same time King was finding himself at odds with factions of the Democratic Party, he was facing challenges from within the Civil Rights Movement to the two key tenets upon which the movement had been based: integration and non-violence. Black activists within SNCC and CORE had chafed for some time at the influence wielded by white advisors to civil rights organizations and the disproportionate attention that was given to the deaths of white civil rights workers while black workers' deaths often went virtually unnoticed. Stokely Carmichael, who became the leader of SNCC in 1966, was one of the earliest and most articulate spokespersons for what became known as the "Black Power" movement after he used that slogan, coined by activist and organizer Willie Ricks, in Greenwood, Mississippi on June 17, 1966. In 1966 SNCC leader Stokely Carmichael began urging African American communities to confront the Ku Klux Klan armed and ready for battle. He felt it was the only way to ever rid the communities of the terror caused by the Klan. Several people engaging in the Black Power movement started to gain more of a sense in black pride and identity as well. In gaining more of a sense of a cultural identity, several blacks demanded that whites no longer refer to them as "Negroes" but as "Afro-Americans." Up until the mid-1960s, blacks had dressed similarly to whites and combed their hair straight. As a part of gaining a unique identity, blacks started to wear loosely fit dashikis and had started to grow their hair out as a natural afro. The afro, sometimes nicknamed the "'fro," remained a popular black hairstyle until the late 1970s. Black Power was made most public however by the Black Panther Party which founded in Oakland, California, in 1966. This group followed ideology stated by Malcolm X and the Nation of Islam using a "by-any-means necessary" approach to stopping inequality. They sought to rid African American neighborhoods of Police Brutality and had a ten-point plan amongst other things. Their dress code consisted of leather jackets, berets, light blue shirts, and an afro hairstyle. They are best remembered for setting up free breakfast programs, referring to police officers as "pigs", displaying shotguns and a black power fist, and often using the statement of "Power to the people." Black Power was taken to another level inside of prison walls. In 1966, George Jackson formed the Black Guerilla Family in the California prison of San Quentin. The goal of this group was to overthrow the white-run government in America and the prison system in general. This group also preaches the general hatred of Whites and Jews everywhere. In 1970, this group displayed their ruthlessness after a white prison guard was found not guilty for shooting three black prisoners from the prison tower. The guard was found cut to pieces, and a message was sent throughout the whole prison of how serious the group was. Also in 1968, Tommie Smith and John Carlos, while being awarded the gold and bronze medals, respectively, at the 1968 Summer Olympics, donned human rights badges and each raised a black-gloved Black Power salute during their podium ceremony. Incidentally, it was the suggestion of white silver medalist, Peter Norman of Australia, for Smith and Carlos to each wear one black glove. Smith and Carlos were immediately ejected from the games by the USOC, and later the IOC issued a permanent lifetime ban for the two. However, the Black Power movement had been given a stage on live, international television. King was not comfortable with the "Black Power" slogan, which sounded too much like black nationalism to him. SNCC activists, in the meantime, began embracing the "right to self-defense" in response to attacks from white authorities, and booed King for continuing to advocate non-violence. When King was murdered in 1968, Stokely Carmichael stated that whites murdered the one person who would prevent rampant rioting and burning of major cities down and that blacks would burn every major city to the ground. In every major city from Boston to San Francisco, racial riots broke out in the black community following King's death and as a result, "White Flight" occurred from several cities leaving Blacks in a dilapidated and nearly unrepairable city. In 1970 Civil Rights lawyer Roy Haber began taking statements from inmates, which eventually totalled fifty pages of details of murders, rapes, beatings and other abuses suffered by the inmates from 1969 to 1971 at Mississippi State Penitentiary. In a landmark case known as Gates v. Collier (1972) four inmates represented by Haber sued the superintendent of Parchman Farm for violating their rights under the United States Constitution. Federal Judge William C. Keady found in favor of the inmates, writing that Parchman Farm violated the civil rights of the inmates by inflicting cruel and unusual punishment. He ordered an immediate end to all unconstitutional conditions and practices. Racial segregation of inmates was abolished. And the trustee system, which allow certain inmates to have power and control over others, was also abolished. The prison was renovated in 1972 after the scathing ruling by Judge Keady in which he wrote that the prison was an affront to "modern standards of decency." Among other reforms, the accommodations were made fit for human habitation and the system of "trusties" (in which lifers were armed with rifles and set to guard other inmates) was abolished. In integrated correctional facilities in northern and western states, blacks represented a disproportionate amount of the prisoners and were often treated as second class citizens at the hands of white correctional officers. Blacks also represented a disproportionate number of death row inmates. As a result, Black Power found a ready constituency inside prison walls where gangs such as the Black Guerilla Family were formed as a way to redress the disproportionalities, organizing Black inmates to take militant action. Eldridge Cleaver's book Soul on Ice was written from his experiences in the California correctional system and further fueled black militancy. National economic empowerment organizations: Local civil rights organizations:

http://www.reference.com/browse/American+Civil+Rights+Movement+(1955%E2%80%931968)

The difference between a nuclear power plant and a fossil-fuel power plant is the heat source. A fossil-fueled (coal, oil, gas) power plant uses oxygen to burn the fuel and create steam to spin the generator. This process produces carbon dioxide as a byproduct. In contrast, nuclear reactors use enriched uranium as their heat source. The uranium atoms create heat by splitting; the technical term for this process is fission. Fission requires no oxygen and produces no carbon dioxide. Uranium fuel comes to the power plant in the form of small, solid ceramic pellets. The electricity produced by one fuel pellet, roughly the size of a pencil eraser, is equal to the amount produced by 4.5 barrels of oil or one ton of coal. Inside the reactor, pellets of uranium are stacked end-to-end in 12-foot long tubes, or fuel assemblies. These fuel assemblies are precisely arranged in bundles within the reactor with spaces between the bundles for control rods. The control rods can be moved in and out of the reactor to stop and start the fission process. Our Fermi 2 plant contains 185 control rods and 764 zirconium alloy fuel assemblies. Each assembly contains approximately 13,000 uranium pellets.

http://www.dteenergy.com/nuclear/fuelAndFission.html

The labor movement in the United States grew out of the need to protect the common interest of workers. For those in the industrial sector, organized labor unions fought for better wages, reasonable hours and safer working conditions. The labor movement led efforts to stop child labor, give health benefits and provide aid to workers who were injured or retired. The origins of the labor movement lay in the formative years of the American nation, when a free wage-labor market emerged in the artisan trades late in the colonial period. The earliest recorded strike occurred in 1768 when New York journeymen tailors protested a wage reduction. The formation of the Federal Society of Journeymen Cordwainers (shoemakers) in Philadelphia in 1794 marks the beginning of sustained trade union organization among American workers. From that time on, local craft unions proliferated in the cities, publishing lists of "prices" for their work, defending their trades against diluted and cheap labor, and, increasingly, demanding a shorter workday. Thus a job-conscious orientation was quick to emerge, and in its wake there followed the key structural elements characterizing American trade unionism--first, beginning with the formation in 1827 of the Mechanics' Union of Trade Associations in Philadelphia, central labor bodies uniting craft unions within a single city, and then, with the creation of the International Typographical Union in 1852, national unions bringing together local unions of the same trade from across the United States and Canada (hence the frequent union designation "international"). Although the factory system was springing up during these years, industrial workers played little part in the early trade union development. In the nineteenth century, trade unionism was mainly a movement of skilled workers. The early labor movement was, however, inspired by more than the immediate job interest of its craft members. It harbored a conception of the just society, deriving from the Ricardian labor theory of value and from the republican ideals of the American Revolution, which fostered social equality, celebrated honest labor, and relied on an independent, virtuous citizenship. The transforming economic changes of industrial capitalism ran counter to labor's vision. The result, as early labor leaders saw it, was to raise up "two distinct classes, the rich and the poor." Beginning with the workingmen's parties of the 1830s, the advocates of equal rights mounted a series of reform efforts that spanned the nineteenth century. Most notable were the National Labor Union, launched in 1866, and the Knights of Labor, which reached its zenith in the mid-1880s. On their face, these reform movements might have seemed at odds with trade unionism, aiming as they did at the cooperative commonwealth rather than a higher wage, appealing broadly to all "producers" rather than strictly to wageworkers, and eschewing the trade union reliance on the strike and boycott. But contemporaries saw no contradiction: trade unionism tended to the workers' immediate needs, labor reform to their higher hopes. The two were held to be strands of a single movement, rooted in a common working-class constituency and to some degree sharing a common leadership. But equally important, they were strands that had to be kept operationally separate and functionally distinct. During the 1880s, that division fatally eroded. Despite its labor reform rhetoric, the Knights of Labor attracted large numbers of workers hoping to improve their immediate conditions. As the Knights carried on strikes and organized along industrial lines, the threatened national trade unions demanded that the group confine itself to its professed labor reform purposes; when it refused, they joined in December 1886 to form the American Federation of Labor (afl). The new federation marked a break with the past, for it denied to labor reform any further role in the struggles of American workers. In part, the assertion of trade union supremacy stemmed from an undeniable reality. As industrialism matured, labor reform lost its meaning--hence the confusion and ultimate failure of the Knights of Labor. Marxism taught Samuel Gompers and his fellow socialists that trade unionism was the indispensable instrument for preparing the working class for revolution. The founders of the afl translated this notion into the principle of "pure and simple" unionism: only by self-organization along occupational lines and by a concentration on job-conscious goals would the worker be "furnished with the weapons which shall secure his industrial emancipation." That class formulation necessarily defined trade unionism as the movement of the entire working class. The afl asserted as a formal policy that it represented all workers, irrespective of skill, race, religion, nationality, or gender. But the national unions that had created the afl in fact comprised only the skilled trades. Almost at once, therefore, the trade union movement encountered a dilemma: how to square ideological aspirations against contrary institutional realities? As sweeping technological change began to undermine the craft system of production, some national unions did move toward an industrial structure, most notably in coal mining and the garment trades. But most craft unions either refused or, as in iron and steel and in meat packing, failed to organize the less skilled. And since skill lines tended to conform to racial, ethnic, and gender divisions, the trade union movement took on a racist and sexist coloration as well. For a short period, the afl resisted that tendency. But in 1895, unable to launch an interracial machinists' union of its own, the Federation reversed an earlier principled decision and chartered the whites-only International Association of Machinists. Formally or informally, the color bar thereafter spread throughout the trade union movement. In 1902, blacks made up scarcely 3 percent of total membership, most of them segregated in Jim Crow locals. In the case of women and eastern European immigrants, a similar devolution occurred--welcomed as equals in theory, excluded or segregated in practice. (Only the fate of Asian workers was unproblematic; their rights had never been asserted by the afl in the first place.) Gompers justified the subordination of principle to organizational reality on the constitutional grounds of "trade autonomy," by which each national union was assured the right to regulate its own internal affairs. But the organizational dynamism of the labor movement was in fact located in the national unions. Only as they experienced inner change might the labor movement expand beyond the narrow limits--roughly 10 percent of the labor force--at which it stabilized before World War I. In the political realm, the founding doctrine of pure-and-simple unionism meant an arm's-length relationship to the state and the least possible entanglement in partisan politics. A total separation had, of course, never been seriously contemplated; some objectives, such as immigration restriction, could be achieved only through state action, and the predecessor to the afl, the Federation of Organized Trades and Labor Unions (1881), had in fact been created to serve as labor's lobbying arm in Washington. Partly because of the lure of progressive labor legislation, even more in response to increasingly damaging court attacks on the trade unions, political activity quickened after 1900. With the enunciation of Labor's Bill of Grievances (1906), the afl laid down a challenge to the major parties. Henceforth it would campaign for its friends and seek the defeat of its enemies. This nonpartisan entry into electoral politics, paradoxically, undercut the left-wing advocates of an independent working-class politics. That question had been repeatedly debated within the afl, first in 1890 over Socialist Labor party representation, then in 1893-1894 over an alliance with the Populist party, and after 1901 over affiliation with the Socialist party of America. Although Gompers prevailed each time, he never found it easy. Now, as labor's leverage with the major parties began to pay off, Gompers had an effective answer to his critics on the left: the labor movement could not afford to waste its political capital on socialist parties or independent politics. When that nonpartisan strategy failed, as it did in the reaction following World War I, an independent political strategy took hold, first through the robust campaigning of the Conference for Progressive Political Action in 1922, and in 1924 through labor's endorsement of Robert La Follette on the Progressive ticket. By then, however, the Republican administration was moderating its hard line, evident especially in Herbert Hoover's efforts to resolve the simmering crises in mining and on the railroads. In response, the trade unions abandoned the Progressive party, retreated to nonpartisanship, and, as their power waned, lapsed into inactivity. It took the Great Depression to knock the labor movement off dead center. The discontent of industrial workers, combined with New Deal collective bargaining legislation, at last brought the great mass production industries within striking distance. When the craft unions stymied the afl's organizing efforts, John L. Lewis of the United Mine Workers and his followers broke away in 1935 and formed the Committee for Industrial Organization (cio), which crucially aided the emerging unions in auto, rubber, steel, and other basic industries. In 1938 the cio was formally established as the Congress of Industrial Organizations. By the end of World War II, more than 12 million workers belonged to unions, and collective bargaining had taken hold throughout the industrial economy. In politics, its enhanced power led the union movement not to a new departure but to a variant on the policy of nonpartisanship. As far back as the Progressive Era, organized labor had been drifting toward the Democratic party, partly because of the latter's greater programmatic appeal, perhaps even more because of its ethnocultural basis of support within an increasingly "new" immigrant working class. With the coming of Roosevelt's New Deal, this incipient alliance solidified, and from 1936 onward the Democratic party could count on--and came to rely on--the campaigning resources of the labor movement. That this alliance partook of the nonpartisan logic of Gompers's authorship--too much was at stake for organized labor to waste its political capital on third parties--became clear in the unsettled period of the early cold war. Not only did the cio oppose the Progressive party of 1948, but it expelled the left-wing unions that broke ranks and supported Henry Wallace for the presidency that year. The formation of the afl--cio in 1955 visibly testified to the powerful continuities persisting through the age of industrial unionism. Above all, the central purpose remained what it had always been--to advance the economic and job interests of the union membership. Collective bargaining performed impressively after World War II, more than tripling weekly earnings in manufacturing between 1945 and 1970, gaining for union workers an unprecedented measure of security against old age, illness, and unemployment, and, through contractual protections, greatly strengthening their right to fair treatment at the workplace. But if the benefits were greater and if they went to more people, the basic job-conscious thrust remained intact. Organized labor was still a sectional movement, covering at most only a third of America's wage earners and inaccessible to those cut off in the low-wage secondary labor market. Nothing better captures the uneasy amalgam of old and new in the postwar labor movement than the treatment of minorities and women who flocked in, initially from the mass production industries, but after 1960 from the public and service sectors as well. Labor's historic commitment to racial and gender equality was thereby much strengthened, but not to the point of challenging the status quo within the labor movement itself. Thus the leadership structure remained largely closed to minorities--as did the skilled jobs that were historically the preserve of white male workers--notoriously so in the construction trades but in the industrial unions as well. Yet the afl--cio played a crucial role in the battle for civil rights legislation in 1964-1965. That this legislation might be directed against discriminatory trade union practices was anticipated (and quietly welcomed) by the more progressive labor leaders. But more significant was the meaning they found in championing this kind of reform: the chance to act on the broad ideals of the labor movement. And, so motivated, they deployed labor's power with great effect in the achievement of John F. Kennedy's and Lyndon B. Johnson's domestic programs during the 1960s. This was ultimately economic, not political power, however, and as organized labor's grip on the industrial sector began to weaken, so did its political capability. From the early 1970s onward, new competitive forces swept through the heavily unionized industries, set off by deregulation in communications and transportation, by industrial restructuring, and by an unprecedented onslaught of foreign goods. As oligopolistic and regulated market structures broke down, nonunion competition spurted, concession bargaining became widespread, and plant closings decimated union memberships. The once-celebrated National Labor Relations Act increasingly hamstrung the labor movement; an all-out reform campaign to get the law amended failed in 1978. And with the election of Ronald Reagan in 1980, there came to power an anti-union administration the likes of which had not been seen since the Harding era. Between 1975 and 1985, union membership fell by 5 million. In manufacturing, the unionized portion of the labor force dropped below 25 percent, while mining and construction, once labor's flagship industries, were decimated. Only in the public sector did the unions hold their own. By the end of the 1980s, less than 17 percent of American workers were organized, half the proportion of the early 1950s. Swift to change the labor movement has never been. But if the new high-tech and service sectors seemed beyond its reach in 1989, so did the mass production industries in 1929. And, as compared to the old afl, organized labor is today much more diverse and broadly based: 40 percent of its members are white-collar workers, 30 percent are women, and the 14.5 percent who are black signify a greater representation than in the general population and a greater rate of participation than by white workers (22.6 percent compared to 16.3 percent). In the meantime, however, the movement's impotence has been felt. "The collapse of labor's legislative power facilitated the adoption of a set of economic policies highly beneficial to the corporate sector and to the affluent," wrote analyst Thomas B. Edsall in 1984. And, with collective bargaining in retreat, declining living standards of American wage-earning families set in for the first time since the Great Depression. The union movement became in the 1980s a diminished economic and political force, and, in the Age of Reagan, this made for a less socially just nation. Foster R. Dulles and Melvyn Dubofsky, Labor in America: A History, 4th ed. (1984); Robert H. Zieger, American Workers, American Unions, 1920-1985 (1986). How to Cite this Page: Labor Movement. (2013). The History Channel website. Retrieved 5:17, May 18, 2013, from http://www.history.com/topics/labor. Labor Movement. [Internet]. 2013. The History Channel website. Available from: http://www.history.com/topics/labor [Accessed 18 May 2013]. “Labor Movement.” 2013. The History Channel website. May 18 2013, 5:17 http://www.history.com/topics/labor. “Labor Movement,” The History Channel website, 2013, http://www.history.com/topics/labor [accessed May 18, 2013]. “Labor Movement,” The History Channel website, http://www.history.com/topics/labor (accessed May 18, 2013). Labor Movement [Internet]. The History Channel website; 2013 [cited 2013 May 18] Available from: http://www.history.com/topics/labor. Labor Movement, http://www.history.com/topics/labor (last visited May 18, 2013). Labor Movement. The History Channel website. 2013. Available at: http://www.history.com/topics/labor. Accessed May 18, 2013.

http://www.history.com/topics/print/labor

Educating Students on the Autism Spectrum: Individuals With Disabilities Act The Individuals with Disabilities Education Act (IDEA) ensures that all children with disabilities receive a free, appropriate public education in the least restrictive environment, tailored to each child’s individual needs. This law guarantees all children, regardless of their abilities, the right to obtain educational benefits from their educational setting. As autism affects approximately 1,500,000 individuals in the U.S., and proper implementation of this law is of utmost importance to many families and to the education community at large. For children with autism, it is particularly important to provide opportunities to learn through a variety of educational options - from typical school settings to more specialized settings. The Individualized Education Program No matter the level of disability, the educational program for an individual with autism must be based on the unique needs of that person. To help determine what sort of learning environment would be best for a person with autism, an Individualized Education Program (IEP) should be developed. In the IEP, a collaborative team that includes the classroom teacher, other professionals who work with the child, administrators and the child’s parents or guardians set forth the educational goals, objectives, and evaluation standards for the child. Clearly stated, measurable goals to chart the child’s progress are a vital component of the IEP, which is reviewed annually or more frequently, if necessary. All areas of the student’s development should be addressed specifically in the IEP, including academic achievement, social and adaptive behavioral goals, and development of fine and gross motor skills. The development of communication skills (critical for students with autism) should be a vital component of the IEP. It is important for the IEP to not only address areas of need, but also to outline ways to build upon a child’s strengths in specific subjects or skills. Support services, such as occupational therapy to address the sensory needs of students with autism and speech therapy to advance the student’s ability to understand and use language, must be included in a child’s IEP when appropriate. The IEP should also delineate any necessary adaptations to the learning environment or to school programming. Examples of adaptations to the learning environment include the physical placement of the student in the classroom, using visuals to enhance communication, or other modifications to the classroom. Examples of adaptations to the school programming include extending school days, lengthening the school year to include summer months, and/or extending education programs into the home environment. Reprinted with the permission of the Autism Society. Add your own comment Today on Education.com - Kindergarten Sight Words List - The Five Warning Signs of Asperger's Syndrome - What Makes a School Effective? - Child Development Theories - Why is Play Important? Social and Emotional Development, Physical Development, Creative Development - 10 Fun Activities for Children with Autism - Test Problems: Seven Reasons Why Standardized Tests Are Not Working - Bullying in Schools - A Teacher's Guide to Differentiating Instruction - Should Your Child Be Held Back a Grade? Know Your Rights

http://www.education.com/reference/article/Ref_Individ_Act/

THE risk to spacecraft from a collision with space debris could be reduced by equipping launchers with a gossamer-thin "sail". The idea is to deploy the sail after the rocket has released its payload to amplify the drag of the last vestiges of the atmosphere, and so force the rocket out of orbit. Rocket stages are a particular risk to spacecraft because they often contain large amounts of unused fuel, which can explode when sunlight heats the tank. Leaking fuel can also act like a mini-thruster, pushing the rocket into an orbit where it may cause a collision. One way to tackle the problem is to vent unused fuel in a controlled way, and drain power from the battery, but this is unlikely to eliminate all collisions. Now space-flight engineers Max Cerf and Brice Santerre at the European aerospace firm EADS Astrium are devising ways to build a sail that ... To continue reading this article, subscribe to receive access to all of newscientist.com, including 20 years of archive content.

http://www.newscientist.com/article/mg20227045.900-space-sail-could-bring-used-rockets-back-to-earth.html

Copyright © Peter Wakefield Sault 2003-2005 All rights reserved worldwide The shape of the Earth is an oblate spheroid, which for most practical purposes can be approximated as an ellipsoid. Due to the Earth's spin it is wider across the Equator than across the Poles, the difference in diameters amounting to some 27 miles. The first step in approximating a great circle circumference is to ascertain the minor radius, R. The major radius (a) is always the equatorial radius of the Earth. That great circle tilted 0° is the Equator itself (EW, coloured red in Figure D-1) and is here treated as though it were a true circle. As the angle of tilt increases, the minor radius - which is that from the centre of the Earth to the vertex of the great circle - decreases. The length of the radius is calculated by taking it as an intermediate radius of a meridian (EVN, coloured green in Figure D-1), an ellipse which passes through the North and South Poles and whose major and minor radii are known, being the equatorial (a) and polar (b) radii respectively, using the following formula, where q is the angle of tilt to the Equator (i.e. the dihedral angle between the plane of the equator and that of the tilted great circle):- The circumference P of the tilted great circle (VW, coloured blue in Figure D-1) is then calculated by substituting R into Ramanujan's second approximation (which, for ellipses comparable in size and eccentricity to great circles of the earth, is accurate to within a Bohr radius):- Ignoring topographical features, the Moon is an almost perfect sphere. It has a very slight bulge, amounting to no more than a few metres, in the side which faces the Earth. This bulge, which dates from the solidification of the Moon before the features which we see resulting from meteoric bombardment appeared, is sufficient to keep the same side facing towards the Earth at all times. It is a curious accident that the apparent angular diameter of the Moon as viewed from the Earth, about ½°, is almost identical to that of the Sun, allowing the Solar Corona to be viewed at the periphery of the Lunar disk during total eclipses of the Sun. The Moon's mean radius, k, is expressed in units of Earth's equatorial radius. The Moon's orbit about the Earth is an ellipse of eccentricity 0.0549 inclined at 5°8' to the Ecliptic, the plane of the Earth's orbit. The points where the Moon's orbit crosses the Ecliptic are the nodes, which move westward, taking 18.6 years to go all the way round the Earth. The point where the Moon is nearest the Earth, the perigee, moves eastward, taking 8.8 years for a complete circuit. The movement of the Moon against the stars is, therefore, quite complicated and variable. Nevertheless, the Moon remains within the zodiacal band along the Ecliptic. The highest latitude where the Moon ever passes directly overhead is 28°35', comprising the sum of the inclinations of the terrestrial Equator and the orbit of the Moon, 23°27' and 5°8' respectively, to the Ecliptic. Copyright © Peter Wakefield Sault 2003-2005All rights reserved worldwide Music: Nikolai RIMSKY-KORSAKOV (1844-1908), Scheherezade, Op.35 (symphonic suite), The Sea and Sinbad's Ship. MIDI realization J.Nishio THE CLASSICAL ARCHIVES

http://www.odeion.org/atlantis/appendix-d.html

All vertebrates have a middle ear and inner ear systems in an auditory bulla or otic capsule that is variously fused, embedded, or attached to their skulls. The morphology, or variations in how these attachments evolved tells us much about the particular animal’s adaptations to their environment. While we are still learning about how aquatic animals hear, we know that animals that hear airborne sound rely on pressure-sensing diaphragms (ear drums) to convert pressure-gradient acoustical energy into physical motion that then mechanically stimulates nerves exposed to the physical motion. Underwater hearing is complicated by the fact that extreme pressure variations due to water depth can greatly overpower the sensitive pressure sensing excursions of eardrums. As a consequence marine vertebrates have adapted other ways of converting acoustic-mechanical energy through tissues, cilia (nerve fibers), vibrissae (whiskers), and other mechanosensors that are more suitable for an aqueous environment. Adapted for habitat Terrestrial mammals sense sound through pressure sensing diaphragms Aquatic mammals conduct sound through fatty tissues (lipids) Amphibious animals can have either or both types of sound conduction systems Terrestrial mammals have fused bulla or enclosed oitc capsules Aquatic mammals can have fused, partially fused, or unattached bulla Inner ear bones (ossicles): Stapes, Incus, Malleus Bulla (contains inner ear hearing systems of mammals. Size is correlated to the hearing capabilities) Petrous Pyramid found in humans (very dense for precision; as dense as human teeth) Hollow Jaw (outer “pan” conducts sound from surroundings into the acoustical lipids) Acoustical Lipid (conducts sound into the hearing systems) - Internal otic capsule - External bulla - Fused to the skull - Partially fused - Not Fused - Phocidae (earless seals or true seals) - Otaridae (eared or fur seals and sea lions) - Odobenidae (walrus) Cetaceans – order of marine mammals that include: - Odontocetes (toothed whales: dolphins, porpoises, sperm, beaked, and other whales with ivory teeth. - Mysticetes (“mustache” or baleen whales) Diaphragm – a thin tissue tensioned like a drum head.

http://ocr.org/portfolio/skull-morphology/

If one says “American Revolution” in the United States today, it is assumed that what is being referred to is the North American liberation struggles against the British Empire in the late eighteenth century. But the British North Americans were not the only group of European colonists in the Americas to rebel against their distant rulers in this era. Beginning in 1808, those in Spain’s vast American empire—spanning from Mexico in the north to Buenos Aires in the south; Peru in the west to the present-day coast of Venezuela in the east—rose up against Spanish rule. As in North America, a combination of ideology, geopolitics, and material interests motivated the revolutionaries. The Spanish American revolutions were protracted and complex. They are better thought of in the plural than the singular given their chronological progression and disparate geographical centers of action. Of all the revolutions in modern history, those in Spanish America in the early nineteenth century might be most closely related to eighteenth-century revolution that created the United States. In both cases, centuries-old transatlantic colonial ties were severed in wars of independence. Both revolutionary movements were also civil wars of sorts, pitting pro-independence factions against those who fought for the continuation of the colonial connection. Historical actors in the United States and in Spanish America were alive to witness the revolutions in both regions. Consider Thomas Jefferson, who authored the US Declaration of Independence in 1776 and lived until 1826, the year most historians cite as the end of the Spanish American revolutions; or José de San Martín, the Argentine revolutionary leader, who was born in 1778 during the American Revolution. Finally, both independence movements began a protracted and contentious process of postcolonial nation-building. In time, a single United States emerged from the ashes of British colonialism. In Spanish America, several new states came into being, led by Mexico, Gran Colombia (whose territory included present-day Colombia, Panama, Venezuela, and Ecuador), Peru, Buenos Aires (present-day Argentina), and Chile. Contemporaries often commented upon these affinities. Revolutionaries in Spanish America pointed to the United States as an example of a successful rebellion against Old World colonial rule. In the United States, observers viewed the revolts in Spanish America as validation of their own revolution. “Our example has animated the South-American provinces to declare themselves independent!” exclaimed the North American Review reporting on the conflict in Pernambuco in 1817. There is no question that the inhabitants of North and Spanish America were deeply aware of the similarities of their revolutions. But can the US Revolution be said to have influenced those in Spanish America several decades later, as the North American Review contended?Show Full EssayHide Full Essay The answer to this question hinges upon historical method. Assessing influence is a notoriously tricky business. One way forward is to explore the circulation of revolutionary ideas from North to Spanish America. The work of historian Peggy K. Liss provides a model study. Liss found that Thomas Paine’s Common Sense—a publication crucial to promoting the revolutionary cause in North America in the 1770s—was circulated widely in Spanish America. Translated into Spanish by Venezuelan Manuel Garcia de Sena in 1811 and published in a volume that included translations of the founding national documents of the United States, this text was popular in Spanish America during the revolutionary struggles of the 1810s. The influence of the US revolution in Spanish America can be traced in other ways. The political ideas and practices of the new US republic, as well as the constitutions of the individual states in the Union, can be found in the political documents and institutions of the new Spanish American republics. Venezuela’s assertion of independence in 1811 so closely resembled that of 1776 that a Spanish official believed its author was none other than Thomas Jefferson. George Washington posthumously became a celebrity figure in Spanish America, often serving as the archetype of a successful revolutionary. Other connections can be found within the United States. Spanish American diplomats and envoys, for example, traveled to the United States to lobby for support. Philadelphia, where US independence was declared, became an important center of activity for Spanish American revolutionaries and their North American sympathizers. These networks and texts provide empirical evidence that links the North American 1776 to the subsequent revolutions in Spanish America. The North American example undoubtedly inspired and influenced the independence movements in Spanish America. Yet influence should not be confused with causation. The international event that most directly triggered the revolts in Spanish America was the French invasion of Spain in 1808, not the US Declaration of Independence. In stark contrast to North America in the 1770s, it was the crumbling of central imperial power in Spain, not the exercise of it, that precipitated revolution. Furthermore, Spanish American invocations of the North American revolutionary model should not be seen as straightforward attempts at mimicry. Rather, when Spanish Americans invoked 1776 or the writings of Thomas Paine, they sought not only to learn from the US example, but also to validate their own actions, to appeal to wavering allies, or to communicate their determination to achieve independence to foreign audiences—not least the United States, which did not recognize Spanish American independence until 1822. Political utility, as well as ideological inspiration, accounts for the prominence of references to the United States during the Spanish American revolutions. When assessing external influences in the Spanish American revolutions, it is also important to place the role of the United States in a broader, international context. If it is true that this era witnessed the forging of new links between the inhabitants of the Americas, these were not the only international connections of significance. Many—indeed, most—Spanish Americans continued to look primarily across the Atlantic for external reference points. Tracts from the French Revolution also were translated into Spanish and widely circulated. That the violence and bloodshed in France in the 1790s often led Spanish American elites to present it as a negative model does not diminish its importance as an external influence. The most important foreign reference point was Britain. It should come as no surprise that Spanish American revolutionaries looked to Britain for support. Boasting the world’s greatest navy and serving as the Atlantic economy’s financial center, Britain had more to offer the cash-strapped Spanish American rebels than did any other foreign power. But Spanish American elites also looked to Britain for political inspiration. Suspicious of fundamental social change and wary of US-style democracy, elite revolutionaries like Simón Bolívar found in Britain a model polity that balanced conservative institutions, such as monarchy, with the rule of law and a tradition of gradual reform. Though he greatly admired the United States—declaring after his visit there in 1806 that “for the first time in my life I saw national liberty”—Bolívar doubted that its political system would flourish in Spanish America. “I think it would be better for [Spanish] America to adopt the Koran than the government of the United States, although it is the best in the world,” Bolívar asserted. Britain’s constitutional monarchy, in contrast, held greater appeal: “England is the envy of all Countries in the world, and the pattern all would wish to follow in forming a Constitution and Government.” The potential that the new republics in Spanish America might gravitate toward the British caused much concern in the United States. The revolutions that had been seen as validation of its own independence movement threatened to play into the hands of the United States’ former colonial master. No US politician trumpeted the Spanish American cause more than did Henry Clay. But for as much as Clay presented the revolutions as a triumph of the anti-imperialism of 1776, he also viewed them through the hard-headed lens of US national interest. Clay argued that an independent Spanish America would become an important US export market, as well as enhance US security by pushing European powers out of the western hemisphere. Like many of his compatriots, Clay viewed the revolutions in Spanish America as an opportunity for the United States to enhance its geopolitical position by countering the designs of the British. The famous Monroe Doctrine of 1823, which was largely the work of Secretary of State John Quincy Adams, struck a similar note. The document expressed solidarity with Spanish Americans, but did not extend concrete support to them at a moment in which it was feared that reactionary European powers might intervene to re-establish colonial authority. Instead, it was crafted to advance the unity of the United States, as well as to counter British advances in Spanish America. In time, the Monroe Doctrine became less a symbol of a shared, pan-American anti-imperial ideology than a nationalist justification for US territorial expansion across North America and imperialist intervention in the Caribbean. Developments such as the evolution of the Monroe Doctrine from anti-imperial symbol to imperialist instrument changed the way in which Spanish Americans viewed the American Revolution. By the late nineteenth century, memories of 1776 were less a model for Spanish Americans to follow than they were a mirror to hold up to the increasingly powerful United States. Anticolonial nationalists such as José Martí, who was a leader in Cuba’s struggle against Spain in the late nineteenth century, romantically looked back at US history. But Martí’s purpose was less to use 1776 as a model for Cuban independence than it was to remind US statesmen to live up to their nation’s anti-imperial founding. Lester Langley, The Americas in the Age of the Revolution, 1750–1850 (New Haven: Yale University Press, 1996); Wim Klooster, Revolutions in the Atlantic World: A Comparative History (New York: New York University Press, 2009). “Revolution in Pernambuco,” North American Review and Miscellaneous Journal, July 1817, 226. Peggy K. Liss, Atlantic Empires: The Network of Trade and Revolution, 1713–1826 (Baltimore: The Johns Hopkins University Press, 1983), 210. J. H. Elliot, Empires of the Atlantic World: Britain and Spain in America, 1492–1830 (New Haven: Yale University Press, 2006). John Lynch, Simon Bolívar: A Life (New Haven: Yale University Press, 2006), 216–217; Liss, Atlantic Empires, 203, 219. Jay Sexton is University Lecturer in American History at Corpus Christi College, Oxford. He is the author of The Monroe Doctrine: Empire and Nation in Nineteenth-Century America (2011) and Debtor Diplomacy: Finance and American Foreign Relations in the Civil War Era, 1837–1873 (2005) and co-editor, with Richard Carwardine, of The Global Lincoln (2011). Make Gilder Lehrman your Home for History Already have an account? Please click here to login and access this page. How to subscribe Click here to get a free subscription if you are a K-12 educator or student, and here for more information on the Affiliate School Program, which provides even more benefits. Otherwise, click here for information on a paid subscription for those who are not K-12 educators or students. Make Gilder Lehrman your Home for History Become an Affiliate School to have free access to the Gilder Lehrman site and all its features. Click here to start your Affiliate School application today! You will have free access while your application is being processed. Individual K-12 educators and students can also get a free subscription to the site by making a site account with a school-affiliated email address. Click here to do so now! Make Gilder Lehrman your Home for History Why Gilder Lehrman? Your subscription grants you access to archives of rare historical documents, lectures by top historians, and a wealth of original historical material, while also helping to support history education in schools nationwide. Click here to see the kinds of historical resources to which you'll have access and here to read more about the Institute's educational programs. Individual subscription: $25 Click here to sign up for an individual subscription to the Gilder Lehrman site. K-12 School subscription: $195 Click here to sign up for an institutional subscription, which allows site access to all faculty and students in a single school, or all visitors to a library branch. Make Gilder Lehrman your Home for History Upgrade your Account We're sorry, but it looks as though you do not have access to the full Gilder Lehrman site. All K-12 educators receive free subscriptions to the Gilder Lehrman site, and our Affiliate School members gain even more benefits! How to Subscribe K-12 educator or student? Click here to edit your profile and indicate this, giving you free access, and here for more information on the Affiliate School Program. Not a educator or student? Click here for more information on purchasing a subscription to the Gilder Lehrman site. Related Site Content - EssayThe Declaration of Independence in Global Perspective - Primary SourceThe Monroe Doctrine, 1823 - EssayTwo Revolutions in the Atlantic World: Connections between the American Revolution and the Haitian Revolution - Teaching ResourceEssential Questions in Teaching American History - EssayAdvice (Not Taken) for the French Revolution from America - MultimediaAlexander Hamilton, American - EssayEmpire Building - Teaching ResourceRevolutionary in America - EssayThe Invention of the Fourth of July - MultimediaWashington as Symbol of the Founding Era

http://gilderlehrman.org/history-by-era/age-jefferson-and-madison/essays/us-and-spanish-american-revolutions

In geometry, a surface S is ruled (also called a scroll) if through every point of S there is a straight line that lies on S. The most familiar examples are the plane and the curved surface of a cylinder or cone. Other examples are a conical surface with elliptical directrix, the right conoid, the helicoid, and the tangent developable of a smooth curve in space. A ruled surface can always be described (at least locally) as the set of points swept by a moving straight line. For example, a cone is formed by keeping one point of a line fixed whilst moving another point along a circle. A surface is doubly ruled if through every one of its points there are two distinct lines that lie on the surface. The hyperbolic paraboloid and the hyperboloid of one sheet are doubly ruled surfaces. The plane is the only surface which contains three distinct lines through each of its points. The properties of being ruled or doubly ruled are preserved by projective maps, and therefore are concepts of projective geometry. In algebraic geometry ruled surfaces are sometimes considered to be surfaces in affine or projective space over a field, but they are also sometimes considered as abstract algebraic surfaces without an embedding into affine or projective space, in which case "straight line" is understood to mean an affine or projective line. Ruled surfaces in differential geometry Parametric representation The "moving line" view means that a ruled surface has a parametric representation of the form one obtains a ruled surface that contains the Möbius strip. Alternatively, a ruled surface can be parametrized as , where and are two non-intersecting curves lying on the surface. In particular, when and move with constant speed along two skew lines, the surface is a hyperbolic paraboloid, or a piece of an hyperboloid of one sheet. Developable surface A developable surface is a surface that can be (locally) unrolled onto a flat plane without tearing or stretching it. If a developable surface lies in three-dimensional Euclidean space, and is complete, then it is necessarily ruled, but the converse is not always true. For instance, the cylinder and cone are developable, but the general hyperboloid of one sheet is not. More generally, any developable surface in three dimensions is part of a complete ruled surface, and so itself must be locally ruled. There are developable surfaces embedded in four dimensions which are however not ruled. (Hilbert & Cohn-Vossen 1952, pp. 341–342) Ruled surfaces in algebraic geometry In algebraic geometry, ruled surfaces were originally defined as projective surfaces in projective space containing a straight line through any given point. This immediately implies that there is a projective line on the surface through any given point, and this condition is now often used as the definition of a ruled surface: ruled surfaces are defined to be abstract projective surfaces satisfying this condition that there is a projective line though any point. This is equivalent to saying that they are birational to the product of a curve and a projective line. Sometimes a ruled surface is defined to be one satisfying the stronger condition that it has a fibration over a curve with fibers that are projective lines. This excludes the projective plane, which has a projective line though every point but cannot be written as such a fibration. Ruled surfaces appear in the Enriques classification of projective complex surfaces, because every algebraic surface of Kodaira dimension −∞ is a ruled surface (or a projective plane, if one uses the restrictive definition of ruled surface). Every minimal projective ruled surface other than the projective plane is the projective bundle of a 2-dimensional vector bundle over some curve. The ruled surfaces with base curve of genus 0 are the Hirzebruch surfaces. Ruled surfaces in architecture - Hyperbolic paraboloids, such as saddle roofs. - Hyperboloids of one sheet, such as cooling towers and some trash bins. See also - Differential geometry of ruled surfaces - Rational normal scroll, ruled surface built from two rational normal curves - Barth, Wolf P.; Hulek, Klaus; Peters, Chris A.M.; Van de Ven, Antonius (2004), Compact Complex Surfaces, Ergebnisse der Mathematik und ihrer Grenzgebiete. 3. Folge. 4, Springer-Verlag, Berlin, ISBN 978-3-540-00832-3, MR2030225 - Beauville, Arnaud (1996), Complex algebraic surfaces, London Mathematical Society Student Texts 34 (2nd ed.), Cambridge University Press, ISBN 978-0-521-49510-3; 978-0-521-49842-5 Check |isbn=value (help), MR1406314 - Sharp, John (2008), D-Forms, Tarquin. Models exploring rules surfaces Review: Jrnl of Mathematics and the Arts 3 (2009), 229-230 ISBN 978-1-899618-87-3 - Edge, W. L. (1931), The Theory of Ruled Surfaces, Cambridge, University Press. Review: Bull. Amer. Math. Soc. 37 (1931), 791-793, doi:10.1090/S0002-9904-1931-05248-4 - Hilbert, David; Cohn-Vossen, Stephan (1952), Geometry and the Imagination (2nd ed.), New York: Chelsea, ISBN 978-0-8284-1087-8. - Iskovskikh, V.A. (2001), "Ruled surface", in Hazewinkel, Michiel, Encyclopedia of Mathematics, Springer, ISBN 978-1-55608-010-4

http://en.wikipedia.org/wiki/Ruled_surface

Civil Rights Movement Following the landmark Supreme Court decision in 1954, the civil rights movement pushed forward through a decade of important gains and accomplishments toward the goal of desegregation not only in education but in many areas of public life. Learn more about the historic places of the Civil Rights movement at a Web site produced by the U.S. Department of Interior, National Park Service, U.S. Department of Transportation, The Federal Highway Administration, and the National Conference of State Historic Preservation Officers: http://www.nps.gov/history/nr/travel/civilrights/ One cannot think of this tumultuous time without the name of the Rev. Martin Luther King Jr. coming to mind. King came from a long line of Baptist pastors. He studied theology extensively, as well as nonviolent activism to promote social change as exemplified through the teachings of Mahatma Gandhi. King was president of the Montgomery (Ala.) Improvement Association, which coordinated the Montgomery Bus Boycott that helped end segregation on public buses. He also helped form the Southern Christian Leadership Conference (SCLC) whose main goal was to coordinate nonviolent protests in the South. Throughout his life, King helped motivate hundreds of thousands of activists—both black and white—through his speeches and the example he set. Assassinated in 1968, Martin Luther King Jr. remains today one of the most influential figures of the civil rights movement, and his words continue to inspire generations of peaceful protesters and nonviolent activists. A Certain Type of Fire This lesson plan covers the civil rights movement during the 1950s and 1960s. It is targeted to 11th-graders and includes objectives, assessment options, scoring guide, and many resources (worksheets and PowerPoint presentations) available online. Eyes on the Prize This 1989 PBS documentary focuses on the civil rights movement, key players, and important gains made. The site contains lesson plans based on the documentary, as well as thematic lesson plans, primary source documents, and profiles of key figures and organizations. The Martin Luther King, Jr. Papers Project Housed at Stanford University, this site includes speeches, audio clips, and timelines of King's life and efforts to bring civil rights to African-Americans. The Montgomery Bus Boycott led to the U.S. Supreme Court 1956 declaration that segregation on public buses was unconstitutional. Lesson 1: Riding the Bus—Taking a Stand Developed by the Alabama Department of Archives and History, this lesson plan for middle to high school students, uses historical documents that can be downloaded and used to teach about Rosa Parks and her role in the Montgomery Bus boycott. The Civil Rights Act of 1957 prevented voting interference based on race, and created a Civil Rights Commission and a Civil Rights Division in the Department of Justice. The Civil Rights Act of 1960 expounded on the 1957 act by including more details on voting rights, as well as renewing the Civil Rights Commission. Although these two acts did little to change the situation of blacks in America, they proved to be important groundwork for later legislation. In 1957, Arkansas Gov. Orville Faubus ordered the Arkansas National Guard to prevent black students from entering a Little Rock High School.The controversy attracted national media coverage, which in turn sparked a national controversy as Americans everywhere witnessed brutal racism night after night on the televised news. President Eisenhower demanded that the black students be allowed access to the white high school. When Gov. Faubus refused, the president federalized the 10,000-man strong Arkansas National Guard and sent in a thousand paratroopers to protect nine black students who were seeking to attend the school. Although it would prove a difficult year for these students, the controversy in Little Rock paved the way for future gains in the civil rights movement and the long struggle to desegregate public education. Conflict at Little Rock This middle school lesson plan developed by the Center for Technology and Teacher Education at the University of Virginia focuses on the conflict at Little Rock. It includes most materials needed for the lesson plan, assessment methods, objectives, and links to related sites. Started by students, the sit-ins of the early 1960s were peaceful protests that originated in the South and led to a nationwide demand for integration. Two weeks after the first sit-in, students in 11 cities sat patiently at stores and lunch counters, primarily at Woolworth's and S.H. Kress. By August 1961, more than 70,000 people had participated in sit-ins, which generated over 3,000 arrests. Students formed the Student Nonviolent Coordinating Committee (SNCC) to lead the effort, which would continue even after the Civil Rights Act of 1964 declared segregation at lunch counters illegal. The technique was used to protest segregation at many public places, including movie theaters, and showed that nonviolent protest and the power in numbers of young people could help end segregation. Freedom Rides began in 1961 in an effort to desegregate interstate buses. Freedom Rides consisted of buses of interracial activists headed south. The Montgomery bus boycott had put an end to segregation on intercity buses but there were no specific rulings about buses, traveling through more than one state. The Freedom Ride left Washington, D.C., on May 4, 1961, and was scheduled to arrive in New Orleans on May 17, the seventh anniversary of the Brown decision. The group met strong resistance in Alabama where the bus was firebombed and the riders badly beaten by an angry white mob. The Freedom Rides led the Interstate Commerce Commission to outlaw segregation in interstate bus travel, a ruling that took effect in September, 1961. Early in May 1963, hundreds of children, ages 6 to 18, marched on downtown Birmingham, Ala., singing, "We Shall Overcome." Water hoses and police dogs were set loose on the marchers. Once again, the media brought the violence on children to the nation's attention. The Birmingham business community ultimately relented and—fearing the loss of business and damage to their stores--agreed to integrate lunch counters and provide more employment opportunities for blacks. A. Philip Randolph, a prominent black leader, fought for labor rights and was a leading civil rights activist. In 1941 he met with first lady Eleanor Roosevelt, along with several other black leaders, to present a list of grievances regarding the civil rights of blacks and demanded an executive order to stop job discrimination. At the time, Randolph threatened to bring thousands of blacks to the White House lawn if their demands were not met. More than 20 years later, on Aug. 28, 1963, Randolph's dream was realized when the March on Washington for Jobs and Freedom brought 250,000 men, women, and children together on the grounds of the Lincoln Memorial to show their support for the civil rights movement. Their goal: to raise national awareness of the plight of African-Americans. In addition to supporting civil rights, the leaders and planners of the march stressed economic inequities and called for passage of a new federal jobs program and a higher minimum wage. The March on Washington and Its Impact Produced by "Newshour with Jim Lehrer," in conjunction with PBS, this informative lesson plan focuses on the march and its effects. An audio clip and text of Martin Luther King Jr.'s, speech is also available. The Civil Rights Act of 1964 outlawed discrimination in voter registration, voting rights, and in public accommodations and/or businesses; gave the federal government jurisdiction over cases to enforce desegregation; and prohibited businesses with 25 or more employees from basing hiring decisions on race. Major Features of the Civil Rights Act of 1964 This site provides an overview of each title of the 1964 Civil Rights Act along with a comprehensive case history of the act. Teaching with Documents Lesson Plan: The Civil Rights Act of 1964 and the Equal Employment Opportunity Commission Developed by the National Archives and Records Administration, this lesson plan centers around a facsimile of the 1964 Act, and includes detailed explanations of its meaning and significance, teaching activities, and standards correlations.

http://www.aft.org/yourwork/tools4teachers/bhm/civilrights.cfm

Epidemics are the result of any disease spreading through a population, they occur every year all around the world. Epidemics vary in severity according to how the disease spreads, and how severe the actual disease is. Preparing for an Epidemic Epidemics, like all disasters, require you to store food and water. Unlike other natural disasters they require you to make special considerations for medication, air filtering, isolation, and special suits. Food should always be a part of disaster preparation, having sealed food set aside that you know is not contaminated could make all the difference if a severe epidemic hits. Having food also allows you to avoid visiting stores and risking exposure. Water should always be on hand. During an epidemic tap water could be contaminated, or the supply could be interrupted entirely. Ideally you should have both storage and an alternative source such as a well or rain collection system. Whenever possible you should acquire medication to have on hand, especially broad-spectrum antibiotics. If the epidemic is bacterial having antibiotics might be effective, however, antibiotics should only be used if you understand what you are doing. Vaccinations are also important, you should get every vaccination you possibly can. A virus cannot be medicated after you are infected, but if you have been vaccinated you are far less likely to contract the disease. Positive Pressure Home Air Filtering Being outside of a heavily populated area, while not always an option, will protect you from most disease. Epidemics spreads through various means, airborne, blood borne, direct contact, etc... Being outside of dense population will help protect you from all of these means of exposure.

http://www.zombiehunters.org/wiki/index.php/Epidemics

Infectious Disease Epidemiology Program Vaccine-preventable Diseases - Measles Measles is a respiratory disease caused by a virus that can be spread through the air by breathing, coughing, or sneezing. The disease is also called rubeola and is easily spread from person to person. Measles causes fever, runny nose, cough and rash all over the body. The rash usually begins on a person's face and spreads down to the neck, trunk, arms, legs and feet. When the rash appears, a person's fever may rise to more than 104 degrees Fahrenheit. Children can be vaccinated for measles with the Measles, Mumps and Rubella (MMR) vaccine or with Measles, Mumps, Rubella and Varicella (MMRV) vaccine. Please see the vaccine information statement (VIS) below. Resources for Maine Residents: - Measles Fact Sheet (Word*) - Measles Vaccine Information Statement (VIS) (pdf*) - Maine Immunization Program - For questions or to report a disease call 1-800-821-5821 (24/7)

http://www.state.me.us/dhhs/mecdc/infectious-disease/epi/vaccine/measles.shtml

1. Students will be able to identify five works of American Author Washington Irving. 2. Students will be able to summarize the basic plots of Washington Irving’s best-known works, The Legend of Sleepy Hollow, and Rip Van Winkle. 3. Students will be able to explain why Washington Irving is such an important figure in the history of American Literature. 1. The idea of this lesson is for the students to become aware of the works of American author Washington Irving. The teacher will begin the lesson by mentioning the best-known works of Washington Irving, The Legend of Sleepy Hollow and Rip Van Winkle. The class will discuss what is known about these two works. Another possible introduction to this lesson would be to show clips from the Disney version of The Legend of Sleepy Hollow, which is available in four segments on You Tube. 2. The teacher will inform the students that they will be responsible for finding information on the works of Washington Irving as well as some information on the author himself. Computers may be used to complete this activity or the information could be printed from the websites if Internet access is not available. 3. The students will use the two biographies of Washington Irving listed below to complete the Works of Washington Irving worksheet provided with this lesson. 4. There are two other resources included with this lesson. They are summary sheets for the most prominent works of Washington Irving, Conducting further study of the specific works of Washington Irving could extend this lesson. Below in the Sources and resources section of this lesson plan are links to complete online copies of these works as well as summaries and study guides. Irving, Washington. The Legend of Sleepy Hollow. Tribecca Books, 2011. Irving, Washington and Moses, Will. Rip Van Winkle. Philomel Books, 1999. The Legend of Sleepy Hollow (1) The Legend of Sleepy Hollow (2) The Legend of Sleepy Hollow Summary The Legend of Sleepy Hollow Study Guide Rip Van Winkle Rip Van Winkle Study Guide Washington Irving Biography Irving Biography 2 Irving Biography 3 Irving Biography 4 This lesson was developed by Robert McClelland, Cleveland Metropolitan School District.

http://www.firstladies.org/curriculum/curriculum.aspx?Curriculum=1086

Part i: Introduction; Part ii: Theories of Lumbee Origins; Part iii: Discrimination and Injustice in the Nineteenth Century; Part iv: Lumbee Pursuit of Education, Civil Rights, and Self-Governance; Part v: The Fight for Federal Recognition; Part vi: Lumbee Language and Culture; Part vii: References Part ii: Theories of Lumbee Origins The earliest and perhaps most famous theory of the Lumbee tribe’s origins is the so-called Lost Colony theory, proposed in 1885 by Robeson County legislator and local historian Hamilton McMillan and later expanded upon by North Carolina historian Stephen B. Weeks. The theory holds that the Lumbee are descendants of Sir Walter Raleigh’s Roanoke Island colonists. The colonists left their settlement, according to the theory, sometime after Governor John White had returned to England in 1587, moving south to an island or mainland location called ‘‘Croatoan’’—the sole word White and his men found carved in a wooden post upon returning to the island in 1590. There the English colonists settled among and intermarried with the friendly Croatan Indians, and by 1650 they migrated to the area of present-day Robeson County. The Lost Colony theory gained considerable credence among Lumbee people as well as non-Indians when Lumbee historian and author Adolph Dial argued in favor of it during the latter half of the twentieth century. John R. Swanton, an anthropologist with the Smithsonian Institution, wrote a report for the U.S. Department of the Interior in 1933 on the probable origins of the Lumbee. His research concluded that the tribe descended mainly from Siouan tribes, primarily the Saura (Cheraw) and Keyauwee. The Saura theory of origin has also been supported by Jack Campisi, an ethnohistorian who was the primary author of the tribe’s massive 1987 petition to the Bureau of Indian Affairs seeking full federal tribal recognition, and by William Sturtevant, editor of the Smithsonian Institution’s Handbook of North American Indians. Several other theories have been advanced, including the Cherokee theory, which states that during the Tuscarora War of 1711–13, Cherokees joined Col. John Barnwell in fighting the Tuscarora and marched home through Robeson County. Some Cherokees may have remained there and intermarried with local residents. Angus Wilton McLean, a Robesonian who served as governor, advocated this theory before Congress in 1913. Mary W. Norment, in an 1875 book, also proposed descent from the Tuscarora. Lumbee oral tradition reveals no fewer than four other migration theories, documented by anthropologist Robert K.Thomas in an unpublished 1976 report. Archaeological research reported by Stanley Knick in 1988 established that the land that makes up Robeson County has been inhabited by native peoples continuously from 12,000 B.C. (the early Paleo-Indian period), through the Archaic period (8000–1000 B.C.) and Woodland period (1000 B.C.–1600 A.D.), and up to the present day. In addition, Robeson County was a zone of cultural contact from the Middle Archaic period through the Woodland period and into colonial times. Knick argues that Indians from tribes of three eastern Carolina language families (Algonquian, Iroquoian, and Eastern Siouan) interacted with the Indians already living in the area. Early in the colonial period, European diseases and Indian wars began to decimate the southeastern tribes. As these processes unfolded, remnants of tribes from the three Eastern Carolina language families—primarily Saura and Siouan-speaking Indians—coalesced with the Indians already living in geographically isolated Robeson County. The area, dominated by swamps and other marginal lands for settlement and agriculture, did not generally interest whites, so the Indians’ chance of survival was increased. Evidence suggests that the amalgamated tribe that became the Lumbee was in place in Robeson County by 1750. Keep reading >> Part iii: Discrimination and Injustice in the Nineteenth Century 1 January 2006 | Stilling, Glenn Ellen Starr

http://www.ncpedia.org/lumbee/origins

Science Fair Project Encyclopedia Shotgun sequencing is a method used in genetics for sequencing long DNA strands. Since the chain termination method can only be used for fairly short strands, it is necessary to divide longer sequences up and then "assemble" the results to give the overall sequence. In chromosome walking, this division is done by progressing through the entire strand, piece by piece; shotgun sequencing uses a faster, but more complex, process to assemble random pieces of the sequence. In this technique, small segments of the target DNA strand are cloned randomly, and then these clones are sequenced using the chain termination method. By doing this for several copies of the same long DNA strand, overlapping fragments are created. Finally, computer programs align these overlapping sequences and determine the original (long) sequence. An extremely simplified example with only two sequences is as follows: Original strand : XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX First shotgun sequence : XXXAGCATGCTGCAG TCATGCTTAGGCTAXXXX Second shotgun sequence : TTAGGCTAXXXX XXXAGCATGCTGCAGTCATGC Reconstructed strand : XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX In real-world applications, there are thousands or millions of sequences to deal with, with the addition of transcription and sequencing errors. The computational power required to re-align the sequence in real projects is enormous. For the shotgun sequencing of the human genome in the Human Genome Project run by Celera Genomics in 2000, several supercomputers were running some months nonstop to align all human DNA correctly. The contents of this article is licensed from www.wikipedia.org under the GNU Free Documentation License. Click here to see the transparent copy and copyright details

http://www.all-science-fair-projects.com/science_fair_projects_encyclopedia/Shotgun_sequencing

The GDR was more democratic, in the original and substantive sense of the word, than eastern Germany was before 1949 and than the former East Germany has become since the Berlin Wall was opened in 1989. It was also more democratic in this original sense than its neighbor, West Germany. While it played a role in the GDR’s eventual demise, the Berlin Wall was at the time a necessary defensive measure to protect a substantively democratic society from being undermined by a hostile neighbor bent on annexing it. By Stephen Gowans While East Germany (the German Democratic Republic, or GDR) wasn’t a ‘workers’ paradise’, it was in many respects a highly attractive model that was responsive to the basic needs of the mass of people and therefore was democratic in the substantive and original sense of the word. It offered generous pensions, guaranteed employment, equality of the sexes and substantial wage equality, free healthcare and education, and a growing array of other free and virtually free goods and services. It was poorer than its West German neighbor, the Federal Republic of Germany, or FRG, but it started at a lower level of economic development and was forced to bear the burden of indemnifying the Soviet Union for the massive losses Germany inflicted upon the USSR in World War II. These conditions were largely responsible for the less attractive aspects of life in the GDR: lower pay, longer hours, and fewer and poorer consumer goods compared to West Germany, and restrictions on travel to the West. When the Berlin Wall was open in 1989, a majority of the GDR’s citizens remained committed to the socialist basis of their society and wished to retain it. It wasn’t the country’s central planning and public ownership they rebelled against. These things produced what was best about the country. And while Cold War propaganda located East Germany well outside the ‘free world,’ political repression and the Stasi, the East German state security service, weren’t at the root of East Germans’ rebellion either. Ultimately, what the citizens of the GDR rebelled against was their comparative poverty. But this had nothing to do with socialism. East Germans were poorer than West Germans even before the Western powers divided Germany in the late 1940s, and remain poorer today. A capitalist East Germany, forced to start at a lower level of economic development and to disgorge war reparation payments to the USSR, would not have become the social welfare consumer society West Germany became and East Germans aspired after, but would have been at least as worse off as the GDR was, and probably much worse off, and without the socialist attractions of economic security and greater equality. Moreover, without the need to compete against an ideological rival, it’s doubtful the West German ruling class would have been under as much pressure to make concessions on wages and benefits. West Germans, then, owed many of their social welfare gains to the fact their neighbour to the east was socialist and not capitalist. The Western powers divide Germany While the distortions of Cold War history would lead one to believe it was the Soviets who divided Germany, the Western powers were the true authors of Germany’s division. The Allies agreed at the February 1945 Yalta conference that while Germany would be partitioned into French, British, US and Soviet occupation zones, the defeated Germany would be administered jointly. The hope of the Soviets, who had been invaded by Germany in both first and second world wars, was for a united, disarmed and neutral Germany. The Soviet’s goals were two-fold: First, Germany would be demilitarized, so that it could not launch a third war of aggression on the Soviet Union. Second, it would pay reparations for the massive damages it inflicted upon the USSR, calculated after the war to exceed $100 billion. The Western powers, however, had other plans. The United States wanted to revive Germany economically to ensure it would be available as a rich market capable of absorbing US exports and capital investment. The United States had remained on the sidelines through a good part of the war, largely avoiding the damages that ruined its rivals, while at the same time acting as armourer to the Allies. At the end of the war, Britain, France, Germany, Japan and the USSR lay in ruins, while the US ruling class was bursting at the seams with war industry profits. The prospects for the post-war US economy, however, and hence for the industrialists, bankers and investors who dominated the country’s political decision-making, were dim unless new life could be breathed into collapsed foreign markets, which would be needed to absorb US exports and capital. An economically revived Germany was therefore an important part of the plan to secure the United States’ economic future. The idea of a Germany forced to pour out massive reparation payments to the USSR was intolerable to US policy makers: it would militate against the transformation of Germany into a sphere of profit-making for US capital, and would underwrite the rebuilding of an ideological competitor. The United States intended to make post-war life as difficult as possible for the Soviet Union. There were a number of reasons for this, not least to prevent the USSR from becoming a model for other countries. Already, socialism had eliminated the United States’ access to markets and spheres of investment in one-sixth of the earth’s territory. The US ruling class didn’t want the USSR to provide inspiration and material aid to other countries to follow the same path. The lead role of communists in the resistance movements in Europe, “the success of the Soviet Union in defeating Nazi Germany,” and “the success of the Soviet Union in industrializing and modernizing,” had greatly raised the prestige of the USSR and enhanced the popularity of communism. Unless measures were taken to check the USSR’s growing popularity, socialism would continue to advance and the area open to US exports and investment would continue to contract. A Germany paying reparations to the Soviets was clearly at odds with the goals of reviving Germany and holding the Soviet Union in check. What’s more, while the Soviets wanted Germany to be permanently disarmed as a safeguard against German revanchism, the United States recognized that a militarized Germany under US domination could play a central role in undermining the USSR. The division of Germany began in 1946, when the French decided to administer their zone separately. Soon, the Western powers merged their three zones into a single economic unit and announced they would no longer pay reparations to the Soviet Union. The burden would have to be borne by the Soviet occupation zone alone, which was smaller and less industrialized, and therefore less able to offer compensation. In 1949, the informal division of Germany was formalized with the proclamation by the Western powers of a separate West German state, the FRG. The new state would be based on a constitution written by Washington and imposed on West Germans, without their ratification. (The GDR’s constitution, by contrast, was ratified by East Germans.) In 1954, West Germany was integrated into a new anti-Soviet military alliance, NATO, which, in its objectives, aped the earlier anti-Comintern pact of the Axis powers. The goal of the anti-Comintern pact was to oppose the Soviet Union and world communism. NATO, with a militarized West Germany, would take over from where the Axis left off. The GDR was founded in 1949, only after the Western powers created the FRG. The Soviets had no interest in transforming the Soviet occupation zone into a separate state and complained bitterly about the Western powers’ division of Germany. Moscow wanted Germany to remain unified, but demilitarized and neutral and committed to paying war reparations to help the USSR get back on its feet. As late as 1954, the Soviets offered to dissolve the GDR in favour of free elections under international supervision, leading to the creation of a unified, unaligned, Germany. This, however, clashed with the Western powers’ plan of evading Germany’s responsibility for paying war reparations and of integrating West Germany into the new anti-Soviet, anti-communist military alliance. The proposal was, accordingly, rejected. George Kennan, the architect of the US policy of ‘containing’ (read undermining) the Soviet Union, remarked: “The trend of our thinking means that we do not want to see Germany reunified at this time, and that there are no conditions on which we would really find such a solution satisfactory.” This placed the anti-fascist working class leadership of the GDR in a difficult position. The GDR comprised only one-third of German territory and had a population of 17 million. By comparison, the FRG comprised 63 million people and made up two-thirds of German territory. Less industrialized than the West, the new GDR started out poorer than its new capitalist rival. Per capita income was about 27 percent lower than in the West. Much of the militant section of the working class, which would have ardently supported a socialist state, had been liquidated by the Nazis. The burden of paying war reparations to the Soviets now had to be borne solely by the GDR. And West Germany ceaselessly harassed and sabotaged its neighbor, refusing to recognize it as a sovereign state, regarding it instead as its own territory temporarily under Soviet occupation. Repeatedly, West Germany proclaimed that its official policy was the annexation of its neighbor to the east. The GDR’s leaders faced still other challenges. Compared to the West, East Germany suffered greater losses in the war. The US Army stripped the East of its scientists, technicians and technical know-how, kidnapping “thousands of managers, engineers, and all sorts of experts, as well as the best scientists – the brains of Germany’s East – from their factories, universities, and homes in Saxony and Thuringia in order to put them to work to the advantage of the Americans in the Western zone – or simply to have them waste away there.” As Pauwels explains, “During the last weeks of the hostilities the Americans themselves had occupied a considerable part of the Soviet zone, namely Thuringia and much of Saxony. When they pulled out at the end of June, 1945, they brought back to the West more than 10,000 railway cars full of the newest and best equipment, patents, blueprints, and so on from the firm Carl Zeiss in Jena and the local plants of other top enterprises such as Siemens, Telefunken, BMW, Krupp, Junkers, and IG-Farben. This East German war booty included plunder from the Nazi V-2 factory in Nordhausen: not only the rockets, but also technical documents with an estimated value of 400 to 500 million dollars, as well as approximately 1,200 captured German experts in rocket technology, one of whom being the notorious Wernher von Braun.” The Allies agreed at Yalta that a post-war Germany would pay the Soviet Union $10 billion in compensation for the damages inflicted on the USSR during the war. This was a paltry sum compared to the more realistic estimate of $128 billion arrived at after the war. And yet the Soviets were short changed on even this meagre sum. The USSR received no more than $5.1 billion from the two German states, most of it from the GDR. The Soviets took $4.5 billion out of East Germany, carting away whole factories and railways, while the larger and richer FRG paid a miserable $600 million. The effect was the virtual deindustrialization of the East. In the end, the GDR would compensate both the United States (which suffered virtually no damage in World War II) through the loss of its scientists, technicians, blue-prints, patents and so on, and the Soviet Union (which suffered immense losses and deserved to be compensated), through the loss of its factories and railways. Moreover, the United States offered substantial aid to West Germany to help it rebuild, while the poorer Soviet Union, which had been devastated by the German invasion, lacked the resources to invest in the GDR. The West was rebuilt; the East stripped bare. The GDR’s democratic achievements Despite the many burdens it faced, the GDR managed to build a standard of living higher than that of the USSR “and that of millions of inhabitants of the American ghettoes, of countless poor white Americans, and of the population of most Third World countries that have been integrated willy-nilly with the international capitalist world system.” Over 90 percent of the GDR’s productive assets were owned by the country’s citizens collectively, while in West Germany productive assets remained privately owned, concentrated in a few hands. Because the GDR’s economy was almost entirely publicly owned and the leadership was socialist, the economic surplus that people produced on the job went into a social fund to make the lives of everyone better rather than into the pockets of shareholders, bondholders, landowners and bankers. Out of the social fund came subsidies for food, clothing, rent, public transportation, as well as cultural, social and recreational activities. Wages weren’t as high as in the West, but a growing number of essential goods and services were free or virtually free. Rents, for example, were very low. As a consequence, there were no evictions and there was no homelessness. Education was free through university, and university students received stipends to cover living expenses. Healthcare was also free. Childcare was highly subsidized. Differences in income levels were narrow, with higher wages paid to those working in particularly strenuous or dangerous occupations. Full gender equality was mandated by law and men and women were paid equally for the same work, long before gender equality was taken up as an issue in the West. What’s more, everyone had a right to a job. There was no unemployment in the GDR. Rather than supporting systems of oppression and exploitation, as the advanced capitalist countries did in Africa, Latin America and Asia, the GDR assisted the people of the global South in their struggles against colonialism. Doctors were dispatched to Vietnam, Mozambique and Angola, and students from many Third World countries were trained and educated in the GDR at the GDR’s expense. Even the Wall Street Journal recognized the GDR’s achievements. In February, 1989, just months before the opening of the Berlin Wall, the US ruling class’s principal daily newspaper announced that the GDR “has no debt problem. The 17 million East Germans earn 30 percent more than their next richest partners, the Czechoslovaks, and not much less than the English. East Germans build 32-bit mini-computers and a socialist ‘Walkman’ and the only queue in East Berlin forms at the opera.” The downside was that compared to West Germany, wages were lower, hours of work were longer, and there were fewer consumer goods. Also, consumer goods tended to be inferior compared to those available in West Germany. And there were travel restrictions. Skilled workers were prevented from travelling to the West. But at the same time, vacations were subsidized, and East Germans could travel throughout the socialist bloc. West Germany’s comparative wealth offered many advantages in its ideological battle with socialism. For one, the wealth differential could be attributed deceptively to the merits of capitalism versus socialism. East Germany was poorer, it was said, not because it unfairly bore the brunt of indemnifying the Soviets for their war losses, and not because it started on a lower rung, but because public ownership and central planning were inherently inefficient. The truth of the matter, however, was that East German socialism was more efficient than West German capitalism, producing faster growth rates, and was more responsive to the basic needs of its population. “East Germany’s national income grew in real terms about two percent faster annually that the West German economy between 1961 and 1989.” The GDR was also less repressive politically. Following in the footsteps of Hitler, West Germany banned the Communist Party in the 1950s, and close tabs were kept by West Germany’s own ‘secret’ police on anyone openly expressing Marxist-Leninist views. Marxist-Leninists were barred from working in the public service and frequently lost private sector jobs owing to their political views. In the GDR, by contrast, those who expressed views at odds with the dominant Marxist-Leninist ideology did not lose their jobs, and were not cut off from the state’s generous social supports, though they too were monitored by the GDR’s ‘secret’ police. The penalty for dissenting from the dominant political ideology in the West (loss of income) was more severe than in the East. The claim that the GDR’s socialism was less efficient than West Germany’s capitalism was predicated on the disparity in wealth between the two countries, but the roots of the disparity were external to the two countries’ respective systems of ownership, and the disparity existed prior to 1949 (at which point GDP per capita was about 43 percent higher in the West) and continued to exist after 1989 (when unemployment – once virtually eliminated — soared and remains today double what it is in the former West Germany.) Over the four decades of its existence, East German socialism attenuated the disparity, bringing the GDR closer to West Germany’s GDP per capita. Significantly, “real economic growth in all of Eastern Europe under communism was estimated to be higher than in Western Europe under capitalism (as well as higher than that in the USA) even in communism’s final decade (the 1980s).” After the opening of the Berlin Wall, with capitalism restored, “real economic output fell by over 30 percent in Eastern Europe as a whole in the 1990s.” But the GDR’s faster growth rates from 1961 to 1989 tell only part of the story. It’s possible for GDP to grow rapidly, with few of the benefits reaching the bulk of the population. The United States spends more on healthcare as a percentage of its GDP than all other countries, but US life expectancy and infant mortality results are worse than in many other countries which spend less (but have more efficient public health insurance or socialized systems.) This is due to the reality that healthcare is unequally distributed in the United States, with the wealthy in a position to buy the best healthcare in the world while tens of millions of low-income US citizens can afford no or only inadequate healthcare. By contrast, in most advanced capitalist countries everyone has access to basic (though typically not comprehensive) healthcare. In socialist Cuba, comprehensive healthcare is free to all. What’s important, then, is not only how much wealth (or healthcare) a society creates, but also how a society’s wealth (or healthcare) is distributed. Wealth was far more evenly distributed in socialist countries than it was in capitalist countries. The mean Gini coefficient – a measure of income equality which runs from 0 (perfect equality) to 1 (perfect inequality) – was 0.24 for socialist countries in 1970 compared to 0.48 for capitalist countries. Socialist countries also fared better at meeting their citizens’ basic needs. Compared to all capitalist countries, socialist countries had higher life expectancies, lower levels of infant mortality, and higher levels of literacy. However, the comparison of all socialist countries with all capitalist countries is unfair, because the group of capitalist countries comprises many more countries unable to effectively meet the basic needs of their populations owing to their low level of economic development. While capitalism is often associated with the world’s richest countries, the world’s poorest countries are also capitalist. Desperately poor Haiti, for example, is a capitalist country, while neighboring Cuba, richer and vastly more responsive to the needs of its citizens, is socialist. We would expect socialist countries to have done a better job at meeting the basic needs of their citizens, because they were richer, on average, than all capitalist countries together. But the conclusion still stands if socialist countries are compared with capitalist countries at the same level of economic development; that is, socialist countries did a better job of meeting their citizens’ basic needs compared to capitalist countries in the same income range. Even when comparing socialist countries to the richest capitalist countries, the socialist countries fared well, meeting their citizens’ basic needs as well as advanced capitalist countries met the needs of their citizens, despite the socialist countries’ lower level of economic development and fewer resources. In terms of meeting basic needs, then, socialism was more efficient: it did more with less. Why were socialist countries, like the GDR, more efficient? First, socialist societies were committed to improving the living standards of the mass of people as their first aim (whereas capitalist countries are organized around profit-maximization as their principle goal – a goal linked to a minority that owns capital and land and derives its income from profits, rent and interest, that is, the exploitation of other people’s labor, rather than wages.) Secondly, the economic surplus the citizens of socialist countries produced was channelled into making life better for everyone (whereas in capitalist countries the economic surplus goes straight to shareholders, bondholders, landowners and bankers.) This made socialism more democratic than capitalism in three ways: • It was more equal. (Capitalism, by contrast, produces inequality.) • It worked toward improving as much as possible the lot of the classes which have no other means of existence but the labor of their hands and which comprise the vast majority of people. (Capitalist societies, on the other hand, defend and promote the interests of the minority that owns capital.) • It guaranteed economic and social rights. (By comparison, capitalist societies emphasize political and civil liberties, i.e., protections against the majority using its greater numbers to encroach upon the privileges of the minority that owns and controls the economy.) As will be discussed below, even when it came to political (as distinct from social and economic) democracy, the differences between East and West Germany were more illusory than real. Stanching the outward migration of skilled workers Despite the many advantages the GDR offered, it remained less affluent throughout its four decades compared to its capitalist neighbor to the west. For many “the lure of higher salaries and business opportunities in the West remained strong.” As a result, in its first decade, East Germany’s population shrunk by 10 percent. And while higher wages proved to be an irresistible temptation to East Germans who stressed personal aggrandizement over egalitarian values and social security, the FRG – keen to weaken the GDR – did much to sweeten the pot, offering economic inducements to skilled East Germans to move west. Working-age, but not retired, East Germans were offered interest-free loans, access to scarce apartments, immediate citizenship and compensation for property left behind, to relocate to the West. By 1961, the East German government decided that defensive measures needed to be taken, otherwise its population would be depleted of people with important skills vital to building a prosperous society. East German citizens would be barred from entering West Germany without special permission, while West Germans would be prevented from freely entering the GDR. The latter restriction was needed to break up black market currency trading, and to inhibit espionage and sabotage carried out by West German agents. Walls, fences, minefields and other barriers were deployed along the length of the East’s border with the West. Many of the obstacles had existed for years, but until 1961, Berlin – partitioned between the West and East – remained free of physical barriers. The Berlin Wall – the GDR leadership’s solution to the problems of population depletion and Western sabotage and espionage — went up on August 13, 1961. From 1961 to 1989, 756 East German escapees, an average of 30 per year, were either shot, drown, blown apart by mines or committed suicide after being captured. By comparison, hundreds of Mexicans die every year trying to escape poor Mexico into the far wealthier United States. Approximately 50,000 East Germans were captured trying to cross the border into West Germany from 1961 to 1989. Those who were caught served prison sentences of one year. Over time, the GDR gradually relaxed its border controls, allowing working-age East Germans to visit the West if there was little risk of their not returning. While in the 1960s, only retirees over the age of 65 were permitted to travel to the West, by the 1980s, East Germans 50 years of age or older were allowed to cross the border. Those with relatives in the FRG were also allowed to visit. By 1987, close to 1.3 million working-age East Germans were permitted to travel to West Germany. Virtually all of them – over 99 percent – returned. However, not all East Germans were granted the right to cross the border. In 1987, 300,000 requests were turned down. East Germans only received permission after being cleared by the GDR’s state security service, the Stasi. One of the effects of loosening the border restrictions was to swell the Stasi’s ranks, in order to handle the increase in applications for visits to the West. Pauwels reminds us that, “A hypothetical capitalist East Germany would likewise have also had to build a wall in order to prevent its population from seeking salvation in another, more prosperous Germany. Incidentally, people have fled and continue to flee, to richer countries also from poor capitalist countries. However, the numerous black refugees from extremely poor Haiti, for example, have never enjoyed the same kind of sympathy in the United States and elsewhere in the world that was bestowed so generously on refugees from the GDR during the Cold War…And should the Mexican government decide to build a ‘Berlin Wall’ along the Rio Grande in order to prevent their people from escaping to El Norte, Washington would certainly not condemn such an initiative the way it used to condemn the infamous East Berlin construction project.” GDR sets standards for working class in FRG…and abroad Despite its comparative poverty, the GDR furnished its citizens with generous pensions, free healthcare and education, inexpensive vacations, virtually free childcare and public transportation, and paid maternity leave, as fundamental rights. Even so, East Germany’s standard of living continued to lag behind that of the upper sections of the working class in the West. The comparative paucity and lower quality of consumer goods, and lower wages, were the product of a multitude of factors that conspired against the East German economy: its lower starting point; the need to invest in heavy industry at the expense of light industry; blockade and sanctions imposed by the West; the furnishing of aid to national liberation movements in the global South (which benefited the South more than it did the GDR. By comparison, aid flows from Western countries were designed to profit Western corporations, banks and investors.) What East Germany lacked in consumer goods and wages, it made up for in economic security. The regular economic crises of capitalist economies, with their rampant underemployment and joblessness, escalating poverty and growing homelessness, were absent in the GDR. The greater security of life for East Germans presented a challenge to the advanced capitalist countries. Intent on demonstrating that capitalism was superior to socialism, governments and businesses in the West were forced to meet the standards set by the socialist countries to secure the hearts and minds of their own working class. Generous social insurance, provisions against lay-offs and representation on industrial councils were conceded to West German workers. But these were revocable concessions, not the inevitable rewards of capitalism. East Germany’s robust social wage acted in much the same way strong unions do in forcing non-unionized plants to provide wages and benefits to match union standards. In the 1970s, Canada’s unionized Stelco steel mill at Hamilton, Ontario set the standard for the neighboring non-unionized Dofasco plant. What the Stelco workers won through collective bargaining, the non-unionized Dofasco workers received as a sop to keep the union out. But once the union goes, the motivation to pay union wages and provide union benefits disappears. Likewise, with the demise of East Germany and the socialist bloc, the need to provide a robust social safety net in the advanced capitalist countries to secure the loyalty of the working class no longer existed. Hence, the GDR not only furnished its own citizens with economic security, but indirectly forced the advanced capitalist countries to make concessions to their own workers. The demise of the GDR therefore not only hurt Ossis (East Germans), depriving them of economic security, but also hurt the working populations of the advanced capitalist countries, whose social programs were the spill-over product of capitalism’s ideological battle with socialism. It is no accident that the claw back of reforms and concessions granted by capitalist ruling classes during the Cold War has accelerated since the opening of the Berlin Wall. The collapse of the GDR and the socialist bloc has proved injurious to the interests of Western working populations in another way, as well. From the Bolshevik Revolution in 1917 to the opening of the Berlin Wall in 1989, the territory available to capitalist exploitation steadily diminished. This limited the degree of wage competition within the capitalist global labor force to a degree that wouldn’t have been true had the forces of socialism and national liberation not steadily advanced through the twentieth century. The counter-revolution in the Soviet Union and Eastern Europe, and China’s opening to foreign investment, ushered in a rapid expansion worldwide in the number of people vying for jobs. North American and Western European workers didn’t compete for jobs with workers in Poland, Romania, Slovakia and Russia in 1970. They do today. The outcome of the rapid expansion of the pool of wage-labor worldwide for workers in the advanced capitalist countries has been a reduction in real wages and explosive growth in the number of permanent lay-offs as competition for jobs escalates. The demise of socialism in Eastern Europe (and China’s taking the capitalist road) has had very real – and unfavourable – consequences for working people in the West. Since the opening of the Berlin Wall and the annexation of the GDR by the FRG in 1990, the former East Germany has been transformed from a rapidly industrializing country where everyone was guaranteed a job and access to a growing array of free and nearly free goods and services, to a de-industrialized backwater teeming with the unemployed where the population is being hollowed out by migration to the wealthier West. “The easterners,” a New York Times article remarked in 2005, “are notoriously unhappy.” Why? “Because life is less secure than it used to be under Communism.” During the Cold War East Germans who risked their lives to breach the Berlin War were depicted as refugees from political repression. But their escape into the wealthier West had little to do with flight from political repression and much to do with being attracted to a higher standard of living. Today Ossis stream out of the East, just as they did before the Berlin Wall sprang up in 1961. More than one million people have migrated from the former East Germany to the West since 1989. But these days, economic migrants aren’t swapping modestly-paid jobs, longer hours and fewer and poorer consumer goods in the East for higher paying jobs, shorter hours and more and better consumer goods in the West. They’re leaving because they can’t find work. The real unemployment rate, taking into account workers forced into early retirement or into the holding pattern of job re-training schemes, reaches as high as 50 percent in some parts of the former East Germany. And the official unemployment rate is twice as high in the East as it is in the West. Erich Quaschnuk, a retired railroad worker, acknowledges that “the joy back then when the Berlin Wall fell was real,” but quickly adds, “the promise of blooming landscapes never appeared.” Twenty years after the opening of the Berlin Wall, one-half of people living in the former East Germany say there was more good than bad about the GDR, and that life was happier and better. Some Ossis go so far as to say they “were driven out of paradise when the Wall came down” while others thank God they were able to live in the GDR. Still others describe the unified Germany as a “slave state” and a “dictatorship of capital,” and reject Germany for “being too capitalist or dictatorial, and certainly not democratic.” Much as the GDR was faulted for being less democratic politically than the FRG, the FRG’s claim to being more democratic politically is shaky at best. “East Germany…permitted voters to cast secret ballots and always had more than one candidate for each government position. Although election results typically resulted in over 99 percent of all votes being for candidates of parties that did not favour revolutionary changes in the East German system (just as West German election results generally resulted in over 99 percent of the people voting for non-revolutionary West German capitalist parties), it was always possible to change the East German system from within the established political parties (including the communist party), as those parties were open to all and encouraged participation in the political process. The ability to change the East German system from within is best illustrated by the East German leader who opened up the Berlin Wall and initiated many political reforms in less than two months in power.” West Germany outlawed many anti-capitalist political parties and organizations, including, in the 1950s, the popular Communist Party, as Hitler did in the 1930s. (On the other side of the Berlin Wall, no party that aimed to reverse socialism or withdraw from the Warsaw Pact was allowed.) The West German parties tended to be pro-capitalist, and those that weren’t didn’t have access to the resources the wealthy patrons of the mainstream political parties could provide to run the high-profile marketing campaigns that were needed to command significant support in elections. What’s more, West Germans were dissuaded from voting for anti-establishment parties, for fear the victory of a party with a socialist platform would be met by capital strike or flight, and therefore the loss of their jobs. The overwhelming support for pro-capitalist parties, then, rested on two foundations: The pro-capitalist parties uniquely commanded the resources to build messages with mass appeal and which could be broadcast with sufficient volume to reach a mass audience, and the threat of capital strike and capital flight disciplined working class voters to support pro-business parties. No one would have built a Berlin Wall if they didn’t have to. But in 1961, with the GDR being drained of its working population by a West Germany that had skipped out on its obligations to indemnify the Soviet Union for the losses the Nazis had inflicted upon it in World War II, there were few options, apart from surrender. The Berlin Wall was, without question, regrettable, but it was at the same time a necessary defensive measure. If the anti-fascist, working class leadership of the GDR was to have any hope of building a mass society that was responsive to the basic needs of the working class and which channelled its economic surplus into improving the living conditions and economic security of all, drastic measures would have to be taken; otherwise, the experiment in German democracy — that of building a state that operated on behalf of the mass of people, rather than a minority of shareholders, bondholders, landowners and bankers — would have to be abandoned. And yet, by the history of drastic measures, this was hardly drastic. Wars weren’t waged, populations weren’t expelled, mass executions weren’t carried out. Instead, people of working-age were prevented from resettling in the West. The abridgment of mobility rights was hardly unique to revolutionary situations. While the needs of Cold War propaganda pressed Washington to howl indignantly over the GDR’s measures to stanch the flow of its working-age population to the West, the restriction of mobility rights had not been unknown in the United States’ own revolution, where the ‘freedoms’ of dissidents and people of uncertain loyalty had been freely revoked. “During the American Revolution…those who wished to cross into British territory had to obtain a pass from the various State governments or military commanders. Generally, a pass was granted only to individuals of known and acceptable ‘character and views’ and after their promise neither to inform or otherwise to act to the prejudice of the United States. Passes, even for those whose loyalty was guaranteed, were generally difficult to acquire.” Was the GDR worth defending? Is its demise to be regretted? Unquestionably. The GDR was a mass society that channelled the surplus of the labor of all into the betterment of the conditions of all, rather than into the pockets of the few. It offered its citizens an expanding array of free and virtually free goods and services, was more equal than capitalist countries, and met its citizens’ basic needs better than did capitalist countries at the same level of economic development. Indeed, it met basic needs as well as richer countries did, with fewer resources, in the same way Cuba today meets the basic healthcare needs of all its citizens better than the vastly wealthier United States meets (or rather fails to meet) those of tens of millions of its own citizens. And while the GDR was poorer than West Germany and many other advanced capitalist countries, its comparative poverty was not the consequence of the country’s public ownership and central planning, but of a lower starting point and the burden of having to help the Soviet Union rebuild after the massive devastation Germany inflicted upon it in World War II. Far from being inefficient, public ownership and central planning turned the eastern part of Germany into a rapidly industrializing country which grew faster economically than its West German neighbor and shared the benefits of its growth more evenly. In the East, the economy existed to serve the people. In the West, the people existed to serve the minority that owned and controlled the economy. Limiting mobility rights, just as they have been limited in other revolutions, was a small price to pay to build, not what anyone would be so naïve as to call a workers’ paradise, but what can be called a mass, or truly democratic, society, one which was responsiveness to the basic needs of the mass of people as its principal aim. 1. Austin Murphy, The Triumph of Evil: The Reality of the USA’s Cold War Victory, European Press Academic Publishing, 2000. 2. Henry Heller, The Cold War and the New Imperialism: A Global History, 1945-2005, Monthly Review Press, New York, 2006. 3. Jacques R. Pauwels, The Myth of the Good War: America in the Second World War, James Lorimer & Company Ltd., Toronto, 2002; R. Palme Dutt, The Internationale, Lawrence & Wishart Ltd., London, 1964. 4. Melvyn Leffler, “New perspectives on the Cold War: A conversation with Melvyn Leffler,” November, 1998. http://www.neh.gov/news/humanities/1998-11/leffler.html) 6. John Wight, “From WWII to the US empire,” The Morning Star (UK), October 11, 2009. 7. John Green, “Looking back at life in the GDR,” The Morning Star (UK), October 7, 2009. 8. Shirley Ceresto, “Socialism, capitalism, and inequality,” The Insurgent Sociologist, Vol. XI, No. 2, Spring, 1982. 9. Dutt; William Blum, Killing Hope: U.S. Military and CIA Interventions Since World War II, Common Courage Press, Maine, 1995. 18. The Wall Street Journal, February 22, 1989. 34. Fred Goldstein, Low-Wage Capitalism, World View Forum, New York, 2008. 36. The New York Times, December 6, 2005. 37. The Guardian (UK), November 15, 2006. 38. “Disappointed Eastern Germans turn right,” The Los Angeles Times, May 4, 2005. 39. Julia Bonstein, “Majority of Eastern Germans felt life better under communism,” Der Spiegel, July 3, 2009. 41. Albert Szymanski, Human Rights in the Soviet Union, Zed Book Ltd., London, 1984

http://gowans.wordpress.com/category/west-germany/

Geothermal power is energy generated from heat stored in the earth, or the collection of absorbed heat derived from underground.As of 2008, geothermal power supplies less than 1% of the world’s energy. Geothermal resources range from shallow ground to hot water and rock several miles below the Earth’s surface, and even further down to the extremely hot molten rock called magma. Wells over a mile deep can be drilled into underground reservoirs to tap steam and very hot water that can be brought to the surface for use in a variety of applications. Learn more about how Geothermal energy is harnessed. Geothermal Possibilities in the Caribbean Saint Kitts and Nevis The island of Nevis, long known for its numerous hot springs, commenced drilling for the construction of a geothermal power plant at Spring Hill, Nevis, in January 2008. When completed (estimated 2010), the plant will supply 50 megawatts of electricity, enough to fulfill all of Nevis’ demand (approximately 10 megawatts), and also enough to export to neighboring Saint Kitts as well as other nearby islands via submarine electrical transmission cables. The project, being undertaken by West Indies Power, will make Saint Kitts and Nevis the first country in the Caribbean to utilize large-scale Geothermal energy, and, when complete, will make Saint Kitts and Nevis one of the least dependent nations in the world on fossil-fuels. Project in Dominica The Government of Dominica awarded geothermal exploration and development license to West Indies Power (Dominica) Ltd. on 10 July 2008. Initial geologic and geochemical field exploration work will begin in August 2008. Based on the results of the thermal gradient holes slim holes will be drilled in 2009 and the geothermal power plant will be constructed in 2010. Project in Saba In Saba, West Indies Power develops geothermal power plant with capacity of 75 MW.

http://www.nvgebe.com/Environment/RenewableEnergy/GeothermalEnergy.aspx

For young children, fairness means: Young children are very impressionable, and parents are the most important teacher children ever have. One way you can help your child learn to be fair is by example. If your child sees you following rules, sharing with your family, listening to others and not placing blame, he or she will be likely to follow your example. Infants and fairness One important way to establish a foundation for teaching fairness to your child is by listening. When your child is awake and alert, listen to her different sounds and respond to them. When your baby starts babbling, she will love to hear you copy her sounds and she will probably babble some more. If your baby sees you respond to her babbling, she will babble some more. You will be encouraging language development. Remember that listening is character development. Babies who are listened to will learn that they are important and valuable and will be likely to listen to others when they are older. Toddlers and fairness Concepts of fairness are not easy for toddlers to understand. During this time, think of building a foundation of fairness. Many things you do for your child will help in her later understanding of fairness. Listening to your toddler is a good example. When your toddler wants your attention, let her know you care by getting down on her level and listening to her. She will learn from this that she is important and listening to others is important. Toddlers love to hand toys and objects to adults. This is an early form of sharing. Pay attention to these moments and to your toddler's sharing behavior, and your toddler will learn the value of sharing (take note that this probably will take several years to develop). Remember that part of being fair is following the rules. The first rules toddlers usually learn revolve around safety issues, for example, not touching hot pots on the stove or staying away from the street. The rules may not be easy to enforce, but toddlers need boundaries, and enforcing rules is a good way to to this. Preschool classrooms generally have rules, such as no running inside, pick up your toys when you are through with them or be kind to your friends. Enforcing similar rules at home will be helpful to your child because he or she will become accustomed to following the same standard of behavior at home and at school. If you are unsure of what rules to establish at home, you may want to involve your children. Their ideas may surprise you. Playing card or board games with your child is another way to encourage your children to take turns and share. Look for games that are designed for the age of your child. They will not be frustrating, but will still provide a challenge. Send to friend

http://www.lsuagcenter.com/en/family_home/family/character_education/character_critters/for_parents/Teaching+Children+about+Fairness.htm

Full details, including credits and location for the maps featured can be found on the BBC Four site. Aims and objectives - To define a map. - To understand the importance of maps to historians. - To begin to develop an understanding how human scientific knowledge of the world has changed. - To understand how historical and contemporary maps differ. - To understand religious beliefs in the medieval world. Resources required for this lesson - Psalter lesson worksheet 1 and Psalter Map video with teacher's transcript - Psalter lesson worksheets 2 - 6 - Examples of maps - Cardboard, scissors, glue, coloured paper, coloured pencils The lesson plan - Split the class out into groups of four. - Handout copies of all the maps as well as a contemporary A-Z, Atlas, Road Atlas and tourist map. - Using the example they have been given ask the groups to answer the question. What is a map? They should list the key points to read out to the rest of the class. - Feedback the answers and discuss as a class. - Create a class a spider diagram to define a map. - Load the video clip of the map onto the IWB. - Hand out Psalter worksheet 1. - Play sections of the clip and pause at stages (referring to the teacher's transcript downloadable from the Psalter video page) for the class to match the definitions of events and fill in missing words on Psalter lesson worksheet 1. - Once they have watched the clip discuss the answers as a class. - Split the class into pairs or groups of 3-4 pupils to complete a card sort. - Hand out the card out the cards cut out from Psalter worksheet 2. - Once the class have placed their cards under the headings discuss the answers. - Hand out the statements about the main aims of the map. See Psalter worksheet 3. They have to decide which one they most agree with and explain why. - Each pair/group should then feedback their answers to the class and as a class, pupils must agree upon the most important aim of the map. - Split the class into groups of 2-3 pupils. - Handout Psalter worksheet 4a. This gives a basic outline of the things people were expected to do in order to get to heaven. - Give each group a specific way to get to heaven from the worksheet and ask them to produce a short role play where they mime a way to get to heaven and the rest of the class have to guess which it is. This should be done like the game charades. - Perform role-plays. - Discuss the number of ways people could get to heaven and which were most appropriate for the rich and which for the poor. - Split the class into groups of 3-4. Hand out Psalter worksheet 4b. This explains how to create a medieval map game about how to get to heaven. - Once the games are complete the groups need to swap games and play. The teacher could give a prize for the best three games. - Play the video clip again. - Divide the class into pairs. Ask them to discuss and record all the things they have learned from the map about medieval religious views. - Feedback and compile a class list. - Split the class into groups of four and give them the scenario sheet given in worksheet 4c. They have to persuade the governors of a local museum to buy and display this map. In their speeches each group needs to explain what it reveals about religious belief and geographical understanding. - Research life in a Medieval Monastery. - Explore the details of the map in greater detail, using the BBC Four: Beauty of Maps site.

http://www.bbc.co.uk/schools/teachers/beautyofmaps/psalter.shtml

Bullying: What Parents Can Do To bully means to single someone out for deliberate and repeated harassment. There is an imbalance of power between the child being bullied and the bully. Many children have behaviors that could feel like bullying, but a child that is the target/victim of a bully will feel powerless to help themselves or stand up to the bully. BULLYING CAN BE: VERBAL: name-calling, threatening, teasing, taunting PHYSICAL: hitting, taking or damaging possessions, making someone do things he or she doesn't want to do, pushing and shoving EMOTIONAL: spreading rumors, ignoring or excluding others, making someone uncomfortable or scared BOTH BOYS AND GIRLS can bully, although most bullying is done by boys. Boys usually prefer swift and effective physical aggression. Girls tend to favor verbal and emotional intimidation or humiliation as bullying tools. WHO GETS BULLIED? Kids who tend to get bullied are not necessarily children who are overweight, wear glasses or braces, or speak with an accent. What victims do have in common is emotional vulnerability! In classroom counseling lessons, we refer to this as someone who will easily give up their "power". (Ask your child what this means) They are also the ones who are less outgoing, the ones who prefer to stand back and watch before joining in, or lack the social skills to enter into active play or group situations. These less assertive children are often looked on by their aggressive peers as potential "targets". (ask about this as well:) SO... what can you do as a parent? * Some kids will feel traumatized and ashamed; with others, bullying's effects will be minimal and short-lived. Take your cues from your child's reaction. Children become victims because they lack the skills to stop the bullying on their own, so rushing in to help may make your child feel even more inadequate. *Discuss the problem with your children. Help them identify their feelings and explore what they can do instead of remaining a victim. Explain that bullies can't exist without victims. *Teach the assertive responses that enable kids to deprive bullies of the "reward" of humiliating others. Using role-play dialogue and acting out various scenarios, rehearse with your child how to respond to being bullied. *Encourage your child to make friends and socialize at school. The most severe bullying is directed at loners. Children who have good social skills and a network of friends tend not to be bullied. *Inform school officials immediately about any bullying. Keep a written record of times, dates, names, and circumstances to show the harassment has a pattern. Experts recommend reporting all incidents of bullying, although you should always respond in the way you feel is appropriate. Informing the school staff is important in creating a safe school environment. information obtained from our curriculum through: Sunburst Visual Media

http://www.buncombe.k12.nc.us/site/Default.aspx?PageID=19265

Physical Properties of Liquids Added by Dr. Andrew Pulham on Dec 15, 2008 This activity shows that different substances can be characterised by their physical properties, such as density, melting point, etc. Experiments provided investigate the physical properties of some liquids, and then encourage students to use the internet to identify an unknown substance by its physical properties. This item teaches: - about melting and boiling points as characteristic properties of substances - about density as a characteristic property of a substance - To characterise different liquids by their physical properties - To identify an unknown liquid by its physical properties - External link: searchable periodic table: http://chemlab.pc.maricopa.edu/periodic/periodic.html - Periodic Table - Inorganic Chemistry - physical, density, boiling point, melting point - 1,691 times - Related Items - This Author Properties of Ionic Materials This activity investigates the physical properties that are ... The periodic table: some transition metals An interactive animation showing some of the transition meta... States of Matter The activity helps students to investigate the properties as... Ionic, covalent and metallic (melting points) Learn how the melting and boiling points change between ioni... This activity investigates how temperature changes when a su... Identifying Unknown Compounds 2 This activity guides pupils through the logical steps requir... Percentage Composition and Empirical Formulae This activity reinforces the concept that when a substance c... Energy Changes in Reactions (2) This activity investigates a series of reactions by measurin... Energy Transfer in Reactions 1 This activity shows that monitoring the temperature change d... Periodicity in Group 7 This activity focuses on the study of halogens (Group 7 of t...

http://www.yenka.com/content/item.action?quick=1ed

Cooperative discussion groups can be an enriching and rewarding way for your students to interact with literature and each other. Variations of Literature Circles are also called book clubs, literature groups, and grand conversations. There are many effective ways to organize Literature Circles and the choices that you make depend on the instructional and developmental needs of your students. Temple et al. (2002) outline five key factors when organizing a Literature Circle: "the books that are chosen, group size, length and frequency of sessions, who leads discussions, and whether responses are free or guided" (p. 474). In some cases, the teacher may list several books and allow students to sign up for each discussion group. In other cases, books and group members are assigned by the teacher. The teacher may choose to assign a specific job to each student, as practiced in cooperative groups. The groups may address specific questions during the course of the discussion. The choices made by the teacher in organizing the groups should be appropriate to the students needs. Once these discussions are recorded as podcasts, there are several options for sharing them. Separate small groups can have concurrent discussions on the same book and then exchange recordings to see how different groups addressed the same topics. Groups may read different books by the same author and then compare the recordings to find similarities or patterns. Exchanges can also be made with other classes, on the same or different books. Discussions can be recorded to reflect growth in learning. For instance, compare the concluding discussion after reading one book by a particular author or genre with the concluding discussion by the same group after reading another book by the same author or in the same genre. The discussions can illustrate a growing understanding of an authors style or a genres elements. Lets say that your class recorded a series of Literature Circle discussions about The Island of the Blue Dolphins by Scott ODell. Later, a student reading that book independently could listen to those discussions to see how others reacted to the same material. Making Literature Circles digital and online through podcasting means that students can review discussions later, conversations can be shared with other groups and other classes, and progress over time can be examined. Literature Circles can be appropriately organized for groups ranging from elementary through high school. In teacher preparation programs, either Literature Circles or Expository Circles can be used to encourage meaningful discussion of text. - Daniels, H. (1994). Literature circles: Voice and choice in the student-centered classroom. York, ME: Stenhouse. - Temple, C., Martinez, M., Yokota, J., Naylor, A. (2002). Childrens books in childrens hands. Boston, MA: Allyn & Bacon. - Tomkins, G. (1998). Fifty literacy strategies. Upper Saddle River, NJ: Prentice-Hall, Inc.

http://fcit.usf.edu/podcasts/literature_circles.html

Pinkeye is going around my son's preschool class. I have heard that it is very contagious. What can I do to prevent it and how can I determine if my son has it? You are correct that pink eye, medically referred to as conjunctivitis, is quite common. Technically speaking, conjunctivitis is a term that by definition means the thin layer of tissue that covers the white parts of the eye and the inside of the eyelids (the conjunctiva) is red and/or swollen (it is). While all sorts of things can cause this sort of inflammation, including an allergic reaction or irritating substances, for example, when we're talking about the contagious form of conjunctivitis, we're talking about pink eye caused by either viruses or bacteria. Distinguishing between viral and bacterial pink eye isn't always easy (and not always necessary). There are some rough rules of thumb regarding distinguishing differences, in that bacterial conjunctivitis tends to be associated with a redder eye and more green or yellow eye discharge than viral pink eye, whereas viral pink eye is more likely to involve pink, swollen and sensitive, watering eyes. In either case, pink eye infections are easily spread from one person (or child) to the next simply by touching hands or surfaces contaminated with the germs responsible for the infection. As the owner of a private preschool myself, I can tell you that preventing the spread of pink eye altogether isn't always possible, much in the way that completely preventing children from sharing their snotty nose colds is unrealistic. That said, there are definite measures you (and your child's preschool) can take to significantly limit the spread. They include: - Having a child with pink eye see their doctor to determine if it is bacterial, in which case antibiotic eye drops can be prescribed - Promoting routine and careful hand washing before and after touching the eyes, nose, and/or mouth - Extra attention given to the routine disinfection of all toys that are frequently touched by children - A child is unable to participate and staff determine that they cannot care for the child without compromising their ability to care for the health and safety of the other children in the group - The child meets other exclusion criteria, such as fever with behavior change - There is a recommendation of the health department or the child's health professional

http://www.babyzone.com/preschooler/pink-eye-conjunctivitis_79060

Table of contents The specific three dimensional arrangement of atoms in molecules is referred to as molecular geometry. We also define molecular geometry as the positions of the atomic nuclei in a molecule. There are various instrumental techniques such as X-Ray crystallography and other experimental techniques which can be used to tell us where the atoms are located in a molecule. Using advanced techniques, very complicated structures for proteins, enzymes, DNA, and RNA have been determined. Molecular geometry is associated with the chemistry of vision, smell and odors, taste, drug reactions and enzyme controlled reactions to name a few. Molecular geometry is associated with the specific orientation of bonding atoms. A careful analysis of electron distributions in orbitals will usually result in correct molecular geometry determinations. In addition, the simple writing of Lewis diagrams can also provide important clues for the determination of molecular geometry. Click on a picture to link to a page with the GIF file and a short discussion of the molecule. Valence Shell Electron Pair Repulsion (VSEPR) theory Electron pairs around a central atom arrange themselves so that they can be as far apart as possible from each other. The valence shell is the outermost electron-occupied shell of an atom that holds the electrons involved in bonding. In a covalent bond, a pair of electrons is shared between two atoms. In a polyatomic molecule, several atoms are bonded to a central atom using two or more electron pairs. The repulsion between negatively charged electron pairs in bonds or as lone pairs causes them to spread apart as much as possible. The idea of "electron pair repulsion can be demonstrated by tying several inflated balloons together at their necks. Each balloon represents an electron pair. The balloons will try to minimize the crowding and will spread as far apart as possible. According to VSEPR theory, molecular geometry can be predicted by starting with the electron pair geometry about the central atom and adding atoms to some or all of the electron pairs. This model produces good agreement with experimental determinations for simple molecules. With this model in mind, the molecular geometry can be determined in a systematic way. Molecules can then be divided into two groups: This page viewed 20065 times

http://chemwiki.ucdavis.edu/index.php?title=Inorganic_Chemistry/Molecular_Geometry&bc=0

Cover of the Minutes and Proceedings of the First Convention of People of Color, 1831 Image Ownership: Public domain After more than a decade of organized abolition among northern free blacks, a group of prominent free African American men organized the National Negro Convention Movement. The convention movement among northern free blacks symbolized the growth of a black activist network by the mid-nineteenth century. Between its first meeting in Philadelphia in 1831 and its last in Syracuse, New York in 1864, the conventions charted important shifts in rhetoric and focus and the development of a black nationalist political consciousness. The National Convention met a dozen times before the Civil War in Pennsylvania, Ohio, and New York state. The catalyst for the first meeting in Philadelphia centered upon a proposal by city leaders to oust Cincinnati’s black population as a response to conflict that had emerged over job competition between black and white men. The Cincinnati Riot of 1829 led black leaders to organize throughout the Midwest and Northeast in protest against anti-black violence, discrimination, and slavery. The first decade of convention meetings revealed growing interracial cooperation between black and white abolitionists. By the late 1840s the gathering were dominated by frustration and disillusionment among many black activists with the “moral suasion” approach of the abolitionist movement which appeared to have little impact on the slave system in the South. The passage of the Fugitive Slave Law in 1850 led to the crystallization of black nationalist consciousness as many African American leaders began to believe the United States would never act justly toward black people. As a result, the Negro conventions at mid-century debated the merits of voluntary African American emigration to places like Canada, Liberia, and the Caribbean versus the solidification of a black nationalist movement in the United States. During this period convention delegates consistently linked the status of free blacks and slaves in their calls for meetings. In 1855, for example, organizers of the Philadelphia convention wrote that “the elevation of the free man is inseperable (sic) from, and lies at the very threshold of the great work of the slave’s restoration to freedom.” The majority of delegates to the conventions were men, despite the active participation of free black women in the convention meetings and in the black abolitionist and nationalist movement in general. At the Philadelphia meeting, only two women, Elizabeth Armstrong and Rachel Cliff, served as official delegates. The Convention Movement died during the Civil War as emancipation came to the four million enslaved people in the South and soon afterwards the promise of citizenship during Reconstruction led, prematurely as it turned out, to the belief that African Americans would fully participate in the nation's politics. Howard Holman Bell, ed., Minutes of the Proceedings of the National Negro Conventions, 1830-1864 (NY: Arno Press, 1969) and Nikki M. Taylor, Frontier to Freedom: Cincinnati’s Black Community, 1802-68 (Athens, OH: Ohio Univ. Press, 2005). University of Washington, Seattle

http://www.blackpast.org/?q=aah/national-negro-convention-movement-1831-1864

A microphone converts sound waves to electric waves. It was created at the same time as the telephone but was invented by several different people working independently. These included Johann Phillip Reis, Alexander Graham Bell, Elisha Gray, Amos E. Dolbear, and Thomas Edison. Bell’s microphone consisted of a small magnet attached to a flat diaphragm that was very light and sensitive enough to vibrate when sound waves contacted it. The magnet’s vibrations created a current in a nearby coil of wire through the principle of electromagnetic induction. There were many variations of the microphone developed in the late 1870s and 1880s. All were intended to improve the quality of telephone conversations. One important innovation was Thomas Edison’s 1878 discovery that a chunk of carbon could be used as a microphone. If wires and a battery were connected to the carbon in a circuit, the carbon conducted the current with a certain amount of resistance. That resistance would change slightly when the tiny vibrations of sound waves hit its surface. The change was enough to create a signal that could be fed into telephone wires and sent to a telephone receiver. Other inventors discovered ways to “modulate” a flow of electricity in this way, using electromagnets, capacitors, or resistors. One famous example was the use of a very lightweight coil of fine wire, attached to a diaphragm, in which a signal was induced by a stationary magnet. This was the famous “moving coil” designed by German inventors Siemens and Halske in 1877. The moving coil is still used today. However, the microphone was almost always used in telephones before the 1920s. Even after the phonograph appeared, recordings were not made with microphones for many years. The next wave of innovation came after the development of voice radio broadcasting, which was launched in many countries between 1915 and 1920. One of the earliest experimenters to broadcast voice by radio was Reginald Fessenden. Fessenden invented a type of microphone that could withstand the extremely high currents necessary to broadcast the voice in those days. His microphone could withstand a continuous flow of 15 amperes, but had to be surrounded by pipes carrying cool water to keep it from overheating. Bell Laboratories, as part of its ongoing research into sound, improved many forms of the microphone and introduced some new varieties. Bell Labs engineers improved the condenser microphone 1916, which was used in early talkies. Their “double button” microphone in 1920 was a variation of the telephone microphone, but was used widely in early radio stations in the early 1920s. The dynamic microphone of 1931 and the cardoid microphone of 1938 were later used in sound recording as were two important forms of capacitor microphone invented at RCA: the ribbon microphone of 1931 and the velocity microphone of 1932. In Europe, the most famous microphones of the day were condenser microphones designed by German engineer Georg Neumann. When Germany was split into Eastern and Western nations in the 1940s, Neumann microphones continued to be made in East Germany, and when the two countries were united almost half a century later, it was discovered that these classic designs were still in production. Many engineers consider the 1950s to be the peak of microphone design. Working examples of these older models are still highly sought by recording engineers today. Most of the later improvements in microphones related to their size rather than their sound quality. One example was the electret microphone. An electret is like a magnet, expect that it retains a permanent static electric field rather than a permanent magnetic field. The electret was discovered by Mototaro Eguchi in 1919, but was not used for microphones until about the 1960s, when James West and Gerard Sessler of Bell Labs invented the foil electret microphone. Since the 1970s, foil electrects have become the most widely used small microphones. Television, which became an international phenomenon after 1945, stimulated the demand for microphones small enough to be hidden on the body. Back in 1936, the CBS radio network in the United States introduced microphones small enough to be clipped to ones lapel at the 1936 Democratic National Convention. Today, microphones are small enough to be hidden inside tape recorders and computers.

http://www.ieeeghn.org/wiki6/index.php?title=Microphone&oldid=71840

2nd Grade Oral Language Resources Children will:• Learn about the concept of performances. • Access prior knowledge and build background about different kinds of performances. • Explore and apply the concept of how people perform to why people perform. Children will:• Demonstrate an understanding of the concept of performances. • Orally use words that describe ways that we can learn about different kinds of performances. • Extend oral vocabulary by speaking about why people perform. • Use key concept words [stage, actors, audience, crew, perform, Curtain Up!]. Explain• Use the slideshow to review the key concept words. • Explain that children are going to learn about: • What performance means. • Different kinds of performances. • What is and what is not a performance. • Why people perform. Model• After the host introduces the slideshow, point to the photo on screen. Ask children: What are the children in the photo doing? (dancing). How can you tell the children are performing? (sharing something with other people). • Ask children: What is your favorite kind of performance? (answers will vary). • Say: It can be scary to perform in front of people. You might feel shy. It can also be a lot of fun! What sounds fun about performing? (sharing a song, a dance, or a play; performing for family and friends). Guided Practice• Guide children through the next four slides, showing them the different parts of a theater performance. Always have the children describe what the people are doing in the photos. Apply• Have children play the games that follow. Have them discuss with their partner the different topics that appear during the Talk About It feature. • After the first game, ask children to talk about other kinds of performances they can think of and help the children learn more about the kinds of performances they are interested in. After the second game, have them discuss what part of a performance they would like to be involved in. Close• Ask children: What is the best performance you have seen? Explain. • Summarize for children that performing can be fun! We can perform by sharing something with other people. We can share a song, a play, or a dance. Encourage children to think about what part they would like to play in a performance.

http://treasures.macmillanmh.com/alabama/teachers/resources/grade2/oral-language-resources/resource/curtain-up

What Is Character Ed, Anyhow? Character education involves teaching children about basic human values including honesty, kindness, generosity, courage, freedom, equality, and respect. The goal is to raise children to become morally responsible, self-disciplined citizens. Problem solving, decision making, and conflict resolution are important parts of developing moral character. Through role playing and discussions, students can see that their decisions affect other people and things. The State Legislature and the Governor enacted a law in 2001 that requires instruction in civility, citizenship and character education. The Greater Johnstown School District and Glebe Street Elementary School strive to comply with State law and continuously work to further develop and strengthen the character The Glebe Shared Decision Making team has adopted the "six pillars" model for its character education program. Those very pillars that support the character building that we strive for are represented through colors and positive character traits (Respect, Responsibility, Trustworthiness, Caring, Fairness, and Citizenship). All six pillars combined represent Panther The picture above shows our newly encased structural pillars that represent the positive character traits (pillars) that we work so hard to model each day at Glebe Street Elementary School. (top of page)

http://www.johnstownschools.org/glebe/GlbeCharacterEd.htm

This broadside lists the requirements that the Virginia Constitution of 1902 imposed on men who wished to register to vote. As in most of the other southern states, many white men in Virginia were intent on reducing the number of African American men who voted and held public office, and they had engaged in violence, intimidation, and corruption to prevent African Americans and Republicans from voting or winning elections during the 1880s and 1890s. In 1901 the General Assembly authorized a convention to draft a new constitution that would, among other things, restrict the vote to white men without violating the terms of the Fifteenth Amendment, which prohibited states from denying the vote to any man because of his "race, color, or previous condition of servitude." The Constitution of 1902 disenfranchised about 90 percent of the black men who still voted at the beginning of the twentieth century and nearly half of the white men. The number of eligible African American voters fell from about 147,000 in 1901 to about 10,000 by 1905. For the first elections to be held in 1902 and 1903 Civil War veterans and their adult sons and property owners who had paid at least $1 in property taxes during the previous year or who could give a reasonable explanation of any portion of the new state constitution were allowed to register and vote. After that, the article created an administrative structure and allowed the legislature to pass enabling laws designed to make it difficult or impossible for the average Virginian, black or white, to register to vote. The constitution required payment of a poll tax of $1.50 for each of three years preceding an election, meaning the effective exclusion from the ballot box of many poor black and poor white men. It also required each man who wished to vote to seek out a registrar and go through a complex process of registration and examination without any guidance from the registrar, giving the registrar an extraordinary amount of power to determine a man's eligibility to vote. The constitution also created electoral boards to oversee the conduct of elections and the certification of election returns. All of those officers except the locally elected collector of the poll tax were appointees of the local judge who in turn was elected by the General Assembly in which Democrats of white-supremacy beliefs had and expected to retain a more-than-comfortable majority. Virginia's poll tax remained in effect until the 1960s, when federal court decisions, the Twenty-Fourth Amendment to the United States Constitution, and the Voting Rights Act of 1965 made it illegal to deny the right to vote to any person who failed to pay the poll tax. The 1902 Constitution also required racial segregation in public schools. Fearful that voters who would be disenfranchised by the new constitution would vote against ratification, the convention proclaimed the constitution in effect as of July 10, 1902. It remained in effect until 1971, far longer than any other constitution of Virginia. 1. Who was allowed to vote under the Fifteenth Amendment? 2. What was the ultimate goal of the 1902 Virginia Constitution? 3. Were there any exceptions for voter registration under the 1902 Constitution? 1. Compare the restrictions and the roadblocks to black voting with tools employed by other southern states. How did Virginia's efforts compare? 2. Discuss the connection between voting rights and civil rights. Use examples from the Reconstruction era and the Civil Rights era to examine their impact on the franchise throughout Virginia's and America's history. 3. Compare the 1902 Virginia Constitution with the "First Virginia Constitution, June 29, 1776." Can you perceive differences in the framer's intentions? Holt, Wythe W., Jr. "The Virginia Constitutional Convention of 1901–1902: A Reform Movement Which Lacked Substance." Virginia Magazine of History and Biography 76, no. 1 (January, 1968) 67–102. Dinan, John J. The Virginia State Constitution: A Reference Guide. New York: Greenwood Publishing Co., 2006. Pulley, Raymond H. Old Virginia Restored: An Interpretation of the Progressive Impulse, 1870–1930. Charlottesville: University Press of Virginia, 1968, 66–91.

http://www.virginiamemory.com/online_classroom/shaping_the_constitution/doc/constitution_1902

I was talking to my granddaughter about the solar system and how planets and comets move in ellipses with the sun at one focus. I told her how you could draw an ellipse by sticking two pins in a sheet of paper both equidistant from and in line with the central point, placing a loop of string around them, and then by putting a pencil in the loop and keeping it tight, go right round. The pencil would thus draw the ellipse, each pin being at a focus. I then asked her to draw the biggest ellipse she could on a sheet of paper 50 centimetres long and 30 cm wide, and then to find the area of the rectangle she could inscribe in her ellipse whose longest side was equal in length to that of the shorter side of the original sheet. How far apart must she place the pins? How long was the string? What was the area of the inscribed rectangle? WIN £15 will be awarded to the sender of the first correct answer opened on Wednesday 20 February. The Editor's decision is final. Please send entries to Enigma 1733, New Scientist, Lacon House, 84 Theobald's Road, London WC1X 8NS, or to Answer to 1727 Common factors: The consecutive numbers are 17, 18 and 19 The winner Ivan Simmons of Edinburgh, UK If you would like to reuse any content from New Scientist, either in print or online, please contact the syndication department first for permission. New Scientist does not own rights to photos, but there are a variety of licensing options available for use of articles and graphics we own the copyright to. Have your say Only subscribers may leave comments on this article. Please log in. Only personal subscribers may leave comments on this article

http://www.newscientist.com/article/mg21729011.800

Strategies for Teaching English Learners and Students with Learning Disabilities As a researcher, I have always been interested in learning about the instructional strategies that work for students with learning disabilities, for English language learners, and for students in general. I began my search with Classroom Instruction That Works (Marzano, Pickering, & Pollock, 2001), a synthesis of research on strategies for students in general, and Classroom Instruction That Works with English Learners (Hill & Flynn, 2006). From these two sources, I went on to look for other effective strategies for students with learning disabilities that fit the following criteria: - The strategy should not be entirely new so that teachers don't feel overloaded. - The strategy has to be relatively easy to learn to keep time and professional development costs down. - The strategy should be able to be used frequently, if not daily. - The set of strategies should be interdependent; one strategy can facilitate the use of another one. In selecting strategies to highlight, I also noted the advice of special education experts (e.g., Winebrenner, 2006; Bender, 2008), as long as there was research-based evidence of a particular strategy's effectiveness for the general student population (Carr & Bertrando, 2012). Based on these criteria, I discovered six instructional strategies that research suggests are effective for native English speakers and English learners (Carr, Sexton, & Lagunoff, 2007; Carr et al., 2009). Unfortunately, research studies, especially those using rigorous experimental designs, are sparse about the effectiveness of these strategies for students with learning disabilities in the special or general education classroom. Here are the six instructional strategies that hold promise to work for the diversity of students in a general education classroom and form a cohesive practice. - Cues—hints, prompting questions, and (most important) advance organizers. - KWL—a publicly posted chart with three columns in which the teacher writes what students already know (K) and want to know (W) about a new topic before they begin a lesson; near the end of the lesson, the teacher writes what they have learned (L) in the third column. - Visuals—pictures, diagrams, charts, or other graphics (especially graphic organizers) that support oral instruction and reading long texts. - Think-Pair-Share—an activity in which students think individually for a brief time, discuss ideas in a pair or triad (perhaps while working on a task), and then offer ideas for consideration. - Think Aloud—a form of modeling in which teachers describe their cognitive processing (e.g., interacting with a text to derive meaning, exploring strategies to complete a math task, determining cause and effect in a science experiment). - Summarization—taking notes at key points during a lesson or providing summary statements orally or in writing to identify key concepts, connections between concepts, and supporting details. Six Strategies Scenario Although the research tends to treat these strategies separately, my observations led me to believe that these six strategies are most powerful and effective when used together in a cohesive practice. Let's see how a teacher might use them. Tony is an English language learner and a high school student with learning disabilities in a general education science class. In a unified practice that draws on all six strategies, the science teacher must first know something about her students. To help with this, the special education teacher tells the science teacher that Tony needs visuals to support oral instruction. On a personal survey that the science teacher gave on the first day of class, Tony indicated that he mostly thinks in pictures, "like professor Temple Grandin," he noted, having read part of her book (Grandin, 1995). He also indicated that his top interests are cars, weather and earthquakes, and Boy Scouts. The teacher starts a unit on magnetism and electromagnetism with an advance organizer. She states orally and uses a PowerPoint slide to show what she expects her students to learn. Using a form of KWL, the teacher reminds students that they learned about magnets in middle school and asks what properties they can recall. She directs them to use Think-Pair-Share and intermittently shows pictures and illustrations on PowerPoint slides as cues to help them recall facts. While looking at a slide illustrating the magnetic poles of the Earth, she whispers to Tony, "You are a Boy Scout, and Boy Scouts use a compass when hiking. Look at this slide. What does a compass have to do with the Earth? If you think of an answer, share it in your group." During whole-class sharing, the teacher writes facts and misconceptions in the K column of the KWL chart. She remarks, "We will explore magnetism and find out which of these ideas are facts and which are not true." This scenario is just the start of a lesson, and the teacher has already combined four of the six strategies: three types of cues (an advance organizer, slides, and a prompting question personalized for Tony), visuals to support oral instruction and give hints, Think-Pair-Share, and the first part of a KWL chart. The teacher uses Think Aloud to make explicit how proficient readers interact with text to comprehend key ideas, find evidence, and make connections, such as cause-and-effect, inferences, and generalizations. She asks struggling readers to use the same process as they read aloud to the teacher or in small groups. The science teacher might say, "I don't quite understand all the words and ideas in this paragraph, so I look in the page margins and I see short definitions and pictures as examples." A student with autism spectrum disorder may not have noticed "the stuff" in the margins or made the connection to words or parts in the text. A student who "thinks in pictures" gains insight into how the teacher and other students think in words. Tony's teacher is aware that his social skills and expressive language are weak, so she uses Think Aloud to model expected interactions in a small group and places arrows beside certain discussion sentence starters (Carr & Bertrando, 2012; Kinsella, 2007) on a wall chart that students are expected to use during the group discussion. Summarization is embedded in the "L" part of the KWL strategy. Students are taught alternative ways to take notes (e.g., traditional outline format, graphic organizer) so that each student can choose an appropriate method. English learners and students with learning disabilities might be given a notes template with sentence frames so that they are actively engaged in constructing new knowledge and not thwarted by lack of language or writing skills. The teacher can pause at key points during direct instruction so that all students can write notes individually or in pairs. Pausing signals that a key idea has been stated and helps students avoid the frustration of writing one idea while listening to a new idea. Putting the Strategies to the Test Although research and experts support each of these six strategies as being useful for a diversity of learners, no study has examined a possible synergistic effect of their combined implementation. Nonetheless, I contend that these six strategies could serve as a core set of practices among teachers to provide a foundation for the science of teaching and still allow ample time for the art of teaching, which may include adding other strategies, techniques, and tools. These strategies would also be ideal as Tier I interventions in a school that is implementing Response to Intervention. Bender, W. N. (2008). Differentiating instruction for students with learning disabilities. Thousand Oaks, CA: Corwin Press. Carr, J., & Bertrando, S. (2012). Teaching English learners and students with learning difficulties in an inclusive classroom. San Francisco, CA: WestEd. Carr, J., Carroll, C., Cremer, S., Gale, M., Lagunoff, R., & Sexton, U. (2009). Making mathematics accessible to English learners: A guidebook for teachers. San Francisco, CA: WestEd. Carr, J., Sexton, U., & Lagunoff, R. (2007). Making science accessible to English learners: A guidebook for teachers. San Francisco, CA: WestEd. Grandin, T. (1995). Thinking in pictures: My life with autism. New York, NY: Vintage Books. Hill, J. D., & Flynn, K. M. (2006). Classroom instruction that works for English language learners. Alexandria, VA: ASCD. Kinsella, K. (2007). Language strategies for active classroom participation. Retrieved from http://www.sccoe.org/depts/ell/kinsella.asp Marzano, R. J., Pickering, D. J. & Pollock, J. E. (2001). Classroom instruction that works: Research-based strategies for increasing student achievement. Alexandria, VA: ASCD. Winebrenner, S. (2006). Teaching kids with learning difficulties in the regular classroom. Minneapolis, MN: Free Spirit Publishing. John Carr is a senior research associate at WestEd. ASCD Express, Vol. 8, No. 2. Copyright 2012 by ASCD. All rights reserved. Visit www.ascd.org/ascdexpress.

http://www.ascd.org/ascd-express/vol8/802-carr.aspx

Science State Standards Standard 3-1: The student will demonstrate an understanding of scientific inquiry, including the processes, skills, and mathematical thinking necessary to conduct a simple scientific investigation. 3-1.1 Classify objects by two of their properties (attributes). 3-1.2 Classify objects or events in sequential order. 3-1.3 Generate questions such as “what if?” or “how?” about objects, organisms, and events in the environment and use those questions to conduct a simple scientific investigation. 3-1.4 Predict the outcome of a simple investigation and compare the result with the prediction. 3-1.5 Use tools (including beakers, meter tapes and sticks, forceps/tweezers, tuning forks, graduated cylinders, and graduated syringes) safely, accurately, and appropriately when gathering specific data. 3-1.6 Infer meaning from data communicated in graphs, tables, and diagrams. 3-1.7 Explain why similar investigations might produce different results. 3-1.8 Use appropriate safety procedures when conducting investigations. Habitats and Adaptations Standard 3-2: The student will demonstrate an understanding of the structures, characteristics, and adaptations of organisms that allow them to function and survive within their habitats. (Life Science) 3-2.1 Illustrate the life cycles of seed plants and various animals and summarize how they grow and are adapted to conditions within their habitats. 3-2.2 Explain how physical and behavioral adaptations allow organisms to survive (including hibernation, defense, locomotion, movement, food obtainment, and camouflage for animals and seed dispersal, color, and response to light for plants). 3-2.3 Recall the characteristics of an organism's habitat that allow the organism to survive there. 3-2.4 Explain how changes in the habitats of plants and animals affect their survival. 3-2.5 Summarize the organization of simple food chains (including the roles of producers, consumers, and decomposers). ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~Earth's Materials and Changes Standard 3-3: The student will demonstrate an understanding of Earth's composition and the changes that occur to the features of Earth's surface. (Earth Science) 3-3.1 Classify rocks (including sedimentary, igneous, and metamorphic) and soils (including humus, clay, sand, and silt) on the basis of their properties. 3-3.2 Identify common minerals on the basis of their properties by using a minerals identification key. 3-3.3 Recognize types of fossils (including molds, casts, and preserved parts of plants and animals). 3-3.4 Infer ideas about Earth's early environments from fossils of plants and animals that lived long ago. 3-3.5 Illustrate Earth's saltwater and freshwater features (including oceans, seas, rivers, lakes, ponds, streams, and glaciers). 3-3.6 Illustrate Earth's land features (including volcanoes, mountains, valleys, canyons, caverns, and islands) by using models, pictures, diagrams, and maps. 3-3.7 Exemplify Earth materials that are used as fuel, as a resource for building materials, and as a medium for growing plants. 3-3.8 Illustrate changes in Earth's surface that are due to slow processes (including weathering, erosion, and deposition) and changes that are due to rapid processes (including landslides, volcanic eruptions, floods, and earthquakes). Heat and Changes in Matter Standard 3-4: The student will demonstrate an understanding of the changes in matter that are caused by heat. 3-4.1 Classify different forms of matter (including solids, liquids, and gases) according to their observable and measurable properties. 3-4.2 Explain how water and other substances change from one state to another (including melting, freezing, condensing, boiling, and evaporating). 3-4.3 Explain how heat moves easily from one object to another through direct contact in some materials (called conductors) and not so easily through other materials (called insulators). 3-4.4 Identify sources of heat and exemplify ways that heat can be produced (including rubbing, burning, and using electricity). Motion and Sound Standard 3-5: The student will demonstrate an understanding of how motion and sound are affected by a push or pull on an object and the vibration of an object. (Physical Science) 3-5.1 Identify the position of an object relative to a reference point by using position terms such as “above,” “below,” “inside of,” “underneath,” or “on top of” and a distance scale or measurement. 3-5.2 Compare the motion of common objects in terms of speed and direction. 3-5.3 Explain how the motion of an object is affected by the strength of a push or pull and the mass of the object. 3-5.4 Explain the relationship between the motion of an object and the pull of gravity. 3-5.5 Recall that vibrating objects produce sound and that vibrations can be transferred from one material to another. 3-5.6 Compare the pitch and volume of different sounds. 3-5.7 Recognize ways to change the volume of sounds. 3-5.8 Explain how the vibration of an object affects pitch. All SC science standards can be accessed through the following website:

http://www.saludaschools.org/Page/625

How it Plays Make a simple fishing pole by attaching about 5 feet of string to one end of a 2- to 3-foot-long stick. Tie a U-shaped magnet to the end of the string. Separate magnetic numbers or letters so they aren't sticking together, then fill a dishpan or soup pot three-quarters full with water. Drop in the numbers or letters, a few at a time. You might want to start with the letters in your child's name or the numbers she already knows. Then let your child fish for them with her new pole. As she pulls out each one, ask her to identify what she's caught. Turn it into a game by challenging her with questions: "Can you catch the first letter of your name?" "What letter comes next?" "Can you catch a 3?" "What other numbers do you want to catch?" Then take a turn and see what you can catch. What You'll Need Learning and Growing Children at this age are starting to recognize that the world is full of symbols. Fishing for magnetic letters and numbers invites your child to explore her growing understanding of these important symbols.

http://www.pampers.com/fishing-for-magnetic-letters

What is Coal Seam Methane? Methane (CH4) is a gas formed as part of the process of coal formation – coalification. When coal is mined methane is released from the coal seam and the surrounding disturbed rock strata. Methane can also be released as a result of natural erosion or faulting. The methane content in coal seams generally increases the deeper the seam, and also with age. As the depth of the coal seam increases, so does the pressure level. This in turn reduces the level of permeability, causing the methane to be much more tightly bound to the coal and surrounding rock strata. Underground mining can therefore produce substantially greater levels of methane than surface mining. In fact, underground mines account for the overwhelming majority (up to 90%) of all methane emissions from the coal sector. |Depth Interval (metres)||Mean methane content (cubic metres per tonne of coal)| Source: IEA CCC 2005 Methane is highly combustible – its release can have serious implications for the safety of mine operations. It is also a potent greenhouse gas (GHG) – 23 times more harmful than carbon dioxide (CO2). Tackling methane emissions is therefore an important step in meeting the challenge of climate change and in ensuring the safety of mining operations. Methane can also act as a valuable source of energy- it is the principal constituent of natural gas - allowing countries to further diversify their energy supplies. Why Recover Methane from Coal Seams? There are three main drivers for the recovery of methane from coal seams. Methane is released during the process of extracting coal in both surface and underground mining. The released methane then mixes with air, which becomes highly explosive if methane concentration levels reach 5-15%. Methane explosions are devastating, causing significant loss of life and damage to property. There is significant industry effort to prevent these accidents occurring. The risk of explosion is a particular problem in underground mines, where providing a sufficient level of ventilation air is essential. Failure to provide enough air to dilute the methane below the 5-15% range can put miners at risk due to the threat of explosion. In surface mining, the released methane is heavily diluted by its immediate exposure to air and therefore the risk of explosion is minimal. Methane explosions in underground mines cause a large number of deaths around the world each year. While these numbers are still too high, they have been falling year on year in recent times as awareness of the hazards of methane has increased and methane recovery technologies have been improved and deployed on a wider scale. (2) Reducing Greenhouse Gas Emissions The recovery of methane released during coal mining plays an important role in global efforts to reduce GHG emissions and mitigate climate change. Methane is one of five greenhouse gases covered by the Kyoto Protocol and this provides opportunities for countries to meet their obligations under Kyoto by undertaking projects that reduce methane emissions from coal mining activities. These projects can be developed domestically or in host countries under the Protocol’s Clean Development Mechanism (CDM) and Joint Implementation (JI) scheme. The global warming potential (GWP) of methane is 23 times greater than that of CO2, which means that for a given volume of methane emitted, the resulting global warming effect will be 23 times stronger over one hundred years compared to the same volume of CO2. Methane remains in the atmosphere for a period of approximately 12 years after it has been emitted. In comparison, CO2 is estimated to have an atmospheric lifetime of 50-200 years. The differences in the GWP and atmospheric lifetimes of methane and CO2 means that methane has a relatively large global warming effect over a short period of time, whereas CO2 has a relatively small global warming effect but over a much longer period of time. Coal mining is an important anthropogenic source of methane emissions. Although agriculture accounts for by far the largest proportion of methane emissions from human activities, emissions from all coal mining related activities - extraction, transport and storage - accounted for around 8% of total global anthropogenic methane emissions in 2006. Global Methane Emissions from Human Activities (2006) Source: M2M 2006 (3) Energy Generation Methane is a valuable energy resource; 70-90% of natural gas is methane (with the rest being made up of ethane, propane, butanes, pentanes and higher molecular weight hydrocarbons, elemental sulphur, and sometimes helium and nitrogen). Coal seam methane therefore provides a useful ‘unconventional’ source of natural gas. Coal seam methane resources are distributed differently to the ‘conventional’ natural gas found in natural gas fields. This allows countries with restricted access to natural gas but plentiful coal supplies to utilise alternative sources of natural gas. Coal seam methane of a high quality (typically with a concentration level of over 93%) can be fed into the existing gas pipeline network to supplement or replace conventional natural gas. The United States has been utilising vast quantities of coal seam methane in its natural gas supply since the early 1990s. This can be supplied directly to homes and businesses for use in cooking and heating. Coal seam methane can also be utilised to replace or supplement conventional natural gas in electricity generation systems such as gas turbines and gas engine systems. These systems are often deployed directly on mine sites to provide auxiliary power to the mines themselves. How is Coal Seam Methane recovered? A range of technologies are available to recover methane from coal and these can be broken down into three categories. (1) Coal Bed Methane (CBM) Methane recovered from un-mined coal seams. The coal seams may be mined in the future but this is largely dependent upon geological factors such as coal depth and quality. (2) Coal Mine Methane (CMM) Methane recovered during mining activities as the coal is in the process of being extracted and thus emitting significant quantities of the gas. (3) Abandoned Mine Methane (AMM) Methane recovered from mines that have been abandoned following the completion of mining operations. Significant amounts of methane may remain trapped in the mine or may continue to be emitted from openings.

http://www.worldcoal.org/coal/coal-seam-methane/

This large depiction of Confucius (Kung Fu-tzu ), one of the great cultural heroes of Chinese history, was most likely used in a temple or at an altar dedicated to his system of thought. Confucius was born at Ch'u-fu (Shantung Province), their capital of the state of Lu in 551 B.C. After spending much of his life travelling from state to state seeking a ruler who would adopt his principles of government, he returned to Ch'u-fu and spent many years teaching disciples until his death in 479 B.C. A great political and social thinker, his ideas, writings and moral precepts were codified and provided a basis for Chinese societal and government organization for over 2000 years. Confucian temples used to be found throughout China and the official worship of the great sage was carried out on the spring and autumn equinoxes. Many surviving portraits of Confucius are stereotypical representations similar to this one. They feature a bearded Confucius with clasped hands and a placid expression, attired in formal court robes.

http://www.artsconnected.org/resource/94920/portrait-of-confucius-gallery-label-current

Glaciers Help to Shape Mount Rainier The modern glaciers that grace the slopes of Mount Rainier are much smaller descendants of the vast ice masses that repeatedly overwhelmed the Cascade Range during Pleistocene time. Extensive glaciation in this region both preceded and followed the development of Rainier's modern cone, 500,000 years ago. At times of glacial maximum, ice volumes filled valleys to the brim and extended for more than 100 km (60 mi) down channel into the lowlands surrounding Mount Rainier. Since the Little Ice Age (A.D. 1250 to mid-1800'a), the glaciers have been receding and ice volumes decreasing. Today, 25 glaciers cover 92 km2 (35 mi2) of the volcano, and they are the headwaters for five major rivers, including some that provide water for hydroelectric power and irrigation. Major Glacial Periods Hayden Creek (~170 to 130 ka) Icecaps covered the high elevations of Mount Rainier during this period of alpine glaciation. Long valley filling glaciers flowed down the Cowlitz River channel to a distance of about 105 km (63 mi) and down the Nisqually River valley 48 km (30 mi) to the west end of Alder Lake. Within present day Mount Rainier National Park, Hayden Creek till was found on a ridgetop that is 600 m (nearly 2000 ft) above the adjacent valley floor – these upland valley glaciers were extremely thick. Evans Creek (22 to 15 ka) Glaciers were substantially smaller in the Cascade Range during Evans Creek time than they were during the preceding Hayden Creek glaciation. Although icefields or an icecap covered the slopes of Mount Rainier and parts of nearby mountains, glaciers away from the volcano were wholly confined within valleys. From origination point on Mount Rainier, these valley glaciers extended for 64 km (38 mi) down the Cowlitz, 30 km (19 mi) down the Nisqually, 38 km (24 mi) down the White, and about 26 km (16 mi( down obth the Puyallup and Mowich river valleys. From the late Pleistocene (12 ka) to the end of the Little Ice Age (mid-1800's) several glacial advances, much smaller than Hayden and Evans Creek periods, occurred at Mount Rainier. The McNeeley Drift includes two sets of moraines dated at approximately 11,300 and 9,500 years old. The Little Ice Age is the most recent episode of several periods of renewed glacial advances that have occurred during the last 10,000 years. Influence of glaciers on Mount Rainier topography Glaciers mantled Mount Rainier for most or all of its 500,000-year lifespan. Many lava flows that erupted during ice ages were unable to melt entirely through the thick, valley-filling ice, and instead chilled and hardened beside it. With continued eruptions, lava flows would skirt the margin of the valley- filling glacier, advancing only where ice was thin or absent. As the glaciers retreated, and the valleys emptied of ice, lava flows were left perched high on the sides and crests of ridges, much like docks stranded along the former shores of a shrinking lake or reservoir. This process accounts for why lava flows cap many of the ridges radiating from Mount Rainier, instead of filling the deep valleys. Today’s glaciers are too small to exert much control on the movement of lava. Instead, eruptions of lava and of pyroclastic flows will melt snow and ice, causing destructive lahars. The Ricksecker Point lava flow, which erupted 40,000 years ago, was important for developing understanding that glaciers directed the courses of lava flows at Mount Rainier. Canyons 250 m (800 feet) deep flank Ricksecker Point on the north and south, but 40,000 years is too brief to excavate to such depths by erosion. Impoundment of the lava flow against thick glaciers that filled the valleys to the north and south, followed by emptying of the canyons during ice retreat, provides an explanation for the great depth of the flanking canyons despite the relative youth of the lava flow. One of the biggest pieces of evidence for understanding that Mount Rainier's lava flows followed ridges adjacent to valley filling glaciers are large horizontally oriented columnar joints along the margins of lava flows. The orientation of these columns suggests that lava cooled laterally rather than from the upper and lower margins of a lava flow.

http://volcanoes.usgs.gov/volcanoes/mount_rainier/mount_rainier_geo_hist_77.html

This term we are working on place value, ordering numbers and addition / subtraction. We will also continue our work with multiplication tables to improve the pupil's grasp of these for rapid application in our daily activities. Activities for you to do We have added lots of online videos and resources to compliment our work on fractions, decimals and multiplication. Please take some time to go through these and have some fun whilst you learn. Learn: Read about multiplication and division on this KS2 Bitesize page Try the videos and games that we have added in the left hand menu

http://clc2.uniservity.com/GroupHomepage.asp?GroupId=20218822

Wikipedia uses the following definition of plot: A plot is a graphical technique for presenting a data set drawn by hand or produced by a mechanical or electronic plotter. It is a graph depicting the relationship between two or more variables used, for instance, in visualising scientific data. Plots help greatly in visualizing the structure of your data, or the outcome of an analysis. Good plots yield insight into the data, which is often hard to gain from just looking at the numbers. R roughly has three separate systems which provide plotting facilities: - Base plot: these are the plot routines standardly available in R. The syntax works roughly equivalent to MATLAB. The first one creates a plot, then additional calls to, for example, linesadds additional graphical features to the plot. lattice: which provides an implementation of Trellis graphics (S-PLUS) for R. ggplot2: a loose implementation of the grammar of graphics for R.

http://stackoverflow.com/tags/plot/info

Towed diver surveys, or towboard surveys, is a survey method coral researchers use to assess relatively large areas of reef habitat. How it Works This reef assessment method is primarily used by our researchers in the Pacific. The NOAA-certified SCUBA divers can safely utilize this method at depths up to 90 ft below the surface; if visibility is good, they can assess deeper reefs without having to go deeper themselves. How does it work? Envision waterskiing on your stomach—underwater. Typically, two divers are towed behind a small boat that is moving at a velocity of 1-2 mph. The divers can actively maneuver the “towboards” they are holding onto so that they maintain a relatively constant elevation above the surface of the reef and avoid any obstacles in their path. One of the two towboards is equipped with a digital videocamera that is positioned facing forward while the other towboard is equipped with a digital videocamera that faces down to the ocean floor. Both towboards are equipped with a SEABIRD sensor that records depth and water temperature every 5 seconds. A GPS unit on the boat records the path over which the divers, and recording cameras, are being towed. A complete towboard survey is 50 minutes in length, and covers close to two miles of reef! [a] What Data is Collected The forward-facing camera is used to record the three-dimensional topography of the reef, as well as the fish associated with the reef. The downard-facing camera records the benthos—the community of organisms which live on, in, or near the seabed—over which the diver and camera are being towed. Computer analysis of the video allows researchers to quantify the percent cover of different components of the reef ecosystem. The genus and sometime species of the corals and algae on the video can sometimes be identified. The SEABIRD sensor data allows researchers to link the visual data with physical parameters in the environment above the reef and the GPS allows the recordings to be linked to geographic position. [a]

http://coralreef.noaa.gov/aboutcorals/facts/coral_towboard.html

In fourth grade, students are expected to know basic multiplication and division facts from memory. They should be mastering addition, subtraction, multiplication, and division of large numbers. Expanded notation is a part of the fourth grade mathematics curriculum. This involves place value and demands that students identify the value of a given digit in numbers from hundredths to millions. For example: 4,637 is 4000 + 600 + 30 + 7 Fourth graders are expected to multiply by multiples of 10, 100, and 1,000. At the very least, they will be expected to multiply a 3-digit number by a 1-digit number. They will, also, be able to solve division problems with a 1-digit divisor and a 3-digit dividend with and without remainders. Use of fractions will be an important part of fourth grade math work. Students will work with fractions whose denominators include anywhere from 2 to 1,000. They will compare and order fractions to hundredths and locate fractions on a number line. They will be able to recognize that two fractions are equivalent or non-equivalent and will add and subtract fractions. Decimals through the hundredths are part of the fourth grade curriculum. Students are asked to describe and compare fractions and decimals. The following are the California Fourth Grade Mathematics Standards. They indicate what your child should know and be able to do by the time he/she leaves Fourth Grade. I have included them because they are specific, rigorous, and reflect the Fourth Grade mathematics standards of the National Council of Teachers of Mathematics (NCTM). If you would like to know what your state’s mathematics standards include, your child’s teacher or school will be glad to give you a copy.

http://www.mathgamesandactivities.com/fourth-grade-math-expectations/

6 Written Questions 6 Multiple Choice Questions - an aversive stimulus, which decreases the frequency of the immediately preceding response; an aversive consequence that follows a voluntary behavior thereby decreasing the probability that the behavior will be repeated. - occurs when the conditioned stimulus, after being presented without the unconditioned stimulus, loses its predictive value. Eventually the conditioned stimulus no longer elicits the conditioned response. In operant conditioning, a response is extinguished when it is non longer reinforced. - reinforcement given after a variable number of behaviors are exhibited. (slot machine) - a reinforcement is given after some period of time which is changeable. (pop quizzes reinforce for studying done regularly) - a sudden grasp of new relationships that are necessary to solve a problem and was not learned in the past. The sudden appearance of (often creative) or awareness of a solution to a problem. - the stimulus that only after repeated pairings with the unconditioned stimulus causes a conditioned response that is similar to the unconditioned response 5 True/False Questions acquisition → learning involving an unpleasant or harmful unconditioned stimulus or reinforcer classical conditioning → learning that occurs when an active learner performs certain voluntary behavior and the consequences of the behavior (pleasant or unpleasant) determine the likelihood of its recurrence. (Skinner, Watson) fixed interval schedule → when reinforcement is applied within a set period of time (a paycheck which is given every week) stimulus generalization → occurs when an organism displays a conditioned response to a stimulus that is similar but not identical to the conditioned stimulus. stimulus discrimination → occurs when an organism displays a conditioned response to a stimulus that is similar but not identical to the conditioned stimulus.

http://quizlet.com/10908101/test/

Tulsa Riots of 1921: History Uncovered Students will perform a webquest on the Tulsa Riots of 1921 and other historic tragedies as well as perform comparisons. Critical thinking will allow students to develop a deeper understanding of tragedies and consider approaches to societal problems through discussion and presentation. Keywords: riots race discrimination Tulsa black wall street Students will analyze documents concerning the Tulsa Riots in order to develop an understanding of the event's historical influence. Students will identify and evaluate benefits and obstacles that arose during riots and other historic tragedies through the completion of WebQuests. Students will be able to successfully navigate various websites by utilizing search engines and homepages in search of facts. Students will be able to compile and organize facts concerning riots and other historic tragedies by visiting different websites in order to establish their own ideals concerning the events. Students will be able to compare the Tulsa Riots to other historic tragedies by browsing websites in instances of further research on the topics. Use research and inquiry skills to analyze American history using primary and secondary sources. (SS.912.A.1) Analyze the effects of the changing social, political, and economic conditions of the Roaring Twenties and the Great Depression. (SS.912.A.5) Demonstrate an understanding of the origins and purposes of government, law, and the American political system. (SS.912.C.1) Evaluate the roles, rights, and responsibilities of United States citizens and determine methods of active participation in society, government, and the political system. (SS.912.C.2) Understand how to use maps and other geographic representations, tools, and technology to report information. (SS.912.G.1) The teacher should: 1. input the websites into a computer before starting the lesson for ease of access 2. read and view materials within the attachments: excerpt, map, webquest, and exit pass 3. prepare copies of the WebQuest for students 1. Students will participate in a photo analysis of a picture from the Tulsa Riots of 1921 (see first website attached). Teacher-directed spiral-questioning will ensue throughout the analysis: What do you see in the picture? Where might this have occurred? Provide evidence to support your idea. What might have caused the scene to look this way? How do you think the person in the picture feels? 2. In order to provide students an understanding of what caused the destruction in the photograph the teacher will read an excerpt (see second attached website) from a related source aloud to the class. 3. Based on the students' newly acquired knowledge of the event, the teacher will then display the original photograph and again ask students similiar questions (Why does the scene look this way? How do you think the man in the photograph feels? What do you think this man will do today, tomorrow?) 4. To familiarize students with the location of the event, the teacher will display a detailed map (see third attached website) and point out the location of Oklahoma in relation to the rest of the United States and then focus in on Tulsa. 5. To complete the WebQuests, teacher will place students in pairs in front of computers or laptops. 6. Each pair of students will receive one WebQuest worksheet to complete (see attached PDF).The WebQuest handout will be read together in the class by both teacher and students for understanding and to address any possible questions. 7. Students will be assigned roles of “recorder of data” and “computer navigator” based on teacher discretion. These roles could be switched mid-way through the activity. 8. After information is found and recorded, the classroom will discuss the validity, organization, and utility of websites and information. 9. Students will be directed to visit the EASE History website. After reviewing the content, students will be instructed to choose one other event to compare to the Tulsa Riots. 10. Using the selected event and the Tulsa Race Riots, students will complete a Venn Diagram to compare and contrast the two Continuous informal assessment will occur through instructor observation of webquest completion and class discussion. Students will also be assessed through the completion of the exit assignment and venn diagram, as well as the list of websites found and recorded by the student. Possible Spiral Questions: 1. Was the information in which you were searching for on the site easy to find? Why or Why Not? 2. Were the websites organized in a user-friendly manner? Describe in your own words: 3. If you could change or add any content/images to any one of these sites, how would you go about these changes? Estimated Lesson Duration - Experience Acceleration Support Environment. Retrieved January 2010 Website: http://www.easehistory.org - Flicker Photo of Tulsa Riot Victim, Retrieved May 2011 - Website: http://www.flickr.com/photos/mfspeccoll/3427411245/in/set-72157616477359519/ - Florida Department of Education. Retrieved November 2007 - Website: http://www.fldoe.org/bii/curriculum/sss - Free Dictionary, Retrieved February, 2010 - Website: http://www.thefreedictionary.com - Montgomery College, Story of Tulsa Riots of 1921 - National Education Technology for Students. Retrieved November 2007 - Website: http://cnets.iste.org/students/s_stands.html - National Public Radio Online. Retrieved January 2010 - Website: http://www.npr.org - Oklahoma, 1920: map - Website: http://etc.usf.edu/maps/pages/1500/1556.pdf - Public Broadcasting Service. Retrieved February 2010 - Website: http://www.pbs.org - Subliminal Organization. Retrieved January 2010 - Website: http://www.subliminal.org/tulsa/#av - Tulsa-City County Library. African-American Resource Center. Retrieved February 2010 - Webquest-ExitPass.pdf 100.07 KB

http://etc.usf.edu/lplanner/view/80/

How to Raise a Reader In This Article: Children develop much of their capacity for learning in the first three years of life, when their brains grow to 90 percent of their eventual adult weight. When you talk, sing, and read to your child, links among his brain cells are strengthened and new cells and links are formed. Play is the work of your young children. From the first lullaby to dramatization of a favorite story, music and other creative arts can stimulate language and literacy development. You can help build pre-literacy skills through dramatic play and one-on-one interaction. Many pediatricians believe that a child who has never held a book or listened to a story is not a fully healthy child. Reading aloud to young children is so critical that the American Academy of Pediatrics recommends that doctors prescribe reading activities along with other advice given to parents at regular check-ups. Despite the considerable evidence of a relationship between reading regularly to a child and that child's later reading development, six in ten babies and five in ten toddlers are not read to regularly by parents or family members. More on: Activities for Preschoolers

http://school.familyeducation.com/preschool/school-readiness/38402.html

Island climates are variable, depending on the location, but temperature extremes are usually less than on the mainland because of the ameliorating effects of the ocean. Climates range from very wet to very dry depending on the wind regime and the presence of mountains, although the humidity is usually relatively high because of the proximity of the ocean even on islands that are dry because of their low rainfall. Seasonality is often less well defined than on the adjacent mainland. Soils are immensely variable, dependent in part on the origin of the island. Many are of volcanic origin, others sand or coral, and those on larger islands can be complex. Usually they are appropriate for the climate and vegetation, as in the major bioclimatic zones. On sufficiently large islands, the vegetation is characteristic of one of the major bioclimatic zones. On small islands, plant associations may be limited to the beach or strand vegetation types characteristic of the region. Very large islands, from Madagascar up to Australia, may have the full complement of bioclimatic zones appropriate for their latitude. Species diversity is always lower on islands than in comparable mainland environments. Extinction rates are dependent to some degree on island size and are relatively high on small islands because many populations are small. Immigration rates are dependent on distance from mainland or other island sources, with the probability of survival upon immigration dependent on presence of appropriate habitat, shelter, and food and abundance of predators and competitors. Diversity is somewhat increased in archipelagos (as opposed to single islands) because of speciation and recolonization opportunities. Oceanic islands exhibit a high degree of endemism, often with substantial adaptive radiation in relatively few groups. Island plant species tend to be adapted for dispersal, as these types are the ones that reach islands. Dispersal adaptations include wind-borne ballooning seeds (thistle type), water-borne seeds that can withstand salt-water immersion (coconut) or that can grow in salt water (mangroves), and bird-carried seeds, either stuck to feathers or in the digestive system. Beach adaptations are typical, including heavy seeds that won't blow away once deposited in sand. Additionally, there is much evolution toward loss of dispersal ability in groups once established--seeds become larger and less likely to balloon, float, or adhere to birds. The isolated nature of many islands has prompted much divergence in the species that reach them. There are many examples of evolution of woody species in families that are otherwise herbaceous (Compositae is a good example), presumably an adaptive shift from an early-succession dispersal ability to a stable residence in forest environments. Many animal adaptations are comparable to those of plants. Species typically show well-developed powers of dispersal; birds and flying insects are obvious examples, as are spiders, the young of which balloon into the air on threads, and lizards, the eggs of which are viable in driftwood. Once established on an island, there has been a tendency for reduction of flight powers to avoid being blown away from it; flightless insects and birds often evolve on islands. There may be major adaptive radiation from single immigrants, for example Hawaiian honeycreepers, Galapagos finches, and Madagascar lemurs. Australian plants and animals are the best examples of adaptive radiation on an island long separated from the continents. Islands, especially small ones, are very vulnerable to the negative effects of humans; human-caused extinction is much more likely there than on the mainland. Total habitat destruction is likely in circumscribed areas with human population growth. Many island plants and animals evolved in the absence of predators, thus the have no resistance to human hunters and introduced predators and herbivores such as cats, rats, pigs, goats, and mongooses. Even introduced parasites can have devastating effects, as for example malaria on Hawaiian honeycreepers. The Polynesians that successively colonized Pacific islands, including the Hawaiian Islands, extirpated substantial proportions of the native biota.

http://www.pugetsound.edu/academics/academic-resources/slater-museum/biodiversity-resources/world-biomes/characteristics-of-bioclimatic/islands/

Between 1830 and 1837, the Chickasaw negotiated four removal treaties and agreements. Ratification of the Franklin Treaty (1830), the Treaty of Pontotoc Creek (October 20, 1832), the Treaty of Pontotoc Creek (October 22, 1832), and the Articles of Convention and Agreement (1834) at Washington, which amended the latter, depended on the Chickasaw finding land in the West that suited them. Their searches were unsuccessful until 1837, when, in the Treaty of Doaksville (1837), they agreed to remove and occupy the westernmost district of the Choctaw Nation in present-day south central Oklahoma. Terms of removal were set down in the Pontotoc Treaty and the Washington Articles. While the Doaksville document confirmed removal, the Pontotoc treaties ceded all Chickasaw land east of the Mississippi and provided for allotments of land to heads of households, according to the number of people in the household, and to single men and orphan girls. Money from sale of surplus land would be used to pay expenses of land survey and sales, removal, and subsistence of the people for one year after removal. The treaty also provided for compensation for abandoned improvements on their homesteads when they removed. Land sales were to be public in an effort to prevent land speculation. Two years later, the Articles of Convention and Agreement addressed Chickasaw objections to some provisions of the Pontotoc Treaty. They adjusted the size of allotments for households, provided more generous allotments for orphans, and called for investing the money generated from sales of land that had not been allotted and use of the earnings from investments to pay for land survey and sales and removal. Individuals were to receive title to their allotments in fee simple, and when the allotments were sold at removal, the money would go to the individuals. The Articles also established a commission of seven Chickasaw leaders to oversee land sales and determine the competency of individuals to do business and therefore receive their money. While Chickasaw exploring parties searched for lands in the West, the Chickasaw received their allotments and awaited removal. Living under the civil and criminal laws of Mississippi and Alabama, which the states began to press in late 1828 and early 1829, they suffered from a loss of their tribal government, which was forbidden, and the social disruption that followed the influx of whites into their lands and the actions of American merchants, who encouraged the whiskey trade and sought to get the Chickasaw in debt. Removal began in the summer of 1837. Insistence on paying for their own removal gave the Chickasaw a good deal of independence that other tribes did not experience during removal. A good example is the first party of more than 400 Chickasaw, who removed for Sealey's District of the Chickasaw Nation in June and July 1837. Traveling overland to Memphis, the Chickasaw were supposed to take steamboats from there to Indian Territory. However, at Memphis they decided to travel through the Mississippi Swamp to Little Rock. There the government agent had assumed that they would travel up the Military Road to Fort Gibson and beyond. However, about 300 chose to cross the Arkansas River at Little Rock and go to Fort Towson. They traveled at leisure, going only 35 miles in two weeks, hunting and supplying their own needs. Summer was the "sickly" season in Arkansas, and some became ill, suffering primarily from fevers, but only a few died. The people were beset by horse thieves and whiskey dealers from the time they left Little Rock until they entered the Choctaw Nation near present-day De Queen, Arkansas. Although government agents threatened and cajoled them into a faster pace from time to time, the Chickasaw clearly controlled their own movements. The largest removal occurred in the fall of 1837, when an estimated 4,000 Chickasaw converged on Memphis. They, too, were supposed to go by steamboat from that point, but a majority of them chose, instead, to go overland. Water levels were good, and those who traveled by water reached Fort Coffee in about a week. Those who went by land passed through the Mississippi Swamp, crossed the St. Francis, and turned southwest to Mouth of Cache, known today as Clarendon. From there they crossed the Grand Prairie to Little Rock. From that point, most went up the Military Road to the Choctaw Agency and Fort Coffee while others took to the boats. No other large-scale removals occurred. Small groups removed in early 1838, choosing for the most part to travel by land, with other small parties following in 1838 and 1839. An estimated 1,000 Chickasaw moved on their own resources. By the fall of 1839, the vast majority of Chickasaw and their slaves (some 7,968) were in the West. The government "officially" closed Chickasaw removal in 1839, but the Chickasaw continued to arrive in the West as late as 1850. Unlike the other tribes, many of whose members were reduced to poverty by removal, the Chickasaw were deemed wealthy because of the money received from the sale of their land and because of their determination to take their personal property with them. Although government regulations allowed each person in other tribes to take only 30 pounds of personal property on the removal trail, the Chickasaw averaged more than 450 pounds. In addition, the Chickasaw drove great herds of livestock, including more than 7,000 horses. Thus they escaped many of the rigors of overland travel. Few Chickasaw walked; nearly all rode horses or traveled in wagons or other vehicles. The Chickasaw also experienced low mortality rates. They avoided epidemic diseases such as cholera that attacked other tribes and were vaccinated either on the trail or upon their arrival against smallpox, which was raging in the West at the time of their removal. For many Chickasaw, the most difficult times followed their arrival in the West. The subsistence rations system, established to help them during their first year, at times failed. The Chickasaw hoped that proceeds from land sales would benefit individuals by helping them bear the expenses of removal and reestablish themselves in the West, but many saw no immediate benefits. The federal government held the money of the so-called "incompetents" and orphans, who spent years attempting to obtain what was due them. The Chickasaw commissioners extended the ration period an extra seven months. Still, the people experienced hard economic times that led to a highly inflated credit economy, based on IOUs known as "due bills" issued by merchants in the Choctaw Nation. Throughout the removal period, the Chickasaw people maintained a remarkable sense of unity that the other southeastern tribes did not. For more than 20 years following 1834, the Chickasaw Commission acted as a de facto government for the Chickasaw. Consisting of the hereditary minko Ishtehotopa and six others, the body resembled the old Chickasaw hereditary form of government, preferred by most Chickasaw to the Choctaw system, under which they lived. Although the Chickasaw had a district chief and council members who represented them in the Choctaw national council, they considered the society and laws of the Choctaw too Americanized and sought a separation from them, which they achieved in a treaty in 1855. The Chickasaw were determined to reunite their people in the West. From 1839 onward, the Chickasaw Commission encouraged those Chickasaw who had remained east of the Mississippi to join them in the West, paying $30 per person to defray their expenses. Chickasaw removals on those terms continued at least until 1850. As a result, the Chickasaw were the only major tribe from the southeast who left no remnant tribe east of the Mississippi. Daniel F. Littlefield, Jr. Paige, Amanda, et al. Chickasaw Removal. Ada, OK: Chickasaw Press, 2010; Atkinson, James. Splendid Land, Splendid People. Tuscaloosa: University of Alabama, 2004; Foreman, Grant. Indian Removal. Norman: University of Oklahoma Press, 1972; Gibson, Arrell. The Chickasaws. Norman: University of Oklahoma Press, 1971; Hitchcock, Ethan. A Traveler in Indian Territory. Grant Foreman, ed. Cedar Rapids, IA: Torch Press, 1930.

http://www.historyandtheheadlines.abc-clio.com/ContentPages/ContentPage.aspx?entryId=1678706&currentSection=1678598&productid=43

This image illustrates how scientist measure a coral for size and growth rate. First, the edges of a structure are identified (a) and then the coral is digitally measured in pixels from the edge of a structure to the tip of the colony (b). The structure of known diameter is measured in pixels and then pixels are converted into centimeters (c). Distance “b” is divided by the number of years the structure has been submerged to get colony growth rate in centimeters per year. Division of coral length by the total number of years a structure is submerged assumes that the coal settled immediately after the structure was put in place. Because the coral may have settled at a later date, growth rate estimates using this method are always minimum growth rates. Image courtesy of Lophelia II 2012 Expedition, NOAA-OER.

http://oceanexplorer.noaa.gov/explorations/12lophelia/background/growth/media/measurement.html

Huge volcanic eruptions that occurred over the past 2 million years formed Yellowstone National Park’s striking landscape. Two eruptions from 1.2 million and 600,000 years ago ejected more than 1,000 cubic kilometers (240 cubic miles) of material each, making them among the largest volcanic eruptions known in the Earth’s geologic record. At the same time, the emptying of the magma chambers beneath Yellowstone created large surface depressions called calderas. The youngest caldera measures nearly 80 kilometers (50 miles) long by 50 kilometers (31 miles) wide. Thought by most geologists to be the current location of a “hot spot” of upwelling, hot material from Earth’s mantle, the continuing activity of the region is demonstrated by its geysers, hot springs, and boiling mud pots. This astronaut photograph is centered on Yellowstone Lake, a popular camping and fishing location within the National Park. The lake basin includes part of the youngest caldera and has an area of 352 square kilometers (136 square miles). Due to the rise and fall of resurgent domes (the locations of volcanic vents) located nearby, the lake basin is now tilted southwards, causing beaches to grow along the northern shore and flooding to occur in the southern arms of the lake. The West Thumb of Yellowstone Lake was formed by an eruption that occurred approximately 150,000 years ago. The resulting relatively small caldera was subsequently filled with water and joined with the larger lake to the east. Numerous geothermal features such as geysers and hot springs are located in the West Thumb area— this is thought to be due to a relatively shallow, local magma source. A more recent change to Yellowstone’s geography is the area covered by large fire scars— cleared areas burned during the vast 1988 forest fires. The scars are still highly visible 17 years later because the light-colored cleared regions contrast with the surrounding forest. Astronaut photograph ISS011-E-10575 was acquired July 15, 2005 with a Kodak 760C digital camera with an 180 mm lens, and is provided by the ISS Crew Earth Observations experiment and the Image Science & Analysis Group, Johnson Space Center. The International Space Station Program supports the laboratory to help astronauts take pictures of Earth that will be of the greatest value to scientists and the public, and to make those images freely available on the Internet. Additional images taken by astronauts and cosmonauts can be viewed at the NASA/JSC Gateway to Astronaut Photography of Earth. - ISS - Digital Camera

http://earthobservatory.nasa.gov/IOTD/view.php?id=5816

Diamonds are crystals of pure carbon that form under crushing pressures and intense heat. They mostly form in the Earth's mantle, the layer beneath the crust or surface layer, at a depth of about 150km. Cross-section of a kimberlite pipe (after Harlow (ed), The Nature of Diamonds, 1998) © CUP Diamonds that were formed deep inside the earth can be mined close to the surface. The earth's geological processes make this possible. From time to time, gas-rich magmas, or molten rock, force their way upwards from the mantle and erupt explosively at the surface. If they sweep through an area with diamonds in it, they pick them up along with any other minerals that are present. As it cools, the magma solidifies into carrot-shaped pipes, or sometimes thin dykes, of kimberlite rock. These are named after the place where the first pipe was discovered, in Kimberley, South Africa. The carrot-shaped pipes normally extend to depths of around 2.5km below the surface. The upper levels erode over hundreds of millions of years and expose any diamonds they are carrying.

http://www.nhm.ac.uk/nature-online/earth/rock-minerals/diamonds/diamond-formation/index.html

System of government in which the legislature comprises two houses. It originated in Britain (see Parliament), where eventually it served to represent the interests of both the common people and the elite and to ensure deliberation over legislation. In the U.S. the bicameral system is a compromise between the claims for equal representation among the states (each state is represented by two members of the Senate) and for equal representation among citizens (each member of the House of Representatives represents roughly the same number of people). Each house has powers not held by the other, and measures need the approval of both houses to become law. Many contemporary federal systems of government have bicameral legislatures. All U.S. states except Nebraska have bicameral legislatures. Seealso Canadian Parliament; Congress of the United States; Diet. Learn more about bicameral system with a free trial on Britannica.com.

http://www.reference.com/browse/Bicameral

Grade Range: K-12 Resource Type(s): Primary Source, Artifacts Date Posted: 5/6/2010 This sign was purchased by a North Beach second-hand shop from a proprietor in the neighboring Chinatown district of San Francisco. It is said to date from between 1890 and 1910. If that is so, the sign’s survival is quite miraculous: The 1906 earthquake in April of that year caused much damage throughout the city due to spreading wildfires. Residents of Chinatown grabbed what they could easily carry and evacuated the neighborhood ahead of the fires, taking up temporary residence in relief camps in San Francisco and Oakland. Relocating Chinatown permanently to Hunter’s Point or North Beach was discussed, but, with realization of the continued need for the tax base provided by foreign trade between the business community and Asia, Chinatown was ultimately rebuilt at its original location and continued to be not only a major center for the Chinese American community but a popular destination for tourists to the present day. Translation of this shop sign would help to document a portion of the economic history of this neighborhood. It is likely that the language is Cantonese, the dialect used in Southern China, which was engaged in foreign trade long before military oppression and American labor recruitment in the mid-19th century brought immigrants to “Gun San” or the “Land of the Golden Mountain,” as the Cantonese referred to the West Coast of the United States. Not only did Chinese pan for gold in San Francisco. They labored excavating coal, mercury, and borax, building railway lines and tunnels, and working for fisheries and canneries throughout Far West. Economic depression in the late 1800s brought fear, discrimination, and violence to established Chinese communities. Successively restrictive acts of Congress prohibited further Chinese immigration beginning in 1882, with continuing restrictions of civil rights until the Immigration Law of 1965 eliminated such restrictions, bringing a new wave of migration to the United States from Asia. With dwindling opportunities to earn enough money to return home, Chinese Americans turned to such service industries as laundries and restaurants and specialized increasingly in trade abroad. But this sign also may have advertised availability of herbal medicines, foodstuffs, cookwares, or furnishings desired by the local Chinese American community, which, while changing in population, has survived in San Francisco to the present day.

http://historyexplorer.si.edu/themes/theme/?key=2

THE Andes should be a collection of molehills, according to some geoscientists, rather than one of the world's greatest mountain ranges. But two American researchers believe they understand how the 7000-kilometre-long South American mountain chain stays aloft. The crust of continental South America is relatively rigid in the east, but softer near its western edge. This is because heat and volcanism generated as the Nazca oceanic plate plunges into the Peru-Chile Trench, just off South America's west coast, soften the neighbouring rocks. As the western edge is held still and the eastern edge is pushed towards it, the western side pops up in a buckled ridge, forming the Andes. But what giant force pushes the Andes up? The main force driving the South American plate is thought to be "ridge push", which stems from the effect of gravity on the mid-Atlantic ridge, a few thousand kilometres off the east coast ... To continue reading this article, subscribe to receive access to all of newscientist.com, including 20 years of archive content.

http://www.newscientist.com/article/mg14920142.800-south-america-buckles-under-the-pressure.html

Rolling rubber bands stretch students Jul 27, 2010 If you roll an elastic band down a slope, you might be amazed at the range of shapes it takes as it gathers speed. While this may sound like a pointless pastime, three students in the US have devised a clever experiment that allows them to explain the complicated physics behind why the shape changes in an unexpected way. The project was inspired by Christophe Clanet while he was a visiting lecturer at the Massachusetts Institute of Technology. The work has earned Clanet – who is normally at Ecole Polytechnique in Paris – and his former students a publication in the prestigious journal Physical Review Letters. Clanet asked his students to come up with variations on Galileo's 17th century study of how a sphere rolls down an inclined plane. One group hit upon the idea of rolling flexible bands, which they made from vinyl polysiloxane. The bands were about 5 cm in diameter and Clanet describes the material as being similar to rubber but softer. Instead of using an inclined plane, the team rolled the bands at a constant speed by placing them inside a hollow drum that spins like a tumble dryer. Each rotating band was photographed from the side to determine its shape, which changed dramatically as the speed of rotation was increased. The team repeated the experiment with a number of rings with differing stiffness. When stationary or rotating at low speeds, the bands tend to be oval shaped with a slight sag in the middle cause by gravity. As the speed increases the sag becomes more pronounced creating two distinct lobes. At even higher speeds, the sag drops right down to touch the lower portion of the band (see figure). Energy trade off Clanet told physicsworld.com that the change in shape is caused by a trade-off involving the gravitational energy, energy of curvature, and rotational energy of the ribbon. Gravity tends to squash the band flat, but this increases the energy of curvature, which is at a minimum when the band is a circle. One might expect a spinning band to become more circular because of the centripetal force. However, Clanet and team have found that when the effect of the centripetal force is considered at all points along the band, the net effect is a downwards force in the middle of the band that increases the sag. Armed with this information, the team was able to successfully calculate the shapes of a number of different bands spinning at different speeds. While Clanet says that the main goal of the study was to inspire his students, the research has captured the imagination of at least one group of professional physicists who are busy trying to work out how long it takes a rotating band to go from a circular shape to its equilibrium peanut shape. He adds that the transition from oval to peanut shape is also seen in rolling water droplets and may also explain why blobs of lava sometimes solidify in lobed shapes. The work is described in Phys. Rev. Lett. 105 044301. About the author Hamish Johnston is editor of physicsworld.com

http://physicsworld.com/cws/article/news/2010/jul/27/rolling-rubber-bands-stretch-students

The past is the key to the future. When snow falls on polar ice sheets, in Greenland and Antarctica for example, air is trapped between the snowflakes. Year after year, the snow compacts under its own weight to become ice, and air is enclosed in small bubbles. These are the best atmospheric archives on Earth. By analysing the air enclosed in polar ice, we can reconstruct past changes in the atmosphere’s composition. We have reconstructed past methane (CH4) variations back to the Roman Empire period, and discovered that humans emitted significant amounts of methane 2,000 years ago. Nobel Prize winner in chemistry Paul Crutzen described the current geological period as the “Anthropocene”, or the human era. It started with the onset of the industrial revolution in the second half of the 19th century, when human-related emissions of atmospheric trace gases strongly increased. But did it really start then? For how long have humans influenced the composition of the atmosphere? A decade ago, famous climatologist William Ruddiman suggested humans influenced the climate much earlier than previously thought. Ruddiman’s hypothesis was criticised, but a few years later isotope measurements on methane trapped in polar ice cores indicated strong biomass burning – likely related to human activity – had increased atmospheric methane levels before the 16th century. The strength of isotope measurements is that they allow distinguishing variations in methane emitted from various sources. Indeed, every type of sources produces methane with a characteristic isotopic signature. Because methane is emitted by multiple sources, understanding its budget is not straightforward. These sources can be divided into three categories: biogenic, pyrogenic and fossil sources, with each category comprising both natural and anthropogenic methane emissions. Biogenic methane is formed by tropical and boreal wetlands, ruminants, rice paddies, landfills and waste water treatment. Pyrogenic emissions include biomass burning and the combustion of bio fuel. And fossil sources can be divided into two groups: fossil fuel and geological sources (methane formed deep in the Earth’s crust, which then travels upward through the sediment to the atmosphere). In order to better understand the contribution of the different methane sources to the atmospheric burden, we have analysed the methane isotopic signature on ice core samples from Greenland. These samples date back to the Roman empire period. Our results were interpreted with the help of atmospheric models. They show that the centennial-scale variations in isotope ratios can be attributed to changes in pyrogenic and biogenic sources. They also reveal several distinct periods of higher methane emissions from biomass burning within the last two thousand years. Variations in biomass burning coincided partly with climate variability (changes in temperature and precipitation), but also with changes in human population and land use. For example, the burning-related emissions decreased during the decline of the Roman empire and the Han dynasty, and increased during the population expansion of the Medieval period. This is attributed to increased deforestation during those periods, but also to the burning of wood for heating purposes and metallurgy. Heavy metals in dust were recorded in the sediment of several lakes in Asia and in Greenland ice. This shows metallurgy, especially to produce weapons and tools, was important during these periods. Further analysis of changes in land use was carried out by EPFL’s Atmosphere Regolith Vegetation group in Lausanne, Switzerland. Their results, together with the methane data, suggest that the long-term increase in methane concentration over the last two thousand years is caused at least partly by agricultural activities. For example, the development of rice paddies and irrigation of agricultural fields, thereby providing experimental evidence for the Ruddiman hypothesis. It seems humans had a global impact on the atmosphere long before industrialisation. The results of our study show a need to reconsider the benchmark of natural versus “anthropogenic” eras, while aiming to predict future climates.

http://world.edu/humans-did-affect-the-atmosphere-even-before-industrialisation/

Understanding Radiation: Scientific Basis of Nuclear Explosions - Attainment of Critical Mass in a Nuclear Weapon Because of the presence of stray neutrons in the atmosphere or the possibility of their being generated in various ways, a quantity of a suitable isotope of uranium (or plutonium) exceeding the critical mass would be likely to melt or possibly explode. It is necessary, therefore, that before detonation, a nuclear weapon should contain no piece of fissionable material that is as large as the critical mass for the given conditions. In order to produce an explosion, the material must then be made “supercritical,” i.e., larger than the critical mass, in a time so short as to preclude a sub-explosive change in the configuration, such as by melting. Two general methods have been described for bringing about a nuclear explosion, that is to say, for quickly converting a sub-critical system into a supercritical one. In the first method, two or more pieces of fissionable material, each less than a critical mass, are brought together very rapidly in order to form one piece that exceeds the critical mass (Fig. 1.52). This may be achieved in some kind of gun-barrel device, in which an explosive propellant is used to blow one sub-critical piece of fissionable material from the breech end of the gun into another sub-critical piece firmly held in the muzzle end. The second method makes use of the fact that when a sub-critical quantity of an appropriate isotope of uranium (or plutonium) is strongly compressed, it can become critical or supercritical as indicated above. The compression may be achieved by means of a spherical arrangement of specially fabricated shapes (lenses) of ordinary high explosive. In a hole in the center of this system is placed a sub-critical sphere of fissionable material. When the high explosive lens system is set off, by means of a detonator on the outside of each lens, an inwardly-directed spherical “implosion” wave is produced. A similar wave can be realized without lenses by detonating a large number of points distributed over a spherical surface. When the implosion wave reaches the sphere of uranium (or plutonium), it causes the latter to be compressed and become supercritical (Fig. 1.53). The introduction of neutrons from a suitable source can then initiate a chain reaction leading to an explosion.

http://www.undergroundbombshelter.com/bombshelter/understanding-radiation-scientific-basis-nuclear-explosion-attainment-critical-mass-nuclear-weapons.htm

The chloride test measures the amount of chloride in your blood. Chloride is a chemical your body needs for metabolism (the process of turning the food you eat into energy). It also helps keep your body's acid-base balance. The amount of chloride in your blood is carefully controlled by your kidneys. Your blood chloride level may be measured to check: This test may also be done to check certain medical treatments. Some medicines can cause the body's chloride level to go up or down. A small amount of blood is taken from your arm with a needle. The blood is collected in tubes and sent to a lab. Having this test will take just a few minutes. Ask your healthcare provider when and how you will get the result of your test. The normal blood chloride range for adults in most labs is 95 to 105 milliequivalents (mEq) per liter. The normal range may vary slightly from lab to lab. Normal ranges are usually shown next to your results in the lab report. Your blood level of chloride may be higher than normal if: Your blood level of chloride may be lower than normal if: Test results are only one part of a larger picture that takes into account your medical history and current health. Sometimes a test needs to be repeated to check the first result. Talk to your healthcare provider about your result and ask questions. If your test results are not normal, ask your healthcare provider:

http://www.everettclinic.com/CRS/aha/aha_schlorid_crs.htm

Mother Nature provided a surprise light show over Russia early on February 14. That’s when a major meteor entered Earth’s atmosphere. The object was originally 17 meters (55 feet) in diameter. That’s as wide as a 5-story building is high. It had also weighed a whopping 10,000 metric tons, according to the National Aeronautics and Space Administration (NASA). The meteor was traveling about 65,000 kilometers (40,000 miles) per hour. It created a brilliant streak as it traveled across the sky for nearly 33 seconds. The meteor then exploded about 20 to 25 kilometers (12 to 15 miles) above Earth’s surface. When the meteor exploded, it created a flash brighter than the sun. The explosion released nearly 500 kilotons of energy. That’s about 70 times as much energy as was released just a few days earlier when North Korea tested a nuclear bomb. NASA maintains an orbital debris office in Texas. It tracks anything that might damage satellites or knock them out of orbit. Asteroids and other rocky objects sailing through space are prime candidates. In fact, on the day the Russian meteor hit, NASA and a number of other space centers around the world had been tracking a very different space rock. Experts were watching for an asteroid called 2012 DA14, about 50 meters (164 feet) in diameter. It was due to pass very close to Earth — within 27,000 kilometers (about 16,800 miles) — later on the same day. While the scientists were watching for DA14, the meteor that broke up over Chelyabinsk, Russia, caught them by surprise. Astronomers rely on telescopes to view such objects approaching from space. But those objects must reflect sunlight for scientists to see them, Margaret Campbell-Brown explained to Science News. She’s an astronomer at Canada’s Western Ontario University in London. The Russian meteor approached Earth from a sunward direction. That means the sun’s reflection would be on the side of the meteor facing away from Earth. So it escaped detection until it began racing through Earth’s atmosphere. At that point, the meteor was impossible to miss. It created a fireball and multiple thunderous sonic booms. A special microphone network that picks up infrasound — sound below the threshold of human hearing — detected the incoming object long before anyone heard it. That infrasound pinpointed the breakup of the meteor just 32.5 seconds after entering Earth’s atmosphere. The meteor’s breakup created shock waves, heard on the ground as sonic booms. The shock waves collapsed walls and shattered windows. Glass went flying. An estimated 1,200 Russians suffered cuts and other injuries. NASA scientists estimate that a meteorite this big hits Earth about once every 100 years. This was the biggest to hit since a far larger meteorite hit in 1908. It also struck Russia. Most of the recent meteor disintegrated in the atmosphere. Some fragments certainly survived the fall to Earth. Usually only about 1 to 5 percent of a meteor’s mass is found on the ground in the form of meteorites, according to the Russian Academy of Sciences. atmosphere The envelope of gases surrounding Earth or another planet. debris Scattered fragments, typically of something wrecked or destroyed. Space debris includes the wreckage of defunct satellites and spacecraft. friction The resistance to movement that occurs when two things — solids, gases, liquids or a combination of two of these — are in contact. Friction generally causes a heating, which can damage the surface of the materials rubbing against one another. asteroid A small, usually rocky celestial body in orbit around the sun. meteor An asteroid or other small celestial body from outer space that enters Earth’s atmosphere. The friction of the atmosphere causes intense heating that will cause a meteor to at least partially burn up or break apart. As a meteor passes through the atmosphere, it appears as a streak of light. meteorite The remains of a meteor that reach the ground. orbit The curved path of an object or spacecraft around a star, planet or moon.

http://www.sciencenewsforkids.org/2013/02/meteor-explodes-over-russia/

Under the US Constitution, the federal government must conduct a census every 10 years. The population data gathered in each census is then used to equalize political representation through two processes: reapportionment and redistricting. Reapportionment is the process of reassigning the 435 seats in the US House of Representatives according to population. In December, after the US Census Bureau released its state-level data, eight states with significant population growth—including Texas, Arizona, Utah and Nevada—gained congressional seats. States where the population grew at a lower rate, mostly in the Northeast and Midwest, lost seats. (Despite its relatively high growth rate—13.2 percent—New Mexico did not gain a seat.) Redistricting is the process whereby each state redraws its congressional and local-government districts to absorb its new population. According to the US Constitution and Supreme Court rulings, political districts—which include everything from state legislative districts down to school board and city council districts—must be made up of approximately equal populations in order to ensure the principle of “one person, one vote.” If population growth occurs uniformly across a state, redistricting is easy: Districts remain roughly equal in population and require minimum adjustment. But that’s not what has happened in New Mexico, Sanderoff says. “The biggest challenge is that although New Mexico has grown by 13.2 percent in the last decade, the distribution of that population growth has not been even,” Sanderoff says. Instead, growth has been concentrated along the Rio Grande corridor—Santa Fe, Albuquerque and Las Cruces—while it has stagnated in the eastern part of the state. Since the number of state legislative seats is set at 112, districts with comparatively little population growth will have to expand in order to maintain populations equal to their faster-growing counterparts. “If there are 42 state senators and 70 state House seats, there’s going to be 42 and 70 when we’re all done,” Sanderoff explains. “It’s just that if the east side doesn’t get base population, it may end up losing a seat—and that seat may emerge in Rio Rancho.” In New Mexico, the state Legislature is responsible for redrawing state House and Senate seats, as well as New Mexico’s three congressional districts, and the Public Regulation Commission and state Board of Education districts. Local governments, Sanderoff says, are responsible for redrawing their own districts. In Santa Fe, the Board of County Commissioners, City Council and Santa Fe Public Schools Board of Education will redistrict in 2011, either by using their own staffs or by contracting with a company like Research & Polling. Officially, redistricting can’t begin until the Census Bureau releases precinct-level data, which is scheduled to happen on or before April 1. And although Sanderoff says it’s hard to know exactly which districts are at stake until that data comes in, legislators, lobbyists and party veterans are quietly preparing for battle.

http://www.sfreporter.com/santafe/article-5855-redrawing-new-mexico.html?current_page=2

Pub. date: 2008 | Online Pub. Date: April 25, 2008 | DOI: 10.4135/9781412963893 | Print ISBN: 9781412958783 | Online ISBN: 9781412963893 | Publisher:SAGE Publications, Inc.About this encyclopedia Gregory R. Foltz THE THERMOCLINE IS the region of the ocean where temperature decreases most rapidly with increasing depth. It separates the warm, well-mixed upper layer from the colder, deep water below. A thermocline is present throughout the year in the tropics and middle latitudes. It is more difficult to discern in high latitudes, where temperature is more uniform with depth. The presence of a very shallow thermocline in the eastern equatorial Pacific Ocean has important implications for global climate. The thermocline exists because the ocean absorbs most of the sun's heat in a shallow layer near the surface. The heat absorbed from the sun increases the temperature of the surface relative to that of the deep ocean, maintaining the thermocline. This is in contrast to the atmosphere, where a much larger portion of incident solar radiation passes through to ...

http://knowledge.sagepub.com/abstract/globalwarming/n625.xml

HISTORY OF MALAWI History and Colonialism The first inhabitants of present-day Malawi were probably to the San (Bushmen). 1st and 4th cent. A.D., Bantu-speaking peoples migrated to present-day Malawi. A new wave of Bantu-speaking peoples arrived around the 14th century, and they soon coalesced into the Maravi kingdom (late 15th–late 18th century), centered in the Shire River valley. In the 18th cent. the kingdom conquered portions of modern Zimbabwe and Mozambique. However, shortly thereafter it declined as a result of internal rivalries and incursions by the Yao, who sold their Malawi captives as slaves to Arab and Swahili merchants living on the Indian Ocean coast. In the 1840s the region was thrown into further turmoil by the arrival from South Africa of the warlike Ngoni. In 1859, David Livingstone, the Scots explorer, visited Lake Nyasa and drew European attention to the effects of the slave trade there; in 1873 two Presbyterian missionary societies established bases in the region. Missionary activity, the threat of Portuguese annexation, and the influence of Cecil Rhodes led Great Britain to send a consul to the area in 1883 and to proclaim the Shire Highlands Protectorate in 1889. In 1891 the British Central African Protectorate (known from 1907 until 1964 as Nyasaland), which included most of present-day Malawi, was established. During the 1890s, British forces ended the slave trade in the protectorate. At the same time, Europeans established coffee-growing estates in the Shire region, worked by Africans. In 1915 a small-scale revolt against British rule was easily suppressed, but it was an inspiration to other Africans intent on ending foreign domination. In 1944 the protectorate's first political movement, the moderate Nyasaland African Congress, was formed, and in 1949 the government admitted the first Africans to the legislative council. In 1953 the Federation of Rhodesia and Nyasaland (linking Nyasaland, Northern Rhodesia, and Southern Rhodesia) was formed, over the strong opposition of Nyasaland's African population, who feared that the more aggressively white-oriented policies of Southern Rhodesia (see Zimbabwe) would eventually be applied to them. The Banda Regime and Modern Malawi In the mid-1950s the congress, headed by H. B. M. Kanyama Chiume, became In 1958, Dr. Hastings Kamuzu Banda became the leader of the movement, which was renamed the Malawi Congress Party (MCP) in 1959. Banda organized protests against British rule that led to the declaration of a state of emergency in 1959–60. The Federation of Rhodesia and Nyasaland was ended in 1963, and on July 6, 1964, Nyasaland became independent as Malawi. Banda led the country in the era of independence, first as prime minister and, after Malawi became a republic in 1966, as president; he was made president for life in 1971. He quickly alienated other leaders by governing autocratically, by allowing Europeans to retain considerable influence within the country, and by refusing to oppose white-minority rule in South Africa. Banda crushed a revolt led by Chipembere in 1965 and one led by Yatuta Chisiza in 1967. Arguing that the country's economic well-being depended on friendly relations with the white-run government in South Africa, Banda established diplomatic ties between Malawi and South Africa in 1967. In 1970, Prime Minister B. J. Vorster of South Africa visited Malawi, and in 1971 Banda became the first head of an independent black African nation to visit South Africa. This relationship drew heavy public criticism. Nonetheless, Malawi enjoyed considerable economic prosperity in the 1970s, attributable in large part to foreign investment. Throughout the decade, Malawi became a refuge for antigovernment rebels from neighboring Mozambique, causing tension between the two nations, as did the influx (in the late 1980s) of more than 600,000 civil war refugees, prompting Mozambique to close its border. The border closure forced Malawi to use South African ports at great expense. In the face of intense speculation over Banda's successor, he began to eliminate powerful officials through expulsions and possibly assassinations. In 1992, Malawi suffered the worst drought of the century. That same year there were against Banda's rule, and Western nations suspended aid to the country. In a 1993 referendum Malawians voted for an end to one-party rule, and parliament passed legislation establishing a multiparty democracy and abolishing the life presidency. In a free election in 1994, Banda was defeated by Bakili Muluzi, his former political protégé, who called for a policy of national reconciliation. Muluzi formed a coalition cabinet, with members from his own United Democratic Front (UDF) and the rival Alliance for Democracy (AFORD). Disillusioned with the coalition, AFORD pulled out of the government in 1996. When Muluzi was reelected in 1999, AFORD joined the MCP in an unsuccessful attempt to prevent his inauguration. President Bingu wa MUTHARIKA, elected in May 2004 after a failed attempt by the previous president (Muluzi) to amend the constitution to permit another term, struggled to assert his authority against his predecessor, culminating in MUTHARIKA quitting the political party on whose ticket he was elected into office. MUTHARIKA subsequently started his own party, the Democratic Progressive Party (DPP), and has continued with a halting anti-corruption campaign against abuses carried out under the previous was excerpted from The Columbia Electronic Encyclopedia) INFORMATION ON MALAWI Geography and Ethnicity is long and narrow, and about 20% of its total made up of Lake Malawi. Several rivers flow into Lake Malawi from the west, and the Shire River (a tributary of the Zambezi) drains the lake in the south. Both the lake and the Shire lie within the Great Rift Valley. Much of the rest of the country is made up of a plateau that averages 2,500 to 4,500 ft (762–1,372 m) in height, but reaches elevations of c.8,000 ft (2,440 m) in the north and almost 10,000 ft (3,050 m) in the south. Malawi is divided into 24 administrative districts. In addition to the capital and Blantyre, other cities include Mzuzu and Zomba. Almost all of the country's inhabitants are Bantu-speakers and about 90% are rural. The Tumbuka, Ngoni, and Tonga (in the north) and the Chewa, Yao, Nguru, and Nyanja (in the center and south) are the main subgroups. About 80% of Malawi is Christian (mostly Protestant and Roman Catholic), and roughly 13% is Muslim; the rest follow traditional beliefs. English and Chichewa are official languages; other languages have regional importance. of Malawi is estimated at 13.01 million (July estimates for this country explicitly take into account the effects of excess mortality due to AIDS; this can result in lower life expectancy, higher infant mortality and death rates, lower population and growth rates, and changes in the distribution of population by age and sex than would otherwise be expected. It is estimated that 14.2% of the adult population (900,000 Malawians) are living with HIV/AIDS (2003 est) and that 84,000 per year die from the disease. temperature and rainfall details in Lilongwe, Malawi has two main seasons, the dry and the wet. The wet season extends from November to April. Rainfall can reach between 635mm and 3050mm, depending on altitude and position of the area. From May to August, it is cool and dry. July is mid-winter month. In September it is hot and dry with October and November as the hottest months with rains expected almost throughout the country. Malawi is a multiparty democracy governed under the constitution of 1995. The president, who is both chief of state and head of government, is popularly elected for a five-year term. The legislature consists of a 177-seat national assembly whose members are also elected by popular vote for five-year Chief of state: President Bingu wa MUTHARIKA (since 24 May 2004); note - the president is both the chief of state and head of government. Head of government: President Bingu wa MUTHARIKA (since 24 May 2004); note - the president is both the chief of state and head of government. Cabinet: 46-member Cabinet named by the president. Elections: president elected by popular vote for a five-year term; election last held 20 May 2004 (next to be held in May 2009). equal horizontal bands of black (top), red, and green with a radiant, rising, red sun centered in the black band. Landlocked Malawi ranks among the world's least developed countries. The economy is predominately agricultural, with about 85% of the population living in rural areas. Agriculture accounts for 36% of GDP and 80% of export revenues as of 2005. The performance of the tobacco sector is key to short-term growth as tobacco accounts for over 53% of exports. crops are corn, cotton, millet, rice, peanuts, cassava, and potatoes. Tea, tobacco, sugarcane, and tung oil are produced on large estates. With the aid of foreign investment, Malawi has instituted a variety of agricultural development programs. Large numbers of poultry, goats, cattle, and pigs There are small fishing and forest products industries. Deforestation has become a problem as the growing population uses more wood (the major energy source) and woodland is cleared for farms. Practically no minerals are extracted, but there are unexploited deposits of bauxite, uranium, and coal. Malawi's few manufactures are limited to basic goods, such as processed food and beverages, lumber, textiles, construction materials, and small consumer goods. Leading imports are foodstuffs, petroleum products, manufactured consumer goods, and transport equipment; the principal exports are tobacco, tea, sugar, coffee, peanuts, and forest products. The chief trade partners are South Africa, Germany, the United States, and Japan. Most of the country's foreign trade is conducted via Salima, a port on Lake Nyasa, which is connected by rail with the seaports of Beira and Nacala in Mozambique. Malawi is a member of the Southern African Development Community. The economy depends on substantial inflows of economic assistance from the IMF, the World Bank, and individual donor nations. In 2006, Malawi was approved for relief under the Heavily Indebted Poor Countries (HIPC) program. The government faces many challenges, including developing a market economy, improving educational facilities, facing up to environmental problems, dealing with the rapidly growing problem of HIV/AIDS, and satisfying foreign donors that fiscal discipline is being tightened. In 2005, President MUTHARIKA championed an anticorruption campaign. Since 2005 President MUTHARIKA'S government has exhibited improved financial discipline under the guidance of Finance Minister Goodall GONDWE. The currency is Kwacha. Recent historical exchange rates are as follows: Kwachas per US dollar - 138.7 (12/31/2008); 137.5 (12/31/2007); 143.69 (12/31/2006); 126.00 (12/31/2005); 105.76 (12/31/2004); 107.60 (12/31/2003); 87.27 (12/31/2002); 68.87 (12/31/2001); 47.49 (12/31/2000); 46.66 (12/31/1999); 45.25 (12/31/1998); 21.75 (12/31/1997). with Tanzania over the boundary in Lake Nyasa (Lake Malawi) and the meandering Songwe River remain dormant. to Map of Malawi

http://www.eyesonafrica.net/african-safari-malawi/malawi-info.htm

view a plan 1, 2, 3, 4 Polling And Politics Grade Levels: First through Fourth Materials: Photos of candidates Length: 2 days; poll one day, tally results the second day. Using pictures of the candidates and their names, create a large sheet for polling the class. As a demonstration lesson to show or reinforce tallying skills, poll the students on their choices for president. After polling the entire class, discuss what information can be learned from the poll. Instruct the class to make a bar graph representing the findings. Divide the class into small campaign teams and have each team create its own polling sheet. Have the teams poll other students in the school (Pre-arrange this with other classroom teachers). After completing their polls, have the teams make a bar graph representing their findings. Each team can share its poll, graph, and findings with the rest of the class. Adaptations and other peer activities: - Have each team poll a specific group (for example: boys, girls, teachers, first graders, fifth graders). Compare the poll findings of the different groups. - Assign the students to do a similar poll at home. - Have each team track the polls of their candidates on television or in newspapers. Just before the primaries, conduct a poll in class to determine if the class represents the country. - Hold a school-wide poll of each class participating and post the winner. - For hearing-impaired students, allow increased reliance on newspapers and magazines for information (and less on television). - For vision-impaired students, increase the use of television as well as radio for students’ information. - If time permits, set up the classroom like a polling center and have students vote in polling booths to make the activity more realistic. Students will learn the basics of the popular vote and what determines who gets elected. Hopefully this activity will also get students to want to vote. They will also get experience with using bar graphs. Assessment will consist of judging how accurate their bar graph is, they can be tested over how the popular vote works, or they could write a paper to submit with their graphs to describe their findings. “Primaries and Caucuses Classroom Activities.” C-SPAN Network . http://www.c-span.org/classroo/primary.htm (15, Sept. 1996).

http://lessonplanspage.com/campaignlesson1-htm/

inclined plane, simple machine, consisting of a sloping surface, whose purpose is to reduce the force that must be applied to raise a load. To raise a body vertically a force must be applied that is equal to the weight of the body, i.e., the product of its mass and the acceleration of gravity. The amount of work done (i.e., energy expended) in raising the body is equal to its weight times the distance through which it is raised. By means of an inclined plane a force smaller than the weight of the body can be exerted over a distance greater than the direct vertical distance, doing work equal to the product of the force and the distance through which it acts. If friction is ignored, the work done using the inclined plane will be exactly equal to the work done in lifting the body directly. In any real system some work is done to overcome friction between the plane and the load. The actual mechanical advantage of an inclined plane is the ratio of the load lifted to the force applied; ideally it is equal to the ratio of the length of the sloping plane to its vertical rise. An inclined plane whose sloping length is 5 m and whose vertical rise is 1 m has a mechanical advantage of 5; a 300-newton load can be moved up such a plane by a 60-newton force. The inclined plane has been modified in many ways. The screw and wedge are applications of the principle of the inclined plane but do not require that the load be moved vertically for their successful operation. The chisel, carpenter's plane, auger bit, and ax are some of the many tools based on this principle. Switchbacks on mountain roads are inclined planes that reduce the effort of an automobile engine but increase the distance a car must travel to ascend the mountain. The Columbia Electronic Encyclopedia, 6th ed. Copyright © 2012, Columbia University Press. All rights reserved. More on inclined plane from Fact Monster: See more Encyclopedia articles on: Technology: Terms and Concepts

http://www.factmonster.com/encyclopedia/science/inclined-plane.html

This painting of a repentant Mary Magdalene lifting her teary eyes to heaven was meant to inspire a greater spiritual devotion, at a time when Catholicism was being challenged by the Protestant reformation. Owing to the popularity of the subject, Titian and his workshop made at least seven versions of this painting. X-rays of the painting revealed that Titian made numerous changes to the composition, suggesting that he used this canvas to work out his ideas over a considerable period of time. This Getty painting is unique because it is the only composition that shows the Magdalene's Bible resting on a cloth-covered support rather than a skull--a symbol used to invite contemplation of death. Images of Mary Magdalene, the fallen woman whom Jesus found worthy to redeem and who would spend the rest of her life in solitude to atone for her sins, were especially prevalent during the Counter-Reformation, a period of devout Catholicism that lasted from approximately 1540 to 1640. Upon seeing Titian's conception of Mary Magdalene, the art historian Vasari declared that the picture "profoundly stirs the emotions of all who look at it; and, moreover, although the figure Mary Magdalene is extremely lovely it moves one to thoughts of pity rather than desire."

http://www.getty.edu/art/gettyguide/artObjectDetails?artobj=536

Generic Brass: Parts of a Brass Instrument When a brass instrument is played, the mouthpiece is placed against the player's lips. Three are three basic parts to a mouthpiece: - Rim – This part of the mouthpiece rests against the player's lips. - Cup – This part of the mouthpiece collects the sound made by the lips and channels it in to the body of the instrument. - Shank – This part of the mouthpiece is inserted into the instrument. It is tapered to ensure a tight fit. The opening of the shank should be circular and the shank must make an airtight seal with the leadpipe. For many players, the mouthpiece is the most important of the instrument, because it is the point of contact. Subtle differences in the shape of the rim or the design and depth of the cup can profoundly influence the quality of the sound. The leadpipe is the starting point of the main tube, where the mouthpiece is inserted. The opening of the leadpipe is often reinforced, because any deviation from a circular cross-section could cause air to leak between it and the shank of the mouthpiece. The main tube extends from the leadpipe to the bell. On an instrument with valves, the valve assembly splits it into two portions. The main tube gradually widens into a flare at the bell. Some sections are cylindrical, especially on the trombone, with its large slide. The bigger proportion of the main tube that is cylindrical, the brighter the tone of the instrument. In general mechanical terms, a valve is a device that opens or closes a pathway for the passage of a liquid or a gas. Musical instrument valves are compound devices, where a single movement opens one passage and closes another. This has the effect of changing the length of the vibrating column of air within the instrument, thereby changing the fundamental pitch. This is analogous to an organ pipe, where larger, longer pipes produce lower tones. There are various designs of brass instrument valves, but all work on the same general principle. The valve consists of a casing, to which are attached the tubes for the air path, and a cylinder that contains ports (air passages) that line up with the openings of the tubes in the casing. The cylinder either slides vertically in the casing (a piston valve) or rotates (a rotary valve), causing the ports to line up in a different manner, connecting or disconnecting the air passages from the tubes. In order for a valve to work properly, is is machined to extremely close tolerances – the valve must be able to move freely but must not allow air to leak around the cylinder. Also, the ports in the casing and the body of the valve must line up precisely or the diameter of the air column will be affected, which can change the tuning and sound quality of the instrument. The graphic above is a schematic representation of a typical piston valve. In the “up” position, the air column passes through one passage of the valve, and the loop is bypassed. When the player presses down the valve core, this passage is closed and other passages align with the ports in the casing, diverting the path throught the loop. This lengthens the air column and lowers the fundamental note. The larger the loop, the more the pitch is lowered. When the player releases the valve, a spring (not shown) returns the valve to the up position. Rotary valves spin around instead of moving in a linear fashion, but the concept of ports opening and closing to lengthen the air column is the same. The basic modern brass instrument has three valves which are tuned approximately a half-tone apart. There are seven different combinations that produce different notes. The trombone slide is constructed so that each position of the slide is a half-step, so that the seven positions on the trombone slide each correspond to a valve combination. Valves are numbered beginning with the one closest to the leadpipe (in terms of the air path). Valve combinations are named according to the numbers of the valves that are “closed” (in the “down” position). The term “open” refers to the situation where all of the valves are in the resting position. |Open||1 (slide fully in)||None| |2||2||0.5 tone lower| |1||3||1.0 tone lower| |1 + 2 (or 3)||4||1.5 tone lower| |2 + 3||5||2.0 tone lower| |1 + 3||6||2.5 tone lower| |1 + 2 + 3||7||3.0 tone lower| All brass instruments are constructed out of tune. The physics and mathematics are simply too complex for an instrument to be perfectly in tune on all valve combinations in all registers at all times. Some of the bad tuning has achieved the status of a standard – for example, the 1 + 3 valve combination is almost always quite sharp. Instrument designers have come up with a number of different schemes to compensate for these problems. On smaller instruments, such as cornets, mechanisms can be provided that allow the player to move on or more of the tuning slides provided in the valve loops while playing. Various rings, levers and brackets are fitted to the instrument that permit the third valve slide (and often the first valve slide also) to be moved with the player's left hand (the right hand is busy on the valves). Larger instruments are sometimes designed with overall tuning slides that can be operated with the player's free hand (this is common in orchestral tuba designs). However, a much more common solution is to add one or more extra valves. The fourth valve (lowers the sound 2.5 steps, equivalent to 1 + 3) is a de facto standard on the euphonium and is often seen on other instruments. This valve compensates for the most commonly out-of-tune note and also provides additional low-end range. Some orchestral tubas are designed with five or six valves. Every brass instrument has a number of slides which are used to make small adjustments to the length of the air column in order to tune the instrument. There is always one slide in the main tube, for overall pitch (even on a trombone). There are also slides on each major valve loop. Some instruments, most often flügelhorns, have a moveable leadpipe rather than a main tuning slide. The bell is the “big end” of the main tube. Different models and manufacturers of the same type of instrument have widely varying amounts of flare. The flare has a small influence on the overall sound of the instrument.

http://www.brasscrest.com/gener/gener002.html

A nucleotide is a chemical compound that consists of a heterocyclic base, a sugar, and one or more phosphate groups. In the most common nucleotides the base is a derivative of purine or pyrimidine, and the sugar is the pentose (five-carbon sugar) deoxyribose or ribose. Structure of a nucleotide Nucleotides are the structural units of RNA, DNA, and several cofactors - CoA, FAD, FMN, NAD, and NADP. In the cell they play important roles in energy production, metabolism, and signaling. Nucleotide names are abbreviated into standard three- or four-letter codes. The first letter is lower case and indicates whether the Nucleotide in question is a deoxyribonucleotide (denoted by a d) or a ribonucleotide (no letter). The second letter indicates the nucleoside corresponding to the nucleobase: U: Uracil not present in DNA, but takes the place of Thymine in RNA The third and fourth letters indicate the length of the attached phosphate chain (Mono-, Di-, Tri-) and the presence of a phosphate (P). For example, deoxy-cytidine-triphosphate is abbreviated as dCTP.

http://www.drpeterjdadamo.com/wiki/wiki.pl/Nucleotide

Monday, April 9, 2012 Never Too Old to Play a Math Game By Vicky Rauch (Scipi) Teacher Pay Teacher Store Front: Scipi Students are smart and want to learn, but many are terrified of math. These students are referred to as mathphobics. We all have these types of students in our classrooms, whether at middle school, high school, or college levels. When working with these types of students, it is important to bear in mind how students learn. Teachers can refer back to the Conceptual Development Model, which states students must first learn at the concrete stage (uses manipulatives) prior to moving to the pictorial stage, and in advance of the abstract level (the book). This method uses lessons with different manipulatives. Games are an easy way to introduce and use manipulatives without making students feel like little kids. The level of mathematical difficulty is controlled by varying rules. Games are customized to meet instructional objectives students are learning. However, as with any classroom activities, teachers should monitor and assess the effectiveness of games. When using games for learning, think about: 1) Excessive competition. Games are to be enjoyed rather than being “fights to the death”. 2) Mastery of mathematical concepts is necessary for successful play. Mastery should be at an above average level unless teacher assistance is readily available when needed. Games should not be played if concepts have just been introduced. 3) Difficulty of rules. If necessary, rules should be modified or altered so students perform well. 4) Physical requirements. Remember students who have special needs. These should be taken into account so all players have opportunities to win. In addition to strengthening content knowledge, math games encourage students to develop skills, such as staying on task, cooperating with others, and organization. Games allow students to review mathematical concepts without risking being called “stupid”. Furthermore, students benefit from observing others solve and explain math problems using different strategies. 1) Pique students’ interests and participations in math practices and reviews. 2) Provides immediate feedback for teachers. For example: Who is still having difficulty with a concept? Who needs verbal assurance? Why is a student continually getting the wrong answer? 3) Encourages and engages reluctant students. 4) Enhances opportunities to respond correctly. 5) Reinforces or supports positive attitudes or viewpoints of mathematics. 6) Students test new problem solving strategies without fear of failure. 7) Stimulates logical reasoning. 8) Requires critical thinking skills. 9) Allows student to use trial and error strategies. Mathematical games give learners numerous opportunities to reinforce current knowledge and to try out strategies or techniques without worries of getting wrong answers. Games provide students with non-threatening environments for seeing incorrect solutions as steps towards finding correct mathematical solutions. Scipi's Related Teachers Pay Teachers Products: Bug Mania Two Math Games Using Positive Negative Numbers $1.79 Roll and Calculate: A Math Game Using Positve & Negative Numbers $1.69 More Related Teachers Pay Teachers Products: Using Numbers in Writing Essays $1.00 Card Game: I Have/Who Has (Fractions, Mixed Numbers, Decimals) $2.00 Table Topics for Reading Discussions$2.95 Weather Tracking and Comparisons $3.18 5 Days of ESL/ELL/ELD Grammar Lesson Plans $4.50 Math Enrichment Worksheets: 22 Fun Activities with Answer Keys $4.50 Pirate Petes Treasure Math and Literacy Centers $5.00

http://tchr2tchr.blogspot.com/2012/04/never-too-old-to-play-game.html?m=1

anthropic principle (Greek: anthropos, "human being") states that the universe was fitted from the very first moment of its existence for the emergence of life in general and human life in particular. As agnostic astronomer, Robert Jastrow, noted, the universe is amazingly preadapted to the eventual appearance of humanity.1 For if there were even the slightest variation at the moment of the big bang, making conditions different, even to a small degree, no life of any kind would exist. In order for life to be present today an incredibly restrictive set of demands must have been present in the early universe—and they were. does the scientific evidence point to a beginning of the cosmos, but it points to a very sophisticated high tuning of the universe from the very beginning that makes human life possible. For life to be present today, an incredibly restrictive set of demands must have been present in the early universe: comprises 21 percent of the atmosphere. If it were 25 percent, fires would erupt, if 15 percent, human beings would suffocate. 2. If the gravitational force were altered by 1 part in 1040 (that’s 10 followed by forty zeroes), the sun would not exist, and the moon would crash into the earth or sheer off into space.2 Even a slight increase in the force of gravity would result in all the stars being much more massive than our sun, with the effect that the sun would burn too rapidly and erratically to sustain life. 3. If the centrifugal force of planetary movements did not precisely balance the gravitational forces, nothing could be held in orbit around the sun. 4. If the universe was expanding at a rate one millionth more slowly than it is, the temperature on earth would be 10,000 degrees C.3 average distance between stars in our galaxy of 100 billion stars is 30 trillion miles. If that distance was altered slightly, orbits would become erratic, and there would be extreme temperature variations on earth. (Traveling at space shuttle speed, seventeen thousand miles an hour or five miles a second, it would take 201,450 years to travel 30 6. Any of the laws of physics can be described as a function of the velocity of light (now defined to be 299,792.458 miles a second). Even a slight variation in the speed of light would alter the other constants and preclude the possibility of life on earth.4 Jupiter was not in its current orbit, we would be bombarded with space material. Jupiter’s gravitational field acts as a cosmic vacuum cleaner, attracting asteroids and comets that would otherwise strike 8. If the thickness of the earth’s crust was greater, too much oxygen would be transferred to the crust to support life. If it were thinner, volcanic and tectonic activity would make life untenable.6 9. If the rotation of the earth took longer than 24 hours, temperature differences would be too great between night and day. If the rotation period was shorter, atmospheric wind velocities would be too great. temperature differences would be too great if the axial tilt of the earth were altered slightly. 11. If the atmospheric discharge (lightning) rate were greater, there would be too much fire destruction; if it were less, there would be too little nitrogen fixing in the soil. 12. If there were more seismic activity, much life would be lost. If there was less, nutrients on the ocean floors and in river runoff would not be cycled back to the continents through tectonic uplift. Even earthquakes are necessary to sustain life as we know it. As early as the 1960s it was explained why, on anthropic grounds, "we should expect to observe a world that possesses precisely three spatial dimensions."7 Robert Dicke found "that in fact it may be necessary for the universe to have the enormous size and complexity which modern astronomy has revealed, in order for the earth to be a possible habitation for living beings."8 Likewise, the mass, the entropy level of the universe, the stability of the proton, and innumerable other things must be just right to make life possible. summarized the theistic implications well: "The anthropic principle… seems to say that science itself has proven, as a hard fact, that this universe was made, was designed, for man to live in. It’s a very theistic result."9 That is, the incredible balance of multitudinous factors in the universe that make life possible on earth points to "fine tuning" by an intelligent Being. It leads one to believe that the universe was "providentially crafted" for our benefit. Nothing known to human beings is capable of "pretuning" the conditions of the universe to make life possible other than an intelligent Creator. Or, to put it another way, the kind of specificity and order in the universe that makes life possible on earth is just the kind of effect that is known to come from an Alan Sandage concluded that "the world is too complicated in all of its parts to be due to chance alone. I am convinced that the existence of life with all its order in each of its organisms is simply too well put together. Each part of a living thing depends on all its other parts to function. How does each part know? How is each part specified at conception. The more one learns of biochemistry the more unbelievable it becomes unless there is some kind of organizing principle—an architect for believers…."10 And all of the conditions were set from the moment of the universe’s Hawking described how the value of many fundamental numbers in nature’s laws "seem to have been very finely adjusted to make possible the development of life" and how "the initial configuration of the universe" appears to have been "very carefully chosen."11 In spite of the fact that only an intelligent cause can "carefully choose" anything, Hawking at this writing remains skeptical about God. He saw the evidence clearly and asked the right question when he wrote: "There may only be a small number of laws, which are self-consistent and which lead to complicated beings like ourselves who can ask the question: What is the nature of God? And even if there is only one unique set of possible laws, it is only a set of equations. What is it that breathes fire into the equations and makes a universe for them to govern?… Although science may solve the problem of how the universe began, it cannot answer the question: Why does the universe bother to exist?" Hawking adds, "I don’t know the answer to Einstein did not hesitate to answer Hawking’s question when he said, "the harmony of natural law… reveals an intelligence of such superiority that, compared with it, all the systematic thinking and acting of human beings is an utterly insignificant reflection."13 prize winner Steven Weinberg, an atheist, went so far as to say that "it seems to me that if the word ‘God’ is to be of any use, it should be taken to mean an interested God, a creator and lawgiver who established not only the laws of nature and the universe but also standards of good and evil, some personality that is concerned with our actions, something in short that is appropriate for us to Anthropic Principle is based on the most recent astronomical evidence for the existence of a superintelligent Creator of the cosmos. In short, it provides the evidence for an updated Teleological Argument for God’s existence. 1 See "A Scientist Caught between Two Faiths: Interview with Robert Jastrow," Christianity Today, 6 August 1982. 2 Fred Heeren, Show Me God: What the Message from Space Is Telling Us About God (Wheeling, IL: Search Light, 1995), p. 196) 3 Ibid., p. 185. 4 Hugh Ross, The Fingerprint of God: Recent Scientific Discoveries Reveal the Unmistakable Identity of the Creator (Orange, CA: Promise, 1989), p. 5 Ibid., p. 196. 6 Ibid., p. 130. 7 John D. Barrow, et al., The Anthropic Cosmological Principle (New York: Oxford University Press, 1986), p. 247. 9 (Jastrow, "A Scientist Caught," p. 17, emphasis added). 10 Alan Sandage, "A Scientist Reflects on Religious Belief," Truth, Vol. 1 (Dallas: Truth Incorporated, 1985), p. 54 11 Cited by Heeren, p. 12 Stephen Hawking, A Brief History of Time: From the Big Bang to Black Holes (New York: Bantam, 1988), p. 99. 13 Albert Einstein, Ideas and Opinions—The Word as I See It, 3rd ed. (New York: Crown, 1982), 14 Steven Weinberg, Dreams of a Final Theory—The Search for the Fundamental Laws of Nature (New York: Pantheon, 1992), p. 244, emphasis added.

http://www.jashow.org/Articles/science/SC0205W3.htm

Climate feedbacks: Ice and snow You need to have Flash Player 10 or above installed to view this video The amount of sunlight reflected by a surface is known as its albedo. Ice and snow are bright surfaces with high albedo, reflecting about 60–80% of the sunlight falling on them. So ice on water or snow on land keeps the Earth cooler than it would otherwise be. An initial change such as a rise in temperature can trigger a feedback – melting some snow and ice leads to the exposure of low-albedo land or water surfaces, which increases the amount of sunlight absorbed by the Earth’s surface, leading to a further rise in temperature as a result. This is known as the ice-albedo feedback. The ice-albedo feedback amplifies temperature changes in regions where ice or snow cover is present. A rise in temperature, leading to ice or snow melt, uncovers water in the case of sea ice, or land and vegetation in the case of land-based ice and snow. These surfaces are darker than the ice and snow and so have lower albedo, meaning that less sunlight is reflected and more is absorbed. In turn this raises temperatures further, resulting in a positive feedback effect. This amplification also works in reverse if temperatures drop, leading to ice or snow formation, higher local albedo and a further decrease in temperature. Scientists estimate that, globally, the ice-albedo feedback adds about 50% to an initial temperature change, turning a rise of 1 °C into 1.5 °C of warming, or a drop of 1 °C into 1.5 °C of cooling. When ice melts, much of the resulting meltwater flows directly into the surrounding sea or onto the surrounding land. However, in the case of a large expanse of ice, the meltwater sometimes has no immediate path by which it can flow off. This can lead to pools of meltwater accumulating on the ice surface. Water is darker and less reflective than ice, so these pools have lower albedo than the ice surface that they cover. As a result, the meltwater pools are heated by their absorption of sunlight and this heats the ice underneath the pools as well, accelerating the melting. Conversely, if temperatures drop and some of the meltwater refreezes, the increased albedo leads to further cooling and accelerates the freezing process. Meltwater on the surface of a glacier can simply accumulate, sometimes forming large pools known as proglacial lakes. But this isn’t always the case. Meltwater pools have lower albedo than the ice, absorbing more sunlight, which heats both the water and the ice below it. This causes accelerated melting of the ice directly beneath the pool, which can lead to the formation of a tunnel – known as a moulin – descending into the glacier’s interior. If sufficient meltwater is produced at the surface, the moulin can flow all the way to the base of the glacier and accumulate between the ice and the land beneath it. In the case of a moving glacier, this water can act as a lubricator, decreasing the friction between the ice and the land and increasing the glacier’s speed. In summer the reflection of sunlight by sea ice prevents the ocean below the ice from absorbing solar energy, keeping the ocean cooler. But in winter, sea ice acts as an insulating blanket, preventing heat loss from the relatively warm ocean to the colder atmosphere. A change in ice cover changes this insulation. For example, reduced sea ice cover leaves more of the ocean surface exposed. In winter this causes more heat to be transferred from the ocean to the atmosphere, causing a rise in air temperatures. However, increased air temperatures also increase the amount of heat lost to space. As a result, scientists think changes in sea ice cover may produce some negative as well as positive feedbacks, though the overall effect of changing sea ice acts as a positive climate feedback.

http://www.sciencemuseum.org.uk/ClimateChanging/ClimateScienceInfoZone/ExploringEarthsclimate/1point4/1point4point4.aspx

Humans aren’t the only ones who depend on freshwater for survival. Freshwater ecosystems are rich in life. An estimated 12 percent of all animal species live in fresh water. Freshwater systems occupy only 0.8 percent of Earth's surface, according to the World Resources Institute. And these limited water supplies are under threat. The world's great rivers are drying up at an alarming rate. The glaciers and snow packs that have long supplied water to Canada’s Prairies are in retreat. Water levels in the Upper Great Lakes are falling. The consequences could be devastating for the humans and wildlife that depend on this precious resource to survive. Across the continent, the picture is critically clear. The U.S. government projects that at least 36 states will face water shortages within five years because of a combination of rising temperatures, drought, population growth, urban sprawl, waste and excess. Canada has some of the world’s most extensive fresh water resources. Approximately 8% of its territory is covered by lakes, and it has about 25% of the world's wetlands. But we cannot continue to take these resources for granted in the face of global warming. Protected areas not only preserve freshwater sources, including the critical headwaters of important river systems, they also protect the land around them from becoming polluted. Canada’s national park system remains incomplete and millions of hectares of wetlands have yet to be preserved. We must do more.

http://naturecanada.ca/water_without.html

Johannes Kepler's Polyhedra Johannes Kepler (1571-1630), best known for his three laws of planetary motion, was one of the most outstanding mathematicians of his day. In addition to his astronomical accomplishments, he systematized and extended all that was known about polyhedra in his time. While previous artist/geometers discovered particular polyhedra, he took a more mathematical approach: he defined classes of polyhedra, discovered the members of the class, and proved that his set was complete. For example, Kepler discovered the infinite class of antiprisms. Kepler's logical approach to polyhedra does not mean that he was free of the mysticism of the day. The following illustration, from his 1619 book, Harmonice Mundi, graphically shows the Platonic associations of the regular solids with the classical elements: The tetrahedron corresponds to fire, the octahedron to air, the cube to earth, the icosahedron to water, and the dodecahedron to the cosmos or ether: The lower-left portion of the above figure illustrates Kepler's two star polyhedra, the small stellated dodecahedron and the great stellated dodecahedron. Although earlier illustrations of these solids exist, Kepler was the first to recognize them as meeting the definition of regular polyhedra, but with nonconvex pentagram faces. (An earlier mosaic of the small stellated dodecahedron is attributed to Uccello and an earlier drawing of the great stellated dodecahedron appears in the work of Jamnitzer.) Kepler saw them from a deeper perspective, and in recognition, we now refer to these as Kepler solids. The lower-right portion of the above figure illustrates the disassembly of two rhombic solids which Kepler discovered: the rhombic dodecahedron and the rhombic triacontahedron. (An illustration of an approximation to the triacontahedron is clear in one of Jamnitzer's monuments drawn fifty years earlier, but Kepler certainly had a much deeper understanding of the triacontahedron's structure and its relationships to other polyhedra.) Below, left, Kepler shows how a dodecahedron can be constructed by adding "roofs" to the six sides of a cube (the construction which Euclid uses). Below, right, is how Kepler constructs a rhombic dodecahedron analogously. These figures are from his book Epitome of Copernican Astronomy. In, Harmonice Mundi, Kepler also defined the class of convex uniform polyhedra which we call the Archimedean solids, unfamiliar with the fact that Archimedes had defined the class already. All of these polyhedra except one (the snub dodecahedron, number 13 at the bottom right below) had already appeared in the work of various Renaissance artists. But those artists were haphazard, and wrote as if there could be an infinite number of related polyhedra which they were selecting from. Kepler's important contribution was to define this class of polyhedra and systematically explore it, to find all its members and prove his set was complete. In doing so, he realized that the prisms and antiprisms belong to the same class, since at each vertex the same combination of regular polygons In my view, a most artistic contribution of Kepler is to be found in his model of the solar system. Kepler proposed that the distance relationships between the six planets known at that time could be understood in terms of the five Platonic solids. His 1596 book, Mysterium Cosmographicum, proposed the model illustrated below, in which one Platonic solid fits between each pair of planetary spheres. (Note the use of Leonardo's style of open faces.) The outer sphere is that of Saturn; inside it is the sphere of Jupiter. Kepler made two prototypes in colored paper hoping to have it fabricated in silver. His original plan was that it would also function as a punchbowl dispensing assorted beverages. The image at right is a closeup of the spheres of inner planets, Mercury, Venus, Earth, and Mars. This is a beautiful astronomical model. For example, it explains why there are only six planets: How could there be a seventh planet, when Euclid proved that there are only five Platonic solids! Of course, the model is completely false, the interplanetary distances it predicts are not sufficiently accurate, and Kepler was scientist enough to accept this eventually. But it an excellent example of how truth and beauty are not always equivalent.

http://www.georgehart.com/virtual-polyhedra/kepler.html

Graphs may be introduced in math class but can also easily show up in history and science. Increase your child's confidence in interpreting bar graphs and throw a little candy into the mix to sweeten the learning process. What You Need: - Multicolored candy, like Smarties What You Do: - Pull out several handfuls of candy. - Have your child sort the candy into piles by color. - Have him count how many pieces of candy are in each pile and write down the numbers. - Instruct him to create a bar graph. Along the bottom line, which is refered to as the x-axis, you will need a section for each color. Along the vertical line, called the y-axis, write in numbers at increments of 5 or 10 depending on the amount of candy you've decided to use. - Have your child draw bars that show how many pieces of candy he has for each color. - Encourage him to use the markers to color the bars to emphasize the colors they represent and to make his graph more visually stimulating. - He's just created a bar graph! In order to check his work, make sure that the height of the bar corresponds with the number of candy pieces in each pile. Once you've verified that the graph is correct, you can celebrate with a bit of candy!

http://www.education.com/activity/article/graph-math/

Tobias Mayer’s colour triangle was first published in 1775 by the Göttinger physicist Georg Christoph Lichtenberg — more than 12 years after Mayer’s death — in an edition which included other «opera inedita» at the suggestion of Johann Heinrich Lambert, who had used the Mayer triangle three years previously. A colour-triangle operates with the three basic-colours cinnibar, massicot and azurite and gives all mixtures in which at least one twelfth of another colour is added to a base-colour. Black and white are treated as the representatives of light and darkness, which in turn either lighten or darken the colours. (Detailed text) Date: In 1758, the mathematician Tobias Mayer attempted to define the number of colours that the eye can distinguish with accuracy. Country of origin: Germany Basic colours: Red, yellow and blue Related systems: Lambert — Benson Bibliography: T. Mayer, «De affinitate colorum commentatio», Göttingen 1775; J. W. von Goethe, «Geschichte der Farbenlehre», Part II, Munich 1963; K. T. A. Halbertsma, «A History of the Theory of Colour», Amsterdam 1949.

http://www.colorsystem.com/?page_id=692&lang=en