Datasets:

ccdv

/

patent-classification

like 19

the present invention relates to a gate driving circuit of a lcd . more particularly , the driving circuit is using to control the charging time in each liquid crystal region corresponding to the multiple gate drivers of a lcd . further , it performs feedback motion by different gate voltages of each gate driver to produce different output enable signals of the pulse length . this can adequately control the pulse length of the output enable signal , and further control the charging time in each liquid crystal region corresponding to the gate driver . as a result , the block dim phenomenon in liquid crystal regions can be avoided . referring to fig3 , it is one preferred block diagram showing circuit according to the present invention . as shown in the figure , it comprises a timing generator 10 , which produces a gate clock signal ( clkv ), and a gate initial signal ( stv ). the two signals are transferred to a trigger signal generator 15 at the same time for producing the initial trigger signals ( g 1 , g 2 , and g 3 ) of each gate driver . then , they are transferred to a delay unit 20 in proper order . the delay unit 20 not only receives trigger signals ( g 1 , g 2 , or g 3 ) but also receives the output gate clock signal ( clkv ) from the timing generator 10 and the gate off - state voltage ( v gl ) from the gate driver for producing and outputting a delay clock signal ( d_clkv ). the delay clock signal ( d_clkv ) is transferred to a logic unit 30 . the delay unit 20 further includes a comparator and a referenced voltage . the comparator receives the gate off - state voltage ( v gl ) of the gate driver and then processes comparison with the referenced voltage for producing the delay clock signal ( d_clkv ). the gate off - state voltage ( v gl ) passes through a noise filter before transferring to the delay unit 20 . the logic unit 30 comprises an ex - or gate 35 and a and gate 37 . the ex - or gate receives a delay clock signal ( d_clkv ) and the gate clock signal ( clkv ) of the timing generator 10 to produce a first signal ( p 1 ). also , the first signal ( p 1 ) is transferred to the and gate 37 . the and gate 37 receives the first signal ( p 1 ) and the gate clock signal ( clkv ) of the timing generator 10 to produce a output enable signal ( oe ), and also transfer it to the gate driver . the delay clock signal ( d_clkv ) of the above delay unit 20 is corresponding to the initial trigger signal of each gate driver . in other words , while the delay unit receives the initial trigger signal ( g 1 ), it means the initial trigger signal ( g 1 ) is the initial trigger signal ( g 1 ) of the first gate driver . the received gate off - state voltage ( v gl ) here is the gate off - state voltage ( v gl ) of the first gate driver . the produced delay clock signal ( d_clkv ) here is processed from the comparison between the gate off - state voltage ( v gl ) of the first gate driver and the referenced voltage . the produced output enable signal is transferred to the first gate driver . as a result , while the delay unit 20 receiving the initial trigger signals ( g 2 and g 3 ), it means that the received delay clock signal ( d_clkv ) is processed from the comparison between the gate off - state voltage of the second gate driver and the gate off - state voltage of the third gate driver . further , the received output enable signals individually are transferred to the second gate driver and the third gate driver thereto control the charging time in the liquid crystal regions of the second and the third gate drivers . referring to fig4 , it is one preferred timing graph showing the output enable signal according to fig3 . as shown in the figure , the gate clock signal ( clkv ) is a cycling square - wave signal . the delay clock signal ( d_clkv ) is that the delay unit 20 is processed from a comparison algorism between the received initial trigger signal and the gate off - state voltage ( v gl ) of the corresponding gate driver . the delay signal ( d_clkv ) varies by the gate off - state voltage ( v gl ) of the gate driver . the first signal ( p 1 ) is produced while the delay clock signal ( d_clkv ) and the gate clock signal ( clkv ) passing through an ex - or gate algorism . the output enable signal ( oe ) is produced while the first signal ( p 1 ) and the gate clock signal processing through a and gate algorism . oe 1 , oe 2 , and oe 3 as shown in the figure are corresponding to the output enable signals of the initial triggers ( g 1 , g 2 , and g 3 ) in the first , the second and the third gate drivers . gd1 output signal , gd2 output signal , and gd3 output signal are the output signal waveforms while the initial trigger signals ( oe 1 oe 2 and oe 3 ) individually outputting to the first , the second , and the third gate drivers . according to the above description , the present invention relates to a gate driving circuit of a lcd . it performs a feedback motion by different gate off - state voltages to produce different output enable signals of the pulse length according to each gate driver . this , therefore , can control the charging time of each liquid crystal region corresponding to the gate driver for avoiding block dim phenomenon happened in the liquid crystal region . although the present invention has been described in detail with respect to alternate embodiments , various changes and modifications may be suggested to one skilled in the art , and it should be understood that various changes , suggestions , and alternations can be made hereto without departing from the spirit and scope of the invention as defined by the appended claims .

6Physics

referring to fig1 the reference numeral 1 denotes a power input shaft , which is only shown in phantom form in the drawing , and which is connected to the rotary power output member such as crankshaft of an engine not shown in the drawing . the power input shaft 1 is rotated in the clockwise direction as viewed from the right of fig1 . to the end of the power input shaft 1 there is connected a flywheel 2 by a plurality of bolts . by a further plurality of bolts 4 there is connected to this flywheel 2 a torque converter housing front cover 3 , which is shaped as a generally disk shaped member with an outer peripheral axially extending flange , facing to the left in fig1 . against the left hand edge in fig1 of this outer peripheral flange there is abutted the right hand edge of the casing portion of a pump impeller 5 . the pump impeller 5 comprises this casing portion and a plurality of vanes located at the inside of the casing portion . the pump impeller 5 is supported on a hollow shaft 6 which is coaxial with the power input shaft 1 , and which is rotatably supported , via a supporting element 10 which may be a needle roller bearing assembly , by the hub portion 8a of the fixed torque converter housing 8 . the left hand end of the hollow shaft 6 in fig1 drives the inner rotor of a hydraulic fluid pump 7 . through the central portion of the hollow shaft 6 there passes a sleeve member 9 , the left hand flanged end of which is fixed to the hub portion 8a of the torque converter housing 8 , and which extends rightwards in the figure to an intermediate portion within the torque converter , where there is mounted on it , via a one way clutch 16 , a torque converter stator member 15 provided with a plurality of vanes . through the central portion of the sleeve 9 there passes a power output shaft 11 , and this power output shaft 11 protrudes out from the right hand end of the sleeve 9 in fig1 . on this right hand end of the power output shaft 11 there is mounted a hub 14 as rotationally connected thereto , and to the outer portion of this hub 14 there is attached by a plurality of studs a torque converter turbine 13 , which is provided with a plurality of vanes . in a per se well known way , the pump impeller 5 , the turbine 13 , and the stator 15 provide transmission of rotary power by fluid circulation around paths defined by their vanes . the torque converter comprising the pump impeller 5 , the turbine 13 , and the stator 15 is generally toroidal in shape , and the part remote from its axis of its axial cross sectional shape is curved ; in other words , the outer sectional shape of the turbine 13 is a smooth curve . as is per se well known in torque converters of this type , when the torque converter is transmitting rotational power at a high rotational speed , the torque conversion function thereof becomes substantially inconsiderable , and the pump impeller 5 , the turbine 13 , and the stator 15 rotate substantially together , along with a mass of hydraulic fluid , as one unit . however , even at such a high rotational speed , a certain few percent of slippage is still liable to occur between the driving pump impeller 5 and the driven turbine 13 , and , while this slippage has no practical effect on the operation of the vehicle to which the torque converter is fitted , it is wasteful of energy and causes undesirable heating of the hydraulic fluid within the torque converter . accordingly , a lock up clutch assembly is provided for mechanically rotationally coupling together the pump impeller 5 and the turbine 13 , and for thus eliminating said hydraulic slippage . this lock up clutch assembly will now be described . the outer peripheral portion of the hub member 14 is formed as a cylindrical surface 17 which is smooth , and this cylindrical surface 17 is slidably engaged with the cylinder shaped inner peripheral surface 19 of the hub portion of a generally disk shaped clutch element 18 , which axially opposes the inner surface of the front cover 3 of the torque converter housing . around the outer circumferential surface 17 of the hub member 14 there is formed an annular groove 20 , and within this annular groove 20 there is fitted an annular sealing ring 21 , which accordingly provides a fluid seal between the cylindrical outer peripheral surface 17 of the hub member 14 and the cylindrical inner peripheral surface 19 of the clutch plate element 18 . around the outer periphery of the clutch plate element 18 there is formed a cylindrical axially extending flange , the outer peripheral surface 22 of which is smooth and opposes the inner peripheral surface 23 of the leftwardly projecting ( in the drawing ) flange of the front cover 3 of the torque converter housing . no sealing member is provided for positively ensuring a fluid seal between these two members , but the proximity of the outer cylindrical surface 22 formed on the flange of clutch plate member 18 and the inner cylindrical surface 23 formed in the flange of the front cover 3 ensures a very restricted gap therebetween , resistance of which to flow of hydraulic fluid is substantial . on the left hand side in the drawing of the front cover 3 there is provided an annular clutch lining 24 , opposing the clutch plate element 18 . accordingly , when the hydraulic fluid pressure on the left hand side of the clutch plate element 18 is substantially greater than that on the right hand side of the clutch plate element 18 , the clutch plate element 18 is biased to the right in the drawing so as to be tightly brought into contact with the annular clutch facing 24 provided on the left hand side in the drawing of the front cover 3 , and thus the clutch plate element 18 is rotationally coupled to the front cover 3 , while , on the other hand , when the hydraulic fluid pressure on the right hand side of the clutch plate element 18 is substantially greater than the hydraulic fluid pressure on the left hand side of the clutch plate element 18 , then the clutch plate element 18 is biased to the left in the drawing , away from the front cover 3 , and accordingly these elements are rotationally uncoupled from one another . as will be explained hereinafter , the clutch plate element 18 is rotationally coupled at its outer flange portion , via a rotary damper assembly , to the hub member 14 which is rotationally coupled to the power output shaft 11 . accordingly , when the clutch plate element 18 is biased by the aforesaid excess of the pressure on its left side over the pressure on its right side towards the front cover 3 so as to be rotationally coupled thereto , the power input shaft 1 is directly rotationally coupled , via the front cover 3 , the clutch plate element 11 , and the hub member 14 , to the power output shaft 11 . in this condition , the torque converter assembly comprising the pump impeller 5 , the turbine 13 , and the stator 15 has no significant function of transmission of rotational power , and rotates as a unit along with the hydraulic fluid therein , according to the engagment of the above described direct engagement clutch assembly . in this state , substantially no energy is lost by swirling of the hydraulic fluid within the torque converter assembly . accordingly , the provision of this direct engagement clutch assembly incorporating the clutch plate element 18 and the front cover 3 effects a very valuable saving of energy , and reduction of heat generation , over the unaided operation of the torque converter assembly . the arrangements for biasing the clutch plate element 18 leftwards and rightwards in the drawing will now be described . two fluid channels are provided for the introduction of hydraulic fluid to within the casing assembly comprising the front cover 3 and the outer casing portion of the pump impeller 5 : a first hydraulic fluid channel defined between the fixed sleeve member 9 and the hollow shaft 6 which supports the pump impeller 5 , through a tubular gap denoted by the reference numeral 32 in the drawing , hydraulic fluid passing through this gap 32 being discharged within the torque converter assembly at points around the base of the stator 15 ; and a second hydrualic fluid channel defined between the power output shaft 11 and the fixed sleeve member 9 , through a tubular gap denoted by the reference numeral 33 in the drawing , hydraulic fluid passing through this gap 33 being passed through a radial hole in the power output shaft 11 into a central axial hole 34 bored in its right hand portion in the drawing , and then being introduced through a space 35 and grooves 37 of a washer 36 into the space between the clutch plate element 18 and the front cover 3 , on the right hand side of the clutch plate element 18 . selectively , according to operational conditions of the vehicle and of the engine incorporated therein , under the control of a fluid pressure control system which is not shown in the drawing and which will not be further described herein , hydraulic fluid under pressure from the hydraulic fluid pressure pump 7 is pumped into one of these first and second hydraulic fluid channels . when hydraulic fluid is pumped into the second hydraulic fluid channel 33 , so that it is supplied into the space between the clutch plate element 18 and the front cover 3 , on the right hand side of the clutch plate element 18 in the drawing , and is discharged from the first hydraulic fluid channel 32 , then this continuous fluid flow , because as mentioned above the annular gap between the circumferential outer surface 22 of the clutch plate element 18 and the circumferential inner surface 23 of the leftwardly in the drawing projecting flange of the front cover 3 is restricted and presents a substantial resistance to the flow of hydraulic fluid , causes the clutch plate element 18 to be biased in the leftwards direction in the drawing , out of contact with the annular clutch lining 24 mounted on the left hand side in the drawing of the front cover 3 , and accordingly in this condition the lock up clutch does not function to couple together the power input shaft 1 and the power output shaft 11 , and accordingly the torque converter comprising the pump impeller 5 , the turbine 13 , and the stator 15 performs its power transmitting function , via the circulation of hydraulic fluid therein . on the other hand , if the flow of hydraulic fluid through the torque converter produced by the hydraulic fluid pressure pump 11 is reversed by the aforementioned fluid pressure control system from the abovementioned condition , i . e ., if hydraulic fluid is pumped into the first hydraulic fluid channel 32 so as to be supplied into the interior of the torque converter , the clutch plate element 18 is biased to the right in the drawing , so as securely to engage it against the annular clutch lining 24 provided on the left hand side of the front cover 3 . in this condition , the lock up clutch assembly provides its function of directly coupling the power input shaft 1 to the power output shaft 11 , and the torque converter assembly comprising the pump impeller 3 , the turbine 13 , and the stator 15 is relieved of any function of transmitting rotational power between the power input shaft 1 and the power output shaft 11 . when the lock up clutch assembly described above is being switched from its non connected state to its connected state , there is a risk that a sudden torque shock will occur , because even when the vehicle incorporating this torque converter is being operated at high speed there is always a certain difference of rotational speed between the power input shaft 1 and the power output shaft 11 , due to the aforesaid residual few percent of slippage between the pump impeller 5 of the torque converter and the turbine 13 thereof . further , during the state of engagement of the lock up clutch assembly , it is desirable to cushion the effect of torque shocks which are being transmitted along the power train . therefore , as mentioned above , a rotary damper assembly which will now be described is provided in the power train of the lock up clutch . this serves both to cushion the shock of the engagement of the lock up clutch , and also to cushion rotational shocks being transmitted along the power train while the lock up clutch is engaged . as outlined before , with the object of minimizing the axial length of the torque converter incorporating the lock up clutch , this rotary damper assembly is arranged to be provided in an annular space defined between the outer part of the torque converter assembly , i . e ., of the turbine member 13 thereof , which , as explained above , is of curved axial cross sectional shape , and the outer part of the clutch plate element 18 , which as explained above , is of substantially a disk shape . the advantageous use of this space for the mounting of the rotary damper assembly results in a very useful shortening of the total axial length of the construction ; but this arrangement , as outlined above , requires that the rotary damper assembly be of a large radius , substantially equal to the outer radius of the clutch plate element 18 , and accordingly the centrifugal forces acting thereon are substantial , when the vehicle is being operated at high torque converter rotational speed . the measures taken to overcome the damaging effect of the high centrifugal forces will be seen hereinafter . the rotary damper assembly comprises two outer damper plate elements 26 and 27 which are axially mutually opposed , and one inner damper plate element 29 which is sandwiched between said outer damper plate elements 26 and 27 . the outer damper plate elements 26 and 27 are rotationally coupled together by a plurality of pins 28 , only one of which can be seen in the figure , which pass through circular holes in the outer damper plate elements 26 and 27 , and through circumferentially extending slot shaped apertures in the inner damper plate element 29 , which are formed as slots in order not to hamper the limited rotational movement of the inner damper plate element 29 with respect to the outer damper plate elements 26 and 27 . the outer damper plate element 27 , in this embodiment , and the inner damper plate element 29 are formed as substantially flat annuli , and lie generally in the aforesaid annular space defined between the outer part of the turbine 13 of the torque converter and the outer portion of the substantially flat clutch plate element 18 . the other outer damper plate element 26 is formed substantially as a flat disk with a central hole therethrough , and the inner peripheral portion of this flat disk damper plate element 26 is connected by a plurality of pins 25 to the hub member 14 which is rotationally coupled to the power output shaft 11 , as described above . further , the outer peripheral portion of the annular inner damper plate element 29 is rotationally coupled to the edge portion of the outer circumferential leftwardly axially extending flange portion of the clutch plate element 18 . the outer damper plate elements 26 and 27 are rotationally coupled , as will be seen hereinafter , with a certain amount of damped rotational play available therebetween , with the inner damper plate element 29 , and thereby , as stated above , the clutch plate element 18 is connected with a certain amount of damped rotational play therebetween with the hub member 14 which is rotationally coupled to the power output shaft 11 , via the aforesaid damper assembly . in a different embodiment of the present invention , the configuration of this damper plate assembly could be somewhat different . it would be possible for the rotational coupling of the outer damper plate element 26 to the hub member 14 , and the rotational coupling of the inner damper plate element 29 to the clutch plate member 18 , to be reversed . in such a configuration , the inner damper plate element 29 would be formed as a disk element , the inner part of which was rotationally coupled to the hub member 14 , and both of the outer damper plate elements 26 and 27 would be formed as substantially flat annuli , the outer part of at least one of them being rotationally coupled to the outer peripheral portion of the clutch plate member 18 . such a reversed construction would still be within the scope of the present invention ; the rotary damper assembly would still generally lie within the aforesaid annular space defined between the outer part of the torque converter turbine 13 and the substantially flat clutch plate member 18 , and the torque transmitting and cushioning function of the rotary damper assembly would remain the same as in the shown preferred embodiment . the arrangements for damped rotational coupling between the outer damper plate elements 26 and 27 and the inner damper plate element 29 will now be described . in this connection , fig2 is a plan view of part of the disk shaped outer damper plate element 26 , taken along the lines ii -- ii in fig1 and fig3 is an axial cross section therethrough , taken along the line iii -- iii in fig2 . further , fig4 is a partly cut away exploded perspective view of part of the engaging construction between the outer damper plate elements 26 and 27 and the inner damper plate element 29 . the inner damper plate element 29 is formed with a number of generally circumferentially extending slot shaped apertures 42 , which have square cut ends . opposing each of these slot shaped apertures 42 in the inner damper plate element 29 there are formed in each of the outer damper plate elements 26 and 27 a plurality of generally circumferentially extending slot shaped apertures 38 and 39 , respectively . around the entire periphery of each of the circumferentially extending slot shaped apertures 38 there is formed a raised lip 40 , which projects out from the general plane of said outer damper plate element 26 away from the inner damper plate element 42 , as best seen in fig4 . correspondingly , around the entire periphery of each of the circumferentially extending slot shaped apertures 39 in the second damper plate element 27 there is formed a raised lip 41 , which projects out from the general plane of said outer damper plate element 27 in the direction away from said inner damper plate element 29 . particularly according to the present invention , each of these raised lips 40 or 41 extends all around the periphery of its circumferentially extending slot shaped opening 38 or 39 in its damper plate element 26 or 27 , including extending around the end portions of said circumferentially extending slot shaped opening 38 or 39 . the reference numeral 40a in fig4 denotes one such portion of the lip member 40 which extends along an end portion of one of the slot shaped openings 38 in the damper plate element 26 . according to a particular specialized aspect of the present invention , in the shown embodiment the raised lips 40 and 41 form acute angles with the planes of their respective damper plate elements 26 and 27 , and in the particular shown preferred embodiment these angles are approximately 45 °. such a construction may conveniently and desirably be made by pressing the lip portions 40 and 41 at the time of press forming the damper plate elements 26 and 27 . this makes for strength of construction . as described above , it has been discovered that the strength of the lip portions 40 and 41 is of considerable importance for the durability of the rotary damper assembly of the direct engaging clutch as a whole . within the plurality of circumferentially engaging slot shaped apertures 42 of the inner damper plate element 29 there are received a plurality of compression coil spring 30 , whose axes extend generally circumferentially to the inner damper plate element 29 , and lie generally within its plane , along the slot shaped apertures 38 and 39 . the sides of these compression coil springs 30 project out somewhat from the sides of the inner damper plate element 29 , and extend into the circumferentially extending slot shaped apertures 38 and 39 of the outer damper plate elements 26 and 27 , and are desirably , as in the shown embodiment , seated against the inwardly facing sides of the raised lips 40 and 41 formed along the circumferential peripheries of the circumferentially extending slot shaped apertures 38 and 39 , because said raised lips 40 and 41 extend at acute angles of approximately 45 ° to the planes of these damper plate elements 26 and 27 . as has been mentioned above , the damper plate elements 26 and 27 are rotationally , and also axially , coupled together by the plurality of pins 28 , which pass through other circumferentially extending slot shaped apertures in the inner damper plate element 29 which are not shown in fig4 and accordingly the outer damper plate elements 26 and 27 are not able axially to be separated by much more than the thickness of the inner damper plate element 29 which is sandwiched between them . thereby , the compression coil springs 30 are held in place within the sandwich composed of the damper plate elements 26 , 29 , and 27 in that order . the rotary damper constructed as described above operates as follows . when the lock up clutch comprising the clutch plate element 18 and the front cover 3 is engaged by the hydraulic fluid pressure on the left side of the clutch plate element 18 being higher than the hydraulic fluid pressure on the right hand side of the clutch plate element 18 , as explained above , then it may well occur that a substantial torque jerk is suddenly required to be transmitted between the outer friction plate elements 26 and 27 and the inner friction plate element 29 . suppose that , as shown in fig4 the inner friction plate element 29 requires , according to such a torque jerk , to be rotated in the counterclockwise direction with respect to the outer friction plate elements 26 and 27 , as shown by the arrows a and b in the drawing . in such a condition , the ends in the clockwise direction of the compression coil springs 30 will abut against the ends 42a of the circumferentially extending slot shaped apertures 42 in the inner damper plate element 29 , and the ends in the anticlockwise direction of the compression coil springs 30 will engage against the end portions 40a of the raised lips 40 which extend along the end portions in the counterclockwise direction of the circumferentially extending slot shaped apertures 38 in the outer damper plate element 26 , and also against the symmetrically disposed , but not visible in the drawing , parts of the raised lips 41 which extend along the end portions in the counterclockwise direction of the circumferentially extending slot shaped apertures 39 in the outer damper plate element 27 . by the rotational twisting between the inner damper plate element 29 and the outer damper plate elements 26 and 27 , in this condition , the compression coil springs 30 are compressed , and absorb the aforesaid rotational torque jerk , thus cushioning torque jerk which is to be transmitted from the power input shaft 1 to the power output shaft 11 . thus , a buffer effect is provided within the lock up connection provided by the lock up clutch between the power input shaft 1 and the power input shaft 11 , by this rotary damper mechanism . it will clear , of course , that torque jerk in the other rotational direction between the power input shaft 1 and the power input shaft 11 will also be cushioned by this rotary damper assembly , by the other ends of the compression coil springs impacting against the other ends of the apertures in the outer and inner damper plate elements 26 , 27 and 29 . according to this construction , because the outer damper plate elements 26 and 27 are formed with these raised lips 40 and 41 , respectively , and because these raised lips extend all around the entire peripheries of the circumferentially extending slot shaped apertures 38 and 39 in these outer damper plate elements 26 and 27 , including around the end portions thereof in the circumferential direction , in a continuous fashion , thereby such a construction is much stronger than the above described prior art constructions in which the circumferentially extending slot shaped apertures such as 38 of the damper plate elements of previous rotary dampers were formed only with flaps on their long sides , i . e ., along their circumferentially extending sides , but were not formed with any flap or lip portions at their ends in the circumferential direction , i . e ., along their short sides . this is because the portions such as 40a of the raised lips 40 and 41 , i . e ., the parts of the raised lips 40 and 41 which extend in a substantially radial direction to the damper plate elements 26 and 27 , serve substantially to brace the outer damper plate elements 26 and 27 , and particularly the outer damper plate element 27 which is formed as an annulus of a not very great radial dimension , from bending . further , according to the shown embodiment of the present invention , because the raised lips 40 and 41 extend generally at acute angles to the planes of the outer damper plate elements 26 and 27 respectively , of which they form part , and in particular in the present embodiment at angles of approximately 45 ° thereto , thereby the compression coil springs 30 are snugly held by these angled raised lip portions 40 and 41 properly in place in between the outer damper plate elements 26 and 27 , and the central axes of these compression coil springs 42 are well maintained substantially in the central plane of the inner damper plate element 29 , even when a considerable centrifugal force is exerted upon these compression coil springs by fast rotation of the rotary damper assembly as a whole . again , in this construction , the provision of the end portions 40a of the raised lips aids in this snug holding of the compression coil springs 30 . it will be clear to one skilled in the art , based upon the foregoing explanation , that , because the raised lips 40 and 41 are continuous all around the peripheries of the circumferentially extending slot shaped apertures 38 and 39 , thereby these peripheries of the slot shaped apertures 38 and 39 are much reinforced , and accordingly a much stronger rotary damper as a whole is attained by the present invention , and this rotary damper is able to stand much greater centrifugal forces , applied for a longer period of use of the rotary damper , than the above outlined prior art constructions . this is particularly important , as explained above , because the rotary damper according to the present invention is located within the aforesaid annular space left between the toroidal torque converter comprising the turbine 13 , and the substantially plate shaped clutch plate element 18 , and accordingly is of relatively large radius . in such a configuration , strength of the rotary damper with regard to the centrifugal forces which act thereon when it rotates at high speed is a critical design factor . although the present invention has been shown and described in terms of a preferred embodiment thereof , and in language more or less specific with regard to structural features thereof , and with reference to the illustrative drawings , it should be understood that in any particular embodiment of the present invention various changes , modifications , and omissions of the form and the detail thereof could be made by a person skilled in the art , without departing from the essential scope of the invention . therefore , it is expressly desired that the scope of the present invention should be uniquely delimited by the legitimate and valid scope of the appended claims , which follow , and not by any of the perhaps purely fortuitous details of the shown embodiment , or of the drawings .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

production of trays ; 235 × 175 × 14 mm addition of potato starch succinic acid ester derivative ______________________________________ingredient / recipe no . 1 2 3______________________________________starch ( 1 ) 100 80 50water 100 100 100starch derivative ( 4 ) -- 20 50thickening agent ( 2 ) 0 , 5 0 , 5 0 , 5release agent ( 3 ) 2 2 2viscosity , mpas , 24 ° c . 1400 1500 3100baking time , sec . 155 160 190baking temperature , ° c . 190 190 190weight , g 16 , 1 21 , 4 22 , 0weight , % 100 133 137______________________________________ ph value 7 , 4 ; conditioning 70 % r . h ., 27 ° c ., 24 hours . ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate ; ( 4 ) succinic acid ester of potato starch , 4 % substitution resistance to compression test : testing the maximum force required to compress the specimens by 30 % according to a relative method has shown the following results . number of specimens per trial : ______________________________________ weight maximum forcerecipe no . g n % s ( 1 ) s , % ______________________________________1 16 , 1 95 100 31 332 21 , 4 337 355 45 133 22 , 0 468 493 51 11______________________________________ ( 1 ) standard deviation n , n = 10 ( n = 9 with no . 3 ) a bending test showed no significant differences in the force required to break the specimens . production of ampoule tray , 80 × 65 × 13 mm ; addition of starch ether derivativ with phosphate cross - linking ______________________________________ingredient / recipe no . 4 5 6 7______________________________________starch ( 1 ) 100 90 70 -- water 100 100 100 100starch derivative ( 4 ) -- 10 30 100thickening agent ( 2 ) 0 , 5 0 , 5 0 , 5 0 , 5release agent ( 3 ) 2 2 2 2baking time , sec . 32 33 36 44baking temperature , ° c . 185 185 185 185weight , g 1 , 78 1 , 85 2 , 00 2 , 88weight , % 100 104 112 162______________________________________ conditioning 72 % r . h ., 26 ° c ., 24 hours . ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate ; ( 4 ) hydroxypropyl ether , crosslinked ______________________________________recipe no . 8 9 10 11 12 13______________________________________ingredientstarch ( 1 ) 100 100 100 100 100 100water 120 120 120 120 120 120fiber ( 4 ) 10 10 10 10 10 10thickening 0 , 5 0 , 5 0 , 5 0 , 5 0 , 5 0 , 5agent ( 2 ) release 2 2 2 2 2 2agent ( 3 ) soda -- 0 , 3 0 , 5 0 , 7 1 2waterglassviscosity , 1500 1400 1300 1300 1200 -- mpas , 22 ° c . ph value 7 , 6 8 , 9 9 , 0 9 , 4 9 , 5 & gt ; 10baking 90 90 90 90 90 90time , sec . baking 200 200 200 200 200 200temperature ° c . weight , g , 8 , 5 9 , 0 10 , 3 12 , 1 14 16without cond . weight , % 100 106 121 142 ( 165 ) ( 188 ) ( 5 ) ( 5 ) ______________________________________ conditioning 70 % r . h ., 27 ° c ., 24 hours . ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate ; ( 4 ) cellulose ; ( 5 ) partly formation of cracks ______________________________________ingredient / recipe no . 14 15 15a 16______________________________________starch ( 1 ) 100 100 100 100water 130 130 130 130fiber ( 4 ) 10 10 10 10thickening agent ( 2 ) 0 , 3 0 , 3 0 , 3 0 , 3release agent ( 3 ) 2 2 2 2potassium waterglass -- 0 , 5 1 0 , 5 ( 5 ) calcium silicate 5 -- -- viscosity , mpas , 22 ° c . 1300 1200 1400 1300ph value 7 , 6 9 , 1 9 , 7 7 , 5baking time , sec . 90 90 90 90baking temperature , ° c . 200 200 200 200weight , g , without cond . 9 , 5 9 , 7 11 , 0 8 , 7______________________________________ conditioning 70 % r . h ., 27 ° c ., 24 hours . ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate ; ( 4 ) cellulose ; ( 5 ) neutralized with 12 ml 0 , 1 n hydrochloric acid production of flat tray , 235 × 175 × 12 mm , wall thickness 4 mm , different additions of potato starch derivatives ______________________________________ingredient / recipe no . 17 18 19 20______________________________________starch ( 1 ) 100 90 80 70water 100 100 100 100starch derivative ( 4 ) -- 10 20 30thickening agent ( 2 ) 0 , 5 0 , 5 0 , 5 0 , 5release agent ( 3 ) 2 2 2 2viscosity , mpas , 22 ° c . 2000 2200 2000 2000baking time , sec . 150 155 160 160baking temperature , ° c . 190 190 190 190weight , g , without cond . 15 , 3 16 , 3 17 , 3 18 , 8weight , % 100 107 113 123______________________________________ conditioning 72 % r . h ., 25 ° c ., 24 hours ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate ; ( 4 ) potato starch , hydroxypropylated , crosslinked production of a basket - like container , 115 × 80 × 38 mm , different additions of hydroxypropylated potato starch ______________________________________ingredient / recipe no . 21 22 23 24______________________________________starch ( 1 ) 100 80 50 -- water 100 100 100 100starch derivative ( 4 ) -- 20 50 100thickening agent ( 2 ) 0 , 5 0 , 5 0 , 5 0 , 5release agent ( 3 ) 2 2 2 2viscosity , mpas , 22 ° c . 1450 1800 3300 & gt ; 10000baking time , sec . 60 55 55 55baking temperature , ° c . 185 185 185 185weight , g 4 , 3 4 , 6 4 , 9 5 , 3weight , % 100 108 113 123______________________________________ conditioning 72 % r . h ., 25 ° c ., 24 hours ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate ; ( 4 ) propoxylated potato starch resistance to compression test : testing the maximum force required to compress the specimens by 30 % according to a relative method has shown the following results . number of specimens per trial : ______________________________________ weight of maximum forcerecipe no . tray , g n % s ( 1 ) s , % ______________________________________21 4 , 3 128 100 17 1322 4 , 6 155 121 17 1123 4 , 9 160 125 22 1424 5 , 3 173 135 35 20______________________________________ ( 1 ) standard deviation n , n = 12 production of rectangular conical container , 145 × 90 × 50 mm ; different additions of an octenyl succinate ester ______________________________________ingredient / recipe no . 25 26 27 28______________________________________starch ( 1 ) 100 90 80 60water 110 110 110 110starch derivative ( 4 ) 0 10 20 40thickening agent ( 2 ) 0 , 5 0 , 5 0 , 5 0 , 5release agent ( 3 ) 2 2 2 2viscosity , mpas , 22 ° c . 1500 1480 1520 1700ph value 8 , 0 7 , 7 7 , 4 7 , 0baking time , sec . 70 68 60 58baking temperature , ° c . 190 190 190 190weight , g 6 , 2 6 , 8 7 , 5 8 , 8______________________________________ conditioning 70 % r . h ., 10 ° c ., 10 hours ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate ; ( 4 ) corn starch , octenyl succinate resistance to compression test : testing the maximum force required to compress the specimens by 30 % according to a relative method has shown the following results . number of specimens per trial : ______________________________________ weight of maximum forcerecipe no . tray , g n % s ( 1 ) s , % ______________________________________25 6 , 2 74 100 16 2226 6 , 8 114 154 16 1427 7 , 5 156 211 16 1028 8 , 7 219 296 40 18______________________________________ ( 1 ) standard deviation n , n = 10 ______________________________________ingredient / recipe no . 29 30 31 32______________________________________starch ( 1 ) 100 75 75 75water 110 110 110 110starch derivative ( 4 ) -- 25 -- -- starch derivative ( 5 ) -- -- 25 -- starch derivative ( 6 ) -- -- -- 25thickening agent ( 2 ) 0 , 5 0 , 5 0 , 5 0 , 5release agent ( 3 ) 2 2 2 2viscosity , mpas , 25 ° c . 1750 1250 1800 3500baking time , sec . 75 67 63 63baking temperature , ° c . 190 190 190 190weight , g 6 , 6 7 , 3 8 , 3 6 , 9______________________________________ conditioning 75 % r . h ., 12 hours , room temperature . ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate ; ( 4 ) corn starch , hydroxypropyl ether ; ( 5 ) corn starch , octenyl succinate ; ( 6 ) corn starch , cationic , hydrophobic ______________________________________ingredient / recipe no . 33 34 35______________________________________starch ( 1 ) 100 -- -- water 100 100 100starch derivative ( 4 ) -- 100 -- starch derivative ( 5 ) -- -- 100thickening agent ( 2 ) 0 , 5 0 , 5 0 , 5release agent ( 3 ) 2 , 0 2 , 0 2 , 0baking time , sec . 60 70 75weight , g , without 6 , 0 9 , 5 10 , 5conditioning______________________________________ conditioning 70 % r . h ., 27 ° c ., 24 hours . ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate ; ( 4 ) corn starch , cationic , hydrophobic ; ( 5 ) corn starch , octenyl succinate ______________________________________ingredient / recipe no . 36 37 38 39______________________________________starch ( 1 ) 100 -- -- 100water 100 100 110 100starch derivative ( 4 ) -- -- 100 -- starch derivative ( 5 ) -- 100 -- -- starch derivative ( 6 ) -- -- -- 10thickening agent ( 2 ) 0 , 5 0 , 5 0 , 5 -- release agent ( 3 ) 2 2 3 2baking time , sec 90 90 115 90weight , g , without 8 , 9 13 , 0 18 , 0 ( 7 ) 12 , 0conditioning______________________________________ ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate ; ( 4 ) rice flour ; ( 5 ) corn starch , cationic , ds = 0 , 04 ; ( 6 ) corn starch , propoxylated , pregelatinized ; ( 7 ) isolated partial formation of cracks production of a tray , 135 × 220 × 19 mm ; addition of different concentrations of al ions ______________________________________ingredient / recipe no . 40 41 42 43______________________________________starch ( 1 ) 100 100 100 100water 100 100 100 100thickening agent ( 2 ) 0 , 5 0 , 5 0 , 5 0 , 5release agent ( 3 ) 2 2 2 2aluminum sulfate . xh . sub . 2 o -- 0 , 11 0 , 22 0 , 4455 % al . sub . 2 ( so . sub . 4 ). sub . 3corresponding to al . sup . 3 + 0 0 , 01 0 , 02 0 , 04batter volume , ml 30 32 34 37batter temperature , ° c . 25 25 25 25viscosity , mpas , ± 100 mpas 1500 1500 1500 1500baking time , sec ., ± 5 sek . 145 145 145 145baking temperature , ° c . 190 190 190 190weight , g ( average ) 15 , 2 16 , 2 17 , 4 18 , 8weight , % ( relative ) 100 107 114 124______________________________________ conditioning 72 % r . h ., 12 hours , room temperature ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate ______________________________________ingredient / recipe no . 44 45 46 47 48______________________________________starch ( 1 ) 100 100 90 90 90starch ( 4 ) -- -- -- -- 10starch derivative ( 5 ) -- -- 10 10 -- water 110 110 110 110 110thickening agent ( 2 ) 0 , 5 0 , 5 0 , 5 0 , 5 0 , 5release agent ( 3 ) 2 2 2 2 2aluminum sulfate . xh . sub . 2 o -- 0 , 15 -- 0 , 15 -- 55 % al . sub . 2 ( so . sub . 4 ). sub . 3 cor - responding to al . sup . 3 + -- 0 , 013 -- 0 , 013 -- viscosity , mpas , 22 ° c . 800 800 850 1000 600ph value 7 , 3 6 , 7 7 , 1 6 , 6 7 , 3batter volume , ml 15 15 17 17 16baking time , sec . 70 74 70 63 70weight , g ( average ) 6 , 83 7 , 17 7 , 31 7 , 38 6 , 92weight , % ( relative ) 100 105 107 108 101______________________________________ baking temperature 180 / 185 ° c ., conditioning 72 % r . h ., 6 hours , 26 ° c . ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate ; ( 4 ) corn starch ; ( 5 ) corn starch derivative , octenyl succinate ______________________________________ingredient / recipe no . 49 50 51 52 53______________________________________starch ( 1 ) 100 100 100 100 100water 110 110 110 110 110thickening agent ( 2 ) 0 , 5 0 , 5 0 , 5 0 , 5 0 , 25release agent ( 3 ) 2 2 2 2 2aluminum sulfate , -- 0 , 05 0 , 1 0 , 15 0 , 15anhydrousviscosity , mpas , 22 ° c . 1400 1700 1800 1900 900ph value 7 , 7 7 , 1 6 , 7 6 , 5 6 , 3baking time , sec . 65 65 70 70 73baking temperature , ° c . 180 180 180 180 180weight , g ( average ) 8 , 3 8 , 7 9 , 6 9 , 0 9 , 8weight , % ( relative ) 100 105 116 118 118______________________________________ conditioning 72 % r . h ., 3 hours , 29 ° c . ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate resistance to compression test : testing the maximum force required to compress the specimens by 30 % according to a relative method has shown the following results . number of specimens per trial : ______________________________________recipe weight specimen al sulfate maximum forceno . of g % g / 100 g starch n % ______________________________________49 8 , 25 100 0 98 10050 8 , 70 105 0 , 05 118 12051 9 , 62 117 0 , 1 133 13652 9 , 70 118 0 , 15 153 156______________________________________ ( 1 ) standard deviation n , n = 10 ______________________________________ingredient / recipe no . 54 55 56______________________________________starch ( 1 ) 100 100 100water 100 100 100thickening agent ( 2 ) 0 , 5 0 , 5 0 , 5release agent ( 3 ) 2 2 2calcium carbonat -- 2 -- calcium hydrogen phosphate -- -- 1viscosity , mpas , 22 ° c . 1500 1900 1300ph value 7 , 6 8 , 9 7 , 3baking time , sec . 65 65 70baking temperature , conditioning as in example 12weight , g 9 , 03 8 , 61 9 , 57weight , relativ -% 100 95 106maximum force , n ( 4 ) 11 , 8 12 , 3 14 , 2maximum force , % ( relative ) 100 104 120______________________________________ ( 1 ) potato starch ; ( 2 ) guar ; ( 3 ) magnesium stearate ; ( 4 ) measured at punched disc , 30 mm diameter ______________________________________ingredient / recipe no . 57 58 59 60______________________________________starch ( 1 ) 100 100 100 100water 120 120 120 120thickening agent ( 2 ) 0 , 3 0 , 3 0 , 3 0 , 3release agent ( 3 ) 2 2 2 2calcium hydrogen phosphate -- 1 , 2 -- -- calcium phosphate -- -- 1 , 25 -- calcium dihydrogen phosphate -- -- -- 0 , 9ph value 7 , 4 7 , 1 7 , 0 6 , 6baking time , sec . 28 - 30 28 - 30 28 - 30 28 - 30baking temperature , conditioningas in example 13weight , g 5 , 01 5 , 55 5 , 45 5 , 37weight , % ( relative ) 100 111 109 107______________________________________ ______________________________________ingredient / recipe no . 61 62 63______________________________________starch ( 1 ) 100 50 0water 100 105 110starch derivative ( 4 ) -- 50 100thickening agent ( 2 ) 0 , 5 0 , 5 0 , 5release agent ( 3 ) 2 2 2baking time , sec . 170 180 ( 5 ) baking temperature , ° c . 190 190 190______________________________________ ph value 7 , 2 ; conditioning 73 % r . h ., 24 ° c . ; 24 hours ( 1 ) potato starch ; ( 2 ) guar ;. ( 3 ) magnesium stearate ; ( 4 ) acetylated potato starch , e1422 ; ( 5 ) no longer properly shaped

8General tagging of new or cross-sectional technology

the present invention includes a multi - queue flow - control device , which is implemented on a single chip . the multi - queue device can be configured to implement between 1 and 128 discrete fifo queues . the user has full flexibility configuring queues within the device , being able to program the total number of queues between 1 and 128 . the user can also independently select the individual queue depths . all queues within the device have a common data input bus ( write port ), and a common data output bus ( read port ). data written to the write port is directed to a respective queue via an internal de - multiplexer , which is addressed by a user . data read from the read port is accessed from a respective queue via an internal multiplexer , addressed by the user . data writes and reads can be performed at high speeds ( up to 200 mhz , with access times of 3 . 6 ns in accordance with one embodiment of the present invention ). data write and read operations are totally independent of each other . thus , a queue may be selected on the write port , and a different queue may be selected on the read port . alternately , read and write operations may be selected on the same queue simultaneously . the device provides a full flag ( ff #) and an empty flag ( ef #) that identify the status of the queues selected for write and read operations , respectively . the device also provides a programmable almost full flag ( paf #) and a programmable almost empty flag ( pae #) that identify the status of the queues selected for write and read operations , respectively . the positions of the paf # and pae # flags are programmable by the user . the flags for queue n are specified by the flag name , followed by n ( e . g ., paf # _n ). fig2 is a block diagram of a multi - queue flow - control device 100 in accordance with one embodiment of the present invention . device 100 includes dual - port memory 101 , write port ( de - multiplexer ) 110 , write control logic 111 , active write queue flag circuit 114 , output multiplexer 120 , read control logic 121 , active read queue flag circuit 124 , output register 130 and output buffer 131 . in the described embodiment , dual - port memory is a 4 . 7 mbit memory , which can be logically divided into up to 128 fifo queues , each having a minimum capacity of 9 k bits . in general , write control logic 111 controls write accesses to the various queues in dual - port memory 101 . more specifically , write control logic 111 provides the required control / address signals to input de - multiplexer 110 and dual - port memory 101 in response to a write chip select signal wcs #, a write enable signal wen #, a write clock signal wclk , a write address signal wradd [ 7 : 0 ] and a write address enable signal waden . as described in more detail below , write control logic 111 also provides control signals to active write queue flag circuit 114 , active read queue flag circuit 124 and read control logic 121 . similarly , read control logic 121 controls read accesses from the various queues in dual - port memory 101 . more specifically , read control logic 121 provides the required control / address signals to output multiplexer 120 and dual - port memory 101 in response to a read chip select signal rcs #, a read enable signal ren #, a read clock signal rclk , a read address signal rdadd [ 7 : 0 ] and a read address enable signal raden . as described in more detail below , read control logic 121 also provides control signals to active write queue flag circuit 114 , active read queue flag circuit 124 and write control logic 111 . as described in more detail below , active write queue flag circuit 114 generates a full flag ff # ( input ready flag ir #) and programmable almost full flag paf # in response to the write address wradd [ 7 : 0 ] and the control signals received by write control logic 111 and read control logic 121 . also , as described in more detail below , active read queue flag circuit 124 generates an empty flag ef # ( output ready flag or #) and programmable almost empty flag pae # in response to the read address rdadd [ 7 : 0 ] and the control signals received by write control logic 111 and read control logic 121 . read operations to multi - queue device 100 will now be described . in general , when a queue within dual - port memory 101 is selected for a read operation , the next word in the selected queue automatically falls through output multiplexer 120 to the output register 130 . all subsequent words from the selected queue require an enabled read cycle in order to be routed to the output register 130 . data cannot be read from the selected queue if the queue is empty . the active read queue flag circuit 124 provides an active - low empty flag / output ready signal ( ef #/ or #) indicating when the data read from the selected queue is valid . if the user switches to a queue that is empty , the last word read from the previous queue will remain in the output register 130 . as described in more detail below , dual - port memory 101 exhibits a four - cycle latency when switching from one queue to another queue ( i . e ., during a queue switch ). fig3 is a block diagram of a read flag counter register ( fcr ) system 200 , which is located in read control logic block 121 and active read queue flag circuit 124 , in accordance with one embodiment of the present invention . read fcr system 200 includes read fcr file 201 , register 202 , multiplexers 211 - 214 , adder circuits 220 - 221 , read counters 250 - 251 and read flag logic 260 . read fcr file 201 includes 128 entries , one for each possible queue in multi - queue device 100 . each entry stores a read count pointer for a corresponding queue . each entry of read fcr file 201 is coupled to register 202 via a selection circuit ( not shown ). as described in more detail below , register 202 latches a read count pointer retrieved from read fcr file 201 at the start of a queue switch ( during cycle qs - 1 ). the read count pointer stored in register 202 is applied to the “ 1 ” input terminal of multiplexer 211 and the “ 0 ” input terminal of multiplexer 212 . the output terminal of multiplexer 211 is coupled to the “ 0 ” input terminals of multiplexers 213 and 214 and to adder 220 . similarly , the output terminal of multiplexer 212 is coupled to the “ 1 ” input terminals of multiplexers 213 and 214 and to adder 221 . adders 220 and 221 each add one to the read count values provided by multiplexers 211 and 212 , respectively . adders 220 and 221 apply the incremented read count values to read counters 250 and 251 , respectively . read counters 250 and 251 latch the incremented read count values on rising edges of the rclky and rclkx read clock signals , respectively . read counters 250 and 251 apply output read count values rcnty and rcntx , respectively , to the “ 0 %” and “ 1 ” input terminals of multiplexers 211 and 212 , respectively . in the described embodiment , multiplexers 211 and 212 are controlled by the same control signal rmux 0 , although this is not necessary . multiplexers 213 and 214 are controlled by rmux 1 and rmux 2 signals , respectively . multiplexer 213 provides an output signal rcnt 1 , and multiplexer 214 provides an output signal rcnt 2 , which are used to derive the empty flag , ef # and the programmable almost empty flag , pae #, respectively . the rcnt 2 signal is also routed back to read fcr file 201 , such that the read fcr file is updated to store changes in the rcnt 2 signal during each read cycle . fig4 is a waveform diagram illustrating the operation of read fcr system 200 in accordance with one embodiment of the present invention . the read clock signal rclk , read enable signal ren #, read address enable signal raden and read address signal rdadd [ 7 : 0 ] are applied to read control logic 121 ( fig2 ). relevant cycles of the rclk signal are labeled qs - 1 , qs 0 , qs 1 , qs 2 and qs 3 . prior to read cycle qs - 1 , data is being read from a first queue , which is hereinafter referred to as the present queue ( pq ). at this time , read fcr system 200 is configured as follows . the read clock signal rclk is routed as the read clock signal rclky to read counter 250 . read counter 250 maintains a read count value ( rcnty ) associated with the present queue pq . the rmux 0 signal has a logic “ 0 ” value , such that multiplexer 211 routes the rcnty value provided by read counter 250 to multiplexers 213 and 214 . the rmux 1 and rmux 2 signals both have a logic “ 0 ” value , such that multiplexers 213 and 214 route the rcnty value as the rcnt 1 and rcnt 2 signals , respectively , to read flag logic 260 . at this time , read flag logic 260 generates the empty flag ef # and programmable almost empty flag pae # in response to the read count value rcnty associated with the present queue pq . more specifically , read flag logic 260 generates the empty flag ef # in response to the rcnt 1 signal and a write pointer value wcnt_ef provided by a write fcr system 300 ( fig8 ). similarly , read flag logic 260 generates the programmable almost empty flag pae # in response to the rcnt 2 signal and another write pointer value wcnt_pae provided by the write fcr file . in general , wcnt_ef is the write count pointer of the same queue represented by the rcnt 1 read count pointer , and wcnt_pae is the write count pointer of the same queue represented by the rcnt 2 read count pointer . the operation of multiplexers 315 and 316 is described in more detail in “ method to optimize interfaces between driver and receiver circuits in datapaths ” by prashant shamarao , jason z . mo and jianghui su , u . s . provisional patent application ser . no . 60 / 555 , 716 , filed mar . 23 , 2004 , which is hereby incorporated by reference . each time that a read operation is performed from the present queue pq , the read clock signal rclky is asserted , thereby causing read counter 250 to latch the incremented read count value ( i . e ., rcnty plus 1 ) provided by adder circuit 220 . read flag logic 260 then uses the incremented rcnty signal to generate the ef # and pae # flags associated with the present queue pq . in the present example , the ef # and pae # flags associated with the present queue pq remain de - activated high , thereby indicating that the present queue is neither empty nor almost empty . prior to the start of read cycle qs - 1 , the read address enable signal raden transitions to a logic “ 1 ” state , thereby indicating that a queue switch ( qs ) will be performed . that is , the read operations from the present queue pq will be stopped , and read operations will be performed from a new queue ( nq ) in dual port memory 101 . the address of the new queue nq is identified by the read address signal rdadd [ 7 : 0 ]. the raden and rdadd [ 7 : 0 ] signals are detected at the beginning of read cycle qs - 1 ( at the rising edge of the rclk signal ). in response to the detected raden signal , read fcr file 201 retrieves the read count pointer from the register corresponding to the queue identified by the rdadd [ 7 : 0 ] signal . for example , if the read address signal rdadd [ 7 : 0 ] identifies queue 2 , then read fcr file 201 provides the read count pointer of queue 2 to register 202 . the write fcr system 300 ( fig8 ) also retrieves the write count pointer associated with the addressed queue ( e . g ., queue 2 ) on port “ d ” at this time . data is read from the present queue and the read count value rcnty is incremented during read cycle qs - 1 . by the start of the next read cycle qs 0 , the read count pointer retrieved from read fcr file 201 has been loaded into register 202 . at this time , multiplexer 212 routes the read count pointer stored in register 202 to the logic “ 1 ” input terminals of multiplexers 213 and 214 , and to the input terminal of adder circuit 221 . also at the start of read cycle qs 0 , the rmux 1 signal transitions to a logic “ 1 ” value , thereby causing multiplexer 213 to route the newly retrieved read point counter associated with the new queue nq as the rcnt 1 signal . also , at the start of read cycle qs 0 , the write fcr system 300 provides the newly retrieved write point counter associated with the new queue nq as the wcnt_ef signal . in response , read flag logic 260 starts to generate a new empty flag ef # in response to the retrieved read and write count pointers associated with the new queue nq . data ( dout ) is still read from the present queue ( and the read count value rcnty is incremented ) during read cycle qs 0 . note that the rcnty value associated with the present queue pq signal ( and provided as the rcnt 2 signal ) and a write count pointer associated with the present queue ( wcnt_pae ) are still used to generate the programmable almost empty pae # flag during the read cycle qs 0 . during cycles qs 1 and qs 2 , the read enable signal ren # remains activated low , thereby enabling data values to be read from the present queue pq during cycles qs 1 and qs 2 , and enabling read clock counter 250 to increment the rcnty value at the rising edges of read cycles qs 1 and qs 2 . as described in more detail below , the read enable signal ren # can be de - activated high prior to the beginning of a read cycle , thereby preventing data values from being read from the queue during the read cycle . in this case , the high ren # signal prevents the read clock signal rclky from clocking read counter 250 , such that the read count value rcnty is not incremented during the read cycle . the last data value to be read from the present queue pq is provided during read cycle qs 2 . the read count value rcnty is routed through multiplexers 211 and 214 to read fcr file 201 as the rcnt 2 signal . during read cycle qs 2 , the read count value rcnty is stored as the read count pointer associated with the present queue pq in read fcr file 201 . at the end of read cycle qs 2 , the read count value rcnty provided by read counter 250 is representative of the exact number of read operations that have been performed to the present queue pq , without any prediction , pipelining or forced data out . consequently , the next time the present queue is accessed , the read count pointer retrieved from read fcr file 201 accurately represents the read address of this queue . at the start of read cycle qs 2 , read flag logic 260 provides an empty flag ef # representative of the status of the new queue nq . as described above , this empty flag ef # is provided in response to the read count pointer previously stored in register 202 during read cycle qs 0 and provided as the rcnt 1 signal . note that during cycle qs 1 , read flag logic 260 decodes the address of the new queue nq , and retrieves a previously stored programmable almost empty flag pae #, which identifies the almost empty status of the new queue nq . during cycle qs 2 , read flag logic 260 provides the pae # flag associated with the new queue as the active pae # flag . the active pae # flag associated with the new queue is then updated during cycle qs 3 ( and during subsequent cycles ). this process provides an accurate result , because the earliest that a read operation can be performed to the new queue is during cycle qs 3 . the logic used to generate the programmable almost empty flag is described in more detail in u . s . patent application ser . no . ( attorney docket no . idt - 1895 ], “ synchronization of active flag and status bus flags in a multi - queue first - in first - out memory system ”, by mario au , jason z . mo and cheng - han wu , which is hereby incorporated by reference . also during read cycle qs 2 , a write count pointer associated with the new queue is retrieved on port “ f ” of the write fcr system 300 . during read cycle qs 3 , data is read from the new queue nq . more specifically , data is read from the address of the new queue nq identified by the read count pointer stored in register 202 . at the start of read cycle qs 3 , the read clock signal rclk is routed to read counter 251 as the read clock signal rclkx . at the rising edge of read cycle qs 3 , read counter 251 latches an incremented read count value ( rcntx plus 1 ) provided by adder circuit 221 . during read cycle qs 3 , the rmux 0 signal is controlled to have a logic “ 1 ” state , thereby causing multiplexer 212 to route the incremented read count value rcntx from read counter 251 to multiplexers 213 and 214 . the multiplexer control signal rmux 2 is also controlled to have a logic “ 1 ” value , thereby causing multiplexer 214 to route the incremented read count value rcntx associated with the new queue to read flag logic 260 . the write count pointer associated with the new queue is retrieved on port “ f ” of the write fcr system 300 and provided to read flag logic 260 as the write count pointer wcnt_pae during cycle qs 3 . read flag logic 260 then begins to generate the programmable almost empty flag pae # in response to the new read count pointer rcnt 2 and the new write count pointer wcnt_pae . fig5 is a waveform diagram illustrating the operation of read fcr system 200 in accordance with another embodiment of the present invention . the embodiment of fig5 is similar to the embodiment of fig4 , with differences noted below . in the embodiment of fig5 , the last data value in the present queue pq is read during read cycle qs 0 . because the present queue becomes empty during read cycle qs 0 , the empty flag ef # is activated low during this read cycle . note that the programmable almost empty flag pae # was activated low in previous read cycles . the logic low empty flag ef # prevents additional data values from being read from the present queue , and prevents the read count value rcnty from being incremented . this is accomplished by basic fifo read logic , which feeds back the status of the empty flag ef # to prevent read operations from occurring ( i . e ., an internal read is only activated if the empty flag ef # is high and the read enable signal ren # is low ). the new queue nq is neither empty nor almost empty in the example of fig5 . consequently , the empty flag ef # and programmable almost empty flag pae # are activated high during read cycle qs 2 , thereby indicating the non - empty status of the new queue nq . a data value is read from the new queue nq during read cycle qs 3 in the manner described above in connection with fig4 . fig6 is a waveform diagram illustrating the operation of read fcr system 200 in accordance with another embodiment of the present invention . the embodiment of fig6 is similar to the embodiment of fig4 , with differences noted below . in the embodiment of fig6 , data values are read from the present queue pq through read cycle qs 2 in the manner described above in connection with fig4 . however , in the example of fig6 , the new queue is empty during cycle qs 3 . because the new queue is empty , the empty flag ef # and the programmable almost empty flag pae # are activated low during read cycle qs 2 . the logic low empty flag ef # prevents data values from being read from the new queue , and prevents the read count value rcntx from being incremented . fig7 is a waveform diagram illustrating the operation of read fcr system 200 in accordance with another embodiment of the present invention . the embodiment of fig7 is similar to the embodiment of fig4 , with differences noted below . in the embodiment of fig7 , the read enable signal ren # is de - activated high prior to the rising edge of read cycle qs 1 . the logic high read enable signal ren # prevents a new data value from being read from the present queue during read cycle qs 1 , and prevents the read count value rcnty from being incremented during read cycle qs 1 . in the foregoing manner , a read queue switch can be implemented in a seamless and flexible manner , without requiring forced data fall through or pipelining the output data . fig8 is a block diagram of a write flag counter register ( fcr ) system 300 , which is located in write control logic block 111 and active queue flag circuit 114 , in accordance with one embodiment of the present invention . write fcr system 300 includes write fcr file 301 , register 302 , multiplexers 311 - 314 , adder circuits 320 - 321 , write counters 350 - 351 , and write flag logic 360 . write fcr system 300 is configured in the same manner as read fcr system 200 ( fig3 ). write fcr file 301 includes 128 entries , one for each possible queue in device 100 . each entry stores a write count pointer for a corresponding queue . each entry of write fcr file 301 is coupled to register 302 via a selection circuit ( not shown ). as described in more detail below , register 302 latches a new write count pointer retrieved from write fcr file 301 at the start of a queue switch ( during cycle qs - 1 ). the write count pointer stored in register 302 is applied to the “ 1 ” input terminal of multiplexer 311 and the “ 0 ” input terminal of multiplexer 312 . the output terminals of multiplexers 311 and 312 are coupled to the “ 0 ” input terminals of multiplexers 313 and 314 , respectively , and to adders 320 and 321 , respectively . adders 320 and 321 each add one to the write count values provided by multiplexers 311 and 312 , respectively . adders 320 and 321 apply the incremented write count values to write counters 350 and 351 , respectively . write counters 350 and 351 latch the incremented write count values on rising edges of the wclky and wclkx write clock signals , respectively . write counters 350 and 351 apply output write count values wcnty and wcntx , respectively , to the “ 0 ” and “ 1 ” input terminals of multiplexers 311 and 312 , respectively . in the described embodiment , multiplexers 311 and 312 are controlled by the same control signal wmux 0 , although this is not necessary . multiplexers 313 and 314 are controlled by wmux 1 and wmux 2 signals , respectively . multiplexer 313 provides an output signal wcnt 1 , and multiplexer 314 provides an output signal wcnt 2 , which are used to derive the full flag ff # and the programmable almost full flag paf #, respectively . the wcnt 2 signal is also routed back to write fcr file 301 as a write count signal , such that the write fcr file 301 is updated to store changes in the wcnt 2 signal during each write cycle . fig9 is a waveform diagram illustrating the operation of write fcr system 300 in accordance with one embodiment of the present invention . the write clock signal wclk , write enable signal wen #, write address enable signal waden and write address signal wradd [ 7 : 0 ] are applied to write control logic 111 ( fig2 ). relevant cycles of the wclk signal are labeled qs - 1 , qs 0 , qs 1 , qs 2 and qs 3 . prior to write cycle qs - 1 , data is being written to a first queue in dual - port memory 101 , which is hereinafter referred to as the present queue ( pq ). at this time , write fcr system 300 is configured as follows . the write clock signal wclk is routed as the write clock signal wclky to write counter 350 . write counter 350 maintains a write count value ( wcnty ) associated with the present queue pq . the wmux 0 signal has a logic “ 0 ” state , such that multiplexer 311 routes the wcnty value provided by write counter 350 to multiplexers 313 and 314 . the wmux 1 and wmux 2 signals both have a logic “ 0 ” value , thereby routing the wcnty value as the wcnt 1 and wcnt 2 signals . write flag logic 360 generates the full flag ff # and programmable almost full flag paf # in response to the write count value wcnty associated with the present queue pq . each time that a write operation is performed to the present queue pq , the write clock signal wclky is asserted , thereby causing write counter 350 to latch the incremented write count value ( i . e ., wcnty plus 1 ) provided by adder circuit 320 . the incremented wcnty signal is then used to generate the ff # and paf # flags associated with the present queue pq . in the present example , the ff # and paf # flags associated with the present queue pq remain de - activated high , thereby indicating that the present queue is neither full nor almost full . prior to the start of write cycle qs - 1 , the write address enable signal waden transitions to a logic “ 1 ” state , thereby indicating that a queue switch ( qs ) will be performed . that is , the write operations to the present queue pq will be stopped , and write operations will be performed to a new queue ( nq ) in dual port memory 101 . the address of the new queue nq is identified by the write address signal wradd [ 7 : 0 ]. the waden and wradd [ 7 : 0 ] signals are detected at the beginning of write cycle qs - 1 ( at the rising edge of the wclk signal ). in response to the detected waden signal , write fcr file 301 retrieves the write count value from the register corresponding to the queue identified by the wradd [ 7 : 0 ] signal . for example , if the write address signal wradd [ 7 : 0 ] identifies queue 127 , then write fcr file 301 provides the write count value of queue 127 . the read fcr system 200 ( fig3 ) also retrieves the read count pointer associated with the addressed queue ( e . g ., queue 127 ) on port “ a ” at this time . data is written to the present queue and the write count value wcnty is incremented during write cycle qs - 1 . by the start of the next write cycle qs 0 , the write count pointer retrieved from write fcr file 301 has been loaded into register 302 . in response to the logic “ 0 ” wmux 0 signal , multiplexer 312 routes the write count pointer stored in register 302 to the logic “ 1 ” input terminals of multiplexers 313 and 314 , and to the input terminal of adder circuit 321 . also at the start of the next write cycle qs 0 , the wmux 1 signal transitions to a logic “ 1 ” value , thereby routing the newly retrieved write count pointer ( wcntx ) associated with the new queue nq as the wcnt 1 signal . also , at the start of read cycle qs 0 , the read fcr system 200 provides the newly retrieved read point counter associated with the new queue nq as the rcnt_ff signal . in response , write flag logic 360 starts to generate a new full flag ff # in response to the retrieved read and write count pointers associated with the new queue nq . data ( din ) is written to the present queue ( and the write count value wcnty is incremented ) during the qs 0 write cycle . note that the wcnty value associated with the present queue pq signal ( and provided as the wcnt 2 signal ) and a write count pointer associated with the present queue ( rcnt_paf ) are still used to generate the programmable almost full paf # flag during the read cycle qs 0 . during cycles qs 1 and qs 2 , the write enable signal wen # remains activated low , thereby enabling data values to be written to the present queue pq during cycles qs 1 and qs 2 , and enabling write clock counter 350 to increment the wcnty value at the rising edges of write cycles qs 1 and qs 2 . as described in more detail below , the write enable signal wen # can be de - activated high prior to the beginning of a write cycle , thereby preventing data values from being written to the queue during the write cycle . in this case , the high wen # signal prevents the write clock signal wclky from clocking write counter 350 , such that the write count value wcnty is not incremented during the write cycle . the last data value to be written to the present queue pq is written during write cycle qs 2 . the write count value wcnty is routed through multiplexers 311 and 314 as the write count value wcnt 2 to write fcr file 301 . during write cycle qs 2 , the write count value wcnty is stored as the write count pointer associated with the present queue pq in write fcr file 301 . at the end of write cycle qs 2 , the write count value wcnty provided by write counter 350 is representative of the exact number of write operations that have been performed to the present queue pq , without any prediction or pipelining . consequently , the next time the present queue is written , the write count pointer retrieved from write fcr file 301 accurately represents the last write address for this queue . at the start of write cycle qs 2 , write flag logic 360 provides a full flag ff # representative of the status of the new queue nq . as described above , this full flag ff # is provided in response to the write count pointer previously stored in register 302 during read cycle qs 0 and provided as the wcnt 1 signal . note that during cycle qs 1 , write flag logic 360 decodes the address of the new queue nq , and retrieves a previously stored programmable almost full flag paf #, which identifies the almost full status of the new queue nq . during cycle qs 2 , write flag logic 360 provides the paf # flag associated with the new queue as the active paf # flag . the active paf # flag associated with the new queue is then updated during cycle qs 3 ( and during subsequent cycles ). this process provides an accurate result , because the earliest that a write operation can be performed to the new queue is during cycle qs 3 . the logic used to generate the programmable almost full flag is described in more detail in u . s . patent application ser . no . [ attorney docket no . idt - 1895 ], “ synchronization of active flag and status bus flags in a multi - queue first - in first - out memory system ”, by mario au , jason z . mo and cheng - han wu , which is hereby incorporated by reference . also during write cycle qs 2 , a read count pointer associated with the new queue is retrieved on port “ c ” of the read fcr system 200 . during write cycle qs 3 , data is written to the new queue nq . more specifically , data is written to the address of the new queue nq identified by the write count pointer stored in register 302 . at the start of write cycle qs 3 , the write clock signal wclk is routed to write counter 351 as the write clock signal wclkx . at the rising edge of write cycle qs 3 , write counter 351 latches an incremented write count value ( wcntx plus 1 ) provided by adder circuit 321 . during write cycle qs 3 , the wmux 0 signal is controlled to have a logic “ 1 ” value , thereby causing multiplexer 312 to route the incremented write count value wcntx from write counter 351 to multiplexers 313 and 314 . the multiplexer control signal wmux 2 is controlled to have a logic “ 1 ” value , thereby routing the incremented write count value wcntx to write flag logic 360 . the read count pointer associated with the new queue is retrieved on port “ c ” of the read fcr system 200 and provided to write flag logic 360 as the read count pointer rcnt_paf during cycle qs 3 . write flag logic 360 then begins to generate the programmable almost full flag paf # in response to the new write count pointer rcnt 2 and the new read count pointer rcnt_paf . fig1 is a waveform diagram illustrating the operation of write fcr system 300 in accordance with another embodiment of the present invention . the embodiment of fig1 is similar to the embodiment of fig9 , with differences noted below . in the embodiment of fig1 , the last data value written to the present queue pq is written during write cycle qs 0 . because the present queue is full during write cycle qs 0 , the full flag ff # is activated low during this write cycle . note that the programmable almost full flag paf # was activated low in previous write cycles . the logic low full flag ff # prevents additional data values from being written to the present queue , and prevents the write count value wcnty from being incremented . this is accomplished by basic fifo read logic , which feeds back the status of the full flag ff # to prevent write operations from occurring ( i . e ., an internal write is only activated if the full flag ff # is high and the write enable signal wen # is low ). the new queue nq is neither full nor almost full in the example of fig1 . consequently , the full flag ff # and programmable almost full flag paf # are de - activated high during write cycle qs 2 , thereby indicating the non - full status of the new queue nq . a data value is written to the new queue nq during write cycle qs 3 in the manner described above in connection with fig9 . fig1 is a waveform diagram illustrating the operation of write fcr system 300 in accordance with another embodiment of the present invention . the embodiment of fig1 is similar to the embodiment of fig9 , with differences noted below . in the embodiment of fig1 , data values are written to the present queue pq through write cycle qs 2 in the manner described above in connection with fig9 . however , in the example of fig1 , the new queue is full during cycle qs 3 . because the new queue is full , the full flag ff # and the programmable almost full flag paf # are activated low during write cycle qs 2 . the logic low full flag ff # prevents data values from being written to the new queue , and prevents the write count value wcntx from being incremented . fig1 is a waveform diagram illustrating the operation of write fcr system 300 in accordance with another embodiment of the present invention . the embodiment of fig1 is similar to the embodiment of fig9 , with differences noted below . in the embodiment of fig1 , the write enable signal wen # is de - activated high prior to the rising edge of write cycle qs 1 . the logic low write enable signal wen # prevents a new data value from being written to the present queue during write cycle qs 1 , and prevents the write count value wcnty from being incremented during write cycle qs 1 . in the foregoing manner , a write queue switch can be implemented in a seamless and flexible manner , without requiring forced data fall through or - pipelining the output data . although the invention has been described in connection with several embodiments , it is understood that this invention is not limited to the embodiments disclosed , but is capable of various modifications , which would be apparent to one of ordinary skill in the art . thus , the present invention is only intended to be limited by the following claims .

6Physics

referring to fig1 of the drawings , the reference 10 refers , in general , to a wellbore 10 that penetrates a producing formation f . it is also understood that a casing ( not shown ) can be provided in the wellbore 10 and that production tubing ( not shown ) is installed in the wellbore 10 . four axially - spaced , cylindrical gravel pack support and screening devices 12 a - 12 d are mounted , in any conventional manner , to the wall of the wellbore 10 adjacent the formation f . the devices 12 a - 12 d can be in the form of screens , slotted liners , or any similar type of gravel support device . although not clear from the drawing due to scale limitations , it is understood that the devices 12 a - 12 d define an annular space with the wall of the wellbore 10 that receives one or more gravel packs , or the like , ( not shown ). the purpose of each gravel pack is to improve the integrity of the wall of the wellbore 10 , yet allow recovered fluids to pass to and through the devices 12 a - 12 d and into the wellbore , while preventing the passage of fines or sand from the fluids . since these gravel packs are conventional , they will not be described in any further detail . two electrical drivers 16 a and 16 b are mounted on the inner wall of the device 12 b in a diametrically opposed relationship . the drivers 16 a and 16 b are conventional and , as such , are connected to a source of ac or dc power in a manner to be described and are adapted to supply electrical power , for reasons to be described . a transducer 20 a is mounted on the wall of the wellbore 10 between the devices 12 a and 12 b ; a transducer 20 b is mounted on the wall of the wellbore 10 between the devices 12 b and 12 c ; and a transducer 20 c is mounted on the wall of the wellbore 10 between the devices 12 c and 12 d . the transducers 20 a - 20 c can be in the form of conventional electromechanical transducers , or converters , such as tuning forks , cantilevers , oval - mode tools , magnetostrictive drivers , or piezoelectric transducers . it is understood that each transducer 20 a - 20 c is electrically connected to one of the drivers 16 a or 16 b so that it can be driven by the electrical power output from the driver to cause the transducer to vibrate accordingly . the transducers 20 a - 20 c are designed to operate at a desired , predetermined frequency , and preferably at their resonate frequency . for example , one or more of the transducers 20 a - 20 c can be designed to operate at a relatively high resonate frequency ; while the other transducer ( s ) can operate at a relatively low resonate frequency . as a non - limitative example , if the desired frequency is above 4 khz , the transducers 20 a and 20 b can be in the form of piezoelectric transducers , such as those marketed under the designation pzt - 4 by the edo corporation of salt lake city , utah . in this case , the transducers 20 a and 20 b are connected to the driver 16 a and the frequency , or frequencies , of the output of the driver 16 a is matched to the resonate frequencies of the transducers 20 a and 20 b so that they are driven at their resonate frequencies . if it is desired to operate below 4 khz , the transducers 20 c and 20 d can be in the form of conventional magnetostrictive drivers that are connected to the driver 16 b , in which case the frequency , or frequencies , of the output of the driver 16 b is matched to the resonate frequencies of the transducers 20 c and 20 d so that they are also driven at their resonate frequencies . the transducers 20 a - 20 c are mechanically coupled to the devices 12 a - 12 d in a manner so that vibrations of the transducers 20 a - 20 c are imparted to the devices 12 a - 12 d . the coupling is such that the devices 12 a and 12 b provide equal and opposite loads on the transducer 20 a , so that it can be used to vibrate the devices 12 a and 12 b simultaneously . similarly , the devices 12 b and 12 c provide equal and opposite loads on the transducer 20 b so that it can be used to vibrate the devices 12 b and 12 c simultaneously ; and the devices 12 c and 12 d provide equal and opposite loads on the transducer 20 c so that it can be used to vibrate the devices 12 c and 12 d simultaneously . a sensor 22 a is mounted to the outer surface of the device 12 b and a sensor 22 b is mounted between the outer surfaces of the devices 12 c and 12 d . also , two axially spaced sensors 22 c and 22 d are mounted to the inner surfaces of the devices 12 a and 12 c , respectively . the sensors 22 a and 22 b are adapted to sense pertinent downhole data , such as pressure and temperature , outside the devices 12 a - 12 d , and the sensors 22 c and 22 d are adapted to sense the same data inside the devices . a control unit 24 , which can include , or be in the form of , a microprocessor , or the like , is mounted to the upper end of the device 12 a . although not shown in the drawings in the interest of clarity , it is understood that the control unit 24 is electrically connected to the sensors 22 a - 22 d so that the data sensed by the sensors 22 a - 22 d is transferred to the control unit 24 . the control unit 24 is adapted to process signals from the sensors 22 a - 22 d and generate corresponding output signals . the drivers 16 a and 16 b are also connected to the control unit 24 so that the control unit 24 can provide a signal to the drivers 16 a and 16 b to enable them to drive the transducers 20 a - 20 c . a telemetry device 26 is mounted on the upper end of the control unit 24 . the telemetry device 26 is electrically connected to the control unit 24 and , as such , is adapted to collect the data from the control unit 24 and transmit the data to the ground surface . since the telemetry device 26 is conventional , it will not be described in detail . it is understood that the devices 12 a - 12 d , the drivers 16 a and 16 b , the transducers 20 a - 20 c , the sensors 22 a - 22 d , the control unit 24 , and the telemetry device 26 can be assembled as a single unitary package before being inserted in the wellbore 10 in a conventional manner . a cable assembly 28 , shown by a dashed line , extends from the ground surface to the telemetry device 26 and to the control unit 24 . it is understood that the cable assembly 28 includes electrical conductors for supplying electrical power from the ground surface . although not shown in the drawings in the interest of clarity , it is also understood that the cable assembly 28 extends to drivers 16 a and 16 b and the sensors 22 a - 22 d to also power these units . in operation , the package consisting of the devices 12 a - 12 d , the drivers 16 a and 16 b , the transducers 20 a - 20 c , the sensors 22 a - 22 d , the control unit 24 and the telemetry device 26 is inserted in , and mounted to , the wellbore 10 adjacent the formation f as shown in fig1 . the devices 12 a - 12 d are packed with sand , or the like , to form gravel packs and production is started . fluids recovered from the formation f pass through the gravel packs and the devices 12 a - 12 d and upwardly in the wellbore 10 to the above - mentioned production tubing ( not shown ) for passing to the ground surface , while the devices 12 a - 12 d prevent fines or sand from the fluids from passing with the fluids . the sensors 22 a and 22 b sense the pertinent downhole data , such as pressure and temperature , outside the devices 12 a - 12 d , and the sensors 22 c and 22 d sense this data inside the devices 12 a - 12 d . each sensor 22 a - 22 d generates corresponding signals that are transmitted to the control unit 24 . the control unit 24 processes and analyzes the above signals and is programmed to respond when the fluid pressure outside the devices 12 a - 12 d exceeds the fluid pressure inside the devices 12 a - 12 d by a predetermined amount , indicating that the devices 12 a - 12 d are at least partially clogged with scale . when this happens , the control unit 24 sends a corresponding signal to the drivers 16 a and 16 b to activate them . the power output from the drivers 16 a and 16 b drive their corresponding transducers 20 a - 20 c to cause corresponding vibration of the transducers 20 a - 20 c and therefore the devices 12 a - 12 d at their resonate frequency in the manner discussed above . these vibrations fracture , or break up , the scale accumulating on the devices 12 a - 12 d . the scale and / or materials recovered from the devices 12 a - 12 d are allowed to fall to the bottom of the wellbore 10 , or could be circulated , in any conventional manner , to the ground surface for recovery . in the meantime , the downhole data from the control unit 24 is transmitted to the telemetry device 26 which , in turn , transmits it to the ground surface for monitoring and / or processing . the output from the transducers 20 a - 20 c can be in a frequency range that also stimulates the formation f adjacent the devices 12 a - 12 d and reduces the “ skin ” around the wellbore 10 that can slow the flow of production fluid from the formation to the wellbore . as a result of all of the foregoing , scale accumulating on the devices 12 a - 12 d is broken up without causing any physical or chemical damage to the devices 12 a - 12 d , while the formation f is stimulated and the skin around the wellbore 10 is reduced . the above operation can be terminated after a predetermined amount of time or after the control unit 24 ceases sending the above signal to the drivers 16 a - 16 b in response to data received from the sensors 22 a and 22 b indicating sufficient scale has been removed from the devices 12 a - 12 d . according to another embodiment of the invention as shown in fig2 , the sensors 22 a - 22 d are eliminated and a reservoir model can be utilized to provide information relating to the need to vibrate the devices 12 a - 12 d in the above manner . otherwise the embodiment of fig2 contains the same components as the embodiment of fig1 . according to the embodiment of fig2 , data is initially collected to generate an initial reservoir model that is inputted to the control unit 24 . after production of fluid from the formation f is initiated , the production information is generated and inputted to the control unit 24 which matches the information to the initial model and adjusts the model as necessary to set a working model . as production continues , the additional production data is collected and inputted to the control unit 24 which compares the data to the working model . if there is a match , the data is fed back to the control unit 24 for further processing ; and , if there is no match , the drivers 16 a and 16 b are actuated to drive the transducers 20 a - 20 c in the manner discussed above and thus initiate the vibration / production stimulation cycle described above . fig3 is a graph of the simulated production from the wellbore 10 vs . time and shows the reservoir model of fig2 by the rectangular data points , and a deviation from the model by the triangular data points , both before and after the scale is removed from the devices 12 a - 12 d and the formation f is stimulated , including removal of the skin , in accordance with the foregoing method which can bring the production back to the model values . thus , the system and method according to the above embodiments performs the screening and stimulation functions yet eliminates the problems discussed above . moreover , the above sensing , analysis , and treatment can be done simultaneously in real time . several variations may be made in both of the above embodiments without departing from the scope of the invention . these variations are as follows : 1 . the control unit 24 can be programmed to adjust the pressure differential required to actuate the drivers 16 a and 16 b . 2 . the number , type , and location of the screening devices 12 a - 12 d , the drivers 16 a and 16 b , the transducers 20 a - 20 c , and / or the sensors 22 a - 22 d can be varied . 3 . the sensors 22 a and 22 b could be eliminated and a scale sensor , or detector , could be mounted on each device 12 a - 12 d to directly detect the presence of scale , and any other foreign materials , and generate a corresponding output signal that is transmitted to the control unit 24 for processing in the above manner . 4 . the control unit 24 can be in the form of any type of data processing device . 5 . the above connections between the control unit 24 , the drivers 16 a and 16 b , and the sensors 22 a - 22 d , the connections between the drivers 16 a and 16 b and the transducers 20 a - 20 c , and the connection between the telemetry device 26 and the ground surface could be wireless . 6 . the cable assembly 28 could be eliminated and a battery pack , or the like , could be provided downhole to supply electrical power to the various units . 7 . rather than use the reservoir model discussed in connection with fig2 instead of the sensors 22 a and 22 b , the reservoir model could be used in addition to the sensors 22 a - 22 b . the foregoing descriptions of specific embodiments of the present invention have been presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed , and obviously many modifications and variations are possible in light of the above teaching . the embodiments were chosen and described in order to best explain the principles of the invention and its practical application , to thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto and their equivalents .

4Fixed Constructions

fig1 schematically illustrates a synchronous motor 1 , which comprises a rotor 2 and a stator 3 , in which a field coil 4 and a sensor coil 5 are housed . the synchronous motor 1 is designed as a reaction motor or as a reactive motor , i . e . the rotor 2 contains poles formed by permanent magnets , which are arranged alternately and which are designated by n and s . by charging the field coil 4 with pulses , for example at a frequency of 16 hz , the rotor 2 can be brought to a speed that corresponds to the number of pole pairs and to the frequency , in the case shown , therefore , to eight revolutions per second . the rotor 2 is caused to start by auxiliary means which are not shown . as is the case with the principle of the synchronous motor , these means are well known in the art . the revolutions of the rotor 2 are transferred through a shaft 6 to a transmission 7 , and from there through a shaft 8 , to the display system 9 . the display system 9 , for example , makes possible an analog display by means of several pointers and a number dial . the sensor coil 5 is formed by an induction coil . just like the field coil 4 , the induction coil lies within the range of influence of the magnetic lines of the poles n and s of the rotor 2 . an output of the sensor coil 5 contacts a connection 10 of a voltage divider , which consists of resistors 11 and 12 . in similar fashion , a tap 13 leads from the resistor 12 to a comparator 14 , as is the case with a second output 15 of the sensor coil 5 . when the rotor 2 rotates , the magnetic field lines of the poles n and s periodically cut the sensor coil 5 . in this way , a sinusoidal voltage with zero crossings , the so - called sensor signal , is generated at the input of the comparator 14 . the comparator 14 can also be called a pulse shaper . here , the sensor signal is converted into rectangular pulses . the vertical edges of these pulses lie at the points of the zero crossings of the sensor signal . the rectangular pulses now replace the positive curve traces of the sensor signal . the pulse intervals between the pulses now replace the negative curve traces of the sensor pulses . the output of the comparator 14 is connected to an anti - jitter stage 15 . the purpose of stage 15 is to suppress brief noise pulses , which result from stray effects from the field coil 4 and the sensor coil 5 . the anti - jitter stage 15 contains an inverter 16 and two d - flip - flops 17 and 18 of type mc 14013 ( all the type designations here are catalog merchandise of motorola company , usa ). the output of inverter 16 is connected to terminal 24 and to a first input of d - flip - flop 17 as well as a second input of a nand gate 20 . the output of d - flip - flop 17 is connected to a first input of d - flip - flop 18 . the outputs of d - flip - flop 18 are connected to first inputs of nand gates 19 and 20 . furthermore , the anti - jitter stage 15 has two nand gates 19 and 20 of type mc 14011 , and two nand gates 21 and 22 of the same type . because of their circuitry , they form another flip - flop . the outputs of nand gates 19 and 20 are respectively connected to first inputs of nand gates 21 and 22 . the outputs of nand gates 21 and 22 are connected to a common terminal 23 . the second input of nand gate 21 is connected to terminal 23 at the output of nand gate 22 and the second input of nand gate 22 is connected to the output of nand gate 21 . a second input of nand gate 19 is connected to terminal 25 and to the output of comparator 14 . a pulse generator 26 is also associated with the entire arrangement . this comprises a quartz oscillator 27 and a frequency divider 28 with two outputs . rectangular pulses with frequencies of , for example , 16 hz and 256 hz are present at these outputs . the output with the 256 hz frequency is connected through a line 29 to second inputs of the d - flip - flops 17 and 18 . the output of the frequency divider 28 , at which the 16 hz frequency is present , is connected through a line 30 to a phase comparator 31 . specifically , line 30 is connected to a d - flip - flop 32 of type mc 14013 . another d - flip - flop 33 of the same type is connected through a line 34 with the terminal 23 of the anti - jitter stage 15 . the phase comparator 31 also comprises two other nor gates 35 and 36 of type mc 14025 as well as two further nor gates 37 and 38 of type mc 14001 interconnected as shown . an input of the nor gate 35 is connected with the terminal 25 , and an input of the nor gate 36 is connected with the terminal 24 of the anti - jitter stage 15 . the output of the nor gate 38 is connected through a line 39 with the field coil 4 , whose other side is grounded . the mode of operation of the arrangement according to fig1 is explained in more detail in connection with fig2 - 7 . the letters a , b , and c at the right margin of fig2 - 7 refer to the correspondingly labelled points of the line layout in fig1 i . e . at the respective points , pulses will exist , under the operating conditions explained below , which correspond to the pulses shown in fig2 - 7 . fig2 illustrates the generator pulses with the frequency 16 hz . this frequency is applied to one input of the d - flip - flop 32 of the phase comparator 31 . the respective pulse train a is compared with that pulse train , which is induced in the sensor coil 5 because of the rotation of the rotor 2 . after appropriate signal processing , it is present at terminal 23 ( location b ) of the anti - jitter stage 15 . the two pulse trains are compared with one another . in particular , the output frequency of the pulse generator 26 is the ( constant ) theoretical frequency , and the pulse frequency at location b is the so - called actual frequency . both frequencies are phase shifted with respect to one another in the normal case . depending on the phase shift between the two frequencies , or respectively depending on the difference between the number of generator pulses ( a ) and sensor pulses ( b ) over a prescribed time interval , a sequence of driving pulses is formed on the line 39 ( c ). their different appearance , in dependence on operating conditions , is explained in more detail by means of fig3 through 7 ( always the lower diagram ). the driving pulses are here formed synchronously with sensor pulses ; however , they lie only within the edges of the latter , and do not necessarily extend over the entire width of the sensor pulses . the width of the driving pulses here depends both on the phase shift and on the difference between the theoretical frequency and the actual frequency . the position of the driving pulses at the beginning and / or at the end of the sensor pulses depends on the sign of the phase shift and respectively on leading or lagging conditions . depending on the relative position of the driving pulse with respect to the sensor pulse , a braking or accelerating torque is generated . the magnitude of this torque again is proportional to the phase shift and the frequency difference . by &# 34 ; driving pulses &# 34 ; are also understood such pulses which effect a negative drive , i . e . a braking action . in fig3 the sensor pulses ( b ) are phase shifted and are wider as compared to the generator pulses ( a ). this indicates that the rotational speed has fallen . the rotor trails more and more , and the positive phase shift increases from φ 1 to φ 2 . because of the comparison in the phase comparator 31 , this will generate a sequence of driving pulses with increasing width , where this width is proportional to the phase shift . these driving pulses occur at the end of each sensor pulse . the sensor pulse of course also indicates the position of the respective pole , which generates the sensor pulse , where this position is measured with respect to the field coil 4 . this happens because of the spatial position of the field coil 4 and of the sensor coil 5 with respect to one another , as shown in fig1 . these coils are arranged in a common plane , which runs radially to the rotor 2 . this can be effected particularly suitable in such a fashion that the axes of the field coil 4 and the sensor coil 5 are aligned coaxially with respect to one another , and also coincide with a radius of the rotor 2 . by the position of the driving pulses with respect to the sensor pulses , and consequently with respect to the poles , an accelerating driving pulse is generated . this is symbolically indicated by a &# 34 ;+&# 34 ;. the effect of these pulses is to make the phase shift as small as possible , i . e . to bring it to a value which is conditioned on the stationary driving losses which occur up to the display system 9 . fig4 also shows a sequence of sensor pulses ( b ), which trail the generator pulses ( a ), i . e . the phase shift is positive and progressive . this is a sign that the actual frequency deviates much more strongly from the theoretical frequency , a process that can occur through an especially strong impact - like torque . as a result of comparing the sensor pulses ( b ) with the generator pulses ( a ) in the phase comparator 31 , driving pulses ( c ) are formed , which are correspondingly wider , as is indicated by the cross - hatched pulse in fig4 . the respective driving pulse generates a very much stronger accelerating torque , so as again to reduce the phase shift φ 2 . here too , the accelerating action of the driving pulses is conditioned by the relative position with respect to the sensor pulse or respectively with respect to the pole . fig5 shows a sequence of sensor pulses ( b ) which leads with respect to the generator pulses ( a ), i . e . the phase shift is negative . through the comparison described above , a sequence of driving pulses ( c ) is now generated in the phase comparator 31 . their position with respect to the sensor pulses or respectively poles is such that a braking torque is generated . this is indicated by a &# 34 ;-&# 34 ;. these braking or negative driving pulses essentially restore the agreement of the generator and sensor pulses . fig3 , and 5 show circumstances in which no pole jump &# 34 ; ε &# 34 ; has as yet taken place . a pole jump is defined as a rotational deviation : gap between pole pairs , always specified in angular degrees . in other words : counting the generator and sensor pulses leads to agreement of the pulse numbers . the situation is otherwise in the case explained by means of fig6 and 7 . here , the phase comparator ascertained that , e . g . because of an extremely strong external shock - like torque , a pole advance or a pole lag has been initiated , which is larger than an integer multiple of the pole gap . this means that either the generator pulses have &# 34 ; overtaken &# 34 ; the sensor pulses and therefore the poles ( pole trailing ), or inversely ( pole leading ). this condition could not be eliminated by a simple proportional control , as has been explained by means of fig3 , and 5 . the reason for this is that such a simple control cannot sense a pole jump . however , an embodiment of the subject of the invention eliminates this circumstance . according to this embodiment , the phase comparator 31 is designed in such a fashion that , if the pole advance is greater than an integer multiple of the pole gap ( pole jump ε =- 1 , - 2 , - 3 , . . . ), braking driving pulses can be generated in the full width of the sensor pulses and synchronous with the latter . if the pole trailing exceeds an integer multiple of the pole gap ( pole jump ε = 1 , 2 , 3 . . . ), accelerating driving pulses are generated in the full width of the sensor pulses and synchronous with the latter . with the operating condition , whose effects are shown in fig6 a pole jump exists in the form of a pole trailing by an integer multiple , i . e . the sequence of generator pulses has overtaken the sequence of sensor pulses . in this case , a driving pulse ( c ) is generated in the full width of the sensor pulse and synchronous with the latter . because of its high torque , this again eliminates the trailing condition of the pole , i . e . the rotor 2 is briefly accelerated so strongly that the pole jump is reduced to zero . with the operating condition according to fig7 there exists a pole jump in the form of a pole advance , i . e . the sequence of sensor pulses has overtaken the sequence of generator pulses . in the phase comparator 31 , the comparison described above now generates driving moments with a strong braking action , which again eliminate this pole jump . it should here be endeavored to prevent the pole jump from becoming larger than 1 , especially if the trailing of the pole is to be eliminated . in the case of a pole advance , however , the objective is to reduce the electrical driving power , and this objective may make it suitable to allow larger pole jumps and to balance these out successively , since a braking of the rotor 2 occurs in any event through frictional forces . the arrangement in accord with fig1 can be built up for battery voltages above 3 volts with conventional cmos circuits ( complementary metal oxide semiconductor circuits ). the connection of the battery with the arrangement according to fig1 has not been shown in particular , but has only been represented by &# 34 ;⊕&# 34 ;. with the arrangement shown , only simple pole jumps ( ε =± 1 ) can be sensed . inasmuch as multiple pole jumps ( ε =± 2 , 3 , . . . ) are to be balanced out , the flip - flops 32 and 33 must be replaced by ascending and descending counters or by right - left shift registers . while an embodiment and application of the invention have been shown and described , it will be apparent to those skilled in the art that many more modifications are possible without departing from the inventive concepts herein described . the invention , therefore , is not to be restricted except as is necessary by the prior art and by the spirit of the appended claims .

6Physics

fig1 a to 1 e are cross sections of a semiconductor device composed of a gaas substrate and an fet , a small capacitor and a large capacitor formed on the substrate , showing manufacturing steps according to a first embodiment of the present invention . according to the first embodiment of the present invention , the fet 12 having a gate electrode 12 a and an ohmic electrode 12 b is formed on the gaas substrate 11 and , in forming the gate electrode 12 a of the fet 12 , a metal film 13 is left on a portion of the gaas substrate 11 , as shown in fig1 a . in this embodiment , the gate electrode 1 2 a and the metal film 13 are sputtered au / wsi films . then , as shown in fig1 b , the fet 12 and the metal film 13 are covered by a sio 2 inter - layer film 14 , an opening is formed in the sio 2 inter - layer film 14 to expose a portion of the metal film 13 and a low dielectric constant film 15 is formed on the whole wafer . in this embodiment , the low dielectric constant film 15 is a sin x film formed by plasma cvd . then , as shown in fig1 c , a first conductive film 16 , a high dielectric constant film 17 and a second conductive film 18 are formed in lamination . the first conductive film 16 has a double layer structure having an upper ti layer portion 20 nm thick and a lower pt layer portion 70 nm thick and the high dielectric constant film 17 is of sto . the close adhesion between ti and sin x is high and the reaction of pt to sto is small . in this embodiment , the second conductive film 18 is a pt of tin film 100 nm thick . thereafter , as shown in fig1 d , the second conductive film 18 , a large capacitor 20 is formed by processing the high dielectric constant film 17 and the first conductive film 16 . simultaneously , the second conductive film 18 and the high dielectric constant film 17 are removed correspondingly to the metal film 13 and a small capacitor 19 is formed by further processing the first conductive film 16 . in this case , the first conductive film 16 forms an upper electrode of the small capacitor 19 and a lower electrode of the large capacitor 20 . then , as shown in fig1 e , the large capacitor 20 is buried by an inter - layer film 21 . then , through - holes are formed in respective portions of the inter - layer film 21 on the lower electrode ( first conductive film 16 ) of the small capacitor 19 and the upper electrode ( second conductive film 18 ) of the large capacitor 20 and through - holes are formed in the low dielectric constant film 15 and the inter - layer film , respectively , such that the gate electrode 12 a of the fet and the lower electrode ( metal film 13 ) of the small capacitor 19 , resulting in a wiring 22 . in the shown example , one of electrodes of the fet 12 is connected to the upper electrode of the small capacitor 19 , the lower electrode of the small capacitor 19 is connected to the lower electrode of the large capacitor 20 and the upper electrode of the large capacitor 20 is connected to other elements mounted on the same substrate . fig2 a and 2 b are cross sections of a semiconductor device according to a second embodiment of the present invention , showing manufacturing steps subsequent to the manufacturing step shown in fig1 d . in this embodiment , after the small capacitor and the large capacitor are formed , the wafer surface is flattened by burying them by an inter - layer film 23 as shown in fig2 a and , then , the wiring 22 is formed by forming through - holes in the positions of the respective electrodes of the fet , the small capacitor and the large capacitor , as shown in fig2 b . fig3 a to 3 e are cross sections of a semiconductor device having an fet , a small capacitor and a large capacitor , showing manufacturing steps according to a third embodiment of the present invention . in this embodiment , the fet 32 having a gate electrode 32 a and an ohmic electrode 32 b is formed on the substrate 31 and , in forming the gate electrode 32 a of the fet 32 , a metal film 33 is left on at least two regions of the substrate 31 for use as lower electrodes of the small and large capacitors , as shown in fig3 a . then , as shown in fig3 b , the fet 32 and the metal film 33 are covered by an inter - layer film 34 , an opening is formed in the inter - layer film 34 to expose a portion of the metal film 33 . then , as shown in fig3 c , a high dielectric constant film 35 and a low dielectric constant capacitor 36 are laminated and the low dielectric constant film 36 in a region in which the large capacitor is to be formed is removed by dry - etching using a photo resist 37 as a mask . after the low dielectric constant film 36 is removed , the photo resist 37 is removed and a first conductive film 38 having thickness of 100 nm is formed as shown in fig3 d . then , as shown in fig3 e , the first conductive film 38 , the low dielectric constant film 36 and the high dielectric constant film 35 on other regions than the region in which the small and large capacitors are to be formed . thus , a small capacitor 39 having the high dielectric constant film 35 and the low dielectric constant film 36 as a dielectric layer provided between the upper and lower electrodes and a large capacitor 40 having the high dielectric constant film 35 provided between the upper and lower electrodes are obtained . finally , a wiring is formed in a similar manner to the steps shown in fig1 e or 2 b . as described hereinbefore , according to the present invention in which at least one of electrodes of a first capacitor and at least one of electrodes of a second capacitor having dielectric constant different from that of the first capacitor are formed simultaneously , the manufacturing process can be simplified compared with the case where these capacitors are formed separately . particularly , when a lower electrode of a capacitor and an upper electrode of another capacitor are formed simultaneously , the manufacturing process can be substantially simplified compared with the conventional manufacturing process .

7Electricity

fig1 shows a section of a large size rotating shaft comprising a twistable part 3 , between the first and second sections 1 , 2 , the shaft being connected to a torque measuring device conforming to the invention . when the first section 1 is connected to a motive unit and the second section 2 to a receiving unit , or vice versa , a torque c is transmitted by the motive unit to the receiving unit through the twistable part 3 of the rotating shaft thus generating a relative angular displacement γ between the two sections , proportional to the torque c applied . the device according to the invention , which constitutes a magnetic torsion meter , allows for simply determining this angular shift γ and therefore the applied torque c . in this preferred embodiment of the invention shown in fig1 the torsion meter essentially comprises a double angular comparator constituted by a first rotor 10 made of non magnetic material ( e . g . aluminium or glass fiber ) which is rigidly connected at the level of a first radial plane a to the first section 1 of the rotating shaft . the torsion meter further consists of a second rotor 20 also made of non magnetic material which is rigidly connected at the level of a second radial plane b to the second section 2 of this rotating shaft . each rotor which is in rotation interdependent with the shaft section to which it is connected , is constituted by an annular disk 11 , 21 comprising a series of pins made of ferromagnetic material 12a , 12b , 22a , 22b , regularly spaced one from another and arranged on the concentric coils , pins 12a , 12b of the first rotor 10 being located facing pins 22a , 22b of the second rotor 20 by defining measuring gaps 30a , 30b . in the example shown , the connection between the rotors and the rotating shaft sections is made by means of rigid hemicylindrical sections made of non magnetic material , which are variable in number , for instance 70 to 73 , extending around the twistable part 3 of this rotating shaft . conventionally , the hemicylindrical sections may be secured to the shaft sections by means of anchoring elements ( not shown ) located in the radial planes a and b . since the rotors are rigidly connected to the rotating shaft sections 1 , 2 on both sides of the twistable part 3 of the rotating shaft , the surface facing the magnetic pin series 12a , 12b ; 22a , 22b of rotors 10 , 20 is directly linked to angle of torsion γwhich , as mentioned above , varies linearly way with the torque to be measured . the reluctance of measuring gap 30a , 30b is therefore a direct function of the torque c to be measured , for a given geometry . according to the invention , this rotating reluctance is looped on an exterior magnetic circuit 40 , which is static and has a known constant reluctance , through two smooth gaps 41 , 42 which ensure the flux continuity between this exterior circuit and rotors 10 , 20 of the magnetic comparator . this exterior magnetic circuit is bow - shaped or u - shaped and extends over a limited area of annular rotors 10 , 20 and covers at least one magnetic pin 12a , 12b ; 22a , 22b of each coil . a continuous magnetic excitation means is associated with exterior magnetic circuit 40 to produce a magnetic flux through this circuit and rotors 10 , 20 , the variation of which will depend on the reluctance variation in the measuring gaps 30a , 30b . this excitation means may be constituted by one or more continuous magnets 43 located in the body of bow 44 or , as represented in fig9 by a torus or a solenoid 45 centered on the bow body and fed by a constant discontinuous current . the reluctance variation in the measuring gaps is determined by at least one magnetic measurement sensor , for instance a hall effect sensor 50 , 51 or a magneto resistor device , located in a smooth gap 42 at the level of the exterior magnetic circuit . in practice , these sensors are secured in one of the internal side walls 46 , 47 of the bow which are facing each of annular rotors 10 , 20 and thus the analog electrical signal provided by these sensors can be treated immediately by a treatment circuit 60 , preferably located at the level of the receiving side wall of these sensors . this treatment circuit can group the sensor feed circuits and the amplification circuits of the measuring signal at the same time , as described further on with reference to fig8 but also compensation circuits of thermal drifts . fig2 and 3 are exterior views respectively according to planes ii -- ii and iii -- iii of fig1 the rotating shaft and hemicylindrical sections being removed . as it can be seen on these figures , the u - shaped pins made of ferromagnetic material , ( e . g . refer to the two different embodiments of fig4 and 10 ) distributed over two concentric coils , are installed so that pins 12a , 12b of the first and second coils of the first disk 11 are magnetically linked two by two ( see fig2 ) while pins 22a , 22b of the first and second coils of the second disk 21 are inversely magnetically isolated ( see fig3 ). a magnetic connection , present or not , simply results in a different orientation ( at 90 °) of the pins of the first and second disks , in one case the orientation makes a contact between the two superimposed pins heads of the two coils possible , and in the other case such a contact is impossible . if fig5 a and 5b are more particularly considered , it can be noted that if there is no exterior torque , an initial angular shift ( αi ) exists between the angular positions of the magnetic pins of first rotor 10 and the angular positions of the magnetic pins of second rotor 20 . it is important to note that this initial angular shift between the magnetic pins of the first and second rotors is identical ( thus ensuring a strict identity of the measuring gap reluctances when the torque is nil ) but in an opposite direction on the first and second coils . so , when an exterior torque c which is not nil , is applied between the rotating shaft sections 1 , 2 on its twistable part 3 , and therefore between rotors 10 , 20 , a relative angular shift y is created between pins 12a , 22a ; 12b , 22b which are facing each other through measuring gaps 30a , 30b . the shift produces a variation of these gap reluctances in opposite directions on the first and second coils . therefore a corresponding inverse variation of the magnetic flux going through these pins is generated by the static excitation means is created . fig6 is an electric diagram equivalent to the magnetic measuring circuit allowing for a better understanding of the magnetic flux distribution in the various elements of the double magnetic comparator . the excitation flux o of exterior magnetic circuit 40 is distributed , through smooth gaps 41 , 42 with a constant reluctance rga and rgb , to the magnetic pins of the first and second coils which flux φ1 and φ2 flow on respectively . the geometric structure of the comparator shows two parallel magnetic circuits , with reluctances r1 ( γ )+ rgb and r2 ( γ )+ rgb , subject to the same magneto motive force produced by permanent magnet 43 . inductions b1 and b2 present at the level of smooth gap 42 being proportional to the corresponding flux φ1 ( γ ) and φ2 ( γ ), it is possible starting from the signals s1 and s2 delivered by magnetic sensors 50 , 51 , to determine ratio s ( γ )=( s2 - s1 )/( s2 + s1 )=( b2 - b1 )/( b2 + b1 )=( r1 ( γ )- r2 ( γ )/( r1 (. gamma . )+ r2 ( γ )+ 2rgb ) that is , for small angles γ ( linear field of measurement ) given : the output signal s ( γ ) is therefore directly proportional to the angle of torsion and consequently to torque c ( γ ) exerted on the rotating shaft , parameters k , rgb , r0 being constants depending only on the device geometry . so , by this differential measurement all the variations other than the angular variation γ between the rotors are eliminated and the external effects of the measurement circuit are cancelled . fig7 shows the variations of the output voltage at the pins of the magnetic measurement sensors 50 , 51 , in the above - mentioned linear field , depending on angle γ . a fine adjustment of the measurement device &# 34 ; zero &# 34 ; ( made necessary by the inexact identity of the sensors ) can be done mechanically by slightly moving the sensors in their housing or more simply by an electronic adjustment of the treatment circuit 60 which will be described with reference to fig8 . the treatment circuit 60 processes the analog signals delivered by sensors 50 and 51 . it also comprises the feed circuits of sensors 600 and eventually 610 necessary to control the means of excitation . the signals delivered by these two sensors are respectively supplied to two input amplifiers 620 , 630 which , in addition to their natural function of amplification ensure a compensation of the zero shift and adjust the sensibility of the concerned sensor . moreover , these amplifiers ensure a filtering function of the high frequencies . the output signals of these amplifiers are then delivered on the one hand to an adding circuit 640 and on the other hand to a subtracting circuit 650 respectively in charge of the elaboration of the s2 - s1 difference and of the s2 + s1 total . then an analog divider 660 calculates the ratio s from the output signals of circuits 640 and 650 , a voltage - to - current converter delivering a more usable signal at the output of the divider . various test samples referenced a to g make it possible to adjust and control the treatment circuit operation which is itself preferably fed by a stabilized reference voltage ( e . g . in 28 v ). of course , this treatment circuit might also comprise an analog - digital converter to transform the analog signal supplied by the sensors into a digital signal that is easier to exploit . fig9 and 11 show two examples of the application of the magnetic torsion measuring device according to the invention in which the twistable part of the rotating shaft is replaced by a torsion shaft 3a inserted between two rotating shaft sections 1 , 2 . the device in fig9 is especially adapted to the torque measurement in laboratory with the advantage of reliability for the measurement of torque in both directions when stopped , and the calibration can be carried out in static position . the extremities of shaft section 1 , 2 , on which torsion shaft 3a is pressed , are mounted in bearings 80 , 82 . an exterior casing made of two parts 84 , 86 surrounds the torsion shaft 3a and all the various elements which compose the torsion meter . the exterior magnetic circuit 40 is directly attached on one of parts 84 of the casing while rotors 10 , 20 are anchored on torsion shaft 3a extremities attached on the rotating shaft sections . in order to protect torsion shaft 3a against accidental overtorques and maintain the relative angular displacement between the rotors in a range of values lower than the pin half width , a mechanical protective device ( not represented ) can be usefully implemented to limit these angular displacements . this mechanical protective device can be simply made of at least one male element ( e . g . a finger ) interdependent with one of the first and second rotors and at least one female receiving element interdependent with the other of the first and second rotors to receive this male element with a predetermined clearance . the device in fig1 shows a torsion meter according to the invention interposed between a motive means 100 and a receiving means 110 of a complicated kinematic chain . it can be noted that the number of pins of each rotor mainly depends on the diameter of the rotor , and in the case of small diameters ( e . g . laboratory instruments ), the number of pins can be reduced . for example , the number of pins may be reduced by six to twelve . the pins can also be made in the form of castings made from high resistivity magnetic powder , when the implemented frequencies of use are very high . it can also be noted that although two magnetic sensors are sufficient to obtain the measurement of the torque applied to the torsion shaft or to the twistable part of a rotating shaft making only a single exterior magnetic circuit 40 necessary , it is possible to locate several circuits around rotors 10 , 20 to ensure a better safety to the torsion meter by a redundancy of the results . for instance , it is possible to implement two measuring devices each comprising an exterior magnetic circuit 40 and diametrically opposite to rotors 10 , 20 . such a redundancy can above all be looked for in applications in the field of automobiles where such a magnetic torsion meter can be used , as in the case of power assisted steering , anti skid or motor power control .

6Physics

the protocol of the present invention ensures that at any moment the amount of power consumed by a pd is not more than the amount of power allocated by the pse for the given pd . the protocol of the present invention also ensures that pds do not consume more than the amount of power configured by an administrator on the pse . the protocol of the present invention assumes that all pses supporting power negotiation with pds are capable of providing a certain minimum amount of power ( referred to herein as minp ). it &# 39 ; s also assumed that pds supporting the negotiation are capable of coming up and running power negotiation at minp . the operation and management of the protocol provided by the present invention are managed by protocol subsystems on respective pses and pds . these protocol subsystems maintain their own copies of data and interact with their respective power managers . a power manager on a pd uses its protocol subsystem to change its power levels . it asks its protocol subsystem for more power by requesting a new power mode and waits for its notification before moving to a higher power mode . similarly , the power manager on the pd notifies its protocol subsystem of reduced power consumption requirements when its consumption requirements decrease . the power manager on pd may just be a simple user interface that users interactively manage or a more complex system that is transparent to a user . the power manager on a pse is responsible for allocating power when a pd asks for it . the power manager on a pse is also responsible for either accepting or denying a pd &# 39 ; s request for new power modes . this may be performed based on the amount of remaining unallocated power and user configuration . a pd inserts the following pieces of information into protocol packets that are sent out during the negotiation process . 1 . consumption — the amount of power consumed by the pd at the time the message was sent . 2 . request sequence number ( generated by pd )— used by the pd and pse to differentiate one pd request from another . 3 . management sequence number ( generated by pse )— used by the pd and pse to differentiate one pse request from another . 4 . request set of power levels — generated by pd to specify the set of power levels , one of which it desires to switch to . used by pse to select one of the levels . 5 . trigger value . a pse inserts the following information in protocol packets that it sends out during the negotiation process . 1 . request sequence number — generated by a pd 2 . management sequence number — generated by a pse 3 . available power — generated by a pse . pse uses this field to specify the amount of power available to the pd . 4 . management power — generated by pse . pse uses this field to specify the maximum amount of power that pd may consume after the receipt of the protocol packet . 5 . trigger value . pds come up in a power mode that consumes not more than the power level specified by minp . after being powered , a pd starts advertising its requests by placing the requested set of power levels in its outgoing protocol packets . the pd may change its consumption after the receipt of packets from pd having request sequence number matching the number that pd used when it sent the requests out . the amount of power consumed in such case may not be more than the minimum of management and available power levels indicated in pse protocol packets . whenever pd plans to increase its power consumption beyond the current level , it places the requested set of levels in its outgoing packets and increments request sequence number indicating new request . the pd can increase its consumption only after acknowledgement from pse that indicates that enough amount of power has been allocated at the pse . conversely , when a pd plans to decrease its consumption , it can do so immediately without waiting for pses acknowledgement . when pd specifies this in its outgoing packets by adjusting the requested set of levels and request sequence number , the pse can deallocate power beyond the pd &# 39 ; s latest rate of power consumption . the protocol packets from pse also carry management information from pse . the pd obeys the requests from pse and adjusts accordingly . the flowchart for pd handles all combinations of pd power manager requests , pse power manager requests and pse acknowledgements . the protocol requires that a pd maintain the following pieces of information . 1 . last received protocol data from pse ( referred to herein as lastrxpseprotdata ), and , 2 . protocol data last transmitted by the pd ( referred to herein as lasttxpdprotdata ). the state maintained by the pd is be initialized as below : 1 . last received pse protocol data : management sequence number ( referred to herein as mgmtseqnum ) set to 0 . request sequence number ( referred to herein as reqseqnum ) set to 0 . available power ( referred to herein as availpower ) set to minp . management power ( referred to herein as mgmtpower ) set to − 1 . trigger ( trigger ) set to 0 . 2 . protocol data last transmitted by the pd : consumption set to minp . request sequence number ( reqseqnum ) set to a non - zero random value . management sequence number ( mgmtseqnum ) set to 0 . request set of power levels ( referred to herein as reqsetofpowerlevels ) set to list of power modes that pd requests to transition to . trigger set to false . pses discover pds and power them up . once a pd has been powered , the pse waits for messages from pd . these initial messages from pds are requests to transition away from initial minp ( low power ) mode . pses process requests from power managers for controlling pd power level , acknowledgements from pds for pse requests and requests from pds for new power modes in order as described in the flowchart . fig1 a - 1f illustrate in flowchart form how the present invention handles all three cases at once to enable pse implementation do background processing of , requests from power manager and messages from pse . the description below , as well as fig1 a - 1f and fig2 a - 2e , utilize notation conventions found in the c programming language . the pse manages parameters in such a way that the following conditions always holds true : last transmitted protocol data ( lasttxpseprotdata ). last received protocol data from pd ( lastrxpdprotdata ). allocated power ( allocpower )— the amount of power budgeted by the power manager for the pd . user configuration ( userconfig )— the maximum amount of power that can be consumed by the pd powered by the pse . the value for this field is determined by power management . this field is set by the system before pse begins discovering pds for powering them up . also , the value for this field cannot be less than minp , else the pd cannot be powered . management sequence number ( mgmtseqnum ) initially set to a non - zero random number . request sequence number ( reqseqnum ) initially set to 0 available power ( availpower ) initially set to some power level as determined by power management and in fig1 a - 1f . management power ( mgmtpower ) initially set to − 1 . management sequence number ( mgmtseqnum ) initially set to 0 . request sequence number ( reqseqnum ) initially set to 0 . requested set of power levels ( reqsetofpowerlevels ) initially set to empty - set . power consumption ( consumption ) is initially set to 0 . pse requests pd to change its consumption for either an increase or a decrease of power . power management ( or other application on pse ) can ask pd to reduce its consumption by decreasing the power level indicated by userconfig . the allocated power level is not changed at this time . an increase in the amount of available power is indicated by increasing the power level indicated by userconfig . at this time allocpower is increased by the power management system . a general condition that must be ensured to be true by the power management subsystem for any request is that allocpower & gt ;= max ( userconfig , lasttxpseprotdata . availpower ). fig1 a - 1f illustrate various sequences of acts performed by pses with respect to power negotiation in accordance with the present invention . directing attention to fig1 a , control begins at act 100 , where the pse discovers a pd and the maximum amount of power consumed by the pd can be determined . if a pd is not found or a pd is found but its maximum consumption level cannot be determined , act 100 is repeated until these conditions are satisfied . at act 102 , the pse requests its power manager to allocate power for the pd discovered at act 100 . in response , the power manager sets a value for allocpower . at decision act 104 , a determination is made as to whether allocpower exceeds minp . if the determination has a negative result , control transitions to act 106 , where it is determined that the pd cannot be powered . the pse can choose to come back later to restart the discovery and power up process for the pd . returning to decision act 104 , if the determination has a positive result , control transitions to act 108 , where the pd is powered up . the pse state is initialized as described above , and lasttxpse . protdata . availpower is set to allocpower ( act 110 ). at act 112 , the pse waits for messages from the pd or the pse &# 39 ; s power manager that indicates the pd needs a change in its power consumption . control loops at this act until such a message is received . if a message is received from a pd but not the power manager on the pse , control proceeds to act 114 , where newtxpseprotdata is assigned the value of lasttxpseprotdata . control then transitions to act 116 , where the received message is designated as the current message . control then transitions to act 124 ( fig1 b ). returning to act 112 , if a message is received from the pse &# 39 ; s power manager for a consumption change on a pd ( and optionally a message is also received from a pd for the consumption change ), control transitions to act 118 , where newtxpseprotdata is assigned the value of lasttxpseprotdata . control then transitions to act 120 ( fig1 b ). directing attention to fig1 b , at act 120 , newtxpseprotdata . availpower is assigned the value of allocpower , newtxpseprotdata . mgmtpower is assigned the value of userconfig , and newtxpseprotdata . mgmtseqnum is incremented . this sequence number value may wrap but is not allowed to be a zero value . at decision act 122 , an evaluation is made as to whether any message has been received from the pd that is currently being processed . if decision act 122 has a negative result , control proceeds to act 158 . if decision act 122 has a positive result , control proceeds to decision act 124 , where a comparison is made between lastrxpdprotdata . mgmtseqnum and currrxpdprotdata . mgmtseqnum as well as between currrxpdprotdata . mgmtseqnum and lasttxpdprotdata . mgmtseqnum . if decision act 124 has a negative result , control transitions to act 132 . else , control transitions to act 126 , where newtxpseprotdata . mgmtpower is assigned the value of currrxpdprotdata . consumption and newtxpseprotdata . availpower is assigned the value of currrxpdprotdata . consumption . control then proceeds to decision act 128 , where a comparison is made between lasttxpseprotdata . availpower and newpsetxprotdata . availpower . if decision act 128 has a negative result , control transitions to act 132 , else , control transitions to act 130 . at act 130 , the pse deallocates any power beyond the pd &# 39 ; s consumption value . allocpower is changed accordingly to equal the value of currrxpdprotdata . consumption . directing attention to fig1 c , control transitions to decision act 132 , where currerxpdprotdata . reqseqnum is compared against lastrxpdprotdata . reqseqnum . if decision act 132 has a negative result , control transitions to act 134 , where newrequestfrompd is set to false , and control transitions to act 156 . else , control transitions to act 136 , where newrequestfrompd is set to true . control transitions to act 138 , where the pse selects a power mode from currrxpdprotdata . reqsetofpowerlevels . control transitions to decision act 140 , where a comparison is made between selectedpowerlevel and allocpower . if decision act 140 has a negative evaluation , control proceeds to act 146 , otherwise control transitions to act 142 . at act 142 , power is allocated by the pse such that allocpower is greater or equal to selectedpowerlevel . control then transitions to act 144 . directing attention to fig1 d , at act 144 , newtxpseprotdata . mgtpower is assigned the value of selected powerlevel and newtxpseprotdata . availpower is assigned the value of selectedpowerlevel . control then transitions act 152 . returning to decision act 146 , a comparison is made between lasttxpseprotdata . mgmtseqnum and currrxpdprotdata . mgmtseqnum . if decision act 146 has a positive evaluation , control transitions to act 148 , where newtxpseprotdata . mgmtpower is assigned the value of selectedpowerlevel and newtxpseprotdata . availpower is assigned the value of selectedpowerlevel . control then proceeds to decision act 152 . returning to decision act 146 , if decision act 146 has a negative evaluation , control proceeds to act 150 , where newtxpseprotdata . mgmtpower is assigned the value of selectedpowerlevel and newtxpseprotdata . availpower is assigned the greater of the values of selectedpowerlevel and lasttxpseprotdata . availpower . control then proceeds to decision act 152 . directing attention to fig1 e , at decision act 152 , several conditions are checked . if lasttxpseprotdata . mgmtpower is different from newtxpseprotdata . mgmtpower or lasttxpseprotdata . availpower is different from newtxpseprotdata . availpower or a newrequestfrompd is received , control transitions to act 154 , where newtxpseprotdata . mgmtseqnum is incremented . control transitions to act 156 , where lastrxpdprotdata is assigned the value of currrxpdprotdata . control then transitions to act 158 , where , if lasttxpseprotdata . mgmtsenum is not equal to newtxpseprotdata . seqnum or lasttxpseprotdata . availseqnum is not equal to newtxpseprotdata . availseqnum , then trigger is set to true ; else trigger is set to false . control then transitions to act 160 . at act 160 , lasttxpseprotdata is assigned the value of newtxpseprotdata . control then transitions to act 162 . directing attention to fig1 f , at act 162 , lasttxpseprotdata . trigger is assigned the value of trigger . control transitions to act 164 . at act 164 , a message is sent if trigger has a true value , the content of the message is defined by the data contained in lasttxpseprotdata . control then proceeds to act 166 . at act 166 , the pse waits for messages from the pd or a request from the pse &# 39 ; s power manager that ask for a change in the pd &# 39 ; s power mode . while in this state , the pse transmits messages regularly with content defined by lasttxpseprotdata . once the pse receives a message from a pd or a request from the pse &# 39 ; s power manager , it stops transmitting messages . the lesser the interval between retransmissions , the quicker the power negotiation will settle . if a request is received from the pse &# 39 ; s power manager ( and optionally a message is also received from a pd ), control proceeds to act 168 , where newpsetxprotdata is assigned the value of lastpsetxprotdata . control then returns to act 120 . if no request is received from the pse &# 39 ; s power manager but a message is received from a pd , control transitions to act 170 , where newpsetxprotdata is assigned the value of lasstpsetxprotdata , and control returns to act 124 . fig2 a - 2e illustrate various sequences of acts performed by pds with respect to power negotiation in accordance with the present invention . directing attention to fig2 a , at act 200 , the pd comes up consuming not more than the power consumption level specified by minp . at act 202 , the state of the pd is initialized as described above . at act 204 , messages are sent at intervals by the pd . the contents of the messages are defined by the pd protocol packet data described above . transmission of the messages is performed in parallel with the wait for messages from the pse and a power mode change request from the pd as described below . control proceeds to act 206 , where the pd waits for a message from the pse or a request from the pd &# 39 ; s power manager for a change in the pd &# 39 ; s power consumption . if no message is received from the pse by a request is received from the pd &# 39 ; s power manager , control proceeds to act 208 , where the pd stops transmitting messages . control proceeds from act 208 to act 254 . if messages are received from the pse and optionally a power mode change request is also received from the pd &# 39 ; s power manager , control proceeds to act 210 , where the pd stops transmitting messages and currrxprotdata is assigned the contents of the message received from the pse ( act 212 ). control proceeds to decision act 214 , where a comparison is made between currrxpseprotdata . availpower and a zero value . if decision act 214 has a positive evaluation , control transitions to act 216 . if decision act 214 has a negative evaluation , control transitions to act 232 . directing attention to fig2 b , the negotiating partner is not providing power and the pd is powered inline . assuming a dumb device such as midspan ( which adds power ), the pd can switch to any power mode listed in lasttxpdprotdata . reqsetofpowerlevels . lasttxpdprotdata . copnsumption is assigned the value of new power level consumption level and lastrxpseprotdata is assigned currrxpseprotdata . control then transitions to act 218 . at act 218 , a message is sent right away if currrxpseprotdata . trigger contains a value of true . the contents of the message are defined by lasttxpdprotdata . control then transitions to act 220 , where the pd waits for messages from the pse and power mode change requests from the pd &# 39 ; s power manager . if a power mode change request is received from the pd &# 39 ; s power manager , control transitions to act 276 . if a message is received from the pse , control transitions to act 222 , where currrxpseprotdata is assigned the message received from the pse . control proceeds to decision act 224 , where currrxpseprotdata . availpower is compared to a non - zero value . if decision act 224 has a positive evaluation , this indicates a problem with the pse . the pd can either switch to low power and indicate an error or , in the alternative , power cycle . if decision act 224 has a negative evaluation , control transitions to act 228 , where a message is sent right away to the pse if currrxpseprotdata . trigger is set to true . the contents of this message are defined by lasttxpdprotdata . control then transitions to act 230 , where lastrxpseprotdata is assigned the value of currrxpseprotdata , and control loops back to act 220 . directing attention to fig2 c , at decision act 232 , comparisons are made between lastrxpseprotdata . mgmtseqnum and currrxpseprotdata . mgmtseqnum ; between lastrxpseprotdata . reqseqnum and currrxpseprotdata . reqseqnum as well as lasttxpdprotdata . reqseqnum and currrxpseprotdata . reqseqnum . if decision act 232 has a negative evaluation , control transitions to act 234 , and the power mode of pd is not changed . newpowerlevel is assigned the value of lasttxpdprotdata . consumption and control transitions to act 250 . if decision act 232 has a positive evaluation , control proceeds to decision act 236 , where a comparison is made between currrxpseprotdata . mgmtpower and the value of − 1 . if decision act 236 has a negative evaluation , control proceeds to act 240 , where powerfrompse is assigned the lesser value of currrxpseprotdata . mgmtpower and currrxpseprotdata . availpower . if decision act 236 has a positive evaluation , powerfrompse is assigned currrxpseprotdata . availpower . acts 238 and 240 transition to act 242 , where minpowerlevel is assigned the lesser of powerfrompse and lasttxpdprotdata . consumption . control proceeds to decision act 244 , where a comparison is made between currrxpseprotdata . reqseqnum and lasttxpdprotdata . reqseqnum . if decision act 244 has a positive evaluation , control proceeds to act 246 , where the pd selects and switches to a new power mode ( newpowerlevel ) such that newpowerlevel does not exceed minp . if decision act 244 has a negative evaluation , control proceeds to act 248 , where the pd selects and switches to a new power mode ( newpowerlevel ) such that newpowerlevel does not exceed powerfrompse . control transitions from acts 246 and 248 to act 250 . directing attention to fig2 d , at act 250 , lasttxpdprotdata . consumption is assigned the value of newpowerlevel and lasttxpdprotdata . mgmtseqnum is assigned the value of currrxpseprotdata . mgmtseqnum . control proceeds to decision act 252 , where a check is made to determine whether the pd &# 39 ; s power manager has requested a new power mode . if decision act 252 has a negative evaluation , control proceeds to act 264 . otherwise , control proceeds to decision act 254 , where a comparison is made between newpowermoderequest and lasttxprotdata . consumption . if decision act 254 has a positive evaluation , control proceeds to act 256 , where lasttxpdprotdata . reqsetofpowerlevels is updated to include the new requested power mode and at least one power mode that &# 39 ; s not more than the current pd &# 39 ; s consumption level . control transitions to act 258 , where lasttxpdprotdata . reqseqnum is incremented to the next non - zero value . returning to decision act 254 , if decision act 254 has a negative evaluation , control proceeds to act 260 , where the pd switches to the power level indicated by newpowermoderequest , and lasttxpdprotdata . consumption is assigned the value of newpowermoderequest . control proceeds to act 262 , where lasttxpdprotdata . reqsetofpowerlevels is updated to not include any mode that is more than current consumption . control then proceeds to act 258 , described above . control transitions from act 258 to decision act 264 . directing attention to fig2 e , at decision act 264 , if a message from a pse is being processed , control proceeds to act 266 , where lastrxpseprotdata is assigned the value of currrxpseprotdata . control then proceeds to act 268 . if decision act 264 has a negative evaluation , control skips act 266 and proceeds directly to act 268 . at act 268 , the pd sends a message right away to the pse . the contents of the message are defined by lasttxpdprotdata . control transitions to act 270 , where the pd waits for a message from the pd and / or a power mode change request from the pd &# 39 ; s power manager . if no messages are received from the pse and a power mode change request is received from the pd &# 39 ; s power manager , control returns to act 254 . if messages are received from the pse and optionally a power mode change request is also received from the pd &# 39 ; s power manager , control transitions to act 272 , where currrxpseprotdata is assigned the message received from the pse . control proceeds to decision act 274 , where a comparison is made between currrxpseprotdata . availpower and a zero value . if decision act 274 has a positive evaluation , control returns to act 216 , otherwise control returns to act 232 . directing attention to fig2 f , at act 276 the new requested mode is included in lasttxpdprotdata . reqsetofpowerlevels . control proceeds to act 278 , lasttxpdprotdata . consumption to the new requested mode . at act 280 , lasttxpdprotdata . reqseqnum is incremented . the pd switches to the requested mode at act 282 , and a message is sent to the pse at step 284 . while fig1 a - 1f describe a sequence of acts carried out by a pse in accordance with the present invention , it is to be understood that these acts may be embodied in software instructions encoded on the pse . alternatively , these acts may also be embodied through hardware included in the pse . likewise , while fig2 a - 2f describe a sequence of acts carried out by one or more pds in accordance with the present invention , it is to be understood that these acts may be embodied in software instructions encoded on the pd . alternatively , these acts may also be embodied through hardware included in the pd . while a method and apparatus for negotiating power between pse and pd have been described and illustrated in detail , it is to be understood by those skilled in the art that many modifications and changes can be made to various embodiments of the present invention without departing from the spirit thereof .

6Physics

referring to fig1 an exemplary crop or plant material 100 is shown prior to the harvesting of any particular component thereof . the crop or plant material 100 which is to be harvested may include , for example , wheat , barley or corn . it is noted however , that the invention is not limited to such specific crops but , rather , may be utilized in connection with various types of grain crops , cereal crops and legumes . the plant material 100 depicted in fig1 is representative of a grain crop and comprises a grain material 101 housed within , or covered by , chaff material 102 . the plant material 100 further includes a stem 104 ( the culm , referred to as straw ) having nodes 106 formed therein dividing the stem into internodal sections 104 a - 104 d . the stem 104 may be wrapped , or at least partially wrapped , by a sheath 108 having one or more leaves 110 branching off therefrom . while the grain 101 is the component that is conventionally harvested from the plant material 100 , other components of the plant material 100 also exhibit desirable qualities and may be useful if they are able to be adequately separated and harvested . for example , the sheaths 108 and leaves 110 conventionally exhibit a higher concentration of nutrients and minerals than do other parts of the plant 100 . sheaths 108 and leaves 110 , therefore , may be utilized to enrich the soil for future crops . also , the stem 104 of various types of plant material 100 is rich in cellulose . this cellulose may be extracted for various revenue generating purposes . for example , the cellulose may be used in extruded plastics , or in production of ethanol for use as a renewable energy source . however , efficient extraction of cellulose from the stem 104 requires selective harvesting of the stem 104 from the sheath 108 , leaves 110 and other components . further , extraction of cellulose from the stem 104 becomes easier if the stem is broken apart and separated from the nodes 106 . thus , for efficient extraction of plant cellulose , it becomes desirable to selectively harvest the internodal stem sections 104 a - 104 d separate from the other components . it is additionally noted that , particularly with small grain material , when selectively harvesting a plant component , such as the internodal stems 104 a - 104 d , it is desirable to perform the harvest prior to discharging the specific plant component back to the crop field as it is generally inefficient to try and recapture the specific plant component from the ground during a second pass across the field . referring now to fig2 a harvesting machine 120 is shown according to one embodiment of the present invention . the harvesting machine 120 includes a chassis 122 supporting an operator &# 39 ; s platform 124 and cab 126 from which an operator controls a plurality of other components housed within and / or supported by the chassis 122 which shall be described in more detail below . the harvesting machine also includes a power source 128 , such as an internal combustion engine , to propel the harvesting machine 120 as well as provide power to the various components and mechanisms thereof . in operation , a header 130 located at the forward end of the harvesting machine 120 cuts down a standing crop , or picks up a previously cut crop , of plant material 100 ( see fig1 ) as the harvesting machine 120 is propelled across a crop field . a conveying mechanism within the header 130 , such as an auger 132 , conveys the cut crop transversely across the header 130 to a second conveying mechanism 134 such as , for example , a feeder . the second conveying mechanism 134 transports the cut crop to a primary threshing and separating mechanism 136 . the primary threshing and separating mechanism shown in fig2 includes an longitudinally oriented rotor 138 and cooperatively configured and positioned concave 140 which , while not shown in fig2 may wrap partially around the rotor . the concave 140 may be formed as a grate or a relatively coarse sieve such that the grain material may flow therethrough as the crop is subjected to a rubbing action between the rotor 138 and the concave 140 . in operation , the harvesting machine 120 may include at least two such threshing and separating mechanisms 136 set in a side - by - side orientation . it is noted that while the harvesting machine 120 is shown and described to include a longitudinal rotor primary threshing and separating mechanism 136 , other conventional mechanisms , such as , for example , transversely oriented threshing and separating mechanisms , may also be utilized in conjunction with the present invention as will be appreciated by those of ordinary skill in the art . as the crop is processed through the threshing and separating mechanism 136 , grain falls through the concave 140 and onto a grain pan 142 which may , for example , be coupled with a vibrating energy source for conveyance of the grain along the grain pan 142 toward the aft end of the harvesting machine 120 . the plant material not falling through the concave 140 is conveyed to a beater 144 positioned above and within a grate 146 for further separation of the grain . grain falling through the grate 146 , as well as grain transported rearward by the grain pan 142 , is then sifted through one or more sieves 148 and 150 for additional cleaning and separation of the grain . in conjunction with the sieves 148 and 150 , an air source , such as but not limited to a forced air source 190 , as depicted in fig2 - 4 , including at least one fan or other means for generating a source of forced air directabable by baffles , conduits or other guides that may be used to direct forced air upwards through the sieves 148 and 150 to further remove chaff and other impurities that may be intermixed with the grain . such chaff and other relatively light impurities are conveyed rearward to be discharged from the harvesting machine 120 while the grain passes through the sieves 148 and 150 into a grain collection zone 152 . a conveying mechanism 154 , such as an auger , conveys the grain laterally to yet another conveying mechanism 156 , such as a grain elevator , which discharges the grain into a central storage vessel 158 . while the grain is discharged through the concaves 140 and the grate 146 , the straw is discharged from the beater 144 to a straw conveyor 160 such as , for example a straw walker , as will be appreciated by those of skill in the art . the straw conveyor 160 transports the straw , which largely comprises the stems of the harvested crop material , to a secondary threshing and separating mechanism 162 . the straw conveyor 160 may also be configured as another sieve so as to provide additional separation of the crop material passing therealong . the secondary threshing and separating mechanism 162 may include a rotor 164 and concave 166 as did the primary threshing and separating mechanism 136 . however , the secondary threshing and separating mechanism 162 may include different design features than the primary threshing and separating mechanism 136 . for example , if both primary and secondary threshing and separating mechanisms 136 and 162 are designed as longitudinally disposed rotors with mating concaves such as shown , the rotor 164 and concave 166 of the secondary threshing and separating mechanism 162 may be designed to be smaller , in length and / or diameter than the rotor 138 and concave 140 of the primary threshing and separating mechanism 136 . further , the secondary threshing and separating mechanism 162 may be designed to be more aggressive than the primary threshing and separating mechanism 136 in that the tines or other rubbing components positioned thereon may exhibit different spacing or configuration than those of the primary rotor 138 . similarly , the concave 166 of the secondary threshing and separating mechanism 162 may exhibit a different grating arrangement , such as the size of openings therein , with respect to the concave 140 of the primary threshing and separating mechanism 136 . the difference in aggressiveness between the primary threshing and separating mechanism 136 to the secondary separating and threshing mechanism 162 is based , at least in part , on which plant components are to be harvested by each . for example , as previously discussed , the primary threshing and separating mechanism 136 is designed to separate and harvest the grain material , while the secondary separating and threshing mechanism is configured to harvest a separate component of the crop material , such as , for example the stems , or more particularly the internodal stems ( i . e ., 104 a - 104 d shown in fig1 ). thus , after separating grain from the crop material , the secondary threshing and separating mechanism 162 , when used to harvest the internodal stems , serves to break the stems of the crop material at locations proximate the nodes 106 ( fig1 ) and then discard the nodes and other impurities through the secondary concave 166 while retaining the internodal stems 104 a - 104 d . a secondary beater 168 with an associated grate 170 may be used to further separate the stems from the nodes . a sieve 172 ( or plurality of sieves ) may be positioned to receive the discharged material from the secondary beater 168 and grate 170 ( or alternatively , if a secondary beater 168 is not used , directly from the secondary threshing and separating mechanism 162 ) for further cleaning and separation . the sieve ( s ) 172 may be combined with a forced air source , as previously described with respect to sieves 148 and 150 , to help separate the plant component being harvested from the undesired components . thus , in harvesting internodal stems , the nodes and other components ( e . g ., remaining chaff , sheaths and / or leaves ) may pass through the sieve 172 for combination with the undesired material previously separated from the grain , the combined stream of undesired or non - harvested plant components being discharged through an outlet port 174 back to crop field . it is noted that , while not shown , the harvesting machine 120 may also include a system or mechanism associated with “ rethreshing ” the plant material as will be appreciated by those of ordinary skill in the art . it is further noted that such rethreshing systems and mechanisms are not to be confused with the secondary threshing and separating mechanism 162 disclosed herein . particularly , as noted above , rethreshing systems are designed to collect and process an amount of crop material discharged from the primary threshing and separating mechanism in an attempt to obtain an additional amount of grain therefrom . in contradistinction , the secondary threshing and separating mechanism disclosed herein is directed to selectively harvesting another component ( i . e ., other than grain ) from the plant material of the crop . upon discharge from the secondary threshing and separating mechanism 162 and / or secondary beater 168 , the harvested plant component ( e . g ., the internodal stems ) may be conveyed to a packaging mechanism 176 . the packaging mechanism 176 may be configured to consolidate and package the harvested plant components into a bale or other similar package that is conveyed through a discharge port or chute 178 . the packaged plant component material may be discharged to the crop field for subsequent collection , or alternatively , discharged to a storage vehicle , such as a trailer being mechanically coupled to and pulled behind the harvesting machine 120 , or a truck driven alongside the harvesting machine 120 . as shown in fig3 which depicts a harvesting machine 120 ′ according to another embodiment of the present invention , the harvesting machine 120 ′ need not have a packaging mechanism integrally associated therewith . rather , a second vehicle 180 housing a packaging mechanism 176 ′ may be mechanically coupled with and pulled behind the harvesting machine 120 ′. in such a case , the component being harvested may be discharged from the harvesting machine 120 ′ after passing through the secondary threshing and separating mechanism 162 and / or the secondary beater 168 . the selectively harvested plant component is then collected by the second vehicle 180 and packaged accordingly . in yet another embodiment of the present invention , shown in fig4 as harvesting machine 120 ″, the secondary threshing and separating mechanism 162 ′ may be housed in a second vehicle 180 ′. thus , after passing through the primary threshing and separating mechanism 136 of the harvesting machine 120 ″, the portion of the crop containing the desired components for additional harvesting ( e . g . the straw / stems ) may be discharged from the harvesting machine 120 ″ to the second vehicle 180 ′ for processing via the secondary threshing and separating mechanism 162 ′. the second vehicle 180 ′ may further include a packaging mechanism 176 ′ for consolidating and packaging the harvested material prior to discharge from the second vehicle 180 ′. additionally , the second vehicle may include an outlet port 174 ′ for discharging undesired plant material ( e . g ., nodes and chaff ) separated out via the secondary threshing and separating mechanism 162 ′. as has been noted above , when selectively harvesting one or more additional components from a given crop such as , for example , the internodal stems , it is often desirable to not discharge the harvested components back to the crop field without proper consolidation and packaging in order to ensure an efficient harvest . thus , if a packaging mechanism is not being utilized , it may be desirable to immediately store the harvested crop , such as in an auxiliary storage tank associated with the harvesting machine 120 or , alternatively , in a storage vehicle pulled by , or driven adjacent to , the harvesting machine 120 . additionally , if the plant component ( other than grain ) being harvested includes the stems , it may be desirable to package the harvested components with material that is biodegradable and / or combustible depending on the intended use of the harvested component material . for example , if the component material is to be used as a combustible energy source , it may be desirable that the packaging material also be combustible such that the component material need not be “ unwrapped ” or “ unpackaged ” before use . such packaging material might include , for example , a web or mesh - type paper - based product that may be wrapped about a mass of the plant component material after consolidation thereof . while the invention may be susceptible to various modifications and alternative forms , specific embodiments have been shown by way of example in the drawings and have been described in detail herein . however , it should be understood that the invention is not intended to be limited to the particular forms disclosed . rather , the invention includes all modifications , equivalents , and alternatives falling within the spirit and scope of the invention as defined by the following appended claims .

0Human Necessities

the process for producing ucn - 01 according to the present invention firstly requires only a solution containing ucn - 02 . using such a solution , in conformity with the present invention , highly purified ucn - 01 can be produced at an excellent efficiency in a simple manner . any solution containing ucn - 02 may be used as the solution containing ucn - 02 in accordance with the present invention . suitable solutions containing ucn - 02 include , for example , a solution obtained by oxidizing staurosporine in a solution comprising dimethyl sulfoxide and an aqueous alkali solution as discussed in aforementioned japanese published unexamined patent application 94 / 9645 . solutions containing ucn - 02 may contain ucn - 01 . therefore , when the solution containing both of ucn - 01 and ucn - 02 , which is obtained by the process for producing ucn - 01 , is treated by the process of the present invention , the solution containing ucn - 01 , which consists of both of ucn - 01 changed from ucn - 02 and ucn - 01 existing in the original solution , is obtained , and ucn - 01 can be obtained in high yield without separation of ucn - 02 from the solutions , the reaction to isomerize ucn - 02 to ucn - 01 can be carried out by adding water so that the concentration of water in the solution is preferably 50 v / v % or more , more preferably 90 v / v % or more , and adjusting the solution to preferably ph 5 or less , more preferably ph 1 to 3 , further more preferably ph 2 to 2 . 5 . the concentration of ucn - 02 in the reaction mixture is preferably 25 g / l or less , more preferably 5 to 10 g / l . when ucn - 01 is contained in the reaction solution , the combined concentration of ucn - 01 and ucn - 02 in a reaction mixture is adjusted to the aforementioned concentration . acids to adjust ph include , among others , acetic acid , hydrochloric acid , sulfuric acid , trifluoroacetic acid , methanesulfonic acid , trifluoromethanesulfonic acid , p - toluenesulfonic acid and xylenesulfonic acid . further , hydrochloric acid or sulfuric acid is preferably used , and hydrochloric acid is more preferably used . the reaction temperature is 0 to 50 ° c ., preferably 20 to 30 ° c . ; and the reaction time is 1 to 24 hours . when the reaction is complete , the reaction mixture is adjusted to ph 7 or more , whereby ucn - 01 is precipitated from the reaction mixture . the precipitate of ucn - 01 is separated from the reaction mixture in a conventional manner such as a filtration . a solution containing ucn - 01 and ucn - 02 was prepared by dissolving staurosporine ( 1 . 0 g ; 2 . 1 mmol ) in 100 ml of dimethyl sulfoxide , followed by addition of 10 ml of 0 . 3 mol / l sodium hydroxide , and then stirring the resulting mixture at room temperature for 8 hours . the ucn - 02 / ucn - 01 ratio in the solution was 14 . 2 %. water ( 33 ml ) was added to the solution to dilute the solution ; and the resulting dilution was passed through a column ( 25 ml volume ) packed with diaion sp - 207 manufactured by mitsubishi chemical industries , co ., ltd . after the solution was passed through the column , sp - 207 was treated sequentially with 25 ml of a 70 % dimethyl sulfoxide solution , 75 ml of water , and 125 ml of an aqueous 0 . 02 mol / l hydrochloric acid solution , followed by elution of ucn - 01 and ucn - 02 with an aqueous 60 % acetone solution containing 0 . 005 mol / l hydrochloric acid . the resulting elution was concentrated by two - fold to remove acetone . then , by using ( 1 ) 1 mol / l hydrochloric acid , ( 2 ) 1 mol / l sulfuric acid , ( 3 ) 1 mol / l trifluoroacetic acid , ( 4 ) 1 mol / l methanesulfonic acid , ( 5 ) 1 mol / l p - toluenesulfonic acid , or ( 6 ) 1 mol / l xylenesulfonic acid , the resulting solution was adjusted to ph 2 . 2 and agitated overnight at room temperature , to isomerize ucn - 02 to ucn - 01 . the ucn - 02 / ucn - 01 ratio in each of these solutions are shown in table 1 . by adjusting these solutions to ph 8 . 5 by using aqueous 1 mol / l sodium hydroxide and subsequently filtering the resulting solution , ucn - 01 was recovered . the recovered weight and recovery are also shown in table 1 . ucn - 01 prepared under the conditions in example 1 was dissolved in 200 ml of chloroform , and the solution was subsequently concentrated to 7 ml . ucn - 01 was crystallized from the solution , and 0 . 7 g of ucn - 01 crystal ( purity 99 %) was recovered . the content of ucn - 02 in the recovered ucn - 01 crystal was 0 . 2 %.

2Chemistry; Metallurgy

referring now to the drawings , and in particular to fig1 a and 1b , there is shown a front truck ft and a rear truck rt of a four - axle railway car or vehicle . the front truck ft includes a pair of wheel axle units w1 and w2 while the rear truck rt includes a pair of wheel axle units w3 and w4 . the wheel axle units w1 , w2 , w3 and w4 have associated magnetic pickup devices p1 , p2 , p3 and p4 , respectively , which may take the form of conventional tachometer generators . each of the tachometer generators is disposed in close proximity to a toothed wheel which is driven by each of the wheel axle units . thus , the magnetic generator senses the passing teeth of the driven gears to produce electrical signals or pulses which have a frequency proportional to the angular rotation of the respective gears . that is , the tachometer generators produce alternating current signals having a frequency which varies with the rotating speed or velocity of the respective wheel axle units . it will be seen that the output of each of the magnetic pickup devices p1 , p2 , p3 and p4 is connected to the input of an associated velocity measuring circuit v1 , v2 , v3 and v4 , respectively . each of the velocity measuring circuits is basically a converter which includes a pulse shaper , counters and buffer latches . it will be appreciated that a . c . signals are fed to the pulse shaper which produces constant - amplitude , square - wave pulses which have a repetition rate proportional to the input frequency . next , the square - wave pulses are fed to a gating circuit which allows a high frequency clock input to the counters to produce an output which is inversely proportional to the frequency of the particular wheel axle unit being monitored . then , the velocity count signals are fed to buffer latches which provide the necessary stabilization and isolation . as shown , the outputs of the velocity measuring circuits v1 , v2 , v3 and v4 are connected to the inputs of the respective rate differentiators r1 , r2 , r3 and r4 , and the outputs of velocity measuring circuits v1 and v2 are connected to the inputs of truck highest velocity circuit th1 while the outputs of velocity measuring circuits v3 and v4 are connected to the inputs of the truck highest velocity circuit th2 . the differentiating circuits operate in a wellknown manner to perform a time derivation for obtaining a rate signal having one polarity when the vehicle is decelerating and the opposite polarity when the vehicle is accelerating . each of the truck highest velocity circuits th1 and th2 is simply a diode tree and operational amplifier auctioning circuit which senses and selects which output signal from either or both of the velocity measuring circuits v1 and v2 has the highest value . the output signals from the truck highest velocity circuits th1 and th2 are fed a car highest velocity circuit ch which selects the output signal from either or both of the circuits th1 and th2 which has the highest amplitude . the velocity output signal from the car highest velocity circuit ch is fed to the input of a car rate differentiating circuit crd which performs a time derivation for obtaining an output substantially proportional to the rate of change of the input . the output from differentiator crd is connected to one input of a synchronous slip logic circuit ssl which will be further described hereinafter . returning now to the rate differentiating circuits , it will be seen that the outputs of the rate differentiators r1 and r2 are connected to the inputs of truck rate comparison circuit tr1 while the outputs of the rate differentiators r3 and r4 are connected to the inputs of the truck rate comparison circuit tr2 . each of the outputs of the truck rate comparators tr1 and tr2 are connected to the two inputs of a car rate comparator crc . as shown , the output of the comparator crc is connected to another input of the synchronous slip logic circuit ssl . it will be seen that the final or third input to the synchronous slip logic circuit ssl is coupled to a code recognition circuit cr which is fed by a rate trainline isolation circuit rti . a requested brake rate signal is applied to terminal 1 which is connected to the input of the rate trainline isolation circuit which may include an optical diode and transistor amplifier to minimize the effects of noise and interference on the system . the rate signal may be automatically generated when the system is placed in a braking mode status and may be a voltage which is representative of , for example , - 8 mphps miles per hour second ( mphps ). the code recognition circuit may be a digital - to - analog converter for providing a voltage to the third input of logic circuit ssl . the output of the logic circuit ssl is fed to the input of a data processor dp which is connected to a slip control valve scv . the data processing apparatus dp may include a main logic portion having a plurality of logical gating inverting and amplifying circuits which receive and process the input data to cause a high or low output which is connected to the slip control valve scv of the front truck ft . in practice , the slip control valve scv of the front truck may take the form of a conventional solenoid electropneumatic dump valve which is capable of applying the pressure during braking , venting the pressure during brake release and holding the pressure during lapping operation . in viewing fig1 a and 1b , it will be seen that a duplicate set of apparatus is provided for the rear truck rt as indicated in the dashed lines . in the present instance , the front truck is selected to provide the single truck staging in order to determine whether synchronous wheel slip is occurring during a controlled braking mode of operation . thus , if desired , the rate trainline isolation circuit rti &# 39 ;, the car highest velocity circuit ch &# 39 ;, the code recognition circuit cr &# 39 ;, the car rate differentiating circuit crd &# 39 ;, the synchronous slip logic circuit ssl &# 39 ;, the data processing circuit dp &# 39 ; and the slip control valve scv &# 39 ; of the rear truck rt may be used in place of the front truck apparatus to provide the single truck staging operation for determining a synchronous wheel slip condition on the railway vehicle . in describing the operation , it will be assumed that the vehicle is in a braking mode and is decelerating so that the velocity of the vehicle is following the velocity curve as shown in fig2 . thus , as soon as the brakes are applied , namely , a time zero ( 0 ), the velocity of the vehicle begins to decrease and under ideal conditions the vehicle will follow the linear velocity curve v which is shown by the partially solid and dashed line . it will be noted that if the vehicle continues to decelerate at a uniform speed , the car rate will remain constant as shown by the solid and dashed line curve rcr in fig3 . however , let us assume that a synchronous wheel slip begins to occur at point 1 of the curves of fig2 and 3 , namely , that the braking force on all four wheel axle units of both trucks is greater than the available adhesion which exists between the wheels and the rails . further , it is assumed that the degree of synchronous wheel slip lies within a range which is less than the rate trip signified by the band between the requested car rate curve rcr and the rate trip curve rt of fig3 thus , the synchronous wheel - slip condition occurs on both trucks and their velocities deviate from the linear velocity curve v and begin to follow the curve v 1 - v 2 where v 1 represents the speed of the front truck and v 2 represents the velocity of the rear truck . in viewing the curves of fig2 and 3 , it will be observed that as the axle velocities decelerate faster than the vehicle velocity , the deceleration rates of the trucks begin to change in the negative direction but remain above the trip rate level and within the differential band of the rate curves rcr and rt . now if the car rate comparator crc receives two inputs which are equal or within a given range , this will indicate or signify that all four axles are rotating at substantially the same speed . thus , the comparator crc supplies a signal to the input of the synchronous slip logic circuit ssl . now if the output of the car rate differentiator crd is larger than the output of the requested code recognition circuit cr , then the synchronous slip logic circuit ssl produces an output which is processed by the data processor dp to cause the energization of the slip control valve scv so that pressure in the brake line for the front truck ft is vented . the venting of the brake line to atmosphere causes the release of the brakes in both wheel axle units w1 and w2 of the front truck ft . the brake reduction causes the deceleration rate of the axle units w1 and w2 to slow up so that the velocity v 1 of the wheels tends to deviate from velocity v 2 of axle units w3 and w4 as shown at point 2 of fig2 . at the same time , the rate r 1 begins to increase as shown at point 2 of fig3 . after a slight delay , the velocity of the wheels on units w1 and w2 will begin to regain speed and will begin to return to the ideal car velocity as shown by point 3 in fig2 . that is , in viewing fig3 it will be seen that when the deceleration rate is zero at point 3 , the velocity of the axle units w1 and w2 will begin to increase back up to the vehicle velocity . approximately at this time the output signal from the truck rate comparator tr1 deviates sufficiently from that of truck rate comparator tr2 , namely , the differential input voltages to car rate comparator crc exceeds the voltage range between cr and rt , so that the input signal to the first input of the synchronous slip logic circuit ssl is removed . thus , the synchronous slip logic circuit ssl no longer supplies the data processor dp , and the wheel axle units w1 and w2 of the front truck will initially be brought up to the vehicle velocity and then the wheel axle units of the rear truck will subsequently be brought up to the velocity of the vehicle whereupon the braking effort is effectively reinstituted on all of the wheel axle units so that the vehicle may be efficiently and safely brought under a controlled braking and / or stopping at a station or the like . it will be understood that various alterations and changes may be made by those skilled in the art without departing from the spirit and scope of the subject invention . further , with the advent of microprocessors and minicomputers , it is evident that the various functions and operations may be carried out and processed by a suitably programmed computer which receives the different inputs and produces the appropriate output . therefore , it will be appreciated that certain modifications , ramifications , and equivalents will be readily apparent to persons skilled in the art , and accordingly , it is understood that the present invention should not be limited to the exact embodiment shown and described , but should be accorded the full scope and protection of the appended claims .

1Performing Operations; Transporting

referring initially to fig1 and 2 , a warming cabinet 10 includes a generally rectangular housing that encases a warming cavity 14 . warming chamber 12 is defined by oppositely disposed internal side walls 16 and 18 , upper and lower walls 20 and 22 , and rear wall 24 . thus , the warming chamber 12 is configured to receive food product therein via , for example , a plurality of food racks ( not shown ) that maybe supported , for example , by the side walls 16 and 18 . if desired , the cabinet 10 may be mounted on appropriate rollers to facilitate its portability . the cabinet 10 further includes a door 46 that is connected to the cabinet via hinges 48 that allow the door to swivel between an open position to render the cavity 14 accessible to the user , and a closed position to completely enclose the cavity . door 46 further includes a latch 50 having a magnet 52 disposed on an inner contact surface that mates with a strikeplate 54 to form a door switch 55 . the switch forms part of a sensor 56 that is mounted into the front surface 13 of the cabinet 10 . accordingly , when the door is closed , the magnet 52 and strikeplate 54 are in direct contact , which is disrupted upon opening the door 46 . as will be described in more detail below , the sensor 56 is connected to control 44 and provides a signal indicating whether the door 46 is open or shut . the door 46 may include an insulating material , or any other suitable material that is capable of minimizing heat loss from the warming cavity 14 when the door is closed . additionally , the door 46 may include a transparent section so as to reveal the warming chamber 12 to the user when closed . the warming chamber 12 further includes a temperature sensor 42 that is mounted onto the inner surface of rear wall 24 so as to avoid being damaged by either the food product or accessories disposed within the cavity 14 . the temperature sensor comprises a thermostat in accordance with the preferred embodiment . cabinet 10 further includes a control 44 that is installed having a faceplate 45 generally flush with a front surface 13 of the cabinet 10 above the warming chamber 12 so as to be accessible to a user . for example , several operating parameters for the warming chamber 12 may be selected via knobs and or buttons on the control , such as power , temperature control , and humidity control . as will be described in more detail below , the control 44 will provide a current supply to a heating element 26 when it is determined that the temperature of the warming cavity 14 , as indicated by the thermostat 42 , is less than the desired temperature indicated by the user on the control 44 . it should be appreciated that conventional warming cavities such as that in accordance with the preferred embodiment are typically configured to introduce moisture into the cavity so as to control the humidity therein . the present invention contemplates such a configuration , and accordingly a reservoir may be attached to the cavity 14 via a conduit having an opening into the cavity ( not shown ) that is configured to introduce a fluid , such as water , into the cavity at predetermined intervals as is understood by those having ordinary skill in the art . referring still to fig2 a plurality of heating elements 26 extend through side and rear walls 16 , 18 , and 24 , respectively , and optionally through bottom wall 22 , and are connected to the control 44 via a bus 25 . alternate embodiments may be produced having only one heating element that may comprise a single long heating wire that wraps around the cavity numerous times . the heating elements 26 comprise elongated wires in accordance with the preferred embodiment having a high resistance that produce a significant amount of heat in response to current , as is well known in the art . accordingly , when elements 26 receive current from the control 44 via a power source ( not shown ), heat is supplied uniformly to the interior cavity 14 . each wall of the warming chamber 12 comprises a laminate having an inner and outer shell 28 and 30 , respectively , that surround an insulation layer 32 . the insulation layer 32 may comprise fiberglass sheets , or a suitable alternative insulator , so as to maintain the generated heat within the warming chamber 12 . outer shell 30 encloses warming chamber 12 and provides protection from the ambient environment . referring also to fig3 each heating element 26 , in accordance with the preferred embodiment , comprises a high resistance wire 34 surrounded by a silicone rubber sheath 36 . the heating element 26 further includes a metallic braid 38 for strength and grounding purposes that is surrounded by an outer silicone rubber jacket 40 . a similar warming chamber is described in u . s . pat . nos . 3 , 521 , 030 and 3 , 800 , 123 , the disclosures of which are incorporated by reference as if set forth in full herein . referring now to fig4 the anticipator circuit 58 constructed in accordance with the preferred embodiment includes the control 44 having a microprocessor 60 disposed therein that receives signals from the door switch 55 , via an input 63 , that indicate whether the door 46 is open or closed . in response to the status of the door switch 55 , the processor 60 , under operation of anticipator circuit logic 62 , as will be described below , is configured to send control signals via output terminal 59 to a relay 61 which controls the current supply to heating elements 26 . it should be appreciated that the anticipator circuit 58 operates concurrently with a closed loop temperature control circuit whereby a temperature sensor 42 sends temperature signals to the microprocessor , which determines whether to activate the heating elements 26 based on a desired temperature , which is entered on the control 44 as a user input . closed loop temperature circuits of this type are well known and understood to those having ordinary skill in the art . in addition , a door timer is incremented while the door 46 is open , and decremented to a value not less than zero once the door has been closed , as will become more apparent from the description below . because the temperature sensor 42 is located in the rear of the chamber 12 , the cold ambient air that enters the front of the cavity 14 will not be sensed immediately , and the temperature control circuit will therefore not respond immediately to the temperature drop within the chamber 12 . as a result , activation of the heating elements by the control circuit lags behind the cooling of the chamber 12 by an amount of time sufficient to potentially decrease the quality of the food product being stored . accordingly , the anticipator circuit 58 is configured to activate the heating elements 26 for a predetermined length of time once the door 46 has been opened , as indicated by the door switch 55 . accordingly , when a substantial temperature drop within the warming chamber cavity 14 is expected to occur , the heating elements will be activated before the temperature within the cavity decreases substantially . referring now to fig5 a , the control operates an anticipator circuitry logic sequence 62 , which is performed in conjunction with the closed loop temperature control process , as will now be described . in particular , at step 64 the control 44 is activated , such as by depressing a power switch on the faceplate 45 . typically , an operator will enter a temperature at which to maintain the cavity 14 under normal operating conditions , which as referred to herein as the set temperature . conventional warming chambers activate the heating elements when it is sensed that the actual temperature within the chamber has fallen below the set temperature . such conventional warming chambers do not take into account an anticipated heat loss that is not sensed until the temperature within the chamber has dropped to potentially unacceptably low levels . advantageously , sequence 62 prevents significant temperature drops from occurring within the cavity , as will now be described . once the sequence 62 has been activated , it begins at step 64 by initializing the parameters that will be used during subsequent steps , such as a door timer , an inhibit flag , and a recover flag , whose respective functions will become apparent from the description below . at decision block 66 , it is determined whether the door 46 is open , as indicated by door switch 55 . if so , the door timer is examined , and if found to be below a minimum threshold amount , the timer is set to that threshold . otherwise , the timer is not adjusted . in accordance with the preferred embodiment , the minimum threshold is set to 15 seconds such that the timer will begin accumulating time starting at 15 seconds and not at 0 seconds . in other words , the timer is preloaded with 15 seconds and begins accumulating time immediately starting at 15 seconds . it will become apparent from the description below that , barring a timeout condition , the heating elements will be activated for the length of time indicated by the timer . accordingly , setting the door timer to 15 seconds at step 70 ensures that the heating elements 26 will be activated for at least 15 seconds once the door is closed . it should be easily appreciated , however , that this minimum threshold may vary depending on the location of temperature sensor 42 , and further depending on the difference between the temperature within the cavity 14 and the ambient temperature . next , at decision block 72 , the measured temperature within the cavity 14 is compared to a desired temperature . in accordance with the preferred embodiment , the desired temperature is selected to equal a predetermined amount greater than the set temperature ( set_temp +″). more particularly , ″ is set to equal 25 ° f . such that the temperature sensor will indicate that the temperature within the cavity 14 is 25 ° f . is greater than the set temperature , it being appreciated that the temperature within the cavity is likely less than the temperature indicated by the temperature sensor 42 . however , it should be appreciated by those having ordinary skill in the art that δ could vary based on the threshold amount of time selected for decision block 68 , the length of time that the door 46 has been open , the location of the temperature sensor 42 within the cavity 14 , and the difference between set_temp and the temperature of the ambient environment . this invention further contemplates that the minimum threshold length of time as well as δ could be determined by the control 44 on a real - time basis taking into account the parameters mentioned above , as would be appreciated by those having ordinary skill in the art . if the temperature within cavity 14 has reached the desired temperature , the recover flag is set false at step 74 . otherwise , at step 76 , the recover flag is set true , which will cause the heating elements 26 to become activated at subsequent steps , as will become more apparent below . once the recover flag has been appropriately set , the door timer is incremented at step 78 . in particular , the door timer advances by one second increments in accordance with the preferred embodiment . next , at decision block 80 , the door timer is compared to an alarm threshold length of time . in accordance with the preferred embodiment , the alarm threshold is set to two minutes , such that an alarm will be activated when the door timer advances to predetermined time intervals beyond two minutes . the alarm could comprise either an audible or visible indicator that alerts the user that the door 46 has been open for an extended period of time . in accordance with the preferred embodiment , the alarm is activated every ten seconds once the door timer has exceeded two minutes at step 82 . sequence 62 then advances to decision block 84 , where it is determined whether the door timer has advanced beyond a maximum threshold door open time , which is selected to facilitate the deactivation of heating elements 26 once it has been determined that the door has been open for a maximum length of time . if the door timer exceeds the maximum door open time , the inhibit flag is set true at step 88 , and the recover flag is set false , thereby ensuring that the heating elements 26 will not activate during the present iteration of sequence 62 . otherwise , if the door timer is less than the maximum door open time , the inhibit flag is set false , and the recover flag remains at the state that was set at either step 74 or 76 . sequence 62 then advances to step 106 , which in turn , advances to a flag examination sequence 107 , which will be described in more detail below . as a result , once the door timer has reached the maximum door open time , the heating elements 26 will not be activated until it is determined that the door 46 has been closed at decision block 66 , as will be described in more detail below . sequence 62 thus provides a safety feature by overriding a closed loop temperature control process to discontinue current to the heating elements at step 76 when the door has been open an unacceptable length of time . this step additionally conserves energy that would unnecessarily be lost while supplying power to the heating elements 26 unnecessarily . while the maximum door open time is chosen as 10 minutes in accordance with the preferred embodiment , this length of time could differ , as is appreciated by those having ordinary skill in the art . because the maximum door open time is greater than the alarm threshold time , sequence 62 advances from decision block 80 directly to step 106 if the door timer is less than the alarm threshold . once the door is closed , decision block 66 advances to step 90 , where the door timer is truncated , if necessary , to a value not greater than a maximum heating time . as described above , once the door 46 is closed , the heating elements 26 are activated for as long as the door was open , as indicated by the door timer . however , it is undesirable to leave the heating elements activated for an extended period of time and , accordingly , if the door timer has exceeded the maximum heating time at step 90 , the timer is truncated to equal the maximum heating time . this limits the length of time that the heating elements are activated , once the door 46 is closed , as will become more understood from the description below . the timer is not adjusted at step 90 if it is either equal to or less than the maximum heating time , which equals two minutes in accordance with the preferred embodiment , though it is easily appreciated that this time could differ according to , for example , the desired temperature and the type of food product being heated . next , at decision block 92 , if the temperature sensor 42 indicates an actual temperature inside the cavity 14 as being greater than the desired temperature , the recover flag is set false and the inhibit flag is set true at step 94 , thereby ensuring that the heating elements 26 will not be activated during the present iteration . additionally , at step 94 , the timer is decremented by one second . however , the door timer is not decremented if it equals zero . sequence then proceeds to step 102 , as will be described below . alternatively , if the temperature within the cavity 14 is not greater than the desired temperature , the door timer is examined at decision block 96 to determine whether it is greater than zero . as stated above , sequence 62 will attempt to heat the cavity 14 to the desired temperature only while the door timer is greater than zero . once the door 46 has been closed as long as it was open , sequence 62 will maintain the temperature within the cavity 14 at the set temperature . accordingly , if the door timer is not greater than zero at decision block 96 , thereby indicating that the timer equals zero , both the recover and inhibit flags are set false at step 98 before proceeding to step 106 . if , however , the door timer is greater than zero at decision block 96 , the recover flag is set true and the inhibit flag is set false at step 100 . additionally , the door timer is decremented by one second , but not less than zero , as described above , before proceeding to decision block 102 . alternatively , if the temperature within the cavity 14 has not reached the desired temperature , and the door timer is greater than zero , the recover flag is set true , the inhibit flag is set false , and the door timer is decremented by one second . next , at decision block 102 , if the door timer equals to one second , a burst of water is applied to the cavity 14 from the water reservoir at step 106 to control the humidity within the cavity , as is understood by those having ordinary skill in the art . otherwise , if the timer has not yet reached one second , sequence advances from decision block 102 to step 106 . because the temperature within the cavity 14 is only compared to the set temperature only when both the recover and inhibit flags are set false , sequence 62 effectively overrides a conventional control temperature loop by independently activating or deactivating the heating elements 26 whenever the door is either open , or closed less than a predetermined length of time , without comparing the temperature within the cavity 14 to the set temperature entered by the user . referring now to fig5 b , the flag examination sequence 107 determines whether to activate the heating elements 26 based , at least in part , on the status of the inhibit and recover flags . for instance , if the inhibit flag is true at decision block 108 , the heating elements 26 are deactivated at step 116 regardless of the status of the recover flag , and regardless of the temperature within the cavity 14 . as discussed above , the inhibit flag is set true when the door 46 is open , and the door timer has exceeded the maximum door open time . additionally , the inhibit flag is set true when the door 46 is closed , and the temperature within the cavity has reached the desired temperature . otherwise , if the inhibit flag is false at decision block 108 , sequence 107 proceeds to decision block 110 , where the recover flag is examined . in particular , the heating elements 26 are activated if the recover flag is true . as discussed above , the recover flag is set true when the door 46 is open and the temperature within cavity 14 has not reached the desired temperature , assuming that the door timer has not reached the maximum door open time . additionally , the recover flag is set true when the door 46 is closed , and the temperature within cavity 14 has not reached the desired temperature , and the door timer is greater than zero . as a result , when the door 46 is opened , the heating elements are activated until the temperature sensor 42 indicates an actual temperature within the cavity 14 equal to the desired temperature , assuming that the door is not open longer than the maximum permissible amount of time . once the door is closed , the heating elements will be activated until either the temperature within the cavity 14 is sensed to equal the desired temperature , or the door timer expires . if the recover flag is false at decision block 110 , the temperature indicated by temperature sensor 42 is compared to the set temperature at decision block 112 . for example , when the door 46 is closed , and the door timer has expired , both the inhibit and recover flags are set false , which causes sequence 107 to only activate the heating elements when the indicated temperature within the cavity 114 has fallen below the set temperature . once the heating elements 26 have either been activated or deactivated at step 114 or 116 , respectively , sequence 107 reverts to decision block 66 , as described above . the invention has been described in connection with what are presently considered to be the most practical and preferred embodiments . however , the present invention has been presented by way of illustration and is not intended to be limited to the disclosed embodiments . for example , while the invention has been illustrated as being implemented in combination with a warming chamber that operates at approximately 150 ° fahrenheit in accordance with the preferred embodiment , it should be easily appreciated that the principle of controlling heat supplied to a heated cavity based on an anticipated heat loss could apply to any type of cavity , such as a conventional oven that reaches significantly higher temperatures , for example approximately 500 ° fahrenheit or greater . accordingly , those skilled in the art will realize that the invention is intended to encompass all modifications and alternative arrangements included within the spirit and scope of the invention , as set forth by the appended claims .

7Electricity

according to this disclosure , as in the process ( 2 ) of the first to fourth aspects , the layers are stacked through printing in the sequence of the positive electrode print layer 2 , the nonaqueous electrolyte print layer 4 , and the negative electrode print layer 3 , or in the reversed sequence thereof while , as in the process ( 1 ), water - soluble silicon resin is employed as a binder , and water is employed as a solvent in each print layer . technical advantages in employing the binder and the solvent have been already described in conjunction with advantages of the invention . in any case of the first to fifth aspects , the positive electrode , the negative electrode and a pigment powder which contains nonaqueous electrolyte is supposed to be set to 100 parts by weight , a binder of water - soluble silicon resin is set to 1 to 50 parts by weight , and a water - based solvent is set to 10 to 100 parts by weight . considering the aforementioned mixture proportions , if the weight percentage of the water - soluble silicon resin exceeds 50 parts by weight , the percentages of the materials of the positive electrode , the negative electrode , and the nonaqueous electrolyte are reduced after the solid type secondary battery is formed through layered printing , so that charge / discharge behavior of each electrode and the conductability of the nonaqueous electrolyte may become insufficient . in comparison , if the weight percentage of the water - soluble silicon resin is smaller than 1 parts by weight , a bonding force between materials may be insufficient when the positive electrode , the negative electrode , and the nonaqueous electrolyte layer are formed , so that it may be difficult to obtain a sufficient mechanical strength in some cases . that is , the weight percentage of the binder is set based on a tradeoff relationship between the charge / discharge capability and conductability and the mechanical strength . however , if the mixture proportion of the water - soluble silicon resin in each print layer is set to 10 parts by weight , that is , if each pigment powder is contained in each print layer by approximately 91 wt %, it is possible to reliably establish the tradeoff relationship . the proportion of the water - based solvent is set to 10 to 100 parts by weight because it is considered to be an appropriate range in order to dissolve the water - soluble silicon resin by a mixture proportion of 1 to 50 parts by weight and enable each pigment powder to be removed . specifically , this is based on a fact that printable ink can be formed by mixing each of the aforementioned pigment powder within a range from the thickest binder state , in which a mixture of 101 parts by weight is obtained by maximizing the amount of the water - soluble silicon resin and minimizing the amount of water , to the thinnest binder state , in which a mixture of 60 (= 50 + 10 ) parts by weight is obtained by maximizing the amount of water - soluble silicon resin and minimizing the amount of water . although silicon resin is employed in a variety of fields in recent years , a basic chemical formula in condensation polymerization reaction is expressed as ( r n sio ( 4 - n )/ 2 ) m ( while r may be selected from a plurality of types of elements or linking groups and is typically selected from linking groups of organic compounds , it is not limited to the linking groups of organic compounds in the case of water - soluble silicon rubber as described below ). in addition , the case of silicon rubber is illustrated in fig1 a , and the case of silicon resin ( silicon varnish ) is illustrated in fig1 b ( as described above , r may be selected from a plurality of types of elements or linking groups ). in general , the water - soluble silicon resin may be implemented by selecting a hydrogen atom ( h ) for ½ or more of the r in the aforementioned general formula . in particular , as the water - soluble silicon resin , siloxane having a sih bonding may be used . preferably , a part of the hydrogen bonding in the aforementioned bonding are substituted with halogen atoms of chlorine ( cl ), bromine ( br ), or fluorine ( f ) or alkali metals of sodium ( na ) or potassium ( k ). alternatively , in the aforementioned bonding , ½ or less of hydrogen may be substituted with linking groups of organic compounds . if a conductive filler is mixed in the nonaqueous electrolyte print layer 4 according to an embodiment , it is possible to obtain excellent conductivity in the nonaqueous electrolyte print layer 4 . as the conductive filler , metallic impalpable powder , conductive carbon black powder , or carbon fiber powder may be employed in any typical example . as the printing method according to the first to fourth aspects , any typical printing example such as screen printing , planographic printing , gravure printing , and flexographic printing may be employed without limitation . in order to efficiently implement the layered printing , it is preferable that each print layer separated from each roller 5 be stacked on both sides of the release sheet 1 moved by the roller 5 as illustrated in fig2 . in the case of the positive electrode print layer 2 , the negative electrode print layer 3 , and the nonaqueous electrolyte print layer 4 , the print layers having predetermined thicknesses are formed by injecting ink for forming such print layers from a rotational center of the roller and the vicinity area 51 and sequentially discharging the ink from the surface of the roller 5 while they leave the roller 5 . according to the aforementioned embodiment illustrated in fig2 , in order to facilitate exfoliation from the release sheet in each of the stacked print layers , first , the aluminum thin film 6 may be arranged in both sides of the release sheet 1 , and further , the print layers may be stacked on both outer sides thereof in the sequence of the process ( 2 ) according to the first to fourth aspects . in the practical solid type secondary battery , in order to prevent a breakdown or damage of the positive and negative electrodes , a positive electrode charge - collecting layer and a negative electrode charge - collecting layer are formed in each of the outer sides of the both electrodes in many cases . in order to form each of the charge - collecting layers , according to a preferable embodiment in this disclosure , typically , the mixture proportion is set to contain graphite powder or graphite fiber powder of 100 parts by weight , a binder of water - soluble silicon resin of 1 to 50 parts by weight , and a water - based solvent of 10 to 100 parts by weight , and each of positive and negative electrode charge - collecting print layers is manufactured by mixing graphite powder or graphite fiber powder with the binder and the solvent described above . moreover , in the printing process ( 2 ), the positive electrode charge - collecting print layer is printed on the outer side of the positive electrode print layer 2 , and the negative electrode charge - collecting print layer is printed on the outer side of the negative electrode print layer 3 to protect the positive and negative electrodes . in the case where the aforementioned embodiment is employed in a printing type in which printing is performed on both sides of the release sheet , the positive or negative electrode charge - collecting layer serves as a target of the initial print layer . in the drying process ( 3 ) according to the first to fourth aspects , any of natural drying , baking , or forced - air drying may be employed . the disclosure is not limited by the thickness of each print layer . however , typically , after the drying process ( 3 ), the positive electrode print layer 2 and the negative electrode print layer 3 have a thickness of 10 to 20 μm , the nonaqueous electrolyte print layer 4 has a thickness of 50 to 150 μm , and the positive electrode charge - collecting print layer and the negative electrode charge - collecting print layer have a thickness of 5 to 10 μm in many cases . each print layer was formed as described below according to the second aspect . positive electrode print layer : silicon carbide pigment powder ( defined by a chemical formula of sic ) of 100 parts by weight , water - soluble silicon rubber of 1 parts by weight based on siloxane of which overall linking groups have the sih bonding , and water of 10 parts by weight . negative electrode print layer : pigment powder ( defined by a chemical formula of si 3 n 4 ) of 100 parts by weight , the aforementioned water - soluble silicon rubber of 1 parts by weight , and water of 10 parts by weight . nonaqueous electrolyte print layer : zirconium oxide ( zro 2 ) pigment powder 100 parts by weight , the aforementioned water - soluble silicon rubber of 1 parts by weight , and water of 10 parts by weight . positive and negative electrode charge - collecting layer : carbon graphite pigment powder of 100 parts by weight , the aforementioned water - soluble silicon rubber of 1 parts by weight , and water of 10 parts by weight . for each of the five print layers described above , the aforementioned layered printing ( 2 ) was performed on both sides of the release sheet as illustrated in fig2 , and then , the drying process ( 3 ) was performed through natural drying . as a result , it was possible to obtain a solid type secondary battery including positive and negative electrode layers having a thickness of 20 μm , a nonaqueous electrolyte layer having a thickness of 100 μm , and positive and negative electrode charge - collecting layers having a thickness of 10 μm . the aforementioned solid type secondary battery was charged using a constant current source capable of providing a current density of 0 . 9 a / cm 2 . as indicated by the curve of fig3 which rises as time elapses , a voltage range of approximately 3 . 5 to 5 . 5 v can be maintained for approximately 7 . 5 hours . then , the solid type secondary battery was discharged . as indicated by the curve of fig3 which falls as time elapses , a voltage range of approximately 5 . 5 to 3 . 5 v can be maintained for approximately 7 hours . in this manner , if the water - soluble silicon resin is employed as a binder , and water is employed as a solvent , it was recognized that the solid type secondary battery is normally operated in the second aspect based on prior art 1 . in prior art 1 , considering a fact that charging of a voltage range of approximately 4 to 5 . 5 v is maintained for approximately 40 hours , and discharging of approximately 4 to 3 . 5v is maintained for approximately 35 hours if ion exchange resin is employed as the nonaqueous electrolyte , it is possible to anticipate that a charge / discharge behavior similar to that of the aforementioned example of the second aspect can be obtained in the case of the first aspect . furthermore , even in the example of prior art 2 , considering a fact that a charge / discharge behavior similar to that of prior art 1 can be obtained if ion exchange resin is employed as the nonaqueous electrolyte , it is possible to sufficiently anticipate that a charge / discharge behavior similar to that of the aforementioned example of the second aspect can be obtained even in the third and fourth aspects . in comparison , it is doubtful that the excellent charge / discharge behavior described above could be obtained if other polymer is employed as a binder , and an organic solvent is employed as a solvent . in this meaning , use of the water - soluble silicon resin and water is innovative . the method of manufacturing the solid type secondary battery according to this disclosure provides an efficient manufacturing method in the field of the solid type secondary battery manufacturing of prior arts 1 and 2 . the method may be sufficiently utilized also in a personal computer ( pc ), a mobile phone , and storage of electric energy based on natural energy such as solar , wind , or ocean tide energy .

8General tagging of new or cross-sectional technology

it is to be understood by one of ordinary skill in the art that the present discussion is a description of exemplary embodiments only , and is not intended as limiting the broader aspects of the invention , which broader aspects are embodied in the exemplary constructions . fig1 is a diagrammatic representation illustrating the manner in which various “ trading partners ” may be interconnected in accordance with the present invention . specifically , a total of four trading partners 10 a - d ( also referred to as tp 1 - tp 4 ) communicate with one another via a “ transaction - based environment ” 11 by which messages are directed according to the transaction to be performed . this is in contrast to many systems of the prior art which have relied on specific message routing from one computer to another . further details of the transaction partners can be discerned from fig2 , which illustrates transaction partner tp 1 for purposes of illustration . in this case , a computer running an application 12 has also been loaded with “ agents ” and “ configuration objects ” to be explained more fully below . as a result , an interface 14 exists on the computer for the purposes of communicating with other trading partners . messages ( including events ) sent by application 12 are converted by interface 14 into a “ context ” which dictates the action to be taken . it is useful at this point to described in detail the agents that may be utilized in a system of the present invention , as well as the objects which model the topography of an enterprise in which the system is employed . any number of “ agents ” may be running on any number of computers supporting a distributed application according to the present invention . agents may be implemented as “ processes ” or “ tasks ,” depending on the operating system of the individual computer . agents running on a given computer communicate with each other using message queues , implemented according to the facilities provided by the operating system . by default , message queues are implemented in memory . the queues to certain types of agents can be configured to be disk queues , freeing the application from limitations on the number of outstanding messages and their retention across computer restarts . each computer which supports these agents normally has a local copy of the configuration ( i . e ., the collection of “ configuration objects ”). agents typically load configuration records into shared memory regions as they are referenced , so that subsequent references to those records are efficient . each agent , as it handles transactions and applications , holds current element values in a data structure referred to as “ context .” as shown in fig3 , context 16 may be configured having a header 18 , followed by a sequence of element value nodes 20 , each of which identify the element whose value is stored using its object identifier , the size of the value stored , and the value itself . additionally , message nodes and address nodes ( e . g ., message nodes 22 ) may appear among the element value nodes . these are similar to the element value nodes , except that they contain the text of messages or address info added and / or used by network agents and related verbs . to facilitate efficient lookup , header 18 contains a hash - table of pointers to element value nodes . so that more than one element can be added to context 16 with the same hash - value , element value nodes 20 may contain a pointer to the next node with the same hash value . additional header fields include the object identifier of the current transaction ( if one has been selected ), a unique transaction identifier , sending and destination agent object identifiers , and sending and destination system object identifiers . as shown in fig4 , the agents in a particular application may include server agents 24 , interface agents 26 , network agents 28 and user login agents 30 . referring now to fig5 , a server agent processes requests for transaction services . when a server agent is started on a particular computer ( as indicated at 32 ), it reads its configuration object ( as indicated at 34 ) to determine whether it should read requests from a memory - resident message queue or a disk queue . it then waits ( as indicated at 36 ) to receive request messages from the queue . a transaction service request is identified as a transaction request or a transaction advice . the agent sending a transaction request expects a response . the agent sending a transaction advice does not expect a response . other possible request message types include administrative requests , such as shut - down ( as indicated at 38 ). multiple server agents may be started for a particular server configuration object . in this case , all agents wait for requests on a common queue . this allows multiple requests to he handled simultaneously . during the course of processing a request , a server agent may need to make a request of some other agent . in this case , the server agent waits for the response to its request on an agent - specific ( i . e . process - or task - specific ) message queue . upon receipt of a transaction request or advice , the server agent makes the transaction context contained in the message the current transaction context . it then looks up the configuration object associated with the transaction object identifier contained in the message ( as indicated at 40 ), and invokes the associated ruleset ( as indicated at 42 ). in addition to other actions , such as data table access / modifications and requests of other agents , the ruleset typically makes changes to the transaction context . it is the resulting context that is returned to the requesting agent . once the ruleset is complete , the agent &# 39 ; s local copy of the context is discarded , and the agent returns to its request queue for the next request message ( as indicated at 44 ). referring now to fig6 , an interface agent translates between a stream of messages to and from some external entity into a set of transaction requests and responses . when an interface agent is started on a particular computer ( as indicated at 46 ), it reads its configuration object to determine whether it should read requests from a memory - resident message queue or a disk queue ( as indicated at 48 ). it then waits to receive request messages from the queue ( as indicated at 50 ). a request message sent to an interface agent may be an incoming message from an associated network agent , or a transaction request / advice or response from some other agent ( e . g ., server , user login , or other interface ). an incoming message from a network agent comprises a context containing message and possibly address nodes . in place of a transaction object identifier , the context contains a reserved token identifying it as an incoming message ( identification indicated at 52 ). upon receipt of an outgoing transaction request / advice or response context , the interface agent makes the received context the current context . it then invokes its out ruleset ( as indicated at 54 ), which may compose and send outgoing message requests to a network agent , invoke additional transactions , or initiate a transaction response . once the ruleset is complete , the agent returns to waiting for messages from its queue ( as indicated at 56 ). upon receipt of an incoming message context from a network agent , the interface agent invokes its in ruleset ( as indicated at 58 ). the in ruleset may examine the text of the message received , invoke transactions , or restore a previously pended transaction context and initiate a response . once the ruleset is complete , the agent returns to waiting for messages from its queue ( as indicated at 56 ). a network agent handles the protocol by which communications with an external entity are implemented , converting a sequence of events and associated timings into a stream of incoming and outgoing messages . when a network agent is started on a particular computer , it reads its configuration object to determine whether it should read requests from a memory - resident message queue or a disk queue , and to discover the details of its particular communications protocol ( it also reads its associated protocol configuration object ). it then waits to receive request messages from the queue , while it handles communications with the external entity . upon receipt of an outgoing message request from its associated interface agent , the network agent sends , or queues to send as soon as possible , the associated message to the external entity . upon receipt of an incoming message from an external entity , the network agent composes a context containing the text of the received message and sends the context to its associated interface agent . referring now to fig7 , a user login ( aka screen ) agent handles application presentation services , including full - screen presentation and capture of data , and full - screen user access to application functionality . upon invocation ( as indicated at 60 ), a user login agent prompts the user for username and password ( as indicated at 62 ). the user login agent then reads its configuration object ( as indicated at 64 ). if a user configuration object corresponding to the entered username is found ( as indicated at 66 ), and the entered password matches the associated password information , the associated ruleset is invoked ( as indicated at 68 ). the ruleset may use a variety of verbs to invoke menus , listings and data - entry screens identified by screen configuration objects . if a user is not found , the agent exits ( as indicated at 70 ). users configuring an application according to the present invention will be presented a series of screens , such as that shown in fig8 , that describe different and independent aspects of the particular computing environment . the resulting “ configuration objects ” are stored on disk as a set of records of varying length in a file with associated indexes . at run - time , configuration objects are read as they are referenced into memory regions which are shared among executing agent processes , including server agents ( transaction service agents ), interface agents , network agents and user login agents ( i . e ., screen agents ). each configuration object has an object type , an object id , an object name , and an object version . users configuring an application may generally refer to objects by their object type and object name , which uniquely identify them . object type and object id also uniquely identify a configuration object . the object id may be arbitrarily assigned when a configuration object is created . object type and object id are generally used internally by the system to store relationships among configuration objects and values of objects at run - time . the combination of object type and id is often referred to here as an object identifier . the referential relationships among configuration objects is shown in fig9 . with this as a backdrop , various configuration objects will now be described . class configuration objects identify data types and associated default values . classes are generally used as attributes of other objects , such as data elements . attribute description data type identifies the structure of data . possible values may include binary integer ( 1 , 2 , 4 , or 8 bytes ), binary floating point ( 4 or 8 bytes ), character ( fixed - length , null - terminated , or leading length byte / word ; character set ascii or ebcdic ), bit string ( fixed - length or leading length byte / word ), packed decimal ( signed or unsigned ; fixed length or leading length byte ), or object identifier . extent1 specifies the length of data . for variable - length data types , specifies the maximum number of characters , digits or hits . for binary data types , specifies the number of significant digits ( precision ). extent2 for floating point data types , specifies the number of decimal places to display . default label the label to use when displaying or prompting for data . default ( 2 ) the headers to use when displaying headers columns of data . default a description to use when displaying description or prompting for data ( the default help text ). default value the object identifier of a function which determines a default value for the data when no explicit value has been set . default the object identifier of a function which determines whether or not the value set for the data is valid ( as defined by the application ). element configuration objects identify atomic units of data which may have a value in the context of a transaction , or which may represent fields in records , in messages , or on data - entry screens . attribute description class the object identifier of a class which describes the format of the data . label the label to use when displaying or prompting for data ; if not specified , inherited from the class . headers ( 2 ) the headers to use when displaying columns of data ; if not specified , inherited from the data class . description a description to use when displaying or prompting for data ( the default help text ); if not specified , inherited from the class . default value the object identifier of a function which determines a default value for the element when no explicit value has been set ; if not specified , inherited from the class . item configuration objects identify atomic units of data which may have a system - wide value on the current system . because the value of an item is held in configuration , all agents active on a given system see the value assigned to the item most recently by any agent . attribute description data type identifies the structure of data . possible values may include binary integer ( 1 , 2 , 4 , or 8 bytes ), binary floating point ( 4 or 8 bytes ), character ( fixed - length , null - terminated , or leading length byte / word ; character set ascii or ebcdic ), bit string ( fixed - length or leading length byte / word ), packed decimal ( signed or unsigned ; fixed length or leading length byte ), or object identifier . extent1 specifies the length of data . for variable - length data types , specifies the maximum number of characters , digits or bits . for binary data types , specifics the number of significant digits ( precision ). extent2 for floating point data types , specifies the number of decimal places to display . dimension identifies the number values which may be set . if greater than one , the item may be thought of as an array . value the value returned when this item is referenced . record configuration objects identify arrangements of fields , which may be elements or sub - records . these arrangements may be positional , in which the fields and the order in which they appear is pre - determined ; bit - mapped , in which case certain fields appear in the record only if an associated controlling bit is set ; or tagged , in which case fields may appear in any order , and are identified by a preceding unique tag ( possibly with an associated field length indicator ). attribute description type identifies the type of field arrangement . possible values include positional , bit - mapped , and tagged ( tag before length , length before tag , or tag only ). tag class the object identifier of a class which specifies the structure of field tags ( if type is tagged ). the object identifier of a class which specifies the structure of field length indicators ( if type is tagged ). fields identifies the fields which may appear in the record . each entry in fields has the following attributes : object the object identifier of an identifier element or record which describes this field . dimension identifies the number times this field is repeated at this position ( i . e ., the field is an array of values ). the array dimension may depend on the value of another field in the record , in which ease dimension is negative and its absolute value represents which entry in fields specifies the array dimension . optional ( flag ) if set , indicates that the field need not appear in every instance of the record . bit - mapped ( flag ) if set , indicates that the field &# 39 ; s existence in any instance of the record depends on the value of a bit in a bit - map . existence ( flag ) if set , indicates that the depends field &# 39 ; s existence in any instance of the record depends on the value returned by the function identified by the exists attribute . length depends ( flag ) if set , indicates that the field &# 39 ; s length in any instance of the record depends on the value returned by the function identified by the length attribute . terminated ( flag ) if set , indicates that the field &# 39 ; s length varies ( up to its maximum length ), in that the end of the field is marked by one of a set of terminators . escaped ( flag ) if set , and terminated is set , indicates that terminators may be included the field data if preceded by an escape character . parent bit - map the object identifier of the field which acts as the bit map containing the bit which controls the existence of this field ( if bit - mapped is set ). parent more than one field may have the occurrence parent bitmap &# 39 ; s object identifier . if the intended parent bit - map is not the first of these , this indicates which one it is ( if bit - mapped is set ). bit - map format identifies how the parent bit - map is to be interpreted . possible values include binary encoded , character encoded ( a string of “ 0 ” and “ 1 ” characters ), and hexadecimal encoded . bit - map identifies which bit in the position parent bit - map controls the existence of this field ( if bit - mapped is set ). tag value the particular tag value that identifies this field ( if type is tagged ). when this value is encountered in the record , the field is assumed to follow ( possibly following with an associated length indication ). terminators a set of characters , any of which indicate the end of this field when they appear ( if terminated is set ). escape a character which , when it appears in the field data , indicates that the character which follows it is to be treated as field data ( if terminated and escaped are set ). exists the object identifier of a function which when evaluated ( as a particular instance of a record is being analyzed ) determines whether or not this field appears in the record ( if existence depends is set ). length the object identifier of a function which when evaluated ( as a particular instance of a record is being analyzed ) determines the length of this field as it appears in the record ( if length depends is set ). file ( or table ) configuration objects identify long term storage ( typically on disk ) for data records . attribute description organization specifies how the data is stored . possible values include ( but are not limited to ) fixed ( records are of a specified length in a operating - system native flat file ), varying ( vfile format , in which all records have a leading and trailing length word , the trailing length word falling on the nearest even byte boundary ; deleted records are identified by a negative record length ), or queue ( internal format for holding messages destined for a particular agent ). record the object identifier of a definition record which describes the format of records in the file . system the object identifier of a system which identifies the location of the file in a distributed system . if not set , an instance of the file can exist on each system . data path the operating - system and organization dependent path which locates the data . this may specify , for example , a directory and file name , and may be relative . open mode the way in which multiple agent processes coordinate access to the data in the file . possible values may include record locking , and exclusive . deleted the object identifier of an index by record which areas of the data from which index records have been deleted may be located . indexes a list of object identifiers , each identifying an index by which records may be located and sorted . key configuration objects are used to sort records in files ( tables ). attribute description file the object identifier of the associated file ( table ). data path the operating - system and file organization dependent path which locates the indexing data . this may specify , for example , a directory and file name , and may be relative . collation determines sort order . possible values include ascending or descending ascii , alphabetic or numeric . key a list of object identifiers , each definitions identifying a key that specifies what record - associated data is assembled to create entries in the index . since more than one key may be specified , records may have multiple index entries . index configuration objects specify what record - associated data is assembled to create entries in an associated index . attribute description file ( table ) the object identifier of the associated file ( table ). mode indicates whether entries in the index are created for records which are missing some or all of the values from which components are resolved . index the object identifier of the associated index . components each component entry identifies elements in the record from which data is to be taken to form an entry in the index . these data are concatenated to form the entry . element the object identifier of the element from which the component is taken . this is fully qualified , as necessary , with the object identifiers of any sub - records in which the element appears , and , in the case of arrays ( of the element and / or any sub - record ) the desired array instance ( s ). offset if set , identifies the first byte of the element value to be used . length if set , identifies the number of bytes of the element value to be used . note that offset and length might be thought of as a sub - string of the value . system configuration objects identify the locations where transaction handling agents or resources reside . a “ system ” may represent a particular software application , a computer , a group of computers , a communications network , or other equipment with which a distributed implementation of the present architecture may communicate and which offers transaction services . systems on which the present architecture is installed and which support one or more transaction - handling agents which share the current configuration are referred to as “ internal ” to the distributed implementation . others may be referred to as “ external .” it is possible for a single computer to house multiple systems ( both internal and external ) simultaneously . note that it is not necessary to identify as systems those applications , computers , networks or equipment which only originate transactions ( i . e ., which offer no transaction services ). attribute description interface id the object identifier of an interface through which to communicate with the system . does not need to be specified for “ internal ” systems . server ( transaction service ) configuration objects identify entities which process transactions . servers are “ internal ” if their associated system is “ internal ,” and “ external ” otherwise . attribute description system the object identifier of the system on which the server agent executes . queue the object identifier of a file that holds requests destined for the server agent . if not set , requests are held in memory . does not need to be specified if the system attribute specified is “ external .” transaction configuration objects identify atomic units of work in an application implemented according to the invention . attribute description ruleset the object identifier of a ruleset that specifies how the transaction is to be processed . does not need to be specified if all of the servers specified are “ external .” servers a list of object identifiers identifying the servers which are capable of processing the transaction . interface configuration objects identify agents which handle the flow of transactions to and from external applications , computers , communications networks or other equipment . attribute description system the object identifier of the system on which the interface agent executes . queue the object identifier of a file that holds requests destined for the interface agent . if not set , requests are held in memory . in ruleset the object identifier of a ruleset which specifies how to interpret incoming messages or events . this ruleset may specify the interpretation rules completely , or may select an in message which specifies additional interpretation rules . out ruleset the object identifier of a ruleset which specifies how to construct outgoing messages or events . this ruleset may specify the construction rules completely , or may select an out message which specifies additional construction rules . networks a list of object identifiers identifying the networks which handle messages passing to and from the external applications , computers , communications networks or other equipment . in message and out message configuration objects identify additional message processing rules to be invoked by interfaces . for example , the in ruleset for a given interface may have rules which identify categories of messages , and select appropriate in message types for detailed analysis depending on the category . note that this is most useful for interfaces that must handle complex sets of messages . attribute description ruleset the object identifier of a ruleset that specifies how the message is to be processed ( analyzed or constructed ). network configuration objects identify agents which handle messages and / or event notifications to and from external applications , computers , communications networks or other equipment . attribute description system the object identifier of the system on which the network agent executes . queue the object identifier of a file that holds requests destined for the network agent . if not set , requests are held in memory . interface the object identifier of the interface to which the network agent sends incoming messages , and from which it receives outgoing messages . type identifies the type of external application , computer , communications network or other equipment with which to communicate ( e . g . generic , intermec ) protocol the object identifier of a protocol object which specifies protocol type and parameters necessary for communication with the external application , computer , communications network or other equipment . type identifies the type of external application , computer , communications network or other equipment with which to communicate ( e . g . generic , intermec ) network info identifies any additional , network type - specific communications parameters . protocol configuration objects identify communications protocol parameters necessary for communications with external applications , computers , communications networks or other equipment . attribute description type the type of communications protocol to use . possible values include ( but are not limited to ) async , bisync , tcp / ip ( client or server ), udp , x25 ( pvc or svc ), lu2 , lu6 . 2 , etc . additional attributes vary depending on the type selected . for example , async attributes include baud rate , character size , stop bits , parity , flow control , and record demarcation ( which includes record length if records are of a fixed length , or the end - of - record character otherwise ). similarly , tcp / ip client attributes include destination host name , service name , and record demarcation . device configuration objects identify external devices that the application would like to manage . the application can send explicit messages to devices ( e . g . “ print ” commands to a label printer ). additionally , the system can manage the download of configuration data ( e . g . form definitions , programs , etc .) to devices . attribute description type the type of device ( e . g . intermec label printer ). address device address information by which messages to / from the device are routed / identified . network the object identifier of the network which handles communications with the device . control names which identify configuration entries data ( formats , programs , etc .) currently downloaded to the device . the names are type specific , but normally those of control objects which further specify what configuration data is downloaded . control configuration objects identify configuration data that may be downloaded to devices ( e . g . form definitions , programs , etc . ), or additional network - specific configuration ( e . g . data - point definitions ). attribute description type the type of device ( e . g . intermec label printer ). buffer type specifies bow buffer is to be interpreted . possible values include ( but are not limited to ) direct ( buffer contains literal download data ), indirect ( buffer contains the pathname of a file which contains the download data ), or data point ( buffer contains a list of data point definitions ). buffer contains control information ( as specified by buffer type ). screen configuration objects identify application presentation screens , used for user input and / or display of data . attribute description detail object the object identifier of a menu , listing , or data entry that specifies the details of the data presentation . title text which may appear as a screen title . actions a list of object identifiers of rulesets which can be invoked at the request of the user when the screen is active , via associated function key or button . each action has an associated label that should describe the function implemented by the ruleset . access control a list of entries controlling who may use this screen , and which of the actions they are allowed . each entry has the following attributes : user or the object identifier of a user or group group for which access is being specified . the system first checks for an entry for the current user ; if none exists , the system checks for an entry for the current user &# 39 ; s group . access allowed or disallowed . the disallowed type value is useful for excluding a particular member of a group while still allowing access for the group . allowed indicates which of the actions may be actions invoked by the user or group . menu configuration objects identify application presentation menus . when a screen which refers to a menu is invoked , a list of selections from which the user may select is displayed . attribute description selections a list of entries that determines what actions are available from the menu . each entry has the following attributes : action the object identifier of a ruleset which can be invoked at the request of the user when the menu is active , via associated key - press or button . label text which should describe the function implemented by the ruleset . one of the letters of the label may be identified as a “ hot key ,” in which case it will appear underlined ( or otherwise highlighted ) to indicate that this selection may be made by pressing the associated letter key . listing configuration objects identify application presentation listings . when a screen which refers to a listing is invoked , a list is displayed which is constructed from a specified set of records in a table . attribute description index the object identifier of an index which determines the file from which records are selected , and the order in which they appear . record the object identifier of a record determination which determines how the records are to be interpreted . by default , the record definition attribute of the associated file is used . first key the object identifier of a function which , when evaluated , determines the value of key of the first record to be displayed in the list . last key the object identifier of a function which , when evaluated , determines the value of key of the last record to he displayed in the list . filter the object identifier of a function which , when evaluated for each record , determines whether or not the record is to be included in the list . display the object identifier of a function which , when evaluated for each record , determines the text to be displayed list . data entry configuration objects identify data entry screens . when a screen which refers to a data entry is invoked , a specified arrangement of fields is displayed . some or all of the fields may be edited by the user , as allowed by the configuration . attribute description record the object identifier of a record which determines the set of fields which are to appear on the screen . fields a set of entries which determines how each of the elements in the record are to be displayed . each entry has the following attributes : label the column and row at which the field location label is to be displayed . label the number of characters of field length label to display . label display attributes of the label ( e . g . display underlined , hold , dim , etc .) modes field the column and row at which the field locations is to be displayed . field the number of characters of field to length display . field display attributes of the field ( e . g ., display underlined bold , dim , etc .) modes field controls how data is entered ( e . g ., control normal , output - only , select - only , modes etc ). detail the object identifier of a ruleset ruleset which is invoked when the user requests details about this field . this ruleset can implement any application functionality , but typically allows selection of a value for the field . report configuration objects identify reports which may be displayed or printed . a report consists of optional title and header lines , primary lines composed of a set of columns , and alternate lines of arbitrary text that may be interspersed with the primary lines . attribute description index the object identifier of an index which determines the file from which records are selected , and the order in which they appear . first key the object identifier of a function which , when evaluated , determines the value of key of the first record from which to generate report lines . last key the object identifier of a function which , when evaluated , determines the value of key of the last record from which to generate report lines . report format identifies the format of the report ( e . g ., standard , free - format , form , etc .) title lines the object identifiers of functions which , when evaluated , determine the text to appear in the report titles ( at the top of each page in a standard format report ). header fields the object identifiers of functions which , when evaluated , determine the text to appear in the report headers ( typically on each page before column headers , and primary and alternate report lines , although , in the ease of form reports , header field values may appear anywhere on the form ). each header field also has associated formatting information , such as indent , width and justification . page breaks the object identifiers of functions which , when evaluated after reading a record , determine whether to insert a page break before generating any additional primary or alternate lines . pre - processing the object identifier of a ruleset which is evaluated after reading each record and before any additional processing is done . post - the object identifier of a ruleset processing which is evaluated before reading the next record , after all processing for the current record is complete . filter the object identifier of a function which is evaluated after reading each record and performing the pre - processing and which determines whether primary lines are generated ( or slave processing occurs ) for the record . slave the object identifier of a report controls report formatting . for each record read as specified in the current report , a complete set of records is processed as defined by the slave report configuration . alternate entries which control arbitrary text lines lines which may appear on the report . each entry has the following attributes : filter the object identifier of a function which is evaluated for each record to determine whether this alternate line is to be generated . contents the object identifier of a function which , when evaluated , determines the text to appear . explode the object identifier of a ruleset which can be invoked when the alternate line text is selected by a user who is viewing the report online . format text width , indent and justification . location whether the alternate line is to be generated before or after the primary line , and / or at the end of the report . primary line includes : number of column headers and format footers ; whether to suppress column headers and footers on pages on which no primary line appears ; whether or not footers “ float ” ( appear immediately after the last detail line ) or are fixed at the bottom of each page . primary line the object identifier of a ruleset explode which can be invoked when the primary line is selected by a user who is viewing the report on - line . primary line entries which control primary text columns lines appearing on the report . each entry controls a column of output and has the following attributes : contents the object identifier of a function or element which , when evaluated , determines the text to appear in the column . format column width , indent and justification . headers the object identifiers of a function which , when evaluated , determine the text to appear at the top of the column on each page . each of the headers has associated formatting information , including justification . footers the object identifiers of a function which , when evaluated , determine the text to appear at the bottom of the column on each page . each of the footers has associated formatting information , including justification . user configuration objects identify users who may access applications via application presentation objects . attribute description group name the group to which the user belongs . password information against which to verify entered passwords . ruleset the object identifier of a ruleset which is invoked when the user logs in . if not set , the ruleset for the group is invoked . group configuration objects identify groups of users who may access applications via application presentation objects . attribute description default the object identifier of a ruleset ruleset which may be invoked when a user in this group logs in . ruleset configuration objects encode application - specific functionality . rulesets are composed using a set of verbs to form rules . a rule is composed of an antecedent and a consequent . an antecedent is a conjunction of conditionals ( constructed of verbs ), evaluated one at a time . if the conditionals return a non - false value , the rule is said to be fired . a consequent is a list of statements ( constructed of verbs ) to be evaluated when the rule is fired . the first rule to be fired completes the invocation of the ruleset , and none of its subsequent rules are evaluated . the syntax is as follows : ruleset := always : stmt ; [[ stmt ;] . . .] ruleset := rule [ rule . . .] [ dfltrule ] rule := if : cond [[ & amp ; cond ] . . .] then : stmt ; [[ stmt ; ] . . .]] dfltrule := otherwise : stmt ; [[ stmt ;] . . .] cond := verb ([ arg . . .] ) stmt := verb ([ arg . . .] ) arg := verb ([ arg . . .] ) arg := literal ( test string , name or number ) function configuration objects encode application - specific functionality . when invoked , a function returns a value . functions are composed by nesting verbs . the syntax is as follows : function := verb ([ arg . . . ]); arg := verb ([ arg . . .]) arg := literal ( text string , name or number ) with reference to fig1 , a hypothetical transaction can be followed through a system of the present invention . imagine the transaction is a financial transaction that must check with an external system for verification . the result of the transaction will be sent back to the originating external system as a response . network agent net 1 ( indicated at 80 ) using protocol prot 1 reads in a message from its external system 82 . net 1 sends this message to its associated interface agent ifc 1 ( indicated at 84 ). ifc 1 examines the message to determine what type of message it is . using the appropriate record structure ( rec 1 ) as a map , it then binds the message into an initialized context . this puts the message data into the various data elements within context , making the transaction context independent of the message layout . ifc 1 then sends the context to the appropriate server agent svr 1 ( indicated at 86 ) for processing . actually , the routing to the correct server takes place automatically within the system . this allows for busy servers to be alleviated during periods of heavy stress . svr 1 reads the context and performs the desired transaction trn 1 . trn 1 needs to request information from external system 2 ( indicated at 88 ) about the information in context . context is sent to interface agent ifc 2 ( indicated at 90 ). ifc 2 builds a message from context using rec 2 . the message is sent to network agent net 2 ( indicated at 92 ). net 2 reads the message and transmits it to external system 2 using prot 2 . some time later , net 2 reads a message in from external system 88 . ifc 2 identifies the message as the response to trn 1 . it binds the message into the context of trn 1 instead of an initialized context . thus , the response from the external system becomes part of our context . ifc 2 sends the context back to svr 1 . trn 1 sends context to another server agent svr 2 ( indicated at 94 ) for additional processing . context is sent back to the originating interface ifc 1 as a response . thus , the transaction request has been fulfilled . ifc 1 builds a message from context using rec 3 . net 1 reads the message and transmits it using prot 1 . while preferred embodiments of the present invention and preferred methods of practicing same have been shown and described , modifications and variations may be made by thereto by those of ordinary skill in the art without departing from the spirit and scope of the present invention , which is more particularly set forth in the appended claims . in addition , it should be understood that aspects of the various embodiments may be interchanged both in whole or in part . furthermore , those of ordinary skill in the art will appreciate that the foregoing description is by way of example only , and is not intended to be limitative of the invention so further described in such appended claims .

8General tagging of new or cross-sectional technology

referring now to fig1 - 5 , the fire extinguisher illustrated therein is identified by reference numeral 21 and comprises a metal container 23 or can formed by a cup - shaped member having a lower lid 27 sealed to the lower end 23a of the member 23 by a double seam forming a cavity 23c . located within the container is a fire extinguishing substance 29 , preferably a fire extinguishing powder which may be of the a . b . c . type or for example , of the b . c . type . as is well know , the a . b . c . type is formed of about 90 % monoammonium phosphate with above 10 percent silicones and other material ( silcia , ground mica ) added to keep it free flowing to protect it from moisture . the b . c . type is about 90 - 94 percent sodium bicarbonate . the balance of the material is stearates or silicones and other materials added to keep it free flowing and to protect the sodium bicarbonate from moisture . the top 23b of the container 23 has a magnet 31 attached thereto to allow the fire extinguisher to be attached to a metallic object and hang with its bottom end 27 downward . the fire extinguisher can be attached to the top of a vent - a - hood of a stove for protection against grease fires . the magnet 31 is encased in a case 33 which is moveably attached to the container by an assembly to be described subsequently . referring to fig2 the bottom lid 27 has grooves or scored lines 41a - 46a selectively formed on the outside thereof to facilitate breaking or rupturing of the bottom end into separate tear - open segments 41 - 46 without fragmentation to forte openings 41b - 46b only in the bottom end or bottom wall portion when the free ends of the segments are forced outward to allow the fire extinguishing powder to fall or pass outward from the container onto the fire . although the scoring is illustrated on the outside surface of the lid it can be on the inside surface thereof . the explosive charge for rupturing the bottom end along the weakened or scored lines for forcing the free ends of the segments outward comprises a small amount of explosive charge 51 deposited on the inside of the lid 27 . the charge 51 is deposited as a thin layer in the area defined by the dotted circle 53 as seen in fig2 . extending through the lid 27 and to the explosive layer 51 is a heat sensitive fuse or firetrain 61 . on the inside , the fuse is held in contact with the explosive 51 by means 51a . the fuse 61 may be held in place by a ferrule and a push on friction nut as shown in u . s . pat . no . 3 , 884 , 307 . the fuse 61 ignites when the temperature outside of the fire extinguisher reaches a certain level to explode the charge 51 . when this occurs , the force of the explosion ruptures the scored or weakened lines and forces the tear open segments 41 - 46 outward to form the openings 41b - 46b . in addition , the force of the charge pushes the fire extinguishing powder upward in the container , loosening any caking . the fire extinguishing powder then falls out of the can by gravitational force to extinguish any fire below which may be in a frying pan , for example . the explosive charge 51 and fuse 61 may be of the type disclosed in u . s . pat . no . 3 , 884 , 307 which patent is herein incorporated by reference . although the fire extinguisher of this patent is effective , some problems have occurred in that the fire extinguishing powder sometimes drops down in a manner which causes splashing of the grease . in addition the pressure in the container resulting from excessive heat before activation of the explosive may cause the container to &# 34 ; puff up &# 34 ; which affects formation of the openings 41b - 46b . in accordance with one aspect of the invention , there is provided a metal metering screen 71 formed of members 71a and 71b which is located in the container and secured to the inside of the lid 27 over the explosive 51 . the screen 71 has a central opening to receive the means 51a . the screen is round and extends outward beyond the explosive where its outer edge 73 is secured to the inside of the lid 27 between the edges 23e and 27e of the can and lid when they are bent together to form the seam . when the openings 41b - 46b are formed , the non - erupting portions or web 27w of the lid 27 hold the central portion of the screen 71 in place . the screen 71 meters the flow of powder through the openings 41b - 46b and causes it to fall down in an even distribution and prevents splashing of the grease which may be in a pan below the fire extinguisher . the screen 71 can be a 1 / 8 inch , 1 / 4 inch , 3 / 8 or 1 / 2 inch mesh size screen . tests were conducted with and without the screen 71 using a container having a diameter of about 3 3 / 8 inches and height of about 2 inches and wherein six openings 41a - 46b in the lid 27 were formed with the lid 27 located 32 inches above a flat surface onto which the powder was dropped . without the screen 71 , the container was emptied in 5 seconds depositing about 75 % of the powder in a 10 inch diameter circle . using a 1 / 2 inch mesh screen 71 , the container was emptied in 6 seconds with 75 % of the powder deposited on the lower surface in a 10 inch diameter circle . using a 1 / 4 inch mesh screen 71 , the container was emptied in about 7 second with 75 % of the powder deposited in a 8 inch diameter circle on the lower surface . with a 1 / 8 inch mesh screen , the container was emptied in about 16 seconds with 75 % of the powder deposited in a 10 inch circle . these test showed that the screen allowed the powder to flow out of the container sufficiently fast with an even distribution on the surface below to minimize any splashing of grease in a pan located on a burner of the stove below . the screen 71 also allows use of the deeper container 23 which holds more fire extinguishing powder 29 . for the container size described above , a 3 / 8 inch mesh size screen is preferred . referring to fig4 and 5 , the assembly for connecting the magnet 31 and case 33 to the top 23b of the container 23 comprises a hollow eyelet 91 , a resilient o - ring 93 , a washer 95 , a hollow eyelet 97 and a hollow eyelet 99 . the top 23b of the container 23 has a central aperture 23ba formed therethrough and the case 33 has a central aperture 33a formed therethrough . the eyelet 91 is inserted through the o - ring 93 , and through the aperture 23ba . the eyelet 97 is located around the eyelet 91 . the case 33 has a central aperture 33a formed therethrough . the eyelet 99 is inserted through the aperture 33a , around the eyelet 91 and into the eyelet 97 . the edge 91e of the eyelet 91 crimped over to secure the assembly together . the eyelet 99 is longer than the eyelet 97 and the space between the rims 97r and 99r of the eyelets 97 and 99 allows the case 33 to tilt relative to the wall 23b of the can 23 . this allows the magnet 31 to be attached to a slanted surface of the metal vent - a - hood with the container 23 hanging generally straight down . the opening 91a extending through the eyelet 91 is filled with a lower temperature melting solder 101 which will melt to provide a vent through the top wall 23b of the container if the inside of the can 23 gets too hot before the explosive 51 is actuated . this relieves the pressure in the container and prevents the container wall from &# 34 ; puffing up &# 34 ; which may occur due to the heat and gases released in the can 23 before the explosive 51 is actuated . if the can 23 does puff up or swell the web 27w may be pushed outward before the explosive 51 is actuated preventing the vanes or segments 41 - 46 from opening outward since the resulting openings 41b - 46b may be smaller than the segments 41 - 46 . fig6 and 7 show different embodiments of vents which also may be formed through the top wall of the container . in the embodiment of fig6 the vent is a one - way &# 34 ; duckbill &# 34 ; valve 103 allowing flow only in the direction of the arrow 105 . in the embodiment of fig7 the vent comprises a hollow vent 107 having its opening 109 filled with wax 111 which melts in the presence of heat allowing pressure release from the container 23 . embossed reinforcing ribs 27wr also are formed on the web 27w to make the web 27w stiffer which prevents the web from being pushed outward which also minimizes the problem of the segments or vanes not opening outward . the ribs 27wr are formed by bending the web 27w outward after the score lines 41a are formed which tends to pull metal away from the score lines 41a - 46a faciliting opening of the segments 41 - 46 . referring now to fig8 and 9 , there is shown an extension fuse 161 adapted to be attached to the main fuse 61 if needed the main fuse 61 extends out of the lower lid 27 about 1 / 2 of an inch and has a diameter of about 3 / 32 of an inch . the extension fuse 161 is formed of the same material as fuse 61 and has the same diameter . its length is about 51 / 2 inches . it has two sleeves 163 and 165 with an opening 167 formed at its end 161u on one side of the fuse 161 between the fuse 161 and the sleeve 163 for receiving the lower end of the fuse 61 and clamping the fuse 161 to the fuse 61 . by attaching the fuse 161 to the fuse 61 , the effective fuse will be closer to the fire source and will result in the fire extinguisher being actuated sooner than if only the shorter main fuse 61 were used . referring to fig1 there is disclosed an acoustic detector 127 and circuitry for closing a solenoid actuated valve 123 in a gas pipe 125 leading to a stove 127 , when the detector 121 and circuity detects the sound produced upon actuation of the explosive charge . 120 a . c . voltage is taken from leads 131a and 131b and applied by way of a 12 volt transformer 135 to a full wave rectifier 137 which converts the a . c . to d . c . voltage . the d . c . is applied to operate the detector 127 and a filter comprising a capacitor 143 and a potentiometer 145 . the filter is a high pass filter and passes a voltage representative of the sound produced upon explosion of the explosive charge 51 for producing an output for controlling a triac 139 for allowing passage of a . c . to lead 141a for closing the normally open valve 123 . the purpose of the filter is to prevent lower frequency background noise from actuating the valve 123 . more details of the circuit of fig1 now will be described . member 151 is a 5 volt regulator which produces 5 volts at its output for operation some of the circuity . member 153 is an operational amplifier for amplifying the output of the microphone 127 . the gain of the amplifier is controlled by potentiometer 155 and its frequency response is controlled by potentiometer 145 . members 161a , 161b , 161c , and 161e are nand gates of a single chip . gates 161a and 161b are inverters and gates 161c and 161d form a set - reset flip - flop . member 171 is an optical coupler . five volts on its left side as shown , turns on two scrs which turns on the triac 139 to close the solenoid valve 123 . in one embodiment the representative of sound frequencies above about one khz . and blocks lower frequencies . the electrical valves and other information of the components of the circuitry are set forth on fig1 .

0Human Necessities

fig1 is an exploded side view cutaway of the major parts of the inventive latch subassembly . the male section or probe 10 is typically mounted in a drill pipe or drill collar 12 about the instrument package ( not shown ) in a suite of logging tools . the probe 10 has a sloping shoulder on its upper end to help align the probe with the leading ring 14 of the female latch receiver 16 . the probe 10 is threaded to accept the male electrical connection 18 . the lower end of probe 10 is also threaded to allow mounting in drill collar 12 . an adaptor 20 is solidly attached to drill collar 12 and places the probe 10 rigidly in the approximate center of the drill collar . it should be apparent that other variations of the depicted adaptor would be just as suitable for positioning the probe in mid - pipe . male electrical connector 18 typically has an upper conductive section 22 and a lower insulative sleeve 24 . although the tool suite ( discussed below with respect to fig3 ) may have a number of logging devices , the gathered information may be multiplied . consequently , a single conductor may be all that is needed for male electrical connector 18 . an additional wire or cable ( not shown ) connects upper conductive section 22 , via the passageways in probe 10 and adaptor 20 , to the logging devices below in drill collar 12 . female mating piece 16 is pumped down through the drill pipe when a connection is to be made . the mating piece 16 is made up of two portions . the first is an overshot portion comprising a leading ring 14 , a middle ring 26 , and a half tube extension 28 . the other portion , an electrical connector receiver section , is made up of the debris deflection surface 30 , the mating orifice 32 , debris exit orifice 34 , and mounting threads 36 . the leading ring 14 may have a significant taper on its leading edge to permit the female portion of the latch substantially to ride on the top of any debris found in the drill pipe . a preferred way to accomplish this is to make the taper angle away from the ring center so that the radially inner edge of the taper is the furthest edge from the electrical connector receiver section . this is illustrated in fig2 . since the half tube extension 28 is open , any debris entering the overshot assembly can readily escape . the probe 10 self - aligns with the mating piece 16 on the leading ring 14 . consequently , minor misalignments between the probe 10 and leading ring 14 are inconsequential . the inside diameter of both the leading ring 14 and the middle ring 26 should approximate the outside diameter of probe 10 . however , the probe may be made up of two sections having different diameters . the larger diameter section would reside within leading ring 14 when the male electrical probe is seated . alternatively , although less desirably , the probe may be slightly conical . the inside surface of the rings , again , should match the outside surface of the probe . the half tube extension 28 lends excellent rigidity to the assembly . the half tube extension may be slotted for additional debris clearance . any trash or debris which precedes the probe 10 through the leading ring 14 and middle ring 26 should be deflected by debris deflector surface 30 . only a small orifice 32 is provided for passage of male electrical connector 18 . most larger pieces of debris will not enter chamber 35 through orifice 32 . even those that enter should be able to exit through debris exit orifice or port 34 . port 34 should be angled to allow ease of fluid flow and should have a diameter larger than orifice 32 to permit debris which has entered chamber 35 to exit . female electrical receptor 40 is mounted inside chamber 35 with substantial clearance around the end nearest orifice 32 . mounting of the female electrical receptor 40 within chamber 35 of the female mating piece 16 is accomplished by mounting threads 36 . receptor 40 has a protective cover 42 , a support base 44 , and a spring contact 46 . the protective cover 42 is perforated on the first electrical contact and will typically be filled with , e . g ., a silicone - type grease , to protect the electrical connection after it is made . the protective cover is desirably made of a suitable elastomeric material which tightly seals around the male electrical connector 18 . the protective cover helps preserve the integrity of the made - up electrical connection even after the grease has leaked out and drilling fluid is inside the cover . a design such as this will reliably allow multiple make and break electrical connections . this inventive latch subassembly may be used as disclosed -- that is to say -- without additional mechanical latching means or it may be used with other known latching devices if the need arises . fig2 merely shows , in perspective , the relative positioning of the major parts of the inventive device . probe 10 is shown with male electrical connector 18 attached . female mating piece 16 is shown with leading guide ring 14 , middle ring 26 , half tube extension 28 , debris deflector surface 30 , connector orifice 32 , and debris exit orifice 34 . the desirability of assuring that connector orifice 32 fall on a line connecting the centers of leading guide ring 14 and middle ring can be seen from this figure . fig3 shows in schematic fashion , the manner in which a latch subassembly such as this would be used . tool string 48 is installed at the bottom end of a string of drill pipe sections 50 ; these drill pipe sections are typically about 30 feet in length . the drill string is shown in a borehole 52 which is deviated nearly 70 ° from vertical . since the inventive latch subassembly would normally be used to log a hole during the time drilling is proceeding or shortly after the well has been drilled to td , a drilling rig 54 is shown at the surface 56 . borehole 52 has a string of casing 58 installed down to casing shoe 60 . the remainder of the borehole below casing shoe 60 is open hole . a pass - through sub 62 is shown in the drill string located at the bottom of casing 58 near casing shoe 60 . the pass - through or side entry sub 62 allows a logging cable to extend from tool string 48 by connector 64 , such as that described herein , up through the interior of various drill pipe sections 50 out side entry sub 62 into the annular area between casing 58 and the drill pipe sections 50 . as was discussed earlier in this specification , solid debris found in the drilling mud tends to collect on the low side of the drill pipe . the inventive latch assembly , which would make up at least a portion of connector 64 , is specifically designed to ride over that debris and exclude it from the mating area of the connector . in any event , logging cable 66 then continues up out of the borehole and over a pair of sheaves 68 and 70 into a winch 72 . for the purpose of clarity , the drill string handling equipment required for movement of the drill string and the surface safety equipment required both by prudence and law have not been depicted in drilling derrick 54 . however , these devices are so well - known that no additional disclosure is considered necessary . pass - through or side entry sub 62 is shown at its lowest point . although , for the purpose of the disclosed method , a number of different crossover subs would be acceptable , the preferable sub is shown in u . s . pat . no . 468 , 532 , filed feb . 22 , 1983 , by a . p . davis , o . m . knight , and j . w . stoltz . in order to protect the wire from the rigors of the open borehole , logging cable 66 normally would not be allowed to venture into the open hole below casing shoe 60 . consequently , the drill string shown in fig3 is ready to log a portion of the hole upward from its depicted position to a point up the hole which is equal in distance as is the pass - through sub 62 from surface 56 . the drill string is merely tripped out of the hole , logging is paused every 90 feet ( a treble of drill pipe 50 ), the treble is removed from the string , logging is recommenced and continues until time comes for removal of another treble of drill pipe . this process continues until side entry sub 62 reaches the surface . at that time , side entry sub 62 is removed from the string and the logging cable withdrawn . if additional wellbore remains to be logged , an amount of drill pipe equal in length to the distance between casing shoe 60 and ground surface 56 is removed from the drill string and the side entry sub reinstalled in the string . the logging cable 66 is then pumped down the interior of the drill string through the side entry sub and latched with tool string connector 64 . the tool string 48 is then run in to a position to log a previously unlogged portion of the borehole 52 . this procedure is repeated until the entire zone of interest is logged . this technique has a number of significant advantages . the tool string is made up of logging tools that are potentially of a very high resolution in that they need not be miniaturized to be pumped down within the interior of a drill string . the fact that a drill string is used to insert the tool string to the bottom allows very accurate depth correlation . the process should save drilling rig time in that the tools are positively placed by pushing , if necessary , rather than being passively inserted as is the case with wireline logging apparatus . the borehole need not be conditioned prior to running a sonde as is often the case with wireline logging apparatus . wireline devices are susceptible to a number of problems in open boreholes , particularly those which are high angle . these problems can be summarized as washouts in which the tools fall and become lodged , doglegs , bridges , and ledges into which the tools nose during their downward path and lose momentum , mud balls , cutting buildups , or heavy muds , all of which impede the downward motion of the logging tool towards the bottom , and key seats found in the upper edge of the boreholes causing the logging tool to hang up upon removal . it should be understood that the foregoing disclosure and description are only illustrative and explanatory of the invention . various changes in and modifications to the components of the inventive device and the methods of using that device as well as in the details of the illustrated construction in processes may be made within the scope of the appended claims without departing from the spirit of the invention .

4Fixed Constructions

fig2 shows an attachment device 30 according to the invention mounted on a substrate 32 , partially shown . substrate 32 could be , for example , a protective cover for a sensor used in an engine compartment or an access panel , and could be a textile or polymer sheet or a plastic or metal plate . attachment device 30 is use to releasably attach substrate 32 to a support structure by engaging threaded studs similar to the example of fig1 . while the attachment device works most advantageously with a threaded stud , it is by no means limited in its use to threaded studs and may be used with any manner of stud or shank . as best shown in cross - section in fig3 , device 30 comprises a housing 34 formed of facing wall portions 36 and 38 positioned in spaced apart relation to one another to form a space 40 . each wall portion 36 , 38 has a respective aperture 42 , 44 through it , providing access to the space 40 . housing 34 is attached to the substrate 32 , and the attachment may be effected in any number of ways . in the example shown in fig2 and 3 , attachment between housing 34 and substrate 32 is effected via a flange 46 extending circumferentially around the housing in spaced relation to the wall portion 38 . flange 46 preferably comprises a rolled - over portion of the housing 34 . together , the flange 46 and wall portion 38 forcibly engage the substrate 32 to secure housing 34 to it . alternatively , wall portion 38 may be adhesively bonded , welded or fused to the substrate 32 or fasteners such as rivets and screws may also be employed . a push nut 48 is positioned within space 40 . push nut 48 comprises a rim 50 surrounding and defining an opening 52 . preferably , the rim is oriented within the space 40 so that its opening 52 may be substantially aligned coaxially with the apertures 42 and 44 for receiving a threaded stud 54 , shown in phantom line . as shown in fig2 , a plurality of teeth 56 are positioned in spaced relation around the rim 50 . teeth 56 are flexible and extend inwardly to engage the threaded stud 54 as shown in fig3 . preferably , teeth 56 are angularly oriented to one side of rim 50 . teeth 56 may be angled to either side . angularly orienting the teeth 56 allows them to be “ self jamming ” when engaged with the stud 54 . because the teeth 54 are flexible and angled , the push nut 48 can be pushed axially over the stud 54 in the direction indicated by arrow 58 . teeth 56 engage the stud 54 and , being flexible , deflect in the direction that increases their orientation angle as they are being pushed over the stud . once engaged with stud 54 , the angular orientation of teeth 56 resists axial force applied to the push nut 48 that would tend to remove it from the stud . teeth 56 , being too long to deflect through the rim 50 when engaged with the threaded stud 54 , are placed under compression , are restrained by the rim , and jam the push nut 48 into engagement with the stud 54 , preventing its removal under axial force . wall portions 36 and 38 and their respective apertures 42 and 44 are sized and spaced apart so that push nut 48 is captured within space 40 . the space 40 is sized so that the push nut 48 can be rotated 360 ° relative to the housing 34 about an axis 60 that is substantially coaxial with opening 52 and apertures 42 and 44 . the apertures 42 and 44 are also sized to expose at least the teeth 56 of the push nut 48 . this permits access to the push nut 48 so that a tool may be used to rotate it for removal from the threaded stud 54 as one would remove a conventional nut . preferably , the space 40 also allows lateral motion of the push nut 48 as indicated by arrow 62 . by allowing lateral motion of push nut 48 within housing 34 the tolerances of the substrate 32 need not be held very closely . this will allow multiple attachment devices 30 on a substrate 32 to easily engage multiple studs 54 on a support structure without significant distortion to the cover . a preferred embodiment 31 of the attachment device according to the invention is illustrated in fig3 a . in this embodiment , housing 34 comprises a cylindrical shell 33 having a longitudinal axis 35 . facing wall portions 36 and 38 are integrally formed from the shell 33 and positioned at one end . the wall portions define respective apertures 42 and 44 that are coaxially aligned with axis 35 . push nut 48 is captured within the space 40 defined by the wall portions 36 and 38 , the wall portions being sized so as to expose teeth 56 . a flange 37 , shown in phantom line , is provided in axially spaced relation to the wall portion 38 for attaching the device 31 to the substrate 32 . the flange 37 and the wall portion 38 form a channel for capturing the substrate 32 . in the embodiment of the invention shown in fig3 a , the channel and the space 40 extend parallel to one another because the substrate 32 is flat . the substrate is captured between the flange and the wall portion . preferably , flange 37 is formed integrally with housing 34 by deforming the end of the shell 33 to extend outwardly from the shell . alternatively , as shown in fig9 , device 31 may be part of an assembly 70 comprising a tubular substrate 74 . shell 33 coaxially engages with substrate 74 and may be held thereto via a friction fit for example , or by adhesive bonding . assembly 70 may serve , for example , as a protective cover for an elongated sensor or other delicate instrument , the protected component being received through the opening 52 along axis 35 . another embodiment 41 of the attachment device according to the invention is shown in fig4 . attachment device 41 has a perimeter 43 having a shape or surface texture that will provide purchase that will allow the device 41 to be turned relative to the substrate 32 . for example , the perimeter may have a hexagonal shape to provide wrench engageable flat surfaces 45 as shown , or the perimeter 43 may be knurled so that device 41 could be manually turned . other shapes and surface textures are also feasible . as shown in fig5 , embodiment 41 has the push nut 48 captured between facing wall portions 36 and 38 of housing 34 , the wall portions engaging the rim 50 to prevent rotation of the push nut 48 relative to the housing 34 . instead , rotation of the attachment device 41 relative to the substrate 32 is permitted by positioning a gap 47 between the flange 46 and the wall portion 38 , the gap 47 being wider than the thickness of substrate 32 and not permitting forcible engagement between the flange 46 , wall portion 38 and substrate 32 . substrate 32 is preferably manufactured with attachment devices 41 positioned within openings that align with studs 54 on a support structure on which the substrate 32 is to be mounted . assembly of the substrate 32 onto the studs 54 is effected by pushing each attachment device 41 onto a respective stud 54 as described above . the attachment device 41 thus permits rapid assembly . removal of the cover is effected by using a wrench to engage the wrench engageable surfaces 45 ( see fig4 ) and unscrew the device 41 from the stud . torque applied to the housing 34 is transmitted to the attachment device 48 because it is secured between the facing wall portions 36 and 38 . this allows teeth 56 to traverse the threads of the stud 54 . however , the torque does not transfer to the substrate 32 because it does not forcibly engage flange 46 or wall portion 38 due to gap 47 . fig6 and 7 illustrate yet another embodiment 49 of the attachment device according to the invention . embodiment 49 has a housing 51 formed as a single piece , the housing 51 surrounding and defining an aperture 53 that receives the stud 54 . the flexible teeth 56 are attached directly to the single piece housing 51 and extend inwardly of the aperture 53 to engage the stud 54 to retain the substrate 32 to the support structure . similar to embodiment 41 described above , attachment device 49 has a perimeter 43 shaped to provide purchase for turning the device , either by a tool such as a wrench or manually . device 49 also has a flange 46 separated from housing 51 by a gap 47 , as best shown in fig7 . this allows the device 49 to turn relatively to the substrate 32 to which it is attached . the attachment device 49 may be pushed directly onto the stud 54 to mount the substrate 32 on a support structure and removed by turning it relative to the substrate 32 , either manually or using a tool such as a wrench . another embodiment 64 of the attachment device according to the invention is shown in fig8 . embodiment 64 comprises a push nut 48 mounted within a housing 66 , the housing being attached to a mounting plate 67 . plate 67 provides an area for attaching the housing to a substrate 32 , shown in phantom line . the substrate 32 may then be attached to a support structure using attachment device 64 . various fastening means may be used to attach plate 67 to substrate 32 . by way of example a rivet 68 is shown , it being understood that other fastening means , such as bolts , nails , hook - and - loop fasteners and the like could also used . attachment devices according to the invention offer several advantages over the prior art method of attachment , including reduced part count as there are no loose fasteners that must be handled and become lost , more rapid assembly and reduced manufacturing costs since parts can be fabricated with greater tolerances due to the relative motion afforded between the fastening components and the cover being attached to a structure .

8General tagging of new or cross-sectional technology

the present description relates to hand - operable vacuum devices . in some cases , hand - operable vacuum devices can be manipulated by a user to draw material into the device and / or expel material from the device . the hand - operable vacuum device can be constructed such that a user can squeeze and deform the device and then the device is resiliently biased to return to an original configuration . the construction of the hand - operable vacuum device can include generally longitudinally arranged resilient outwardly - biasing structures that bias the device back to its original configuration more effectively than existing technologies . this effective bias can create relatively strong vacuum forces for drawing material into the hand - operable vacuum device . fig1 - 11 collectively show an example of a hand - operable vacuum device 100 . fig1 , 3 , and 5 show the hand - operable vacuum device 100 in a first configuration . fig2 , 4 , and 6 show the hand - operable vacuum device 100 manipulated into a second configuration by a human user . fig7 - 11 collectively show how the construction of the hand - operable vacuum device 100 promotes returning to the first configuration of fig1 , 3 , and 5 when the user stops manipulating the device . briefly , the hand - operable vacuum device 100 can be resiliently biased to assume and / or return to the first configuration after user manipulation . fig1 and 2 show perspective views of the hand - operable vacuum device . fig3 - 4 show sectional views of the hand - operable vacuum device taken along section aa indicated in fig1 . section aa is transverse to the x - reference axis and parallel to the yz - reference plane . fig5 - 6 show a component of the hand - operable vacuum device taken parallel to the xz - reference plane as indicated along section bb . in some cases , the hand - operable vacuum device 100 can be thought of as having a deformable portion 102 and an interface portion 104 that can include a nozzle 105 . the deformable portion 102 can extend along a long axis that runs parallel to the x - reference axis . the deformable portion can be generally elongated , spherical , or other shape . the deformable portion can include one or more resilient outwardly - biasing structures 106 . in some implementations the resilient outwardly - biasing structures can be longitudinally oriented ( i . e ., parallel to the long axis ). in this case , the hand - operable vacuum device includes a pair of resilient outwardly - biasing structures 106 ( 1 ) and 106 ( 2 ). the deformable portion 102 can be manipulated or squeezed by a user as indicated by arrows 402 and 404 to deform or squish the deformable portion . the squishing can bend the resilient outwardly - biasing structures as can be seen by comparing fig5 and 6 which show resilient outwardly - biasing structure 106 ( 1 ). fig5 shows the resilient outwardly - biasing structure in a resting or biased configuration . fig6 shows a bowed configuration of the resilient outwardly - biasing structure produced by user manipulation . fig7 - 11 show how the resilient outwardly - biasing structures 106 ( 1 ) and 106 ( 2 ) can return the deformable portion 102 to the resting configuration when the user stops applying pressure . specifically , upward arrows 702 ( 1 ) and 702 ( 2 ) indicate the outward bias exerted by resilient outwardly - biasing structures 106 ( 1 ) and 106 ( 2 ), respectively . the outward bias returns the resilient outwardly - biasing structures from the bowed configuration of fig8 to the more linear configuration of fig9 . ( in another implementation , the resilient outwardly - biasing structures could be outwardly bowed at rest such that user manipulation causes them to be less bowed .) the outward bias exerted by resilient outwardly - biasing structures 106 ( 1 ) and 106 ( 2 ) facilitates returning the deformable portion from the manipulated configuration of fig1 to the resting configuration of fig1 . returning the deformable portion to the resting configuration can increase the volume thereof and can thereby create a very strong vacuum that can be utilized to draw material into the interface portion 104 via nozzle 105 . fig1 illustrates an example of how the resilient outwardly - biasing structures 106 ( 1 ) and 106 ( 2 ) can extend from a perimeter 1202 of the deformable portion 102 . in various implementations the resilient outwardly - biasing structures can extend from the perimeter at an angle a that is oblique or a right angle relative to the perimeter proximate to the outwardly - biasing structure . in some implementations , the angle a can be in a range from about 90 degrees to about 135 degrees . other implementations may be outside this range . the example implementations above include a pair of outwardly - biasing structures 106 ( 1 ) and 106 ( 2 ). fig1 - 14 illustrate some alternative implementations of hand - operable vacuum devices . fig1 shows first and second pairs of outwardly - biasing structures 1302 ( 1 ), 1302 ( 2 ) and 1304 ( 1 ), 1304 ( 2 ) on deformable portion 1306 . in this example the first and second pairs are generally opposing one another , but such need not be the case . however , the present example can be useful in facilitating the user &# 39 ; s grip . fig1 shows an alternative implementation that includes three outwardly - biasing structures 1402 ( 1 ), 1402 ( 2 ), and 1402 ( 3 ) on deformable portion 1404 . in this case the outwardly - biasing structures extend outwardly from perimeter 1406 rather than inwardly as illustrated in the example implementations of fig1 - 13 . fig1 offers another implementation with two outwardly - biasing structures 1502 ( 1 ) and 1502 ( 2 ) on deformable portion 1504 . in this case , the outwardly - biasing structures are generally elliptical rather than linear when viewed in cross - section . other shapes and / or configurations can alternatively or additionally be utilized . fig1 shows an example hand - operated vacuum device 1600 that can be employed as a specimen collector , among other uses . fig1 shows an example hand - operated vacuum device 1700 that can be employed as a throat aspirator , among other uses . fig1 shows an example hand - operated vacuum device 1800 that can be employed as a dental squirt pick , among others . fig1 shows an example hand - operated vacuum device 1900 that can be employed as a nose aspirator , among others . fig2 - 21 collectively show another example of a hand - operated vacuum device 2000 that can be employed to various uses . in this case , the hand - operated vacuum device 2000 includes deformable portion 2002 and interface portion 2004 . the deformable portion 2002 includes resilient outwardly - biasing structures 2006 ( 1 ) and 2006 ( 2 ). the interface portion 2004 includes a removable cap 2008 that covers a nozzle 2010 . fig2 shows the removable cap 2008 in place on the interface portion 2004 . fig2 shows the hand - operated vacuum device 2000 with the cap removed to expose nozzle 2010 . the removable cap 2008 can be formed during manufacture of the hand - operated vacuum device 2000 and / or added to the hand - operated vacuum device . for instance , the removable cap can be formed as part of the hand - operated vacuum device to help maintain internal conditions of the hand - operated vacuum device . for instance , the removable cap could be utilized to maintain sterile conditions in the hand - operated vacuum device until the cap is removed at the time of use . the user can remove the removable cap , such as by twisting . the user can then squeeze the deformable portion and place the nozzle 2010 near a sample to be collected . the user can reduce and / or release the pressure on the deformable portion to create a vacuum that draws the sample into the hand - operated vacuum device . in some implementations , the removable cap 2008 can be re - installed to maintain the sample and avoid cross - contamination . in other configurations , the hand - operated vacuum device 2000 can be manufactured and filled with a liquid , such as a wound cleansing antiseptic solution or a mouthwash . the removable cap can then be added to maintain the integrity of the hand - operated vacuum device until use . a user can remove the removable cap and propel the liquid from the nozzle by squeezing the deformable portion 2002 . hand - operated vacuum devices can be manufactured utilizing various techniques and / or materials . for instance , in some implementations the hand - operated vacuum devices can be formed via a molding process , such as injection molding or blow molding . various materials can be utilized including but not limited to various polymers . in some cases the hand - operated vacuum devices can be manufactured as a single piece , yet the interface portion can be thicker than the deformable portion so that the interface portion is relatively rigid while the deformable portion is readily deformed by a user . for instance , such a configuration can be achieved by blow molding where the polymer is introduced at the interface end of the hand - operated vacuum device . in one such example , the interface portion can have an average thickness of 0 . 1 - 0 . 3 millimeters while the deformable portion has an average thickness of 0 . 3 - 0 . 6 millimeters . in summary , hand - operable vacuum devices are described that can allow great vacuum ( and / or expulsion ) forces to be created by a user . the hand - operable vacuum devices can be inexpensively manufactured and can be disposable and / or reusable . in some instances , the hand - operable vacuum devices can be manufactured and / or packaged so that the devices are sterile until the packaging is opened . further , the hand - operable vacuum devices lend themselves to construction from materials that can be transparent so that the user can see the contents ( if any ). although specific examples of hand - operable vacuum devices are described in language specific to structural features , it is to be understood that the subject matter defined in the appended claims is not intended to be limited to the specific features described . rather , the specific features are disclosed as exemplary forms of implementing the claimed statutory classes of subject matter .

0Human Necessities

the perspective view of fig1 is a schematic presentation of a x - ray tube 1 in accordance with the invention . this diagram is limited to characteristic elements located within the interior of an envelope 2 and made visible in the figure through a cut - out portion forming an opening in said envelope . the envelope 2 supports a cathode 3 , and conventional means ( not shown ) are employed for supporting an anode 4 . in the non - limitative example of this description , said anode 4 is a cylinder provided with a bore 5 having a cross - section s which is identical throughout the length l 2 of said bore . internal walls 9 of the bore 5 are thus parallel to a longitudinal axis 6 of said bore 5 . in the non - limitative example herein described , the cross - section s of the bore 5 is circular and has a diameter d . the same accordingly applies to the first and second ends 7 , 8 of the bore 5 . in fig1 the bore 5 and the second end 8 are shown in dashed lines . the walls 9 are formed by a metal or a metallic compound which preferably has a high atomic number such as tungsten , for example . in the non - limitative example described , the cathode 3 is located in the longitudinal axis 6 of the bore 5 and generates an electron beam 10 having axial symmetry and small divergence substantially along the longitudinal axis 6 . the electron beam 10 which penetrates into the bore 5 through the first end 7 bombards the walls 9 over a length l 1 which , in the non - limitative example herein described , is shorter than the length l 2 of the bore 5 , with the result that the walls 9 thus constitute an anode target . said length l 1 and its position with respect to the length l 2 of the bore 5 are a function of the divergence of the electron beam 10 , of the homogeneity of said beam , and also of the diameter d of the bore 5 . in this arrangement and taking into account the small angle of incidence ( not shown ) at which the electrons bombard the walls 9 , said bombardment produces x - radiation having preferential emission in a direction a and constituting a first x - ray beam fx 1 . said beam fx 1 emerges from the second end 8 opposite to the end corresponding to entry of the electron beam 10 along an axis which is identical with the longitudinal axis 6 and passes out of the x - ray tube via an exit window 14 which is shown in dashed outline . a noteworthy feature lies in the fact that this arrangement makes it possible in particular to obtain an x - ray beam fx 1 which contains a very high proportion of the total x - radiation ( not shown ). another significant feature is that , since the walls 9 are parallel , the x - ray beam fx 1 is caused by the bore 5 to assume the shape of a pencil beam having limits 15 , 16 which are parallel or nearly parallel to the longitudinal axis 6 . the x - ray beam fx 1 in the form of a pencil beam has the same cross - section s as that of the bore 5 . a fraction of the total x - radiation produces a second beam fx 2 which emerges from the bore 5 via the first end 7 or in other words the end through which the electron beam 10 enters the bore . this description of an x - ray tube in which the cathode 3 emits the electron beam 10 along the longitudinal axis 6 is not limitative . thus the cathode 3 can be placed differently and can emit the electron beam 10 along an axis which may or may not coincide with the longitudinal axis 6 . the electron beam may also not have an axis and follow a curved trajectory or any desired trajectory by making use of conventional deflecting means ( not shown ), the sole condition being that the electrons should arrive at the entrance or inlet of the bore 5 substantially along the longitudinal axis 6 of said bore in order to bombard the walls 9 as uniformly as possible . in the event that only the second beam fx 2 is to be utilized , the second end 8 of the bore 5 can accordingly be made opaque to x - radiation . by way of example , this can be achieved by closing said second end 8 by means of a plug ( not shown ) which is made of suitable material and accordingly prevents any emergence of the first beam fx 1 . similarly , the anode 4 can have a shape which is different from that shown in fig1 and the same applies to the cross - section s of the bore 5 . the essential condition to be satisfied lies in the need to obtain an x - ray beam fx 1 in the form of a pencil beam by means of walls 9 constituted by a normed surface in which the generator - lines of said surface ( not shown ) are parallel to the longitudinal axis 6 of the bore 5 . the anode 4 can be formed of the same material as the walls 9 of the bore 5 as explained earlier . in this case , machining of the bore 5 results in direct formation of walls 9 which are ready to perform the function of anode target . the anode 4 can also be of different material and the walls 9 can be lined with suitable material over all or part of the length l 2 of the bore 5 . fig1 a is an axial crossectional view showing the anode 4 . only the second x - ray beam fx 2 is utilized . the second end 8 is closed by a plug 50 , in order to prevent emergence of the first beam fx 1 . fig2 represents another form of construction of an x - ray tube 1 in accordance with the invention and is an axial sectional view showing elements of said x - ray tube . in this embodiment of the invention as well as in the example described , provision is made for an electrostatic or magnetic deflection lens 20 of conventional type . said deflection lens is placed on the path of the electron beam emitted by the cathode 3 , said electron beam being represented in fig2 by electron trajectories t 1 , t 2 , t 3 , t 4 , t 5 , . . . t n . in the non - limitative example herein described , the deflection lens 20 is centered on the longitudinal axis 6 of the bore 5 and can either form part of the anode 4 itself or be located in the vicinity of this latter as in the example described . by means of a magnetic field ( not shown ) produced by the deflection lens 20 , said lens makes it possible to focus the electrons and to establish electron trajectories t 1 , t 2 , . . . t n in such a manner as to ensure that said trajectories have small angles of divergence , with the result that the electrons can pass into the bore 5 and bombard the walls 9 . the beam fx 1 of x - radiation ( not shown in fig2 ) is identical with the beam shown in fig1 . a deflection lens 20 also makes it possible , by adjusting the strength of the magnetic field produced by said lens or by adjusting its position along the longitudinal axis 6 , to adjust the length l 1 or distance over which bombardment of the walls 9 takes place and the position of said length l 1 with respect to the length l 2 of the bore 5 . this in turn permits adjustment of the characteristics of the first beam fx 1 and also of the second beam fx 2 if necessary . in the non - limitative example described , the anode 4 is of copper and is provided with passages 35 through which a coolant fluid is permitted to flow , the walls 9 being provided with a tungsten lining 36 . an x - ray tube 1 in accordance with the invention produces in particular at least one pencil beam fx 1 which serves to obtain a useful beam ( not shown ) such that an x - radiation emission efficiency in said useful beam is increased to a very appreciable extent in comparison with traditional designs . by virtue of its characteristics , an x - ray tube of this type is particularly well - suited to scanning techniques and primarily to digital radiology .

7Electricity

referring to fig1 to 7 , what is shown is a method for the treatment of glaucoma by trabecular bypass surgery . in particular , a seton implant is used to bypass diseased trabecular meshwork at the level of trabecular meshwork to use or restore existing outflow pathways and methods thereof . for background illustration purposes , fig1 shows a sectional view of an eye 10 , while fig2 shows a close - up view , showing the relative anatomical locations of the trabecular meshwork , the anterior chamber , and schlemm &# 39 ; s canal . thick collagenous tissue known as sclera 11 covers the entire eye 10 except that portion covered by the cornea 12 . the cornea 12 is a thin transparent tissue that focuses and transmits light into the eye and the pupil 14 which is the circular hole in the center of the iris 13 ( colored portion of the eye ). the cornea 12 merges into the sclera 11 at a juncture referred to as the limbus 15 . the ciliary body 16 begins internally in the eye and extends along the interior of the sclera 11 and becomes the choroid 17 . the choroid 17 is a vascular layer of the eye underlying retina 18 . the optic nerve 19 transmits visual information to the brain and is sequentially destroyed by glaucoma . the anterior chamber 20 of the eye 10 , which is bound anteriorly by the cornea 12 and posteriorly by the iris 13 and lens 26 , is filled with aqueous . aqueous is produced primarily by the ciliary body 16 and reaches the anterior chamber angle 25 formed between the iris 13 and the cornea 12 through the pupil 14 . in a normal eye , the aqueous is removed through the trabecular meshwork 21 . aqueous passes through trabecular meshwork 21 into schlemm &# 39 ; s canal 22 and through the aqueous veins 23 which merge with blood - carrying veins and into venous circulation . intraocular pressure of the eye 10 is maintained by the intricate balance of secretion and outflow of the aqueous in the manner described above . glaucoma is characterized by the excessive buildup of aqueous fluid in the anterior chamber 20 which produces an increase in intraocular pressure ( fluids are relatively incompressible and pressure is directed equally to all areas of the eye ). as shown in fig2 , the trabecular meshwork 21 constitutes a small portion of the sclera 11 . it is understandable that creating a hole or opening for implanting a device through the tissues of the conjunctiva 24 and sclera 11 is relatively a major surgery as compared to a surgery for implanting a device through the trabecular meshwork 21 only . a seton implant 31 of the present invention for either using or restoring existing outflow pathways positioned through the trabecular meshwork 21 is illustrated in fig5 . in a first embodiment , a method for increasing aqueous humor outflow in an eye of a patient to reduce the intraocular pressure therein . the method comprises bypassing diseased trabecular meshwork at the level of the trabecular meshwork and thereby restoring existing outflow pathways . alternately , a method for increasing aqueous humor outflow in an eye of a patient to reduce an intraocular pressure therein is disclosed . the method comprises bypassing diseased trabecular meshwork at a level of said trabecular meshwork with a seton implant and using existing outflow pathways . the seton implant 31 may be an elongated seton or other appropriate shape , size or configuration . in one embodiment of an elongated seton implant , the seton has an inlet end , an outlet end and a lumen therebetween , wherein the inlet end is positioned at an anterior chamber of the eye and the outlet end is positioned at about an exterior surface of said diseased trabecular meshwork . furthermore , the outlet end may be positioned into fluid collection channels of the existing outflow pathways . optionally , the existing outflow pathways may comprise schlemm &# 39 ; s canal 22 . the outlet end may be further positioned into fluid collection channels up to the level of the aqueous veins with the seton inserted either in a retrograde or antegrade fashion with respect to the existing outflow pathways . in a further alternate embodiment , a method is disclosed for increasing aqueous humor outflow in an eye of a patient to reduce an intraocular pressure therein . the method comprises ( a ) creating an opening in trabecular meshwork , wherein the trabecular meshwork comprises an interior side and exterior side ; ( b ) inserting a seton implant into the opening ; and ( c ) transporting the aqueous humor by said seton implant to bypass the trabecular meshwork at the level of said trabecular meshwork from the interior side to the exterior side of the trabecular meshwork . fig3 shows an embodiment of the seton implant 31 constructed according to the principles of the invention . the seton implant may comprise a biocompatible material , such as a medical grade silicone , for example , the material sold under the trademark silastic ™, which is available from dow corning corporation of midland , mich ., or polyurethane , which is sold under the trademark pellethane ™, which is also available from dow corning corporation . in an alternate embodiment , other biocompatible materials ( biomaterials ) may be used , such as polyvinyl alcohol , polyvinyl pyrrolidone , collagen , heparinized collagen , tetrafluoroethylene , fluorinated polymer , fluorinated elastomer , flexible fused silica , polyolefin , polyester , polysilicon , mixture of biocompatible materials , and the like . in a further alternate embodiment , a composite biocompatible material by surface coating the above - mentioned biomaterial may be used , wherein the coating material may be selected from the group consisting of polytetrafluoroethylene ( ptfe ), polyimide , hydrogel , heparin , therapeutic drugs , and the like . the main purpose of the seton implant is to assist in facilitating the outflow of aqueous in an outward direction 40 into the schlemm &# 39 ; s canal and subsequently into the aqueous collectors and the aqueous veins so that the intraocular pressure is balanced . in one embodiment , the seton implant 31 comprises an elongated tubular element having a distal section 32 and an inlet section 44 . a rigid or flexible distal section 32 is positioned inside one of the existing outflow pathways . the distal section may have either a tapered outlet end 33 or have at least one ridge 37 or other retention device protruding radially outwardly for stabilizing the seton implant inside said existing outflow pathways after implantation . for stabilization purposes , the outer surface of the distal section 32 may comprise a stubbed surface , a ribbed surface , a surface with pillars , a textured surface , or the like . the outer surface 36 , including the outer region 35 and inner region 34 at the outlet end 33 , of the seton implant is biocompatible and tissue compatible so that the interaction / irritation between the outer surface and the surrounding tissue is minimized . the seton implant may comprise at least one opening at a location proximal the distal section 32 , away from the outlet end 33 , to allow flow of aqueous in more than one direction . the at least one opening may be located on the distal section 32 at about opposite of the outlet end 33 . in another exemplary embodiment , the seton implant 31 may have a one - way flow controlling means 39 for allowing one - way aqueous flow 40 . the one - way flow controlling means 39 may be selected from the group consisting of a check valve , a slit valve , a micropump , a semi - permeable membrane , or the like . to enhance the outflow efficiency , at least one optional opening 41 in the proximal portion of the distal section 32 , at a location away from the outlet end 33 , and in an exemplary embodiment at the opposite end of the outlet end 33 , is provided . fig4 shows a top cross - sectional view of fig3 . the shape of the opening of the outlet end 33 and the remaining body of the distal section 32 may be oval , round or some other shape adapted to conform to the shape of the existing outflow pathways . this configuration will match the contour of schlemm &# 39 ; s canal to stabilize the inlet section with respect to the iris and cornea by preventing rotation . as shown in fig3 , the seton implant of the present invention may have a length between about 0 . 5 mm to over a meter , depending on the body cavity the seton implant applies to . the outside diameter of the seton implant may range from about 30 μm to about 500 μm . the lumen diameter is preferably in the range between about 20 μm to about 150 μm . the seton implant may have a plurality of lumens to facilitate multiple flow transportation . the distal section may be curved at an angle between about 30 degrees to about 150 degrees , in an exemplary embodiment at around 70 - 110 degrees , with reference to the inlet section 44 . fig5 shows another embodiment of the seton implant 45 constructed in accordance with the principles of the invention . in an exemplary embodiment , the seton implant 45 may comprise at least two sections : an inlet section 47 and an outlet section 46 . the outlet section has an outlet opening 48 that is at the outlet end of the seton implant 45 . the shape of the outlet opening 48 is preferably an oval shape to conform to the contour of the existing outflow pathways . a portion of the inlet section 47 adjacent the joint region to the outlet section 46 will be positioned essentially through the diseased trabecular meshwork while the remainder of the inlet section 47 and the outlet section 46 are outside the trabecular meshwork . as shown in fig5 , the long axis of the oval shape opening 48 lies in a first plane formed by an x - axis and a y - axis . to better conform to the anatomical contour of the anterior chamber 20 , the trabecular meshwork 21 and the existing outflow pathways , the inlet section 47 may preferably lie at an elevated second plane , at an angle θ , from the first plane formed by an imaginary inlet section 47 a and the outlet section 46 . the angle θ may be between about 30 degrees and about 150 degrees . fig6 shows a perspective view illustrating the seton implant 31 , 45 of the present invention positioned within the tissue of an eye 10 . a hole / opening is created through the diseased trabecular meshwork 21 . the distal section 32 of the seton implant 31 is inserted into the hole , wherein the inlet end 38 is exposed to the anterior chamber 20 while the outlet end 33 is positioned at about an exterior surface 43 of said diseased trabecular meshwork 21 . in a further embodiment , the outlet end 33 may further enter into fluid collection channels of the existing outflow pathways . in one embodiment , the means for forming a hole / opening in the trabecular mesh 21 may comprise an incision with a microknife , an incision by a pointed guidewire , a sharpened applicator , a screw shaped applicator , an irrigating applicator , or a barbed applicator . alternatively , the trabecular meshwork may be dissected off with an instrument similar to a retinal pick or microcurette . the opening may alternately be created by retrograde fiberoptic laser ablation . fig7 shows an illustrative method for placing a seton implant at the implant site . an irrigating knife or applicator 51 comprises a syringe portion 54 and a cannula portion 55 . the distal section of the cannula portion 55 has at least one irrigating hole 53 and a distal space 56 for holding a seton implant 31 . the proximal end 57 of the lumen of the distal space 56 is sealed from the remaining lumen of the cannula portion 55 . for positioning the seton 31 in the hole or opening through the trabecular meshwork , the seton may be advanced over the guidewire or a fiberoptic ( retrograde ). in another embodiment , the seton is directly placed on the delivery applicator and advanced to the implant site , wherein the delivery applicator holds the seton securely during the delivery stage and releases it during the deployment stage . in an exemplary embodiment of the trabecular meshwork surgery , the patient is placed in the supine position , prepped , draped and anesthesia obtained . in one embodiment , a small ( less than 1 mm ) self sealing incision is made . through the cornea opposite the seton placement site , an incision is made in trabecular meshwork with an irrigating knife . the seton 31 is then advanced through the cornea incision 52 across the anterior chamber 20 held in an irrigating applicator 51 under gonioscopic ( lens ) or endoscopic guidance . the applicator is withdrawn and the surgery concluded . the irrigating knife may be within a size range of 20 to 40 gauges , preferably about 30 gauge . from the foregoing description , it should now be appreciated that a novel approach for the surgical treatment of glaucoma has been disclosed for releasing excessive intraocular pressure . while the invention has been described with reference to a specific embodiment , the description is illustrative of the invention and is not to be construed as limiting the invention . various modifications and applications may occur to those who are skilled in the art , without departing from the true spirit and scope of the invention , as described by the appended claims .

0Human Necessities

referring to fig1 there is shown a bird repeller assembly , generally designated 10 , comprising a body 11 , rotationally mounted on a pole or standard 12 secured by a pair of metal or plastic bands 14 , 14 to the piling 15 of a dock 16 . as may be seen best in fig2 - 4 , body 11 comprises a barrel section 18 having a plurality of fins 20 each adjacent to a corresponding vent opening 22 . each fin 20 is attached to the barrel 18 by an elongated hinge segment 24 and preferably has a pressed out cup - like portion or indent 26 for enhancing the catching of a wind current or other air flow produced by the prevailing wind as represented by arrow w . the vents 22 are preferably formed by stamping or otherwise cutting out the fins 20 from the wall of barrel 18 . the wind provides an airflow over the fins 20 which causes the body 11 to rotate in the adirection of arrow r ( fig2 ) due to the concave curvature of the fin surface 27 , and the convex curvature of the fin surface 25 . this rotation is enhanced by the cupping action of the fin indent 26 , which projects from the convex fin surface 25 in the rotational direction r and has a concave surface 29 and a convex surface 31 ( fig4 ). a head section 28 above barrel 18 is rotatably secured to the top or distal end of pole 12 by a screw 30 that passes through a bearing washer 32 and is threaded into a cap 34 adhered to the distal end of the pole . below the barrel 18 is an acoustic section 36 formed integrally with a neck 38 having accordion - like convolutions 40 . the inner surface of the convolutions 40 form ridges 42 that rub and beat against the pole 12 as the rotor body 11 rotates relative thereto . this rubbing and beating action causes vibratory noise and clacking reverberations that are amplified by the acoustic section 36 . as an optional feature , one or more shakable noisemakers , such as a plurality of bells 39 , may be attached to the pole 12 , which vibrates and thereby shakes the noisemakers to produce additional bird repelling noise in response to the rubbing action of the rotor neck against the pole . the wind currents , which produce rotation of the rotor by impacting against the fins , also pass over the fins and through the vents 22 thereby generating a whirring noise . in other words , wind currents pass through the upwind vent openings oriented toward the wind arrow w and into the inner chamber 44 of the rotor 11 , and then pass out of the chamber 44 through the downwind vent openings oriented away from the wind arrow w . this wind current air flow , in combination with rotation of the repeller body 11 , is believed to be the source of the whirring noise observed during prototype testing . in addition , the rubbing and beating action of the neck against the pole generates a clacking noise having a constantly changing rhythm or reverberation cycle . referring now to fig5 there is shown a second embodiment of the invention wherein the same numeral part designations have been used to indicate structural elements identical with those shown in fig1 - 4 . in the modified or second embodiment shown in fig5 the rotary connection between the rotor body 11 and the top of the pole 12 is significantly different from that shown in fig3 . in the second embodiment , a lag - bolt , generally designated 50 , has a head 51 engaging the outer surface of head section 28 , and a threaded shaft 54 that passes through the head section 28 and is secured thereto by a pair of anchor arms 52 - 52 . the lag - bolt 50 is of conventional design wherein thc arms 52 - 52 are initially folded so as to pass through an aperture 53 in the center of the head section 28 , and then the arms 52 - 52 are expanded against the underside of the head section 28 , as shown in fig5 by rotation of the lag - bolt shaft 54 in response to rotation of its head 51 by a screwdriver , wrench or other conventional tool . after the lag - bolt is secured in the position shown , the neck 40 of the rotor is slipped over the top of the mounting pole and the rotor is lowered until the distal end of the bolt shaft 54 rests within and against the bottom of a cup 58 secured to a pole cap 60 , such as by an adhesive 62 where the pole cap 60 is made of plastic , or by soldering or welding where the pole cap 60 is made of metal . as an alternative , the cup 58 and the pole cap 60 may be made of the same material and formed as a single - piece , integral structure . when assembled as shown in fig5 the distal end of lag - bolt shaft 24 rests on the bottom of cup 58 and the shaft rotates within the cup 58 and supports the rotor body 11 for rotation in response to the wind . the fins , vents , neck and remaining structure of the second embodiment function in the same manner as those of the first embodiment as described above . however , since the distal end of shaft 54 rests freely within the cup 58 , the second embodiment may be operated only in an upright position such as that shown in fig5 whereas the first embodiment may be operated either in an upright position , such as shown in fig1 or in an inverted position , such as where the opposite or proximate end of pole 12 is secured to an overhead structure , e . g ., a roof beam of a dock shelter , porch roof or the like . the bird disturbing visual effects provided by the spinning fins may be enhanced by placing designs , such as the holographic eyes 46 shown in fig5 on one or both sides of one or more of the fins . the designs may include a light reflective material , such as sparkling particles 48 , that reflect light in a flashing manner during rotation of the rotor in the presence of light . the reflective material also may be used without a design , as shown in fig2 on one or both sides of one or more of the fins . as shown in fig6 - 8 , another embodiment of the bird repeller in the invention may be made from a one - half gallon round plastic container or bottle having a body 11 ′ with six ( 6 ) cup - like protrusions or bosses 77 projecting radially outward from its side , these projecting bosses or cup - like portions having been formed as an integral part of the body 11 ′ by molding , stamping , pressing out or the like . the body 11 ′ also includes a barrel section 18 ′, an acoustic section 36 ′, a neck section 38 ′, and a neck mouth opening 79 which is approximately 1 ¼ inch in diameter . the following additional supplies may be used in making this embodiment of the bird repeller : a # 10 , ¾ inch stainless steel phillips head screw 30 ; a washer 32 having an aperture for receiving screw 30 ; a section of ¾ inch pvc pipe 12 preferably at least three feet in length ; a pvc rounded end cap 34 for the ¾ inch pvc pipe 12 ; and decal stickers 45 depicting eycs 46 and glitter 48 . the following tools may be used to assemble the foregoing supplies : a sharp knife 65 , a drill ( not shown ), { fraction ( 3 / 16 )} inch and { fraction ( 7 / 64 )} inch drill bits ( not shown ), and a phillips head screw driver ( not shown ). the embodiment of fig6 - 8 may then be made in accordance with the following steps : 1 . using the sharp knife 65 , cut shapes corresponding to the desired fins 20 ′ out of the bosses 77 at six ( 6 ) substantially equally spaced positions around the side wall of the container body 11 ′ by cutting along a cut line 67 that represents the base where the boss 77 transitions into the cylindrical wall of the barrel 18 ′ ( this differs from the embodiments of fig1 - 5 , wherein the fin 20 includes a small portion of the cylindrical barrel wall , and produces a lighter weight fin 20 ′). before cutting , make marks 68 and 69 on the barrel wall and cut along line 67 from mark 68 to mark 69 , leaving thc fin 20 ′ attached to the barrel 18 ′ by a deformable hinge portion 24 ′. in fig7 boss 89 is uncut , boss 91 is being cut by knife 65 , and boss 93 has been cut to form a shape corresponding to that of fin 20 ′. then , bend each fin outward until it extends from the wall of barrel 18 ′ so that a tangent t to the hinge portion and to the distal inner edge of the fin makes an angle f in the range of about 20 ′ to about 90 °, preferably about 30 ° to about 60 °, more preferably about 40 ° to about 50 °, most preferably about 45 °, relative to a radial line l from the spin axis represented by the axis of screw 30 as shown in fig7 . the tangent t touches the innermost surface of the hinge portion 24 ′ and the outermost inner edge of the fin at its distal end 33 ′. 2 . drill a hole in the top center of the bottom 72 of the bottle using the { fraction ( 3 / 16 )} inch drill bit . 3 . drill a hole in the top center of the pvc cap 34 using the { fraction ( 7 / 64 )} inch drill bit . 4 . insert a top portion of the ¾ inch pvc pole 12 through the mouth opening 79 of the bottle neck 38 ′ and push the top portion of the pole through one of the fin openings 22 ′. 5 . push the pvc cap 34 onto the projecting top end of the ¾ inch pvc pole 12 using hand pressure until it is tightly secured by a friction fit or by a pvc adhesive . 6 . retract the top portion of the pole back into the bottle and align the pvc cap hole with the hole in the bottom 72 of the bottle . 7 . secure the bottom 72 to the cap 34 with the # 10 , ¾ inch stainless steel phillips head screw 30 passing through the aperture of washer 32 , being careful not to over tighten and making sure that each fin 20 ′ extends substantially along the tangent t as described in step 1 . 8 . test the resulting bird repeller body 11 ′ by spinning it , and adjust the screw 30 as needed to make sure the body 11 ′ spins freely . 9 . optionally , stickers 45 with eyes 46 and / or glitter 48 may be secured to one or both sides of the fins 20 ′ on the body 11 ′. 10 . a number of different methods may be used to attach the bottom of the pole to a dock piling 15 or other fixed structure so that the pole is fixed in a substantially vertical position . the attaching methods include the straps 14 shown in fig1 or alternatively by first attaching to piling 15 with straps 14 , or with screws and / or nails , a section of 1 inch pvc pipe that will accept the bottom of the ¾ inch pole , in the same manner that a fishing rod holder supports the rod on a boat . referring now to fig8 and 9 , on the exterior surface of the bottom wall of the inverted bottle , which is the top wall 72 of the head section 28 ′ of the repeller body 11 ′, there may optionally be mounted a housing 71 enclosing from the weather a noise device that mimics the sound of a bird of prey or other predator . this noise device may comprise a solar cell 73 , a rechargeable battery 74 , a sound chip 75 , and a speaker 76 that emits the sound of the predator to scare birds away form the area to be protected . solar cell 73 is electrically connected to battery 74 by wires 84 and 85 , battery 74 is electrically connected to chip 75 by wires 80 and 81 , and chip 75 is electrically connected to speaker 76 by a wire 83 . wire 83 passes through an aperture 87 in the top wall 72 because the speaker 76 is preferably mounted within the hollow chamber of body 11 ′ so that the sound emitted by the speaker passes freely ( loudly and clearly ) through the vents 22 ′. while specific bird repeller assemblies and methods for their manufacture have been described and illustrated in detail , it will be apparent to those skilled in the art that many modifications and variations are possible without deviating from the broad scope of the present invention . for example , other types of rotary connections may be used to mount the head of the rotor on the distal end of the pole . in addition , the rotor and the pole may be made of a variety of materials , and the neck , acoustic section , barrel , head section , fins and vents may have a wide variety of shapes and sizes . thus , the specific embodiment described herein is for the purpose of illustrating the present invention , and persons skilled in the art will recognize variations thereof that fall within the scope of this invention , which is limited only by the claims appended hereto , and the equivalence of the features described therein .

0Human Necessities

according to the present invention , a package generally designated by the numeral 10 is provided . in the preferred embodiment , the package is generally pillow - shaped having what could be considered a top wall 12 and an opposed bottom wall 14 , two opposed side walls 16 and 18 , and opposed end walls 20 and 22 . a pair of longitudinally spaced apart cut - outs 24 and 26 are provided by indicia 28 and 30 which could be merely printed indicia for guiding the user to make the cut - outs with scissors or some other sharp implement , or could be perforations . the cut - outs are preferably square or rectangular in shape although they could be round or oval . it is preferred to merely have printed indicia . the cut - outs 24 and 26 are spaced on either side of the transverse axis of top wall 12 . thus , there is left an integral carrying handle 32 . since the material of which the package is made is a heavy - weight plastic , carrying handle 32 will support the weight of the package in carrying it from one location to another . this is especially helpful when the package is converted for use in growing plants and is kept on a balcony or the like of a city dwelling . as the sun shifts , it might be necessary to move the receptacle in which the plants are growing in order to obtain the maximum benefit thereof . referring to fig2 the method of converting the package for use is shown . the user merely cuts along indicia 28 or 30 and removes the cut - out flap 24 or 26 to leave an opening designated in fig2 as 34 filled with a flowable material 36 . in the preferred embodiment shown in fig3 the flowable material 36 is a plant growth medium . in another embodiment , which is not shown , the flowable material could be cat litter . in that instance , the cat would leave its waste in the litter showing through openings 34 and the owner would dispose of the used material by lifting , using handle 32 and disposing of the complete package in the usual manner . another embodiment is shown in fig4 wherein the package designated as 38 is generally rectangular in cross - section rather than oval or free - form . it is also constructed of heavy gauge plastic such as polyethylene and has squared - off ends 40 and 42 constructed in a common manner by over - lapping end flaps and sealing by means of heat or other known methods . referring to fig5 the package generally designated by the numeral 10 is the same as the package of fig1 having cut - outs 24 and 26 and carrying handle 32 in top wall 12 . in using this embodiment , however , rather than cutting completely around indicia 28 and 30 to remove cut - outs 24 and 26 , respectively , as in fig1 the cut - outs are only partially removed initially . it will be seen that cut - out 26 , for instance , is defined by sides 44 , 46 , 48 , and 50 . by cutting only three sides , 44 , 46 , and 48 , and using side 50 as a hinge , a flap is formed which acts as a temporary &# 34 ; greenhouse &# 34 ;. after watering and planting seeds , the flap is allowed to cover the planted seeds protecting them from wind and rain which can disrupt the seeds . it also maintians the moisture and heat in a manner similar to a greenhouse . when the seeds germinate , the flap can gradually be lifted , propped up if need be , and eventually cut off at the hinged side and discarded . obviously , while the flap 46 is depicted in fig5 as being hinged at side 50 , it can be hinged on any one of the four sides depending on the needs or desires of the user . cut - out 24 is hinged in the same manner as cut - out 26 . in the embodiment shown in fig6 package 38 has an integral carrying handle 54 centrally located on end 42 . if desired , another such carrying handle could be located on end 40 . this carrying handle 54 provides for ease in carrying the package before its actual use . when using the package of the present invention for a plant growth medium , any well - known plant growth medium can be utilized . the actual composition of the medium is immaterial to the present invention since it will vary according to the type of plant being grown , the type of raw materials available in any particular geographical area , and the like . one composition which has been used successfully is that suggested by j . w . boodley and r . sheldrake , jr ., of cornell university . the formula for a one bushel mix is given as : ______________________________________ingredient amount______________________________________vermiculine no . 2 size horticultural 1 / 2 bushelshredded canadian or german sphagumumpeat moss 1 / 2 bushelground limestone , preferably dolomitic 4 tablespoonspowdered superphosphate 20 % 1 tablespoon5 - 10 - 5 fertilizer 8 tablespoons______________________________________ the materials are mixed thoroughly and moistened if necessary to reduce dusting . it was suggested by messrs . boodley and sheldrake that &# 34 ; pillow paks &# 34 ; made of 4 to 6 &# 34 ; diameter clear or black polyethylene , of any convenient length , be filled with this mixture . the ends would then be folded over and stapled shut . small holes for individual plants would be cut at appropriate spacing . the physical construction of these &# 34 ; pillow paks &# 34 ; was crude and no commercial success was enjoyed . the importance of this prior art is the formula for the plant growth medium . another description of a suitable plant growth medium appears on the first page of the aforementioned british pat . no . 1 , 365 , 913 . it should be apparent from the foregoing detailed description that the objects set forth hereinabove have been successfully achieved . moreover , while there is shown and described a present preferred embodiment of the invention , it is to be distinctly understood that the invention is not limited thereto but may be otherwise variously embodied and practiced within the scope of the following claims . accordingly ,

0Human Necessities

hereinafter , embodiments according to the present application will be described with reference to the drawings . first , a battery direct - mounted fusible link 10 according to a first embodiment of the present application is shown in fig1 to 3 . as shown in fig3 , for example , the battery direct - mounted fusible link 10 is directly fixed to a battery 12 provided in an automobile and is used . the battery direct - mounted fusible link 10 has a structure in which a bus bar 16 is accommodated in a housing 14 . the housing 14 is made of a non - conductive member such as a synthetic resin . the housing 14 is formed in an l - shape including a horizontal portion 20 that is to be arranged along a top surface 18 of the battery 12 and extends in a horizontal direction ( left - right direction in fig3 ), and a vertical portion 24 that extends perpendicularly from the horizontal portion 20 in a vertical direction ( up - down direction in fig3 ) and is arranged along a lateral surface 22 of the battery 12 . as is clear from fig2 , the horizontal portion 20 is substantially rectangular . a bolt inserting hole 28 through which a bolt - shaped battery post 26 ( see fig3 ) projecting from the battery 12 is to be inserted is formed in a central portion of the horizontal portion 20 . on the other hand , the vertical portion 24 has a hollow box shape that is open downward ( downward in fig1 ). two bolt arranging portions 30 are formed at the end portion on an upper side ( upper side in fig1 ) of the vertical portion 24 . the bolt arranging portions 30 each have a substantially rectangular block shape protruding upward and are open to their front side 32 . the bus bar 16 is accommodated in this housing 14 . fig4 shows the bus bar 16 and load electric wires 34 connected to the bus bar 16 . the bus bar 16 is formed by bending a punched metal plate . the bus bar 16 is provided with a battery connecting terminal 36 . as also shown in fig2 , the battery connecting terminal 36 has a rectangular plate shape formed by being bent at a right angle from a main portion 38 of the bus bar 16 , and is provided with a circular bolt inserting hole that penetrates the battery connecting terminal 36 at a position overlapping the bolt inserting hole 28 of the housing 14 . furthermore , two terminal plate portions 40 are formed in the bus bar 16 . the terminal plate portions 40 each have a rectangular plate shape that extends perpendicularly . the terminal plate portions 40 are formed by bending upward the front end - side edge portions of base end portions 44 that are respectively coupled to the front ends of coupling portions 42 extending from the main portion 38 of the bus bar 16 and that extend perpendicularly with respect to the main portion 38 . it should be noted that the terminal plate portions 40 are to be connected to an alternator and a starter ( not shown ), respectively . furthermore , the bus bar 16 is provided with a plurality of ( five in this embodiment ) load connecting portions 46 . the load connecting portions 46 each have a shape in which a tab - shaped plate is provided with a pair of crimping pieces 50 , and are coupled to the main portion 38 via a fusible portion 48 that fuses when an overcurrent flows . these ( five in this embodiment ) load connecting portions 46 are formed in parallel with appropriate spacings between them on a lower side ( lower side in fig4 ) of the main portion 38 . the load electric wires 34 to be connected to loads provided in a vehicle body , such as a motor and other electric components , are connected to the load connecting portions 46 , respectively . the load electric wires 34 are directly secured to the load connecting portions 46 without using a connector , a connecting terminal , or the like by crimping a core wire 54 exposed from the end of the load electric wire 34 to the load connecting portion 46 with the crimping pieces 50 . the battery direct - mounted fusible link 10 is configured by accommodating this bus bar 16 in the housing 14 . the battery connecting terminal 36 of the bus bar 16 is arranged in the horizontal portion 20 of the housing 14 in a state in which the bus bar 16 is accommodated in the housing 14 . accordingly , the battery connecting portion 58 is formed in the horizontal portion 20 of the housing 14 . the load connecting portions 46 are coupled via the fusible portions 48 to the battery connecting terminal 36 included in the battery connecting portion 58 , and thus are coupled via the fusible portions 48 to the battery connecting portion 58 . the terminal plate portions 40 of the bus bar 16 are arranged in the bolt arranging portions 30 of the housing 14 , respectively . stud bolts 60 are inserted into the bolt arranging portions 30 and overlap the terminal plate portions 40 . accordingly , the stud bolts 60 are arranged in the vertical portion 24 and project in the horizontal direction ( left - right direction in fig3 ). therefore , in this embodiment , the stud bolts 60 are arranged on the upper side of the vertical portion 24 , whereas the load connecting portions 46 are arranged on the lower side of the vertical portion 24 , and thus the stud bolts 60 and the load connecting portions 46 are lined up in the direction in which the vertical portion 24 extends ( up - down direction in fig1 ). in the battery direct - mounted fusible link 10 of this embodiment , in this manner , only the battery connecting portion 58 is provided in the horizontal portion 20 , and the stud bolts 60 and all of the load connecting portions 46 are provided in the vertical portion 24 . as shown in fig3 , the battery post 26 is inserted into the bolt inserting hole 28 of the battery connecting portion 58 and connected thereto by being fastened with a nut or the like , and thus the battery direct - mounted fusible link 10 configured to have this structure is directly fixed to the battery 12 in the state in which the horizontal portion 20 is arranged along the top surface 18 of the battery 12 and the vertical portion 24 is arranged along the lateral surface 22 of the battery 12 . as also shown in fig1 , the stud bolts 60 are inserted into connecting terminals 64 provided at the ends of electric wires 62 connected to an alternator or the like and are fastened with nuts or the like , and thus the electric wires 62 are connected via the bus bar 16 to the battery 12 . with the battery direct - mounted fusible link 10 of this embodiment , only the battery connecting portion 58 is provided in the horizontal portion 20 to be arranged along the top surface 18 of the battery 12 . this makes it possible to reduce the length dimension l of the horizontal portion 20 compared with a case where the stud bolts 60 are also provided in the horizontal portion 20 . as a result , the size of the battery direct - mounted fusible link 10 can be reduced , and the efficiency of the arrangement space can be improved . furthermore , the gap dimension g between the vertical portion 24 and the lateral surface 22 of the battery 12 can be reduced , and when the battery direct - mounted fusible link is to rotate about the battery post 26 , the rotation can be prevented by the vertical portion 24 coming into contact with the lateral surface 22 of the battery 12 . as a result , it is possible to improve the reliability of the connection between the battery direct - mounted fusible link 10 and the load electric wires 34 and electric wires 62 . since the stud bolts 60 are arranged in the vertical portion 24 and project in the horizontal direction , it becomes unnecessary to bend the connecting terminals 64 into an l - shape in order to extend the electric wires 62 connected to the stud bolts 60 downward ( toward the lower side in fig1 ), thus making it also possible to simplify the shape of the connecting terminals 64 and reduce the manufacturing cost . furthermore , in this embodiment , the stud bolts 60 and the load connecting portions 46 are lined up in the direction in which the vertical portion 24 extends from the horizontal portion 20 , that is , in the up - down direction . this makes it possible to stack and compactly dispose the electric wires 62 connected to the stud bolts 60 and the load electric wires 34 connected to the load connecting portions 46 . moreover , the load electric wires 34 to be connected to the load connecting portions 46 are directly secured to the load connecting portions 46 with the crimping pieces 50 . accordingly , connectors , connecting terminals , and the like can be made unnecessary , and the manufacturing cost can be reduced . furthermore , it is unnecessary to form connector accommodating portions and the like in the housing 14 , thus making it possible to reduce the size of the battery direct - mounted fusible link 10 . next , a battery direct - mounted fusible link 70 according to a second embodiment according to the present application is shown in fig5 to 7 . it should be noted that fig6 shows the lower surface of the battery direct - mounted fusible link 70 . moreover , in the following description , structures similar to those of the first embodiment are denoted in the drawings by the same reference numerals as in the first embodiment , and thus their description will be omitted . the vertical portion 24 of the housing 14 of this embodiment is formed into a laterally elongated shape as a whole in which the length in the horizontal direction ( left - right direction in fig5 ) is longer . the horizontal portion 20 is located at the end portion on one side ( right side in fig6 ) in the longitudinal direction of the vertical portion 24 , and the battery connecting portion 58 is provided in the horizontal portion 20 . moreover , the two bolt arranging portions 30 are formed in parallel at the lower end portion of the housing 14 on one side ( right side in fig5 ) in the longitudinal direction . the terminal plate portions 40 ( see fig4 etc .) of the bus bar 16 accommodated in the housing 14 are arranged in the bolt arranging portions 30 , and the stud bolts 60 project in the horizontal direction ( left - right direction in fig7 ). on the other hand , three connector accommodating portions 72 a , 72 b and 72 c that are open downward are formed at the lower end portion of the housing 14 on a side opposite to the bolt arranging portions 30 . it should be noted that a projecting portion 74 that projects in the same direction ( downward in fig6 ) as the direction in which the horizontal portion 20 projects is formed in the connector accommodating portion 72 b , which is located at the center . the load connecting portions 46 of the bus bar 16 are arranged inside the connector accommodating portions 72 a , 72 b and 72 c . accordingly , at the lower end portion of the housing 14 , the stud bolts 60 and the load connecting portions 46 of this embodiment are lined up in the horizontal direction , which is orthogonal to the direction ( up - down direction in fig5 ) in which the vertical portion 24 extends from the horizontal portion 20 . it should be noted that the load connecting portions 46 of this embodiment are each formed into a tab - shaped plate to which the crimping pieces 50 of the first embodiment are not provided . as also shown in fig5 , connectors 76 a , 76 b and 76 c that are provided at the ends of the load electric wires 34 are connected to the connector accommodating portions 72 a , 72 b and 72 c , and thus the load connecting portions 46 are connected to the load electric wires 34 . as shown in fig7 , the battery direct - mounted fusible link 70 of this embodiment is directly fixed to the battery 12 by fixing the battery connecting portion 58 to the battery post 26 as in the first embodiment . since only the battery connecting portion 58 is formed in the horizontal portion 20 , the length dimension l of the horizontal portion 20 can be reduced and the entire size can be made compact , and the gap dimension g between the vertical portion 24 and the lateral surface 22 of the battery 12 can be reduced and the rotation about the battery post 26 can be prevented . in particular , in this embodiment , the connector accommodating portion 72 b is provided with the projecting portion 74 , and thus the gap dimension g between the vertical portion 24 and the lateral surface 22 of the battery 12 is further reduced . in the battery direct - mounted fusible link 70 of this embodiment , the stud bolts 60 and the load connecting portions 46 are lined up in the horizontal direction . this makes it possible to dispose the electric wires 62 connected to the stud bolts 60 and the load electric wires 34 connected to the load connecting portions 46 in parallel such that they do not overlap one another , and to reduce a risk that the electric wires 62 and load electric wires 34 are tangled with one another . although the embodiments according to the present application have been described in detail , the present application is not limited to the specific description . for example , the numbers of the stud bolts and the load connecting portions can be set as desired . moreover , as an embodiment of the direct securing of the electric wires to the load connecting portions , the ends of the electric wires may be secured by crimping as described in the above embodiment as well as by soldering or welding , or may be secured using a glue , for example .

7Electricity

referring first to fig1 there is shown a conventional buck converter circuit , sometimes known as a step down converter , which is commonly used to reduce the voltage to integrated circuits and processors on the circuit board of a portable electronic device or the like . for example , the circuit might be used to reduce an input voltage of 12 volts dc to 5 volts dc ( or 3 . 3 volts dc in some cases ) to drive an integrated circuit or other load ( not shown ). the circuit of fig1 is well known and uses a p channel mosfet 10 for the switching function under the control of a suitable control circuit 11 connected to the fet gate g . fet 10 may be a 20v , 90 m - ohm die available from the international rectifier corporation . a schottky diode 12 which may be a 30 volt , 1 ampere die has its cathode connected to the drain d of fet 10 and is used to perform output current recirculation into inductor 13 and capacitor 14 . as will be later shown , and in accordance with the invention , fet 10 and schottky diode 12 are provided in die form and are mounted on a common lead frame of a single package shown by dotted line block 15 . this novel combination produces a 60 % space saving on the support board of the device and reduces assembly cost . it will be apparent that the invention can be employed in many other circuit configurations . for example , fig2 shows a synchronous buck converter circuit using an n channel mosfet 20 as the switching device , an n channel mosfet 21 , and a schottky diode 22 in parallel for synchronous rectification . in accordance with the invention , fet 21 and schottky diode 22 may be die which are copackaged within a common housing , as shown by dotted block 23 . this circuit is useful to avoid losses found in the “ lossy ” forward voltage drop of the schottky diode 12 of fig1 . it also eliminates the effects of the inherent body diode of the vertical conduction fet 21 from the circuit since the schottky diode 22 handles the reverse current flow seen by the synchronous rectifier during the “ wait ” state of controller 24 . fet 21 of fig2 may be a 30v , 35 m - ohm die available from the international rectifier corporation . housings 15 and 23 may take the form of a known housing type so - 8 , shown in fig3 and 4 . thus , fig3 shows an so - 8 surface mount housing with eight in - line pins 1 to 8 ( fig4 ) which extend from a plastic insulation housing 30 . as seen in fig4 the fet die 10 and schottky diode 12 are internally mounted on a common lead frame , as will be later described and are interconnected to enable their external connection as in fig1 or 2 ( with an appropriate fet die 10 or 21 ) or in other circuit configurations . in fig4 the drain of fet 10 and cathode of schottky diode 12 are connected to one another and to pins 5 to 8 of a common lead frame section as will be later described . the source and gate of fet 10 are connected by wire bonds to isolated pins 3 and 4 , respectively , and the anode of schottky diode 12 is connected by wire bonds to isolated pins 1 and 2 . [ 0028 ] fig5 and 6 show the lead frame and fet 10 and schottky 12 die in more detail . thus , a lead frame 40 is provided which contains a main pad body 41 from which pins 5 to 8 integrally extend . the main pad body 41 is larger than the main pad body of a conventional lead frame so that both the fet die 60 and the schottky diode 12 may be mounted to it . according to a novel aspect of the invention , the walls of plastic insulation housing 30 are thinner than a conventional housing to accommodate the larger main pad body without significantly reducing resistance to moisture . the lead frame also contains pins 1 to 4 and respective bond pad extensions which are within molded housing 30 . these are originally integral with the lead frame body 40 ( during molding ), but are shown in their severed condition which isolates pins 1 to 4 from one another and from main pad 41 . typically , pins 1 to 4 are coplanar with each other and with the main bond pad 41 . lead frame 40 is a conductive frame and may have a conventional lead frame solder finish . the bottom cathode surface of diode 12 and the bottom drain surface of fet 10 are connected to pad 41 as by a conductive epoxy die attach compound and are thus connected to pins 5 to 8 . alternatively , the cathode surface of diode 12 and the drain surface of fet 10 are soldered to pad 41 or are connected to the pad using a conductive glass containing silver particles . the top anode electrode of schottky diode 12 is wire bonded by gold bonding wires 50 and 51 to pins 1 and 2 , respectively ( before molding ), while the source electrode and gate electrode of die 10 are bonded by gold wires 52 and 53 to the internal bonding extensions of pins 3 and 4 , respectively , also before molding the housing 30 . alternatively , aluminum bonding wires are used . the internal bonding extension of the pins are typically silver or gold plated . the bonding wires are generally bonded to the die surface and to the internal bonding extensions using thermosonic ball bonding , as is known in the art , though other processes may be used . thereafter , the molded housing , which may be a mold compound such as nitto mp7400 . it is formed in a conventional molding operation . however , other types of housings , such as a ceramic housing , a hermetic housing or an injection molded metal housing , may be used . it should be noted that other package styles could be used , but the copackaging in a surface - mount package conserves considerable board space . the resulting device can be soldered down to a printed circuit board using conventional mass production soldering techniques . [ 0034 ] fig7 and 8 shows an alternative embodiment of the invention in which the source of fet 10 is connected by wire bonds 151 and 152 to isolated pins 2 and 3 , the gate of fet 10 is connected by wire bonds 153 to isolated pin 4 , and the anode of schottky diode 12 is connected by wire bonds 150 to isolated pin 1 . the drain of fet 10 and the cathode of schottky diode 12 are connected to one another and to pins 5 to 8 of a common lead frame section in the manner described above . [ 0035 ] fig8 and 9 show the lead frame of this embodiment and the fet 10 and the schottky diode 12 in greater detail . the lead frame 140 is similar to the lead frame 40 described above and includes a similar main pad body 141 . the bottom cathode surface of schottky diode 12 and the bottom drain surface of fet 10 are connected to pad 141 in a similar manner to that described above , and the top anode electrode of schottky diode 12 and the source and gate electrodes of fet die 10 are similarly bonded to the internal bonding extensions of the pins as described above . similarly , the housing 130 is formed in the manner described above . although the present invention has been described in relation to particular embodiments thereof , many other variations and modifications and other uses will become apparent to those skilled in the art . it is preferred , therefore , that the present invention be limited not only by the specific disclosure herein , by only by the appended claims .

7Electricity

three pieces of evidence were combined to conceive the invention ; including 1 ) the long term protection from severe respiratory exacerbations and re - hospitalization by a single dose of rhcc10 observed in premature infants , 2 ) the airway epithelial phenotypes of cc10 ko mice , and 3 ) the “ growth factor ” properties of scgb3a2 ( guha , 2012 ; kurotani , 2008 ; kurotani , 2008a ; inoue , 2008 ; niimi , 2001 ). despite many years of research , there is no public consensus concerning the role of cc10 in the respiratory epithelium , other than that it mediates anti - inflammatory effects . a recent clinical trial failure in a nasal allergen challenge model of allergic rhinitis demonstrated that the even its anti - inflammatory effects in vivo are not consistent against all types of inflammatory disease ( widegren , 2009 ). and , despite a complete cc10 deficiency , clara cells are still found in the airways of both strains of cc10 ko mice . although cc10 and scgb3a2 are structurally similar , and , therefore , believed to share some functions , there are no reports pertaining to the stimulation of growth or development of airway epithelial cells by cc10 , and rhcc10 is , in fact , well - known to suppress the growth of tumor cells of epithelial origin ( kundu , 1996 ; leyton , 1994 ), including an airway epithelial cell line , a549 ( szabo , 1998 ). we nevertheless believe that the rhcc10 administered to premature infants on the day of birth stimulated the development of cc10 - secreting cells , which , in turn , produced native cc10 , which stimulated development of more cc10 - secreting cells , and so on . the end result was a more normal and resilient respiratory epithelium in the rhcc10 - treated infants who were more resistant to all environmental challenges ( dust , smoke , allergens , rsv infection , influenza infection , etc .) compared to the placebo - treated infants . a single dose of rhcc10 on the day of birth conferred 100 % protection from re - hospitalization due to severe respiratory exacerbation , contrasting the 50 % re - hospitalization rate observed in the placebo - treated infants . we further believe that the use of cc10 to stimulate development of cc10 - secreting cells in the respiratory epithelium will also work in adults with chronic respiratory diseases in which airway remodeling has resulted in loss of clara cells . a course of treatment with rhcc10 may not cure the disease , but , we believe , would restore , to some extent , clara cells and associated structures , resulting in a more normal epithelium that is then more resistant to subsequent environmental challenges . the clinical outcome of a course of rhcc10 treatment would then be an increase in the time interval to the next severe exacerbation . we further believe that the airway epithelial phenotype of clara cell deficiency in cc10 ko mice suggests that cc10 is an autocrine and paracrine factor required for the development of clara cells , associated structures , and other normal cell populations of the airway epithelium . we believe that cc10 is an autocrine and paracrine factor required for the development and maintenance of cc10 - secreting cells outside of the respiratory tract , including the gastrointestinal tract and urogenital tract . there is much speculation that because secretoglobins share structural similarities that they will also share similar function , however , no biological activity has ever been previously shown to be shared between any two secretoglobins either in vitro or in vivo . herein , we report that rhscgb3a2 shares with cc10 , the ability to inhibit porcine pancreatic phospholipase a 2 in vitro . this is the first report that any other secretoglobin , besides cc10 , actually inhibits any phospholipase a 2 enzyme or possesses any type of anti - inflammatory activity . based on these results , we infer that other secretoglobins , including respiratory secretoglobins , which share structural similarities with rhcc10 , can stimulate the development and maintenance of the cells that secrete them to effect long - term clinical benefits such as increased time to next exacerbation , decreased severity of next exacerbation , and prevention of severe exacerbations following acute injury . the safety , pharmacokinetics , and anti - inflammatory properties of rhcc10 were evaluated in a randomized , placebo - controlled , double - blinded , multicenter trial of 22 premature infants with respiratory distress syndrome ( rds ) with mean birth weight of 932 g and mean gestational age of 26 . 9 wks , who received one intratracheal ( it ) dose of placebo ( n = 7 ), 1 . 5 mg / kg ( n = 8 ) or 5 . 0 mg / kg ( n = 7 ) of rhcc10 following surfactant treatment ( levine , 2005 ). rhcc10 - treated infants showed significant reductions in taf total cell counts ( p & lt ; 0 . 001 ), neutrophil counts ( p & lt ; 0 . 001 ), and total protein concentrations ( p & lt ; 0 . 01 ) and decreased il - 6 ( p & lt ; 0 . 07 ) over the first 3 days of life . the rhcc10 was safe and well tolerated . remarkably , and despite small numbers , follow - up of 17 infants at 6 months corrected gestational age ( cga ) found that 0 / 11 who received rhcc10 were re - admitted to the hospital for respiratory causes compared to 3 / 6 receiving placebo as shown in table 2 ( p & lt ; 0 . 05 fisher &# 39 ; s exact test , two tailed ). this result is even more remarkable when considering that 6 months cga , in this context , means a time period corresponding to 6 months after the infant would have been 40 weeks gestation , and that some infants in the study were 24 weeks post - menstrual age ( pma ) at birth , so that the 6 month cga follow up timepoint occurred as many as 10 months after a single dose of rhcc10 administered on the day of birth . from a statistical standpoint , the results demonstrate at least a 57 % incidence of re - hospitalization in the placebo group versus at least a 27 % in the rhcc10 group . this is a very powerful long - term effect and these data illustrate a significant and unprecedented long - term benefit for administration of rhcc10 . it is even more remarkable to find such a profound long term benefit when pharmacokinetic analyses showed that the excess cc10 was eliminated within 48 hours of administration , with a serum half - life of 9 - 11 hours ( levine , 2005 ). a significant amount of rhcc10 was observed in the tracheal aspirate fluids for nearly 2 days , and reached the serum by 6h , but was then filtered by the kidney and excreted in urine by 12 h . the rhcc10 followed the natural physiological distribution path from lung to blood to urine and demonstrated long - term benefits , despite the rapid elimination . fig2 shows the amino acid sequence of rhscgb3a2 that was made for these studies . the sequence was taken from genebank locus aaq89338 . as a result of the recombinant product method that utilized an ubiquitin - like ( ubl ) fusion system and released the rhscgb3a2 product from the ubl using a ubl - protease , the n - terminus differs from the n - termini predicted for the native protein using consensus single peptide cleavage sites for mammalian secreted proteins . it also differs from the n - termini of actual peptides isolated from human fluid samples . this is the first description of the synthesis of human scgb3a2 without a histidine purification tag and the effects of the n - terminus on the stability and activity of the protein could not be predicted . the amino acid sequence of rhscgb3a2 was shown in table 1 and has predicted molecular weight of 8147 . 82 daltons and a predicted isoelectric point of 6 . 1 . a synthetic dna coding sequence for rhscgb3a2 was designed using jcat ( www . jcat . de ), with codon usage optimized for expression in e . coli bacteria k12 strain . once the dna sequence was generated , restriction sites were added to the ends to facilitate directional cloning of the gene into the bacterial expression vector , ptxb1 , already containing the ubl . scgb3a2 was cloned as a c - terminal extension of the ubl . an aflii site was placed at the 5 ′ end and a bamhi site was placed at the 3 ′ end for directional cloning . the new gene for rhscgb3a2 was synthesized from overlapping oligonucleotides using pcr . the dna sequence for the rhscgb3a2 gene is seq id no 1 : the ptxb1 plasmid containing the ubl - rhscgb3a2 fusion was transformed into e . coli strain hms174 / de3 which contains a de3 prophage encoding the t7 rna polymerase that enables inducible expression of the fusion protein . colonies were screened for expression of the fusion protein and the rhscgb3a2 gene was reconfirmed by dna sequencing in high expressers . a four liter fermentation culture containing superbroth media with ampicillin was inoculated from a 120 ml overnight culture of the highest - expressing clone and grown at 37 ° c . the culture was induced to overexpress the ubl - rhscgb3a2 fusion protein at an od 600 of 8 . 75 using 0 . 3 mm iptg , then allowed to grow for another 2 hours . cell paste was harvested by centrifugation and the wet cell paste yield was 67 grams . the cell paste was then used for purification of rhscgb3a2 . the cell paste was resuspended in 20 mm nah 2 po 4 , 0 . 5 m nacl , ph 7 . 2 , then the cells were ruptured by freeze - thaw to generate a crude lysate . the crude lysate was clarified by centrifugation at 19 , 800 × g for 20 ′ at 4 ° c . dna , endotoxin , and other bacterial contaminants were precipitated out of the clarified lysate supernatant using polyethylimine ( pei ) at a concentration of 0 . 025 % and a second centrifugation at 19 , 800 × g for 10 ′ at 4 ° c . the pei supernatant was then filtered through a 0 . 22 micron filter and 10 mm imidazole was added to the filtrate . both the ubl and the ubl protease contain a histidine tag so that they bind to an immobilized metal affinity chromatography column . the filtrate containing the ubl - rhscgb3a2 fusion protein was then passed over an imac column ( nickel chelating sepharose fast flow ) previously equilibrated in 20 mm nah 2 po 4 , 0 . 5 m nacl , 10 mm imidazole , ph 7 . 2 , the column was washed with the same buffer , then the ubl - rhscgb3a2 fusion protein was eluted with 20 mm nah 2 po 4 , 100 mm nacl , 300 mm imidazole , ph 7 . 2 . the imac eluate was then concentrated and buffer exchanged using tangential flow filtration with a 5 kda nmwco filter in 15 mm tris , 15 mm bistris , 40 mm nacl , ph 7 . 0 . the ubl - rhscgb3a2 was further purified over a macro prep high q column ( biorad ) in which contaminants were bound and the ubl - rhscgb3a2 flowed through . the rhscgb3a2 was then separated from the ubl by digestion with ubl protease den - 1 ( 1 : 100 molar ratio ) in 5 mm dtt , with ph adjusted to 6 . 5 with hcl , at 37 ° c . for 2 hours . the rhscgb3a2 was then purified from the digestion mixture using cation exchange chromatography ( ge sepharose sp high performance ). the sp column was equilibrated with 15 mm tris , 15 mm bistris , 40 mm nacl , ph 6 . 5 , the digestion mixture loaded , and contaminants bound to the column while rhscgb3a2 flowed through . the sp flow through was then extensively dialyzed against 0 . 9 % nacl using a 3 . 5 kda mwco regenerated cellulose membrane . the sample was concentrated using centrifugal concentrators ( 3 . 5 kda mwco ), then filtered through a 0 . 22 micron filter . the filtrate was purified rhscgb3a2 . fig2 shows sds - page analysis of the final purified protein . it is & gt ; 97 % pure by densitometry of sds - page , and roughly 95 % dimer and 5 % monomer . as with rhcc10 , it is difficult to completely reduce the dimer to monomer with reducing agents . the isoelectric point ( pi ) of a protein is a measure of the total surface charge of that protein . pi is measured using standard isoelectric focusing ( ief ) methods . approximately 5 micrograms of rhscgb3a2 , rhcc10 , ubl , and den - 1 were loaded onto an ief gel ( novex ) in order to determine the pi of rhscgb3a2 as shown in fig3 . when a protein migrates as a single band on sds - page and multiple bands are observed in the ief gel , alternate isoforms of the protein are likely present . in contrast to rhcc10 , which shows a single band at pi 4 . 8 , rhscgb3a2 shows two bands at pi 6 . 7 and 6 . 3 . the predicted pi of our rhscgb3a2 sequence is 6 . 1 ( www . expasy . edu ; protein tool “ compute mw / pi ”), yet the vast majority of the protein migrates at a position corresponding to a pi of 6 . 7 . not even the minor band at 6 . 3 corresponds to the predicted pi of 6 . 1 . that there are two rhscgb3a2 ief bands means that either alternatively folded isoforms are present or that they represent monomers and dimers , as visualized in non - reducing sds - page . these pis further show that this preparation is an unknown and unpredicted isoform of rhscgb3a2 that is unique . the unique folding pattern of a recombinant protein is often determined by the synthetic process , in this case , the selection of n - terminus , expression of the protein as a c - terminal fusion with an ubiquitin - like protein , imac purification of the fusion protein , cleavage of the scgb3a2 from the ubl , and separation of the scgb3a2 from the ubl and ubl - protease . thus , the uniqueness of this preparation may be due to the synthetic process , the non - native n - terminus , or a combination of these or other unknown factors . the biological activity of rhscgb3a2 was evaluated in a fluorescent and quantitative hplc assay that evaluates inhibition of porcine pancreatic secretory pla 2 enzyme ( spla 2 ) that was developed to evaluate the potency of different batches of rhcc10 . inhibition of pla 2 enzymes is thought to be a major anti - inflammatory mechanism of action for cc10 . many have speculated that other secretoglobins may also inhibit pla 2 enzymes , due to their structural similarities with cc10 . the rhscgb3a2 ( 5 . 5 micrograms ) was mixed with of 100 nanograms porcine spla 2 1b ( 0 . 1 microgram ) and incubated at 37 ° c . the reaction was started through the addition of the fluorescent phospholipid analogue 2 - decanoyl - 1 -( o -( 11 -( 4 , 4 - difluoro - 5 , 7 - dimethyl - 4 - bora - 3a , 4a - diaza - s - indacene - 3 - propionyl ) amino ) undecyl )- sn - glycero - 3 - phosphocholine ( aka unibipy ; 47 . 6 nanograms ). after 15 minutes the reaction was terminated by the addition of 2 - propanol / n - hexane . the cleavage product was separated from the substrate on a waters spherisorb silica hplc column . the separation was followed with a g1321a fluorescence detector . results of the assay are shown in fig4 . panel a shows the unibipy substrate without spla 2 or rhscgb3a2 ; panel b shows the unibipy substrate plus spla 2 , and panel c shows the unibipy substrate plus spla 2 plus rhscgb3a2 . the spla 2 cleaves the substrate ( peak # 1 ), giving rise to a product ( peak # 2 ). in the presence of rhscgb3a2 , the product peak is significantly reduced . each reaction set was run in duplicate . the rhscgb3a2 showed 83 % inhibition of spla 2 - 1b activity in the assay , which is comparable to rhcc10 protein ( data not shown ). it was concluded that the rhscgb3a2 does inhibit porcine pancreatic spla 2 and the level of activity is comparable to rhcc10 . purified rhscgb3a2 was used to immunize two new zealand white rabbits , using a standard immunization protocol . the protein was conjugated to klh , mixed with freund &# 39 ; s adjuvant , and injected into the animals . both animals produced excellent antibody responses with very high titers . igg was purified from each set of animal sera using a pierce protein a igg purification kit and the purified iggs were dialyzed into pbs , ph 7 . 2 , aliquoted and stored at − 80 ° c . the antibodies were qualified by western blot using tracheal aspirate fluids ( taf ) obtained from premature human infants . samples containing 20 microliters of taf from 6 infants were run on non - reducing sds - page and compared to rhscgb3a2 ( 5 nanograms ). the gel was electro - blotted to pvdf membrane , blocked with 4 % non - fat milk , then the highest titer rabbit anti - rhscgb3a2 igg ( 1 : 5000 dilution ) was incubated with the blot , followed by a goat anti - rabbit - hrp conjugate ( 1 : 20 , 000 dilution ). the blot was developed using enhanced chemiluminescence ( 4ipba - ecl - 100 mm tris / hcl ph 8 . 8 , 1 . 25 mm luminol , 5 . 3 mm hydrogen peroxide and 2 mm 4ipba ). immunoreactive bands appeared in 5 / 6 of the taf samples . two of the samples , ( lane 3 and lane 6 ) contained bands that migrated at the same size as the rhscgb3a2 homodimer , indicating that the rhscgb3a2 preparation resembled native human scgb3a2 in some patients . heterologous expression of recombinant proteins , especially hydrophobic proteins , for use in animal or human studies often yields misfolded , inactive , immunogenic , or otherwise unusable preparations . given that the actual n - terminus of native scgb3a2 is not known and that the pi of rhscgb3a2 was not as predicted , the observation that at least some human samples contained similar proteins validated our synthetic approach and rhscgb3a2 preparation . all 5 reactive samples contained high molecular weight species , on the order of 200 kda and all contained multiple discrete bands in the 8 - 13 kda size range , some of which may correspond to monomers , dimers , and alternative isoforms . two samples ( lanes 3 and 7 ) also contained immunoreactive smears below 3 . 5 kda , which likely represent scgb3a2 degradation products . this is the first time that native scgb3a2 has been visualized by western blot . the anti - rhscgb3a2 antibody used in the western blot was then used to develop an elisa for human scgb3a2 . a competitive elisa was developed using standard methods . in the competitive assay format , the antibody that captures the target is coated onto the wells of the microtiter plate , then an enzyme - conjugated target molecule ( labeled target ) is used to compete with unconjugated target in the sample for binding to available sites in the well . as the concentration of target in the sample increases , the amount of labeled target that binds to the wells decreases . the rabbit anti - rhscgb3a2 antibody was coated onto 96 well maxisorb plates ( 200 ng / well ) then the wells were blocked with 5 % sucrose , 2 . 5 % bsa in pbs , then plates are dried and stored at 4 ° c . a conjugate of horse radish peroxidase ( hrp ) and rhscgb3a2 was made ( pierce kit - ez - link maleimide activated hrp kit , cat # 31494 ) and was used in the assay diluted 1 : 130 , 000 . calibrators ( 1 - 500 ng ) were made using rhscgb3a2 and the standard curve was generated as shown in fig6 . native scgb3a2 was then quantitated in human taf samples as shown in table 3 . scgb3a2 was also measured in 3 adult human serum samples ; returning values of 0 , 29 , and 32 ng / ml . scgb3a2 could not be detected in unconcentrated human urine , or urine concentrated 10 ×. the limit of detection of the assay was 5 ng / ml . a ) a method of use of rhcc10 to prevent hospitalization due to a severe respiratory exacerbation in a patient with acute lung injury for a period of up to ten months after administration . b ) a method of use of rhcc10 to prevent a severe respiratory exacerbation in a patient who experiences frequent exacerbations for at least one month after administration . c ) a method of use of rhcc10 to prevent hospitalization due to severe respiratory exacerbations in a patient with a chronic respiratory condition for a period of at least one month after administration . d ) the method of example a - c where in the chronic respiratory condition is copd . e ) the method of example a - c where in the chronic respiratory condition is asthma . f ) the method of use of rhscgb3a2 to prevent hospitalization due to a severe respiratory exacerbation in a patient with acute lung injury for a period of up to ten months after administration . g ) the method of use of rhscgb3a2 to prevent a severe respiratory exacerbation in a patient who experiences frequent exacerbations for at least two months after administration . h ) the method of use of rhscgb3a2 to prevent hospitalization due to severe respiratory exacerbations in a patient with a chronic respiratory condition for a period of at least one month after administration . i ) the method of use of rhscgb3a2 to prevent hospitalization due to severe respiratory exacerbations in a patient with a chronic respiratory condition for a period of at least 2 months after administration . j ) the method of examples g - i where in the chronic respiratory condition is pulmonary fibrosis . k ) the method of examples g - i where in the chronic respiratory condition is bronchiectasis . scgb3a2 : l ) a composition of matter for recombinant human scgb3a2 protein with n - terminus ata , comprising seq id 1 . m ) a process for synthesizing recombinant human scgb3a2 using a ubl fusion protein and ubl protease that recognizes the fusion partner and cleaves between the fusion partner and scgb3a2 , to release the intact scgb3a2 protein according to seq id 1 . n ) a pharmaceutical composition of rhscgb3a2 that inhibits pla 2 enzymes . o ) a pharmaceutical composition of rhscgb3a2 that migrates in an isoelectric focusing gel corresponding to isoelectric point at or between 6 . 3 - 6 . 7 . q ) a pharmaceutical composition of rhscgb3a2 comprising a homodimer with pi of 6 . 7 that inhibits pla 2 enzymes . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiments , it is to be understood that the invention is not to be limited to the disclosed embodiments but , on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . scgb1a1 : protein encoded by the scgb1a1 gene , same as cc10 , ccsp , cc16 , uteroglobin scgb3a1 : protein encoded by the scgb3a1 gene , same as hin - 1 and ugrp2 scgb3a2 : protein encoded by the scgb3a2 gene , same as hin - 2 and ugrp1 secretoglobin : protein from the family of structurally related proteins characterized by four helical bundle monomers connected by disulfide bonds . respiratory secretoglobins : secretoglobins that are highly expressed and abundant in the respiratory tract , including scgb1a1 , scgb3a1 , and scgb3a2 .

2Chemistry; Metallurgy

as illustrated in the fig1 , and 3 , the detachable housing , according to the present invention includes two side walls 1 and 2 having at their peripheral flanges 3 and 4 several bosses 5a - h and 6a - h , respectively , provided with tapped apertures for assembling the two side walls in a sealing manner . in the assembled housing , obtained after assembly of the side walls 1 and 2 , there is disposed a crankshaft sprocket wheel 7 , a camshaft sprocket wheel 8 , and a sprocket wheel 9 for driving another element of the engine , such as an injection pump . the sprocket wheels 7 , 8 , and 9 are interconnected by a timing chain 10 whose slack portion is put under tension by a tensioner 11 . the sprocket wheels 7 , 8 , and 9 are positioned in the housing by ribs 12 , 13 , and 14 , each of which is in the shape of an arc of a circle . the ribs 12 , 13 , and 14 are formed on the inner sides of the side walls 1 and 2 and match the contour of the sprocket wheels . the ribs 12 , 13 , and 14 serve to maintain the sprocket wheels in position before the housing is mounted on the engine . indeed , the sprocket wheels 7 , 8 , and 9 are directly mounted by keying respectively on the output end portions of a crankshaft 15 , a camshaft 16 , and an injection pump shaft 17 . the chain tensioner 11 is of the strip type and has a control device 18 which extends through an orifice 19 formed in the side wall 1 so as to put the chain under tension only after the housing has been mounted on the various shafts 15 , 16 , and 17 . the end portion of the crankshaft 15 extends through an aperture 20 in the side wall 2 , the crankshaft sprocket wheel 7 to which it is keyed , and an aperture 21 formed in the side wall 1 and , according to the present invention , it projects from the other side of the housing and may receive driving pulleys ( not shown ) for transmission of power to other accessories of the engine . a seal in the region of the aperture 21 is provided by a sealing element 22 whose cross - sectional shape , for example , includes a lip portion as shown at 23 , or by any other known sealing element . a seal is provided in the region of the output end portion of the camshaft 16 by a ring 24 disposed in a corresponding aperture 25 formed in the assembly 26 comprising the cylinder head and cylinder head cover . this ring 24 , whose cross - sectional shape is shown in detail , is adapted to take up the machining tolerances in the distance between the axes of the crankshaft and camshaft . the ring 24 has three circumferential grooves 27 , 28 and 29 formed in each of three sides which are not in contact with the camshaft 16 . each of the circumferential grooves 27 , 28 and 29 is adapted to receive an o - ring sealing element which itself provides the seal . this ring 24 does not only take up the tolerances concerning the distance between the axis of the crankshaft and the axis of the camshaft , but also insures the sealing of the offsets between the confronting surfaces of the cylinder head and cylinder block . alternatively , the free communication of the engine oil between the cylinder head and the cassette unit and crankcase , and the sealing of this connection with respect to the outside of these two parts , at the level of the output end of the camshaft 16 , may be obtained by replacing the ring seal 24 , as shown in the preferred embodiment , by a lip seal , similar to lip seal 23 , mounted in the aperture 25 of the assembly 26 . any other known sealing system may be adopted . the end portion of the camshaft 16 is keyed to the camshaft sprocket wheel 8 which is held fast to the end portion of the camshaft by a screw ( not shown ) accessible through a tapped orifice 30 formed in the side wall 1 and closed by a plug 31 and a sealing element 32 . the side wall 1 also has a tapped orifice 33 which is closed by a plug ( not shown ) and allows access to the end of the injection pumpshaft 17 of the injection pump so as to key and hold fast the sprocket wheel to this shaft . the housing formed by the assembled side walls 1 and 2 is secured to the planar front end side of a cylinder block 34 by screws , not shown , which extend through bored reinforcing bosses 35 , 36 , and 37 of the side wall 1 and spacer portions 38 , 39 , and 40 of the side wall 2 and which are screwed in corresponding tapped apertures 41 , 42 , and 43 formed in the cylinder block . a seal is provided between the aperture 20 and a notch 44 formed in the cylinder block by a flat sealing element ( not shown ) on a machined bearing surface 45 . the timing chain 10 of the timing gear cassette unit is lubricated by the engine oil coming from the cylinder head . the engine oil communicates with the inside of the cassette unit at the outlet of the camshaft 16 through the side wall 2 by means of one or more pipes 50a , 50b which communicate with the lubrication circuit 51a and 51b of the engine . the pipes 50a and 50b may be directed in such a manner as to project oil directly onto the timing chain 10 which then acts as a moving ramp or slide for conveying and permitting the flow of the oil to the lower part of the housing which communicates with the crankcase or sump 52 through the aperture 20 . the flowing and projection of the engine oil inside the timing gear cassette unit serves to cool the oil , with the flow of oil along the inside of the timing gear cassette unit , and its cooling , being assisted by the presence of ribs 60 on the inside surface of the side wall 1 , as is shown in fig2 . the ribs 60 are arranged in a staggered pattern in order to define a long flow path for the oil flowing therealong by gravity . external ribs 57 on the outside surface of the side wall 1 , as shown in fig3 are exposed to outside air , and will also assist in the cooling of the oil . in the illustrated embodiment , the side wall 2 has in its lower part a tab 53 provided with apertures 54 and 55 for the passage of screws for securing it to a flange 56 of the crankcase 52 . the detachable timing gear cassette unit of the chain type according to the present invention is , prior to attachment to the engine , mounted on a gage which permits pre - setting of the timing while the chain tensioner 11 is maintained in a stressed condition so as to exert no tensioning action on the chain . this gage acts as a detachable angular positioning means and may be formed , for example , from a substantially planar structure of plastic material from which extend cylindrical studs having a groove thereon . these studs cooperate with the sprocket wheels and their respective key slots so as to set the angular positions of the sprocket wheels with respect to each other . the gage has not been shown in the drawing since it is only a temporary means whose operation is essentially related to the assembly procedure . when the timing gear cassette unit , according to the invention , must be assembled with the engine on the automobile assembly lines , the unit is positioned with its gage in position on the end portions of the crankshaft , camshaft , and injection pumpshaft which have been previously oriented with respect to each other . the gage is then removed and the sprocket wheels 7 , 8 , and 9 are held fast to the corresponding shafts . the plugs are then mounted to close the orifices 30 and 33 to seal them and alternatively the aperture 21 or the pulleys which must be fixed on the end of the crankshaft 15 are placed in position . the timing chain 10 is then placed under tension by the tensioner 11 by the control means 18 . the use of such a detachable timing gear cassette unit , which permits a pre - setting of the timing , avoids another adjustment on the assembly line . further , in view of the fact that the timing gear cassette unit is oil - sealed and mounted on the end side of the cylinder block , there is no need to machine the vertical joint planes between the cylinder block , the cylinder head , and the crankcase , which is a significant savings as concerns the convenience , cost , and rapidity of the manufacture of the engine . the timing gear cassette unit is sealed against any exterior agent , in particular dust or water , and is lubricated by the oil of the engine . moreover , the timing gear cassette unit performs the function of a return in the lubricating oil circulation and of the regulation ( i . e . cooling ) of the temperature of the oil at an optimum value . indeed , the oil delivered to the upper part of the lubrication circuit may be sent directly to the chain which then acts as a conveyor and a ramp or slide for a rapid return of the oil to the lower crankcase or sump , which is of considerable advantage in the case of high running speeds of the engine when the upper parts of the engine are excessively lubricated , bearing in mind the imposed redescending flow of the oil under the effect of gravity in the circuit returning the oil to the sump and the pump . this detachable timing gear housing also permits the chain and its sprocket wheels to be changed without modifying the setting of the timing because another housing can be substituted therefor . there is , moreover , observed a gain in the overall size relative to notched belts and to arrangements of the type having a timing chain which is integrated in the cylinder block , and also a gain in weight relative to the notched belt . indeed , it is possible to reduce substantially , by a value which may be as much as 30 % or more , the weight of the moving parts relative to the arrangement employing a notched belt . it is well known that chains have a much longer life than notched belts and that the maintenance of the setting characteristics is a function of the duration of the effective operation of the timing chain while the belt may be suddenly destroyed without any warning and with consequences which could result in a seizure of the engine - propelling unit at full speed . the detachable housing for the timing gear of the chain type according to the present invention may be produced by casting it in a light alloy or any other material which resists oil at the operating temperatures encountered . the housing may be made in two parts and assembled by screws or it may be arranged to seal the housing by means which cannot be disassembled so as to lighten the assembly .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

referring therefore to fig1 , a pair of correspondents 10 , 12 communicate over a transmission link 16 . each of the correspondents 10 , 12 includes a cryptographic engine 18 , 20 respectively that may receive information from the correspondent and perform cryptographic operations on it before transmission over the transmission line 16 . similarly , messages received over the transmission line 16 may be processed by the cryptographic unit 18 , 20 to provide information to the recipient . although it will be appreciated that the cryptographic units 18 , 20 are similar and that each can function with its respective correspondent as a recipient or a sender , it will be assumed for the purpose of the following description that the correspondent 10 is the sender of a message and that its cryptographic unit 18 acts to encode the information for transmission and that the correspondent 12 is the recipient of the information and the cryptographic unit 20 acts to process information that is received . referring therefore to fig2 , cryptographic unit 18 includes an input 22 of a message to be forwarded to the recipient 12 . the format of the message may be seen in fig4 and includes a packet header 24 and a payload 26 consisting of the message m . the packet header 24 has packet control information 28 and a plurality of addressing fields including the destination address 30 , in this case , the destination of the correspondent 12 , and the source address 32 , in this case the address of the correspondent 10 . the header 24 is to be transmitted over the link 16 as plain text whereas the payload 26 is to be transmitted in a secure manner . the enciphering of the message m is performed by an encryption module 34 that may implement a suitable encryption algorithm . in the present example , a block cipher mode of operation is performed preferably implementing a block cipher mode compatible with ccm . the encryption module 34 requires as inputs a nonce 36 and a key 38 . as a further input , selected information , a , contained in the header may be forwarded to the encryption module 34 to provide a degree of authentication . the output from the encryption module 34 is encrypted data ‘ c .’ in order to derive a key at input 38 , key information is supplied over line 44 permitting to a key to be derived from for example the addressing information of the sending party and the recipient or by other previously agreed upon means . in order to provide a unique value to the nonce 36 , a frame counter 46 is provided and is not permitted to be reused within the context of utilising the same key input . an input signal indicating the desired protection level is also provided at 48 and is used to indicate whether confidentiality is required and whether authenticity is required and at what level . the encoding of the input signal 48 is shown in fig7 and provides an unambiguous indication of the nature of the security level required . as seen in fig7 , the protection level sec provides eight possible options , as represented by the lexa - decimal codes . this enables lower most bits of the code to represent uniquely and unambiguously the different combination . moreover , the combinations are ordered so that those with a 1xx indicate the encryption is turned on and those 0xx have the encryption turned off to further facilitate recognition of the cooling . the key information 44 , frame counter 46 and protection level 48 are provided to a buffer 50 where they are concatenated to provide a security information output . the protection level of signal 48 is also fed to a encoding module 52 that determines the authentication tag length and provides an input signal m indicating the length of the authentication tag to be appended to the message and included in the ciphertext ‘ c ’. again , as may be seen from fig7 , each of the possible tag lengths , in this case 0 , 4 , 8 or 16 bytes , is provided with a corresponding m value that may be represented as a combination of three bits . the values are provided to the encryption module 34 for inclusion in the data string to enciphered . a greater range of values may be used with additional bits provided m the field as appropriate . the outputs of the header , encrypted data 42 and security information from the buffer 50 are assembled at a database 54 and transmitted over the communication line 16 . the format of the resultant transmission may be seen from fig5 and comprises the packet header 24 and addressing fields 30 , 32 corresponding of to the plain text header and the security information formed from the concatenation of the frame counter , key identifier information and the protection level indication , that is output of the buffer 50 . the output of the encryption module 34 appears as the payload 42 and includes the cipher text of the message in and the encrypted authentication tag u obtained from the authentication data , a . upon receipt of the cipher text at the cryptographic unit 20 of correspondent 12 , the process is reversed as shown in fig3 . the header is processed to remove the associated data and provide an input to the encryption module 34 a . the nonce is reconstructed by the construction module 36 a from the information in the plane text header and the information derived from the security information . the security information is processed through buffer 50 a which extracts the frame counter and derives the protection level included in the security information header . from the protection level , the tag length is derived at module 52 a and provided as an input to the encryption module 34 a . the encryption module 34 a may then perform the decryption and extract the plain text of the message m . as noted above , the input to the encryption module 34 includes the key , the nonce 36 , and the message m to be encrypted and additional authentication data a . the binary string representing the tag length m is also provided as an input . the first step of the encryption module is to compute an authentication field t . in the case of a block cipher implementing the ccm protocol , this is done using the cbc - mac mechanism and truncating the output to the appropriate size . to perform this operation , a series of blocks b 0 , b 1 , . . . b n are defined and the cbc - mac operation applied to these blocks . the first block b 0 is formatted as shown in fig8 and has a first octet to contain a set of flags followed by nonce 36 , a security field indication of the form indicated in fig7 and an indication of the length of the message m . the flag field is itself formatted as shown in fig9 and includes a first field set of bits that indicate the number of octets in the length field of the message and thr authentication length m , i . e . number of octets in the authentication field , corresponding to the tag length derived from the module 52 . a further bit indicated as the a data is used to indicate whether or not authentication is included in the operation . where authentication data is included , the blocks encoding the authentication adata are formed by right concatenating the octet string that encodes 1 ( a ) with a itself and splitting the result into 16 octet blocks . the last block may be right padded with zeros if necessary . these blocks are appended to the first block b 0 . after the additional authentication blocks , if any , have been added to the first block b , the message blocks are right concatenated . the message blocks are formed by splitting the message into 16 octet blocks , right padding the last block with zeros if necessary . if the message m is an empty string , then no blocks are added in this step . as a result , a sequence of 16 octet blocks b 0 , b 1 . . . b n is prepared . x i + 1 := e ( k , x i b i ) for i = 1 , . . . , n where e ( ) is the block cipher function to provide a 16 octet string . an authentication tag t is obtained by truncating the 16 octet string to the left most m octets as indicated in the tag length output from the function 52 . to encrypt the message data , the ctr mode is used and the key stream blocks are defined by si = e ( k , a i ) for i = 0 , 1 , 2 . . . . the encryption blocks a 1 are formatted as shown in fig1 with the sec field being formatted as indicated in fig8 . the flag field as shown in fig1 includes a 3 bit representation of the length 1 , of the message . the bits 3 , 4 , and 5 are each set to 0 . the encrypted message is then prepared by xoring the octets of the message m in order , with the left most octets of the right concatenation of s 1 , s 2 , s 3 . the key block s 0 is not used to encrypt the message but is used to encrypt the authentication field t previously obtained . the encrypted authentication value u results from xoring the octets of the authentication field t with the left most m octets of the key stream block s 0 and is appended to the encrypted message as part of the enciphered payload c . upon receipt of the encrypted message , the encryption key k , the nonce 36 , the additional authenticated data , a , and the encrypted message c is obtained and decryption starts by recomputing the key stream to recover the message m and the authentication field t . the message and additional authentication data a is then used to recompute the cbc - mac value and check t . if the t value is not correct , the message is rejected without revealing further information . the above format of data permits the encryption module to be used without authenticating data . this is simply achieved by setting the flag bit adata in the authentication block shown in fig9 at 0 to indicate the absence of any authentication data a bit value of 1 is indicative of the presence of authentication data . a corresponding value of m indicative of no authentication data is also generated and included in the data to be enciphered . the provision of the protection level encoding and the inclusion of the tag length m within the message generation also permits variable length authentication tags to be utilised within the ccm block cipher mode . as indicated in fig7 , the encoding of the protection level not only indicates the nature of the protection , i . e . authentication with or without encryption but also may be used to uniquely identify the tag length associated with the authentication data . accordingly , as part of the authentication process , the desired tag length can be verified and messages rejected if they are not compliant . although the invention has been described with reference to certain specific embodiments , various modifications thereof will be apparent to those skilled in the art without departing from the spirit and scope of the invention as outlined in the claims appended hereto . the entire disclosures of all references recited above are incorporated herein by reference .

7Electricity

a light fixture 10 according to the present invention is illustrated in fig1 and 2 . light fixture 10 has a weatherproof outer housing or shell , such as die - cast aluminum housing 13 or composite injection molded material , about the internal components ( not shown in fig1 ) of the light fixture 10 . the outer housing 13 further comprises one or more globes or optical lenses 14 for allowing light out of the outer housing 13 or , in the alternative , one or more accessible light sockets or receptacles ( not shown ) for receiving direct attachment of and providing power to one or more light units 12 ( see fig2 ). the light fixture 10 further comprises a mounting means or mounting portion 15 for attaching the light fixture 10 to a utility pole or other support structure 16 . the outer housing 13 and globes or optical lenses 14 may be formed from any suitable materials which are well known in the art , as are the various types of mounts 15 or mounting means . in the embodiment shown in fig1 , outer housing 13 further comprises one or more external peripheral bus receptacles 20 supplying both power and data communication to a powered device 30 located outside of the housing 13 . external peripheral bus receptacles 20 may be of any known type or kind suitable for a particular powered device 30 , such as a universal serial bus ( usb ) port 22 , firewire port ( not shown ), serial ata port ( not shown ), or rj45 port ( not shown ). in the embodiment illustrated in fig1 , the plurality of peripheral bus receptacles 20 are illustrated as one or more usb ports 22 and one or more direct power over ethernet adapter ports 24 . each direct power over ethernet adapter port 24 comprises a poe data receptacle 25 paired with a corresponding poe power receptacle 26 . alternatively , when a powered device is a poe enabled powered device , direct power over ethernet adapter ports 24 may simply comprise a poe data receptacle 25 . as shown in fig2 , the light fixture 10 further comprises a power over ethernet power sourcing device 33 within the housing 13 . in one preferred embodiment , the power over ethernet power sourcing device 33 comprises a poe switch or endspan at least meeting the ieee 802 . 2 at standard , that is , a network switch that has power over ethernet injection built - in . alternatively , in another preferred embodiment , the power over ethernet power sourcing device 33 may comprise a midspan or poe injector . the power over ethernet power sourcing device 33 is responsible for querying connected powered devices 30 to determine the need for power to be applied and to control the amount of power being pulled so that applicable limits are not exceeded . the light fixture 10 may further comprise one or more internal peripheral bus receptacles 40 within the housing 13 , such as usb ports 22 and / or one or more direct power over ethernet adapter ports 24 . the power over ethernet power sourcing device 33 is operatively connected , such as by appropriate cabling or other connections ( not shown ) to the internal peripheral bus receptacles 40 and the external peripheral bus receptacles 20 . internal peripheral bus receptacles 40 located within the housing 13 and external peripheral bus receptacles 20 on the outer housing 13 of the light fixture 10 allow the creation of a local area network or ethernet within the light fixture 10 by allowing for one or more powered devices 30 , such as wireless telecommunications device 36 ( operating under any suitable standard for wireless communication of high speed data , including 3g wireless , 4g wireless ( or lte ) or any suitable standard ), microcontroller unit 37 , and a network switch 38 to be operatively interconnected , such as by appropriate connecting cables 21 , such as the illustrated data cable 31 and power cable 32 , to the power over ethernet power sourcing device 33 through such peripheral bus receptacles 20 , 40 . alternatively , internal peripheral bus receptacles 40 may also comprise fixed connections between the power over ethernet power sourcing device 33 and one or more of the more desirable powered devices 30 , such as a wireless telecommunications device 36 , camera ( not shown ), or a light control unit 39 for controlling the operation of the light units 12 of the light fixture 10 . in another embodiment , one or more of the powered devices 30 may comprise poe - enabled powered devices that may be directly attached by appropriate cat - 5 cable connections to the power over ethernet power sourcing device 33 at a power over ethernet adapter port 24 of the appropriate type . the specific powered devices 30 suitable for attachment to the light fixture 10 may be any peripheral or controller device desired which may now or in the future exist which may be operated through a peripheral bus receptacle 20 or 40 or which require another form of connection for both a power source and a data communication link . powered devices 30 may comprise any electronic or electrical device requiring a source of power or power and data communication . powered devices 30 suitable for the present invention may include , but are not limited to , control units for the lights , control units for other powered devices , computer networking devices , network switches , network routers , security cameras , traffic cameras , video cameras , still - photography cameras , other surveillance equipment , rain sensors , air quality sensors , chemical sensors , radiation sensors , light sensors , temperature sensors , wind sensors , humidity sensors , air pressure sensors , wireless access points , wireless data uplink units , wireless data receivers , telecommunication transmitters and receivers , two way radios , voip telephones , energy consumption meters , heating devices , cooling devices , fans , heat sinks , memory devices , or any other powered device desired and adaptable for attachment to a light fixture 10 , such as a street light . when the light fixture 10 is intended for outdoor use , the powered devices 30 and their connecting cables 21 to the external peripheral bus receptacles 20 will have to be waterproof and otherwise sturdy and rugged enough to function when exposed to the elements and temperature extremes without undue need for repair . additional weather protection may be achieved through the strategic placement of peripheral bus receptacles 20 on the lower surfaces 17 of the outer housing 13 or locating the peripheral bus receptacles 20 in covered or uncovered recesses ( not shown ) formed in the outer housing 13 . of course the best weather protection for powered devices 30 is to locate them within the housing 13 , such as the wireless telecommunications device 36 shown in fig2 . the opening or compartment 34 in the housing 13 shown in fig2 would be covered with a releasably secured detachable access panel ( not shown ). one of the principal advantages of the present invention , however , is the ease and convenience that a light fixture according to the present invention affords for connecting and disconnecting external powered devices 30 to the external peripheral bus receptacles 20 . returning to fig1 , releasably secured detachable protrusions , shells or casings 27 may be provided within which to house powered devices 30 or portions thereof , such as antennas or sensors ( not shown ). such casings 27 provide additional weatherproofing and protection for the powered devices 30 which they surround and may be prefabricated in different shapes to contain and conceal different types , shapes and sizes of powered devices 30 . the outer housing 13 may alternately further comprise one or more fastening means 28 for demountably affixing and securing powered devices 30 , such as the illustrated keyhole mount 51 , threaded shaft 52 , or other common alternative fastening means such as bolts , holes for receiving bolts , clamps , latches , slots , grooves , couplings , hooks , pins , cotter pins , screws or other joints specifically fashioned for holding a specific powered device 30 , such as the female connection port 53 into which the male end ( not shown ) of casing 27 is releasably affixed . any suitable fastening means 28 may be provided to accommodate the desired powered device or devices 30 , and the placement and orientation of the fastening means 28 about the outer housing 30 may be designed differently to fulfill different needs and intended uses . of course , a powered device 30 may be independently affixed to the support structure 16 and only operatively connected to an external peripheral bus receptacle 20 by appropriate cabling ( not shown ). as shown in fig2 , the light fixture 10 is also operatively connected to receive power from an external power source 11 in any of the well known manners , such as the illustrated electrical line 18 entering the light fixture 10 via an access opening 42 in the mount 15 . a terminal block 44 having multiple electrical output terminals ( not shown ) inside the housing 10 is adapted to be connected to the electrical line 18 . light units 12 , preferably led light units , are powered by connection to the terminal block 44 at a first electrical output terminal . similarly , power is supplied to the power over ethernet power sourcing device 33 by an electrical connection to the terminal block 44 , preferably to a second electrical output terminal of the terminal block 44 so that the light units 12 and power over ethernet power sourcing device 33 are run on separate electrical circuits originating at the terminal block 44 of the light fixture 10 . in an alternate embodiment , power source 11 may comprise a built - in solar power unit or batteries ( not shown ). batteries may also be installed as a secondary or back - up power supply configured to engage and power the light fixture only in the event of the failure of the primary external power source 11 . the block diagram of fig3 illustrates a schematic of one embodiment of the present invention . in the embodiment illustrated in fig3 , the power over ethernet power sourcing device 33 is a midspan injector operatively connected in any conventional method to an electrical terminal block 44 ( and thus to the external power source 11 ), such as through ac to dc switching power supply 61 , which provides an output of 48v that is used to power the power over ethernet power sourcing device 33 . the ac to dc switching power supply 61 may be sized as desired to power the intended powered devices ( not shown in fig3 ). it is also preferable for the ac to dc switching power supply 61 to be operatively connected to a dc to dc converter 63 for local point of load within the system . the dc to dc converter 63 converts the 48v input and supplies a low voltage power output for powering low voltage powered devices such as the ethernet switch 65 and microcontroller unit 37 . in other alternate embodiments , an ac / ac inverter power supply , or an ac receptacle may be installed in the light fixture to provide power to a powered device 30 of the type requiring an ac power input source . an ethernet switch 65 , such as a five - port 10 / 100 mb / s ethernet switch , functions as a communication gateway between the different powered devices 30 , providing a communications interface between the various powered devices 30 using standard ethernet protocols . at least one port of the ethernet switch 65 is connected to the microcontroller unit 37 which is used to monitor and control the power which is supplied to the different peripheral bus receptacles 20 , 40 . a serial interface between the microcontroller unit 37 and the power over ethernet power sourcing device 33 allows the microcontroller unit 37 to access and control the voltage and current channeled to each port and the ability to separately turn on and off one or more of the peripheral bus receptacles 20 , 40 or any other direct connections to the power over ethernet power sourcing device 33 . a plurality of ports of the ethernet switch 65 are connected to the power over ethernet power sourcing device 33 , which in turn provides a data connection and a power connection to a plurality of direct poe ports 24 or peripheral bus receptacles 20 , 40 . as described above , direct poe ports 24 provide data connection and power connection to additional powered devices 30 or to internal peripheral bus receptacles 40 and external peripheral bus receptacles 20 . as better illustrated in fig1 and 2 , the power over ethernet power sourcing device 33 provides one or more , preferably a plurality of peripheral bus receptacles 20 , 40 , such as usb ports , each of which is adapted to provide power to and data communication among a number of powered devices . specifically , at a minimum , a light fixture 10 according to the present invention comprises a power over ethernet power sourcing device 33 operatively connected to provide a power connection and a data connection to a wireless , hard - wired or fiber optic telecommunications device 36 , a microcontroller unit 37 for monitoring and controlling the voltage and current of each poe port 24 and / or peripheral bus receptacles 20 , 40 , and a light control unit 39 for controlling the light units 12 of the light fixture 10 . the telecommunications device 36 transmits data and provides a connection between the local area network or ethernet of the powered devices 30 of the light fixture 10 and a global computer information network , such as the internet . additionally , one or more peripheral powered devices 30 , such as a digital camera , wireless access point , cooling unit , or other desired sensors may then be easily connected , disconnected and exchanged through use of the peripheral bus receptacles , and each of the powered devices may in turn be remotely controlled by and return data to a wirelessly connected central communication and control computer ( not shown ) through the communications link provided by the wireless telecommunications device 36 . in an alternate embodiment , the telecommunications device 36 may have only a data connection from the power over ethernet power sourcing device 33 and have a power input connection ( not shown ) for receiving power that may be connected to either the power over ethernet power sourcing device 33 or to an electrical output terminal ( not shown ) of the terminal block 44 . in other words , the telecommunications device 36 may have an independent power connection separate from the power over ethernet power sourcing device 33 , but still be connected to the local area network of the light fixture 10 . such a configuration may be warranted in certain situations , such as where the telecommunications device 36 is of a type requiring greater power input than may be supplied through a power over ethernet power sourcing device 33 . similarly , other types of powered devices 30 may be operatively connected to the local area network of the light fixture 10 but require independent electrical power connections . such powered devices 30 would be operable through the local area network , but not supplied powered through the power over ethernet power sourcing device 33 . in an alternate embodiment , a powered device 30 may further comprises a metrology chip device ( not shown ) operatively interconnected to another of the powered devices 30 connected to the power over ethernet power sourcing device 33 . a metrology chip device may be tasked to monitor and report power status data for a powered device 30 back to the central communications and control computer . such a metrology chip device is especially useful for determining the operational status of each powered device 30 and would enhance the ability to make quick and efficient repairs by providing knowledge regarding the nature of issues prior to physically visiting the light fixture 10 , thereby providing a cost savings over light fixtures 10 having un - monitored powered devices 30 . the input and output power of the power over ethernet power sourcing device 33 and each of the powered devices 30 and be remotely monitored . it will be useful for the owner of the attached powered devices 30 to be notified of a power failure or malfunction of the device , so that proper restoration can be put into effect . although this invention has been disclosed and described in its preferred forms with a certain degree of particularity , it is understood that the present disclosure of the preferred forms is only by way of example and that numerous changes in the details of operation and in the combination and arrangement of parts may be resorted to without departing from the spirit and scope of the invention as hereinafter claimed .

7Electricity

fig1 is a block diagram of an apparatus that is a radio frequency identification ( rfid ) system 10 , and that embodies aspects of the present invention . the system 10 includes two interrogators 12 and 13 , an rfid tag 16 , and a network 18 . fig1 also shows several users 21 - 24 that can each use or interact with the system 10 . a user may be an individual , an entity , a computer , or some other automated device . fig1 is not intended to depict the entire rfid system . for example , the system actually includes a plurality of the tags 16 , and more interrogators than just the two that are shown at 12 and 13 . fig1 shows only selected portions of the rfid system that facilitate an understanding of the present invention . the tag 16 is a mobile , battery - operated device , and can communicate in a wireless manner with each of the interrogators 12 and 13 , in particular by exchanging radio frequency ( rf ) wireless signals 28 . in the disclosed embodiment , all of the wireless signals 28 conform to an existing international industry standard known as iso 18000 - 7 . this international standard was promulgated by the international organization for standardization ( iso ), headquartered in geneva , switzerland . persons skilled in the art are familiar with the iso 18000 - 7 standard . for brevity and clarity in the discussion that follows , the term “ iso ” is used as a shorthand way to refer to the iso 18000 - 7 standard , and should be understood to be a reference to the iso 18000 - 7 standard , rather than a reference to the iso organization itself . the circuitry within the tag 16 includes a processor 41 that is coupled to a memory 42 . the memory 42 in fig1 is a diagrammatic representation of two or more different types of memory , including but not limited to read - only memory ( rom ), random access memory ( ram ), and flash memory . the memory 42 contains a program 43 that is executed by the processor 41 , and data 44 that is utilized by the program 43 . the circuitry of the tag also includes a serial port 51 , through which a not - illustrated external computer or other device can communicate serially with the processor 41 . the tag 16 has an internal clock circuit 52 with a not - illustrated oscillator , allowing the tag 16 to maintain a record of the current date and time . the circuitry of the tag further includes a radio frequency ( rf ) receiver 46 that is coupled to the processor 41 and to an antenna 47 . the processor 41 can receive wireless signals 28 through the antenna 47 and receiver 46 . the tag also includes an rf transmitter 48 that is coupled to the processor 41 and to an antenna 49 . the processor 41 can transmit wireless signals 28 through the transmitter 48 and the antenna 49 . the interrogator 13 is a portable , battery - operated , handheld device that can be manually operated by a user 24 who is an individual . the circuitry in the interrogator 13 includes a processor 56 that is coupled to a memory 57 . the memory 57 is a diagrammatic representation of various different types of memory , including but not limited to rom , ram and flash memory . the memory 57 contains a program 58 that is executed by the processor 56 , as well as data 59 that is used by the program 58 . the interrogator 13 includes an rf transmitter 61 that is coupled to the processor 56 and to an antenna 62 . the processor 56 can transmit wireless signals 28 through the transmitter 61 and the antenna 62 . the interrogator also includes an rf receiver 63 that is coupled to the processor 56 and to an antenna 64 . the processor 41 can receive wireless signals 28 through the antenna 64 and the receiver 63 . the handheld interrogator 13 further includes a keypad 66 that is coupled to the processor 56 . the user 24 can manually operate the keypad 66 in order to enter information into the interrogator 13 . the interrogator 12 includes a site manager 71 and a reader 72 that are operatively coupled at 73 . in the disclosed embodiment , the coupling 73 between the site manager 71 and reader 72 is hardwired rather than wireless , and in particular is a network that may conform to a well - known network protocol known as the ethernet protocol . alternatively , however , the site manager 71 and reader 72 could be coupled in any other convenient manner , and could even communicate using wireless signals . within a given site , such as a shipping hub , there may be a plurality of the readers 72 that are provided at spaced locations and that are all coupled to the site manager 71 through the network 73 . however , for simplicity and clarity , fig1 shows only a single reader 72 . as explained earlier , the wireless signals 28 conform to the iso 18000 - 7 industry standard , and the discussion below will focus to some extent on this industry standard . in the real world , the site manager 71 and reader 72 are separate and independent devices that are physically and functionally distinct . however , the iso 18000 - 7 standard basically recognizes two general categories of devices , one of which is tags , and the other of which is interrogators . therefore , for simplicity and clarity in the discussion that follows , the site manager 71 and the reader 72 are collectively referred to herein as an interrogator 12 . in addition , and for simplicity and clarity , the reader 72 is considered herein to be essentially a pass - through device , which facilitates the exchange of iso messages 28 between the site manager 71 and the tag 16 , but without making substantive alterations to any of the messages traveling in either direction . the reader 72 includes a circuit 76 . an rf transmitter 81 is coupled to the circuit 76 , and to an antenna 82 . the circuit 76 can transmit wireless signals 28 through the transmitter 81 and the antenna 82 . an rf receiver 83 is coupled to the circuit 76 and to an antenna 84 . the circuit 76 can receive wireless signals 28 through the antenna 84 and the receiver 83 . the site manager 71 includes a processor 86 that is coupled to a memory 87 . the memory 87 is a diagrammatic representation of various different types of memory , including but not limited to rom , ram and flash memory . the memory 87 stores a program 88 that is executed by the processor 86 , and also stores data 89 that is used by the program 88 . the user 21 can interact with the site manager 71 . for example , the site manager 71 may include a not - illustrated terminal , and the user 21 may be an individual who interacts with the site manager through that terminal . the network 18 is operatively coupled to a network port of the site manager 71 . the network 18 may include one or more of the internet , an intranet , some other type of computer network , or a combination of two more such networks . the users 22 and 23 can communicate with the site manager 71 through the network 18 . the users 22 and 23 may , for example , be individuals who are using personal computers or other terminals that are coupled to the network 18 . alternatively , the users 22 and 23 may be automated systems that are operatively coupled to the network 18 . for example , the user 22 could be a site manager that is similar to the site manager 71 , but that is located in a different site at a physically remote location . as evident from the foregoing discussion , the tag 16 and the interrogators 12 and 13 each include both hardware and software ( where the software may include firmware ). in the embodiment of fig1 , the hardware in the interrogators 12 and 13 and in the tag 16 is entirely conventional . the new and unique characteristics discussed herein are embodied in the software , including the programs 43 , 58 and 88 executed by the various processors in the tag 16 and interrogators 12 and 13 . the new and unique characteristics in the program 88 of the interrogator 12 are essentially the same as those in the program 58 of the interrogator 13 . accordingly , for simplicity and to avoid redundancy , the discussion that follows will focus on the distinctive characteristics of the program 88 in the interrogator 12 , as well as the distinctive characteristics of the program 43 in the tag 16 . but before beginning a detailed discussion of the new and unique characteristics of the programs 88 and 43 , it will be helpful to first briefly discuss the computer programs used in a conventional interrogator and tag . in this regard , fig2 is a block diagram of a system 10 a that includes an interrogator 12 a and a tag 16 a that can exchange wireless communications 28 conforming to the iso 18000 - 7 standard . in fig2 , components that are the same as or similar to components in fig1 are identified with the same or similar reference numerals . for the purpose of this discussion , it is assumed that the hardware of the interrogator 12 a of fig2 is identical to the hardware of interrogator 12 of fig1 , and that the differences between these interrogators reside in the computer programs within them . similarly , it is assumed that the hardware of the tag 16 a of fig2 is identical to the hardware of the tag 16 of fig1 , and that the differences between these tags reside in the computer programs within them . in fig1 , the subject matter depicted within the interrogator 12 and within the tag 16 represents primarily a high - level view of their hardware configurations . in contrast , in fig2 , the subject matter depicted within the interrogator 12 a and within the tag 16 a represents selected high - level aspects of the computer programs within the interrogator 12 a and tag 16 a . in more detail , with reference to fig2 , the computer program in the interrogator 12 a includes an application program 101 . the data maintained by the application program 101 includes an interrogator identification code 103 that uniquely identifies the particular interrogator 12 a . as mentioned earlier , a given site may include multiple interrogators and multiple tags , such that a given tag may be carrying on communications with more than one interrogator , and a given interrogator may be carrying on communications with more than one tag . accordingly , when the interrogator 12 a transmits a wireless iso message at 28 , the interrogator includes in the message its interrogator identification code 103 , so that any tag receiving that message will know which particular interrogator sent the message . the computer program executed in the tag 16 a includes an application program 111 . the application program 111 maintains a database of iso tables 116 , and examples of two iso tables are shown diagrammatically at 117 and 118 . the application program 111 includes a segment of user memory 121 , and maintains a tag manufacturer identification code 122 that uniquely identifies the company that manufactured the tag 16 a . the application program 111 also maintains a tag model number 123 corresponding to the tag 16 a , and a tag serial number 124 that is unique to the particular tag 16 a . the application program 111 further maintains a user - assigned identification code 125 that can be set and / or read by an external user , such as one of the users 21 - 23 . in addition , the application program 111 maintains a routing code 126 . for example , if the tag 16 a happen to be mounted on a container that is being shipped from a manufacturer to a remote shipping hub , and then from the shipping hub to a customer , the routing code 126 may be a code that identifies the particular shipping route . the application program 111 also contains a firmware revision number 127 identifying the particular version of the software / firmware computer program that is currently installed in the tag 16 a . further , the application program 111 maintains a tag password 128 . if password protection in the tag is enabled , and if one of the users 21 - 23 wishes to communicate with the tag , then the user will first need to supply the tag with the correct password . as discussed above , the interrogator 12 a and the tag 16 a exchange wireless communications 28 that conform to the iso 18000 - 7 industry standard . fig3 is a diagram showing one common data format 141 that is used within iso 18000 - 7 messages . this data format 141 includes three fields , which are a type or “ t ” field 142 , a length or “ l ” field 143 , and a value or “ v ” field 144 . combining the first letters of the names of these fields yields the acronym “ tlv ”, and thus the data format 141 is commonly referred to as the “ tlv ” format . the type field 142 contains a code that uniquely identifies the type of data present in the value field 144 . the length field 143 defines the length the value field 144 , and in particular contains a number that represents the number of bytes present in the value field 144 . the value field 144 contains one or more data elements ( and each such data element may itself also have the tlv format ). persons skilled in the art are thoroughly familiar with the tlv data format shown in fig3 . referring again to fig2 , and as explained earlier , wireless messages 28 exchanged between the interrogator 12 a and the tag 16 a conform to the iso 18000 - 7 standard . these iso messages can have a variety of different formats . these formats are all defined in detail in the iso 18000 - 7 specification , and they are therefore not all illustrated and described here in detail . instead , fig4 is a diagram showing a highly - generalized format 151 that is used for many types of iso messages under the iso 18000 - 7 standard . the message format 151 includes a section 153 of iso headers , which is a collection of several different fields . the particular set of fields that are present at 151 will vary somewhat from message to message . for example , the iso headers 153 always include a not - illustrated protocol identification field . the iso headers 153 will typically also include the interrogator identification code 103 ( fig2 ) when the message is being transmitted by the interrogator 12 a , but not if the message is transmitted by the tag 16 a . conversely , the iso headers 153 will typically include the tag serial number 124 ( fig2 ) if the message is being transmitted by the tag 16 a , but not if the message is being transmitted by the interrogator 12 a . there are other fields that can also be present in the iso headers 153 , but since they are well known in the art , they are not all discussed in detail here . the format 151 also includes a command code 154 to tell a receiving device what it is expected to do , a field 155 containing data and / or arguments for the command code 154 , and an error checking field 156 . the error checking field 156 typically contains a cyclic redundancy code ( crc ) of a known type . in regard to the command code shown at 154 in fig4 , table 1 gives examples of some commands that the interrogator 12 a of fig2 can send to the tag 16 a . it will be noted that some of these commands allow the interrogator 12 a to read or write the user - assigned identification code 125 ( fig2 ), the routing code 126 , or the user memory 121 . other commands allow the interrogator 12 a to read the firmware revision number 127 , or the tag model number 123 . still other commands allow the interrogator 12 a to change the tag password 128 , and to engage or disengage password protection . still other commands allow the interrogator 12 a to create a table within the database 116 of iso tables , to write information into a table , or to read information from a table . another command instructs the tag to enter a low - power “ sleep ” mode in which most ( but not all ) of the circuitry in the tag is turned off in order to conserve battery power . still another command turns on or off a not - illustrated audible beeper that is located within the tag . table 1 does not list all of the commands that exist under the iso 18000 - 7 standard , but merely gives examples of some of those commands . in the discussion that follows , messages that are sent from the interrogator 12 a to the tag 16 a and that involve security fall generally within one of three different categories . first , even when a number of the tags are present , the interrogator 12 a can select any one of the tags and send a message specifically to that one particular tag , and then expect a single response from that tag . this type of message is known as a point - 2 - point or “ p2p ” message . in a second category of messages , the interrogator 12 a can broadcast a single message to all of the security - enabled tags that are currently within the wireless transmission range of that particular interrogator . as one example , the interrogator can send one or more iso “ table query ” broadcast messages to multiple tags , followed by an iso collection query broadcast message . the interrogator then expects a single separate response from each individual tag . messages in this category are referred to in this discussion as table query broadcast messages . a third category of iso messages is referred to as universal data block or “ udb ” collection . in particular , the interrogator 12 a can broadcast to multiple tags a common message that instructs each tag to formulate and send back a udb data block . each tag then prepares a udb data block that has a predefined format , and that typically contains multiple items of data . for example , under the iso 18000 - 7 standard , the udb data block may include tag identification information ( discussed in more detail later ), and / or a routing code . under proprietary extensions , various other data items could also be present . the various data elements in the udb are typically each presented in the tlv format discussed above in association with fig3 . after each tag has prepared its udb , the tag sends its udb back to the interrogator 12 a in a wireless message 28 that conforms to the iso 18000 - 7 standard . in fig2 , and as mentioned above , all of the wireless messages 28 sent between the interrogator 12 a and the tag 16 a conform to the iso 18000 - 7 standard . but one resulting disadvantage is that these messages are not secure . for example , since these messages are sent as rf communications , a third party can easily receive these messages and / or transmit similar messages , and thus eavesdrop on or interfere with communications between the interrogator 12 a and the tag 16 a . for example , if the tag 16 a transmits a wireless message that includes a udb with a routing code therein , a third party can receive that rf message and thus learn routing information of the tag and any associated object such as a container . what is in the container . as another example , a third - party device can emulate a tag , and the interrogator 12 a will not necessarily be able to tell that it is talking to an imposter rather than an actual valid tag . as still another example , a third - party device can emulate an interrogator and communicate with the tag 16 a . the tag will not know that it is communicating with an imposter rather than an actual valid interrogator . if the tag currently has password protection disabled , the third party device will be able to read or write data present within the tag , possibly in support of a fraudulent purpose . moreover , if a valid interrogator happens to send the tag 16 a a message that includes the current password for the tag , a third - party device can receive the message and learn the password . using the password , the third - party device will have full read and write access to the tag . moreover , using the current password , the third - party device could even replace the current password with a new password , thereby preventing a valid interrogator from subsequently communicating with the tag . in order to avoid these and various other similar problems , it would be desirable to have some level of security for wireless iso messages 28 being exchanged between the interrogator 12 a and the tag 16 a , while still complying with the iso 18000 - 7 standard . however , the iso 18000 - 7 standard does not have any provision for security in the wireless messages 28 , through the use of encryption or otherwise . moreover , the iso 18000 - 7 standard does not have any built - in extension mechanism that would permit the definition of proprietary messages within the protocol , such as proprietary messages with security provisions . in order to address this , one aspect of the present invention involves the provision of a high level of security for information exchanged between an interrogator and a tag , while still remaining fully compatible with the existing iso 18000 - 7 standard . moreover , this is structured so that it involves only a firmware upgrade in each interrogator and each tag , without any hardware change . consequently , existing interrogators and tags can be relatively easily and cheaply upgraded , without the need to incur the expense of completely replacing them , or the hassle and expense of hardware alterations . in more detail , fig5 is a block diagram showing a selected portion of the system 10 of fig1 , including the interrogator 12 , the tag 16 , the network 18 and the users 21 - 23 . as noted above , the subject matter depicted in fig1 within the interrogator 12 and within the tag 16 represents primarily a high - level view of their hardware configurations . in contrast , in fig5 the subject matter depicted within the interrogator 12 and the tag 16 represents selected high - level aspects of the computer programs within the interrogator and tag . in this regard , fig5 is similar in some respects to fig2 . it will be noted that the firmware of the interrogator 12 includes the conventional application program 101 that was discussed above in association with fig2 , and the firmware in tag 16 includes the conventional application program 111 that was discussed above in association with fig2 . the primary difference between fig5 and fig2 is that in fig5 the firmware in the interrogator 12 includes an additional module in the form of a security shim 201 , and the firmware in the tag 16 includes an additional module in the form of a security shim 202 . conceptually , the security shim 201 is disposed between the application program 101 and the wireless messages 28 that are exchanged between the interrogator 12 and the tag 16 . similarly , the security shim 202 is conceptually disposed between the application program 111 and the wireless messages 28 . if the application program 101 in the interrogator 12 wishes to securely transmit an iso message to the application program 111 in the tag 16 , the security shim 201 takes that iso message , uses encryption and authentication techniques to add a level of security , and then sends a wireless message at 28 that contains the encrypted message with authentication information , while being fully compliant with iso 18000 - 7 . the security shim 202 in the tag then uses decryption to recover the original iso message , and delivers that message to the application program 111 . similarly , if the application program 111 in the tag 16 has an iso message to be securely transmitted to the application program 101 in the interrogator 12 , the security shim 202 uses encryption to add a level of security , and then transmits a wireless message at 28 that contains the encrypted message but is fully iso 18000 - 7 compliant . the security shim 201 in the interrogator then uses decryption to recover the iso message , and delivers that message to the application program 101 . the security shims 201 and 202 are effectively transparent to the application programs 101 and 111 . moreover , even though the iso messages exchanged at 28 in fig5 differ in some respects from the messages that would be exchanged if the security shims 201 and 202 were not present , the messages exchanged at 28 are nevertheless all fully compliant with iso 18000 - 7 . thus , the security shims 201 and 202 are transparent from the perspective of iso compliance , because the messages 28 do not violate any of the requirements of the iso 18000 - 7 standard . some of the information maintained by each of the security shims 201 and 202 will now be briefly identified . then , an explanation will be provided as to how this information is used during system operation . beginning with the security shim 202 in the tag 16 , the security shim 202 maintains a security officer access control list 211 . whenever the tag is operational , the list 211 will include at least one security officer access control object 210 that in turn includes a digital certificate 212 known as the “ root ” certificate . the root certificate 212 contains a pki public key 213 . in the disclosed embodiment , the certificate 212 is a type of digital certificate conforming to an industry standard that is known as the x . 509 standard , promulgated by the international telecommunication union ( itu ) based in geneva , switzerland . since this type of x . 509 certificate is known in the art , it is not described here in detail . in addition to the x . 509 certificate 212 , the access control object 210 includes tag access information 214 that defines the level of access that will be permitted to the tag 16 through use of the associated x . 509 certificate . in a sense , the tag access information 214 can be viewed as a set of rules that govern access to the tag . in this regard , the security scheme implemented by security shims 201 and 202 recognizes four distinct levels of access to a tag , which are listed in table 2 . in table 2 , the lowest level of access is that of an “ operator ”, who has only read - only access to information on the tag . the next higher level of access is that of an “ administrator ”, who has read - only access , and also read / write access . the next higher level is that of a “ security officer ”, who can take security - related actions in the tag that will be described later , such as creating cryptographic keysets , and installing and removing digital certificates ( other than the root certificate 212 ). the highest level of access is that of the tag owner , who has the power to install and remove the access control object 210 containing the root certificate 212 . this may , for example , be effected through the serial port 51 , as indicated diagrammatically by a broken line 216 . in fact , the overall degree of security is enhanced where operators , administrators and security officers carry out secure communications in one manner ( for example through wireless communications ), while the access control object 210 containing the root certificate 212 is installed in a different manner ( for example through the serial port 51 ). the tag access information at 214 indicates the maximum levels of access that can be obtained with the associated digital certificate 212 . in this regard , the tag access information 214 indicates whether the associated digital certificate can be used to create keysets for read - only access , and whether the associated certificate can be used to create keysets for read / write access . in the case of the root certificate 212 , it will normally be permissible to create keysets for read - only access and keysets for read / write access . this does not mean that everyone obtaining access with keysets created under this certificate will necessarily enjoy full access . for example , as discussed above in regard to table 2 , a person using operator keysets created under this certificate will be limited to read - only access , even if the tag access information indicates that read / write access is permissible . on the other hand , if the tag access information 214 indicates that read / write access is not permitted , then it will not be possible to create keysets under the associated certificate that would provide read / write access . it is possible for a security officer using a security officer keyset created under one certificate ( such as the root certificate 212 ) to optionally install one or more additional access control objects in the list 211 , for example as shown at 220 . the tag access information for one of these other access control objects might indicate that creation of read - only keysets under the associated certificate 221 is permitted , but that creation of read / write keysets under that further certificate is prohibited . if a security officer is using a security officer keyset created under an existing certificate in an existing access control object , and installs a further access control object , the tag access rights for that further object must not exceed the tag access rights in the existing object under which the security officer keyset was created . the security shim 202 also maintains a further list 226 that is a universal data block ( udb ) recipient list . the list 226 may be empty , or may optionally contain one or more udb access control objects . for example , reference numeral 227 designates a udb access control object containing a digital certificate 225 of a udb recipient . in the disclosed embodiment , the udb certificate 225 is an x . 509 certificate , and contains a pki public key 228 . the udb access control object 227 further includes udb access information 229 . the list 226 may optionally include a second udb access control object 231 containing a digital certificate 230 with a public key 232 , and udb access information 233 . it would be possible to combine the lists 211 and 226 into a single list that contains both types of access control objects . but for clarity in this discussion , two separate lists 221 and 226 are shown and described . in a sense , the udb access information 229 and the udb access information 233 can each be viewed as a set of rules that govern access to udb information , as discussed below . when the tag 16 receives an iso message asking that the tag formulate and return a udb , the udb access control objects in the list 226 identify the persons or entities who will be the ultimate recipients of the tag &# 39 ; s udb information . in response to the iso message presenting the udb request , the application program 111 in the tag 16 collects all of the udb information that is present within the tag . the security shim 202 in the tag intercepts this udb information from the application program 111 , uses the udb access control objects in the list 226 to identify udb recipients , and prepares a respective separate block of udb data for each udb recipient identified by the udb access control objects 227 and 231 in the list 226 . the security shim 202 does not necessarily pass all of the udb information on to each of the recipients identified by the respective access control objects in the list 226 . instead , the udb access information 229 or 233 in each access control object defines which items of udb information will be received by the associated recipient . for example , assume that the udb information provided by the application program 111 is a set of n data elements data 1 through data n . data 1 might be tag identification information , data 2 might be a routing code , and data n might be some other type of data . fig6 is a diagram showing the udb access information 229 associated with the udb access control object 227 , and also the udb access information 233 associated with the udb access control object 231 . it will be noted that the udb access information 229 associated with access control object 227 indicates the associated recipient is permitted to receive each of data elements data 1 , data 2 , and data n ( and possibly other udb data elements that are between data 2 and data n ). in contrast , the access information 233 associated with access control object 231 indicates the associated recipient is entitled to receive data element data 1 ( and possibly other data elements between data 2 and data n ), but not data element data 2 or data element data n . with reference to fig5 , the security shim 202 also maintains udb protection status information 241 . this information identifies the data elements in the tag &# 39 ; s udb information that will be protected by encryption and authentication , and the data elements that will not be protected . referring again to fig6 , the udb protection status information 241 is depicted twice , once in association with udb access information 229 , and again in association with udb access information 233 . in the exemplary embodiment , the udb protection status information 241 indicates that data elements data 2 and data n will be protected , but that data element data 1 will not be protected . since the udb access information 229 indicates that the associated recipient is entitled to receive each of data elements data 1 , data 2 and data n , then when the security shim 202 receives udb information from the application program 111 ( including data elements data 1 through data n ), the security shim 202 will formulate a udb block for that recipient which includes each of data 1 , data 2 and data n ( and possibly other data elements between data 2 and data n ). further , since udb protection status 241 indicates that data 2 and data n need to be protected , the security shim 202 would encrypt data elements data 2 and data n . more specifically , the security shim 202 would generate a random key , use the random key to separately encrypt each of data 2 and data n , and then encrypt the random key with that recipient &# 39 ; s public key 228 . similarly , since the udb access information 233 for the other udb access control object 231 indicates that the associated recipient is entitled to receive data element data 1 but not data elements data 2 and data n , then when the security shim 202 receives udb information from the application program 111 , the security shim 202 will formulate a udb block for that recipient which includes data 1 ( and possibly other data elements between data 2 and data n ), but not data elements data 2 and data n . the udb protection status information 241 indicates that data elements data 2 and data n need to be protected , but this recipient is not receiving those data elements . this recipient is receiving data element data 1 , but the udb protection status information 241 indicates that data element data 1 does not need to be protected . therefore , data element data 1 would not be encrypted . as discussed earlier , the application program 111 maintains a database 116 of iso 18000 - 7 tables , and examples of two of these tables are shown at 117 and 118 . the security shim 202 maintains a database 249 of three virtual iso tables , which are a p2p request table 251 , a p2p response table 252 , and a broadcast request table 253 . these are referred to as virtual tables , because the application program 111 of the tag is not aware they exist . there are standard iso commands that can be used to access iso tables in the database 116 , and the security shim 201 can use these same standard iso commands to access the virtual iso tables 251 - 253 , as discussed in more detail later . the security techniques used by the security shims 201 and 202 involve both ( 1 ) a cryptographic technique used to encrypt and decrypt information , and ( 2 ) an authentication technique used to authenticate information received in wireless iso messages 28 . the security shims 201 and 202 are each capable of working with any of several different cryptographic techniques , and with any of several different authentication techniques . a combination of one particular encryption technique and one particular authentication technique is referred to herein as a “ protection suite ”. the security shim 202 maintains a list 258 of the protection suites with which it is compatible . fig7 is a table showing examples of five protection suites , which are the protection suites with which the security shim 202 is compatible . these five protection suites are merely exemplary , and it would be possible for the list 258 to contain a larger or smaller number of protection suites . it will be noted that the last protection suite in fig7 is a null - null protection suite that does not use either encryption or authentication . this particular suite is utilized for a special purpose that is discussed in more detail later . the protection suite list 258 in the security shim 202 will always include the null - null protection suite , along with at least one other protection suite . referring again to fig5 , the security shim 202 maintains a keyset table 270 that can store four different cryptographic keysets 271 - 274 . with reference to fig5 and table 2 , the keyset 271 is a security officer ( so ) keyset that can be used by a security officer when reading information from or writing information to the tag 16 . thus , the keyset 271 can be said to be bidirectional , in that it can be used for messages sent to the tag and also messages sent by the tag . the keyset 272 is a read - only keyset , and is used for messages that are sent to the tag by anyone other than a security officer , and that do not seek to change any information within the tag . the keyset 272 is unidirectional , in that it is used only for messages sent to the tag , and not for any messages sent by the tag . the keyset 273 is a read / write keyset , and can be used for messages that are sent to the tag by anyone other than a security officer , and that seek to change information within the tag . the keyset 273 is unidirectional , in that it is used only for messages sent to the tag , and not for any messages sent by the tag . the keyset 274 is a tag response keyset , and is used for messages sent by the tag to anyone other than a security officer . the keyset 273 is unidirectional , in that it is used only for messages sent by the tag , and not for any messages sent to the tag . still referring to fig5 and table 2 , a person or entity with operator status would be given the read - only keyset 272 and also the tag response keyset 274 . a person or entity with administrator status would be given the read - only keyset 272 , the read / write keyset 273 , and the tag response keyset 274 . a security officer would use the security officer keyset 271 to carry out certain tasks specific to security officers . table 3 is an expanded version of table 1 , showing examples of some iso commands for which the read - only keyset 272 is used , and examples of other iso commands for which the read / write keyset 273 is used . the commands in table 3 are merely exemplary , because table 3 does not show all iso commands . where the tag replies to any command in table 3 , the tag would use the tag response keyset 274 . as discussed earlier , fig5 shows only a single interrogator 12 and a single tag 16 , but it is possible for the tag 16 to carry on communications with more than one interrogator at the same time . the security shim 202 in the tag 16 maintains a table 279 that contains a record for each interrogator with which the tag is currently communicating . each such interrogator is identified in the left column of the table by its interrogator identification code 103 . for each such interrogator , the right column of the table 279 contains a sequence number . in this regard , any given interrogator may transmit a series of iso wireless messages to the tag 16 , and each of these messages will contain a sequence number , as discussed later . for each interrogator , the table 279 contains the sequence number from the message most recently received from that interrogator . each time the tag receives a message from that interrogator , the security shim 202 checks to see whether the sequence number in the new message is greater than the sequence number currently stored in the table 297 for that interrogator . if the sequence number from the new message is equal to or less than the number in the table , then the security shim flags an error . otherwise , the security shim accepts the new message , and replaces the sequence number in the table 279 with the sequence number from the new message . turning now to the security shim 201 in the interrogator 12 , fig5 shows that the security shim 201 includes security officer credentials 300 , the credentials 300 including a security officer ( so ) certificate 301 containing a public key 302 , and a private key 303 . in this example , the so certificate 301 corresponds to the root certificate 212 in the tag 16 . in this regard , the public key 302 in the credentials 300 was generated by concatenating the public key 213 of the root certificate 212 with a public key corresponding to the private key 303 in the credentials 300 , and then signing the two concatenated keys with a not - illustrated private key corresponding to the public key 213 . there are various ways in which the credential 300 can be introduced into the interrogator 12 . as one example , the credentials 300 could be introduced into the interrogator 12 from a portable memory device 306 of a known type , such as a universal serial bus ( usb ) flash memory device , or a device of the type commonly known as a “ smartcard ”. as discussed above , a protection suite is a combination of one particular encryption technique and one particular authentication technique . the security shim 201 includes a list 311 of protection suites with which it is compatible . this protection suite list 311 is conceptually similar to the protection suite list 258 discussed earlier in association with the security shim 202 and fig7 . however , the set of protection suites identified in the list 311 may not necessarily be identical to the set of protection suites identified in the list 258 . however , both lists will include the null - null protection suite ( fig7 ), as well as at least one other protection suite . in order for the security shims 201 and 201 to exchange secure information , the lists 258 and 311 will need to have at least one protection suite in common ( other then the null - null protection suite ). the security shim 201 can generate and temporarily save a transient pki public key 316 and a corresponding transient pki private key 317 , for a purpose discussed in more detail later . the security shim 201 also includes encrypted storage 326 that may be empty , but that will typically include one or more keyset tables , two examples of which are shown at 327 and 328 . the keyset tables 327 and 328 are each similar to the keyset table 270 discussed above , which contains four keysets 271 - 274 . for the purpose of this discussion , it is assumed that the keyset table 327 is for the tag 16 and is thus identical to the keyset table 270 in the tag 16 , and that the keyset table 328 corresponds to a different tag and thus is not identical to the keyset table 270 in tag 16 . however , there may be some commonality . for example , for reasons discussed later , the keyset tables 327 and 328 may each contain a read - only keyset that is identical to the read - only keyset 272 in the tag 16 . in the disclosed embodiment , the encryption technique used for protecting the storage 326 is implemented with the microsoft ® cryptographic api ( capi ) available on the windows xp ® and windows ce ® platforms ( ce - crypto ). however , the encryption could alternatively be implemented using any other suitable encryption platform . as mentioned above , the storage 326 is encrypted . in order to provide for restricted access to this encrypted storage 326 , the security shim 201 maintains an access control section 336 that contains one or more access control blocks each corresponding to a respective different user . for example , the control section 336 contains an access control block 341 that has a user identification 342 , a password 344 , and an identification 343 of one or more keyset tables 327 - 328 that the specified user is authorized to use . similarly , another access control block 346 has a user identification 347 that identifies a different user , a password 349 for that user , and an identification 348 of one or more keyset tables 327 - 328 that the user is authorized to use . when , for example , the user 342 provides the proper password 344 to the control section 336 , each keyset table identified at 343 is obtained from encrypted storage 326 , decrypted , and then made available for use by that user . each user is permitted to freely change his or her password . depending on the circumstances , and where appropriate , the security officer credentials 300 could also be maintained in protected storage , with access thereto controlled by the access control section 336 . as discussed earlier , the iso 18000 - 7 standard does not have any provision for protecting iso messages that are being transmitted . moreover , this iso standard does not have a built - in extension mechanism permitting the definition of new and proprietary messages that conform to the standard but that could also use encryption or some other security mechanism . accordingly , the security shims 201 and 202 implement a unique technique that complies with the iso 18000 - 7 standard but that provides strong security for iso messages exchanged between the application program 101 in the interrogator and the application program 111 in the tag 16 . according to this technique , the actual original iso 18000 - 7 message is encrypted , then transmitted as a payload within at least one other iso 18000 - 7 message that is not encrypted and that effectively serves as an envelope for the encrypted original message . this approach of embedding one iso message within another is referred to herein as “ tunneling ” the encrypted message within the envelope message . in more detail , and as discussed earlier , the iso 18000 - 7 standard includes commands that permit the interrogator 12 of fig5 to access iso tables in the database 116 , such as the exemplary tables shown at 117 and 118 . the security shim 201 of the interrogator 12 uses the same iso table commands for envelope messages , in order to access the virtual tables 251 - 253 in the security shim 201 . thus , if the application program 101 in the interrogator 12 has an iso message that is to be sent to the application program 111 in the tag 16 , the security shim 201 intercepts this iso message , adds encryption and authentication , and then transmits it as the payload in at least one enveloping iso message containing a table write fragment command directed to one of the virtual tables 251 or 253 . as a practical matter , the encrypted and authenticated command will usually be too large to be sent as the payload of a single iso message . this is due in part to the fact that , in the united states , the federal communications commission limits rfid infrastructure transmissions to 25 msec out of any 100 msec time window , which effectively limits each message to a length of about 100 bytes . other countries and local authorities may also impose constraints . accordingly , since the encrypted and authenticated command will usually be too large to embed within a single iso message , it will typically be broken into several fragments , and then the fragments will be sent separately to the table 251 or 253 in respective different enveloping messages that are each an iso table write fragment command . when all of the fragments have been written into the virtual table 251 or 253 , the security shim 202 will retrieve and reassemble the fragments , authenticate and decrypt the result in order to recover the original iso command , and then deliver this iso command to the application program 111 . conversely , if the application program 111 in the tag 16 has an iso message to send to the application program 101 in the interrogator 12 , the security shim 202 can intercept this iso message , add encryption and authentication , fragment the message , and put the fragments into the virtual table 252 . the security shim 202 then notifies the security shim 201 , and the security shim 201 retrieves these fragments from the virtual table 252 using successive iso table read fragment commands . that is , the fragments are each transported as the payload of a respective envelope iso message sent in response to an iso table read fragment command . when the security shim 201 has retrieved all of the fragments from the table 252 , it reassembles the fragments and then authenticates and decrypts the result , in order to recover the original iso message . the security shim 201 then delivers the original iso message to the application program 101 . with reference to an earlier discussion herein of different categories of messages , the virtual tables 251 and 252 are used for p2p messages and responses , and the virtual table 253 is used for broadcast table query messages . fig8 is a diagram showing in more detail how this can be accomplished for an iso 18000 - 7 p2p message 401 that is generated by the application program 101 . the command 401 has a standard iso format , including iso headers 402 , a command code 403 , a length value 404 , and data 405 . in order to reduce the amount of information that must be encrypted and tunneled , some of the iso headers 402 from the message 401 are dropped , in order to obtain a compressed version 411 of the iso headers 402 . this is shown in more detail in table 4 . in this regard , if all of the iso headers 402 were retained in the tunneled message , some of them would necessarily always be identical to their counterparts in the iso headers of the envelope message . accordingly , these headers are omitted from the tunneled message . at the receiving end , they are added back to the tunneled message by simply copying the counterparts from the envelope message . as shown in table 4 , these include well - known iso headers such as packet options , tag manufacturer identification , tag serial number , and interrogator identification code . as another example , some of the iso headers 402 of the tunneled message would not necessarily be identical to their counterparts in the envelope message , but can be omitted from the tunneled message , and then recreated at the receiving end by recomputing them . as shown in table 4 , these include the well - known iso headers of packet length and crc error checking . one other iso header of interest is the tag status header . this header is maintained without change in the tunneled message . in theory , the counterpart header in the envelope message could be identical . however , this status information in the header of the envelope message would then be publicly accessible to anyone within the transmission range of the tag . in order to avoid making this status information available to anyone other than the intended recipient ( s ), and as indicated in table 4 , the iso tag status header in each envelope message is unconditionally set to indicate a positive status response from the tag , regardless of whether the tag status header in the tunneled message happens to be positive or negative . consequently , other parties who may look at the envelope message will always see it reflecting a positive tag status , and will not know whether the actual tag response was positive or negative . referring again to fig8 , reference numeral 412 identifies the compressed version of the original iso message 401 . as between any pair of transmitting and receiving devices , a selected common protection suite will be in effect . as discussed above , that protection suite will identify both an encryption technique and an authentication technique . in addition , between that same pair of devices , it will be possible to identify an appropriate cryptographic keyset which , depending on the circumstances , may be the security officer keyset 271 , the read - only keyset 272 , the read / write keyset 273 , or the tag response keyset 274 . the compressed iso message 412 is encrypted using the appropriate keyset and using the encryption technique specified in the selected protection suite ( unless the suite specifies null rather than an encryption technique ). the resulting encrypted information 416 is expressed in tlv format . next , a cryptographic information tlv 417 is concatenated to the encrypted information tlv 416 . the cryptographic information tlv is not itself encrypted , but indicates how the information 416 was encrypted , including an identification of the particular protection suite used and the particular keyset used . fig9 is an example of how the cryptographic information tlv 417 would appear if the selected protection suite was the aes - 128 - ctr - hmac - sha1 - 96 suite of fig7 . the cryptographic information tlv 417 and the encrypted information tlv 416 represent the protected payload 421 that is to be transmitted . this payload will usually be too long to be sent in a single iso envelope message . therefore , the protected payload 421 is typically fragmented in a way that minimizes the number of fragments that must be separately sent . in the example shown in fig8 , this results in three fragments frag 1 , frag 2 , and frag 3 . each fragment is then expressed in tlv form , in order to obtain three fragment tlvs f 1 , f 2 , and f 3 , which will each be sent in a respective separate iso envelope message . fig1 is a diagram showing four iso envelope messages 436 - 439 , each of which contains a table write fragment command directed to the virtual table 251 in fig5 . the iso messages 436 - 438 each include a respective one of the fragment tlvs f 1 , f 2 , and f 3 . the fourth iso message 439 contains a tlv 441 with authentication information . the authentication information 441 includes a sequence number , and also a checksum value that will be explained later . with respect to the sequence number , and according to the iso 18000 - 7 standard , the original iso message 401 ( fig8 ) contains a sequence number . this sequence number from the original iso message 401 is the sequence number in the authentication information 441 of the iso message 439 . it is well known in the art how , under the iso standard , several iso table write fragment commands such as those shown at 436 - 439 in fig1 can be used to write respective fragments of related information into a table such as the p2p request table 251 in fig5 . therefore , this technique is not described in detail here . instead , it is discussed only briefly , to an extent that facilitates an understanding of aspects of the present invention . to initiate the process , the security shim 201 of the interrogator 12 transmits to the tag 16 a not - illustrated iso table update record command , which serves as a request for permission to update the table 251 . the security shim 202 of the tag 16 then sends back an iso message containing a value that is commonly referred to as an operation initiation token . this and other similar tokens are random values , which adds to the security of a given message exchange . the interrogator 12 then sends the iso message 436 in order to put the fragment tlv f 1 in the table 251 , and the tag responds by transmitting an iso message with an operation continuation token . the interrogator then transmits the iso message 437 , and receives back an iso message with a further continuation token . the interrogator then transmits the iso message 438 , and receives back another iso message with a continuation token . the interrogator then transmits the iso message 439 . the checksum in the authentication tlv 441 of the message 439 is computed by concatenating all messages that have been exchanged between the interrogator and the tag , beginning with the initial table update record message , and including all messages sent by the tag with continuation tokens , as well as the final message 439 , except for the authentication portion of the final message 439 . this authentication checksum is computed according to the authentication technique indicated in the protection suite identified by the cryptographic information tlv 421 ( fig8 ), and using the appropriate keyset . when all of the iso 18000 - 7 messages 436 - 439 have been received by the tag and are present in the table 252 , the security shim 202 in tag 16 takes the sequence number from the authentication information 441 in the final message 439 , and compares that sequence number to the sequence number currently stored in the table 279 for the interrogator 12 . if the sequence number from the message 439 is less than or equal to the sequence number currently stored in the table 279 , the security shim 202 flags an error . otherwise , the security shim 202 replaces the sequence number in table 279 with the new sequence number from the authentication information in message 439 . then , the security shim 202 locally computes its own authentication checksum , and compares it to the authentication checksum received in the authentication information 441 of the message 439 , in order to confirm that the checksums are identical . if the tag detects an error at any time during the exchange of messages , then the tag sends the interrogator an iso 18000 - 7 error message of a known type . upon receiving this error message , the security shim 201 in the interrogator 12 discontinues the transmission , and notifies the application program 101 about the error . on the other hand , if the security shim 202 in the tag has not identified any errors , and if the authentication checksum is verified successfully , then the security shim 202 ( 1 ) reassembles the fragments f 1 , f 2 , and f 3 , ( 2 ) decrypts this reassembled information , and ( 3 ) replaces or recreates the missing iso headers , in order to thereby end up with the original message that is shown in 401 at fig8 . the security shim 202 then delivers this iso message 401 to the application program 111 in the tag 16 . in response to the command in the iso message 401 , the tag will send a response back to the interrogator . this response is handled in a manner that is only slightly different from the manner described above for the message 401 . in particular , the application program 111 in the tag 16 formulates an iso message containing its response . then , in a manner similar to that shown in fig8 , the security shim 202 compresses the iso headers , encrypts the result , adds a cryptographic information tlv , and puts the resulting fragment tlvs in the p2p response table 252 . the tag then sends the interrogator an iso message containing a special token that indicates to the security shim 201 in the interrogator that a secure response is ready , and waiting to be retrieved . this prompts the interrogator to read the fragment tlvs from the table . for the most part , the manner in which this is carried out is known under the iso 18000 - 7 standard , and the retrieval of the fragments is therefore described only briefly here . in response to the token from the tag , the interrogator sends back an iso message containing an iso table get data command , and the tag responds with an operation initiation token that is a random value . the interrogator then sends an iso table read fragment command to the tag , and the tag sends back an iso message containing the first fragment and a further random token . the interrogator then requests the next fragment , and so forth . after the tag sends the last actual fragment , and in response to the next table read fragment request from the interrogator , the tag sends an iso message that contains a sequence number and an authentication checksum . the authentication checksum is computed by concatenating all messages exchanged between the interrogator and tag , beginning with the message containing the initial token sent by the tag upon completing preparation of its response , and ending with the tag &# 39 ; s final message containing the authentication checksum , except for the checksum itself . during the exchange of messages that transmit the tag &# 39 ; s response to the interrogator , if the tag happens to detect any error , the tag sends the interrogator an iso 18000 - 7 error message . the interrogator then discontinues the exchange , and notifies the application program 101 of the error . when the interrogator receives the message with the tag &# 39 ; s authentication checksum , the interrogator independently computes an authentication checksum , and compares it to the authentication checksum received from the tag , in order to verify that they are identical . if the tag &# 39 ; s authentication checksum is verified successfully , then the security shim 201 in the interrogator reassembles the various fragments it retrieved , decrypts the result , and replaces or recreates the missing iso headers , in order to thereby end up with the iso message that was the tag &# 39 ; s response . the security shim 201 then passes this iso message to the application program 101 in the interrogator . the foregoing explanation relates to an exchange that began when the interrogator 12 decided to send an iso p2p message to a single specific tag 16 . however , as discussed earlier , the interrogator 12 can also broadcast to a plurality of different tags an iso 18000 - 7 broadcast table query message having embedded within it a protected broadcast table query . in particular , the embedded message is a table query directed to one of the iso tables 117 - 118 that is present in each of the tags , and is sent in an envelope message that is a table query to the broadcast request table 253 . the original command is compressed , encrypted and fragmented in a manner similar to that shown in fig8 , with two differences . the first difference is that the encryption is always carried out using the read - only keyset 272 of the tags to which the message is directed . it will be noted that these tags all need to share the same read - only keyset 272 , but the other keysets 271 , 273 and 274 can all be different and unique in each tag . the second difference relates to the compressed iso headers in the tunneled message . more specifically , the iso headers of the tunneled message include a packet options field , which in turn contains a communication type bit . when the security shim 201 intercepts the message prepared by the application program 101 , this communication type bit will be a binary “ 0 ”, to indicate that the communication is a broadcast communication . but during the process of compressing the iso headers , the security shim 201 in the interrogator generates a random bit that is referred to here as the collection query random bit “ cqrb ”. the security shim 201 saves the cqrb for later use , and also stores this bit in the communication type bit of the packet options field in the compressed iso headers , in place of the binary “ 0 ” that the interrogator 12 put there . fig1 is a diagram showing how the fragments of the original table query message are sent in several successive iso table query messages 446 - 449 that are directed to the broadcast request table 253 in the tags . the transmission of the messages 446 - 449 conforms to the iso 18000 - 7 standard , and is therefore discussed here only briefly . the interrogator 12 successively transmits each of the messages 446 - 449 , without receiving any response from any of the multiple tags . the final message 449 contains authentication information 456 , including a final sequence number , and an authentication checksum . the checksum is computed by concatenating all of the information in all of the messages 446 - 449 , except for the checksum itself . the checksum is computed according to the message authentication algorithm of the protection suite identified in the cryptographic information tlv that is embedded within the fragment f 1 in the first message 446 , using the read - only keyset 272 . as each tag 16 is receiving the messages 446 - 449 , the tag &# 39 ; s security shim 202 monitors the iso 18000 - 7 query collection command sequence numbers in those messages , using the table 279 ( fig5 ). in particular , if a received sequence number is less than or equal to the sequence number currently stored in the table 279 for interrogator 12 , the security shim flags an error . otherwise , the security shim 202 replaces the sequence number in the table 279 with the new sequence number . when the messages 446 - 449 have all been properly received , the tag locally computes its own authentication checksum for these messages , and compares it to the authentication checksum received in the final message from the interrogator , in order to verify that they are identical . if this authentication fails , then the tag discards the messages . but if the sequence and authentication information is all correct , then the security shim 202 in the tag decrypts and reassembles the original table query message . as part of the reassembly of the original message , and in particular as the compressed iso headers are reconstructed , the security shim 202 saves the received cqrb bit for later use , and sets the communication type bit of the packet options field in the reconstructed headers to a binary “ 0 ”. the security shim 202 then passes the reconstructed message on to the application program 111 of the tag . in due course , and in a similar manner , the interrogator will transmit to all the tags a broadcast message containing a collection query command . when the security shim 202 in the tag passes this message on the tag &# 39 ; s application program 111 , the application program 111 will generate an iso 18000 - 7 compliant reply message . the iso headers of this message contain a tag status field , which in turn includes a “ service bit ” that represents tag &# 39 ; s reply to the query . this iso message is intercepted by the security shim 202 in the tag , and the security shim performs an exclusive or ( xor ) between the service bit and the cqrb bit , and substitutes the result for the service bit . then without further change or tunneling , the security shim 202 transmits the modified iso message to the interrogator 12 . although this iso message is not encrypted or tunneled , the true value of the service bit cannot be determined . when the security shim 201 in the interrogator 12 receives this iso message , it takes the modified service bit from the tag status field in the iso headers , and carries out an exclusive or ( xor ) between this modified service bit and the previously - saved cqrb bit , in order to thereby recover the original value of the service bit . the security shim substitutes this recovered original service bit for the modified service bit in the iso headers of the message , and then passes the message on to the application program 101 in the interrogator . as mentioned earlier , the iso 18000 - 7 standard has provisions for the interrogator 12 to transmit to multiple tags a broadcast request for a universal data block ( udb ), expecting that each tag will then prepare and return a udb . in addition , the iso 18000 - 7 standard has provisions for the interrogator 12 to transmit to one selected tag a p2p request for a udb , and then only the selected tag will prepare and return a udb . for the purpose of this discussion , it is assumed that , in the disclosed embodiment of fig5 , the application program 101 in the interrogator 12 generates the broadcast iso message for udb collection . the security shim 201 does not apply any encryption or other form of security to that message . instead , the security shim 201 transmits the message at 28 without any change . on the other hand , when each tag 16 responds , the tag &# 39 ; s security shim 202 encrypts certain information in the udb data that is being returned , as briefly mentioned earlier . this is explained in more detail below , with reference to fig1 . more specifically , fig1 is a diagram showing an iso message 501 that contains one or more protected blocks 506 of udb data , and also one or more authentication blocks 508 . the udb blocks 506 and the authentication blocks 508 are provided in pairs . that is , each udb block 506 is associated with a respective different authentication block 508 . as discussed earlier in association with fig5 , the security shim 202 in the tag maintains a udb recipient list 226 , and in the disclosed embodiment this list contains at least two udb access control objects 227 and 231 . the udb message 501 contains a respective udb block 506 for each access control object in the list 226 , and also contains a corresponding authentication block 508 for each access control object . one of the udb blocks 506 is shown in more detail in the upper portion of fig1 . it includes a section 516 of udb data , and this section 516 contains one or more data elements that are each configured in a tlv format . as discussed above in association with fig5 and 6 , the application program 111 responds to a udb request by collecting all of the data elements in the tag that could possibly be returned in reply to a udb request . as discussed in association with fig6 , each udb access control object in the list 226 includes udb access information , such as that shown at 229 or 233 in fig6 . the udb access information defines which of the various udb data elements the associated recipient is entitled to receive . in this example , as discussed above in association with fig6 , the udb access information 229 for one recipient is different from the ubd access information 233 for another recipient . thus , the section 516 in one udb block 506 will contain one set of data elements specified by one recipient &# 39 ; s udb access information 229 , whereas a different udb block 506 will contain a different set of data elements identified by the other recipient &# 39 ; s udb access information 233 . moreover , as discussed above in association with fig6 , the udb protection status information 241 will be used to determine whether or not each data element in each udb block 506 will be protected by encryption . in fig1 , each udb block 506 includes a field 521 that contains a udb sequence number in tlv format , and a further field 522 that contains tag identification information in tlv format . the tag identification information at 522 includes both the tag manufacturer identification 122 ( fig5 ) and also the tag serial number 124 . the fields 516 , 521 and 522 are encrypted by the security shim 202 , using a randomly generated encryption key that is different for each udb block 506 . the random encryption key is then encrypted using the respective public key 228 or 232 ( fig5 ) of the intended recipient of the particular udb block 506 , and this encrypted key is placed in a field 524 of the block 506 , in tlv format . the recipient of the block will have a private key corresponding to the public key 228 or 232 , and will thus be able to decrypt the field 524 in order to retrieve the random key . the recipient can then use this random key to decrypt and authenticate the fields 516 and 521 - 522 . each udb block 506 also includes several other fields 526 - 530 . the fields 526 and 527 are type and length information for the tlv format of the entire udb block 506 . the field 528 is a recipient identification in tlv format . in the disclosed embodiment , the recipient identification is the “ distinguished name ” from the particular recipient &# 39 ; s x . 509 certificate 225 or 230 ( fig5 ). the field 529 contains cryptographic information that will be needed by the recipient in order to decrypt the encrypted portions of the udb 506 . the field 530 contains authentication information in the form of a cryptographic checksum of all of the other fields ( a 1 ) in that particular udb block 506 , computed according to the authentication technique specified by the protection suite identified in the cryptographic information 529 , and using the random key that appears in encrypted form in field 524 . the lower portion of fig1 shows one of the authentication blocks 508 in greater detail . in the disclosed embodiment , each authentication block 508 includes six fields 541 - 546 . the field 546 contains an authentication checksum that is based on all information ( a 2 ) in the message 501 other than the authentication blocks 508 , as well as everything ( a 3 ) in this particular authentication block 508 , other than the field 546 itself . the fields 541 and 542 contain type and length information for the tlv format of the entire authentication block 508 . the field 543 contains a recipient identification which is the same as that in the field 528 of the corresponding udb block 506 . the field 544 contains a cryptographic information tlv of the type shown in fig9 , part of which is an identification of the authentication method used to generate the authentication checksum in the field 546 . the authentication checksum is generated with a random key . this random key is then encrypted using the public key 228 or 232 from the digital certificate of the intended recipient , and placed in a field 545 of the authentication block 508 . the iso message 501 of fig1 containing udb information is not itself encrypted and / or tunneled , because each of the udb blocks 506 in this message 501 have portions that have already been separately encrypted . if the udb blocks 506 and authentication blocks 508 have a collective size that is too large to be sent in a single iso 18000 - 7 message , then this udb “ payload ” is broken up into two or more segments in a manner specified by the iso 18000 - 7 protocol , and the segments are sent in separate messages . since persons skilled in the art are familiar with how , under the iso 18000 - 7 standard , a udb payload is to be segmented and how the segments are to be separately transmitted , that process is not shown and described in detail here . it is assumed for the sake of this discussion that the udb payload is not sufficiently large to require segmentation . consequently , the message shown at 501 will be wirelessly transmitted at 28 in the format shown at 501 . the security shim 201 in the interrogator 12 will receive the message 501 , and then pass it on without change to the application program 101 , which will then forward it on to each of the intended recipients . for example , assume that the users 22 and 23 in fig5 respectively correspond to the udb access control objects 227 and 231 in the tag 16 . the application program 101 would forward the entire message 501 through the network 18 to each of the users 22 and 23 . user 22 will have a private key that corresponds to the public key 228 in the certificate 225 , and will thus have cryptographic access to one udb block 506 and the associated authentication block 508 . the user 23 will have a different private key that corresponds to the public key 232 in the certificate 230 , and will thus have cryptographic access to a different udb block 506 and the associated authentication block 508 . the user 22 will be able to verify the two authentication checksums 530 and 546 in its pair of blocks 506 and 508 , and the user 23 will be able to separately verify the authentication checksums in the fields 530 and 546 of its pair of blocks 506 and 508 . with reference to fig5 , when the tag 16 is first being commissioned , the tag owner will install the security officer access control object 210 that contains the root certificate 212 . at this point , the list 211 will not contain any other certificates , and the list 226 will be empty . further , the cryptographic keysets in table 270 will not yet be defined . after the tag owner installs the access control object 210 containing the root certificate 212 , the next step in the commissioning procedure is for a security officer ( for example the user 21 ) to authenticate himself to the tag , for the purpose of defining keysets 271 - 274 that will allow the security shims 201 and 202 to exchange protected information in the manner described above . the first task that the security officer must complete is to establish the security officer keyset 271 , in a manner explained in more detail below . as this is carried out , the security shim 201 transmits information to the tag 16 , using table write fragment commands that store information fragments in the p2p request table 251 , and using table read fragment commands to read information fragments from the p2p response table 252 , in a manner generally similar to that already described above . one difference is that , with reference to fig7 , the protection suite used for these particular exchanges is the null - null protection suite . in other words , the security shims 201 and 202 exchange p2p iso messages without using any encryption or authentication . this is because the exchange of information between the security officer and the tag in this particular situation is configured to be self - protecting . in more detail , fig1 is a flowchart showing how a security officer can , through the interrogator 12 , authenticate to the root certificate 212 in the tag 16 , determine a protection suite , and establish the security officer keyset 271 . this procedure begins at 571 . in block 572 , the security officer has the security shim 201 generate a transient random public key and a transient random private key , which are respectively shown at 316 and 317 in fig5 . the security officer also has the interrogator &# 39 ; s security shim 201 generate a random number ri . the security officer then has the security shim 201 transmit selected information to the tag at 573 , using the tunneling technique discussed above in association with fig8 and 10 , but with the null - null protection suite ( fig7 ). the information transmitted at 573 includes the security officer &# 39 ; s digital certificate 301 ( including its embedded public key 302 ), the list 311 of protection suites supported by the security shim 201 in the interrogator , the transient public key 316 , and the random number ri . upon receiving this information , the security shim 202 in the tag compares the protection suite list 311 from the interrogator 12 to its own protection suite list 258 , in order to determine whether or not there is at least one protection suite common to both lists ( other than the null - null protection suite ). if there is no common protection suite , then the security shim 202 terminates its participation in the transaction , as indicated at 577 . otherwise , the security shim 202 proceeds to block 578 , where it checks to see if the digital certificate 301 from the security officer is valid . for example , the digital certificate 301 specifies a range of dates within which it is valid , and the security shim 202 can verify that the current date maintained in the tag using clock 52 ( fig1 ) is within the range of dates specified by the certificate . the security shim 202 can also check the integrity of the certificate by verifying the issuer &# 39 ; s signature , using the public key 302 from the security officer &# 39 ; s digital certificate 301 . if the security shim 202 determines that there is a problem with the digital certificate 301 of the security officer , the security shim terminates the transaction at 577 . otherwise , at block 581 , the security shim 202 selects one protection suite that is common to both of the lists 311 and 258 ( other than the null - null protection suite ). the security shim 202 also generates a random number rt . then , the security shim 202 uses the transient public key 316 received from the interrogator at 573 to encrypt both the random number rt and an identification of the selected protection suite . then , at 582 , this information is transmitted back to the security shim 201 in the interrogator 12 . the transfer of this information is effected by putting the information in the p2p response table 252 , and then notifying the security shim 201 in the interrogator , so that the security shim 201 can retrieve this information from the table 252 in the manner discussed earlier . the protection suite selected by the tag at block 581 is not yet in effect , and so all of the exchanges shown in fig1 are carried out using the null - null protection suite . at block 583 , the security shim 201 in the interrogator decrypts the information that it received at 582 from the security shim 202 in the tag . the security shim 201 then computes an authentication value hi , according to the authentication technique identified in the protection suite selected by the security shim 202 in the tag , and using the random key rt received from the security shim 202 . in addition , the security shim 201 generates a further random number salt . the security shim 201 concatenates the authentication value hi and the random number salt , and signs the concatenated result with the private key 303 associated with the digital certificate 301 . this signed information is then transmitted at 584 to the security shim 202 in the tag . upon receiving this information , the security shim 202 uses the public key 302 that it received in the security officer &# 39 ; s certificate 301 , and verifies the signature in the information received at 584 . if the signature is not valid , then the security shim 202 ends the transaction at 577 . otherwise , the security shim 202 in the tag proceeds to block 587 , where it locally computes its own authentication checksum ht , and then compares this to the authentication checksum hi from the interrogator , in order to verify they are identical . if they are different , then the security shim 202 terminates the transaction at 577 . otherwise , the security shim 202 proceeds to block 588 , where it generates the security officer ( so ) keyset 271 . in this regard , the various messages received from the interrogator each include the interrogator identification code 103 ( fig5 ), and of course the security shim 202 has also received from the interrogator &# 39 ; s security shim 201 the random numbers ri and salt . the tag &# 39 ; s security shim 202 concatenates ( 1 ) the random number salt , ( 2 ) the random number rt , ( 3 ) the random number ri , ( 4 ) the tag serial number 124 , ( 5 ) the tag manufacturer identification 122 , and ( 6 ) the interrogator identification 103 . the security shim 202 then uses this concatenated information as an input to well - known algorithm referred to in the art as pbkdf2 ( password - based key derivation function ), in order to derive material that is used as the security officer keyset 271 . this keyset includes both an encryption key , and an authentication key . the tag &# 39 ; s security shim 202 saves this keyset at 271 . next , at 591 , the security shim 202 sends to the interrogator &# 39 ; s security shim 201 a message that instructs the security shim 201 to change protection suites . the security shim 202 then switches from use of the null - null protection suite to use of the protection suite selected at block 581 . when the interrogator &# 39 ; s security shim 201 receives the message sent at 591 , the it already has in hand all of the same information used by the tag &# 39 ; s security shim 202 to generate the security officer keyset . accordingly , at block 592 , the interrogator &# 39 ; s security shim 201 separately derives and saves the security officer keyset 271 in the same manner that this keyset was derived by the tag &# 39 ; s security shim 202 , in particular by concatenating the same information and then using the same pbkdf2 function . the security shim 201 in the interrogator then switches from use of the null - null protection suite to use of the protection suite selected by the tag at block 581 . thereafter , any further communications between the security officer and the tag will still be effected with tunneled messages routed through the p2p request and response tables 251 and 252 , but using the security officer keyset 271 , and the protection suite selected at 581 . in this regard , the security officer can use the selected protection suite and the security officer keyset 271 to send the tag &# 39 ; s security shim 202 a read - only keyset , which the security shim 202 stores at 272 for later use . as mentioned earlier , the security officer will normally provide this same read - only keyset to many different tags , so that broadcast messages sent to multiple tags can contain information encrypted with this keyset , and the various tags will each be able to decrypt the encrypted information . the security officer can also use the security officer keyset 271 and the selected protection suite to instruct the tag &# 39 ; s security shim 202 to generate a read / write keyset . the security shim 202 will then generate random numbers for use as the read / write keyset , store the read / write keyset at 273 , and send the read / write keyset 273 back to the interrogator &# 39 ; s security shim 201 . further , the security officer can use the security officer keyset 271 and the selected protection suite to instruct the tag &# 39 ; s security shim 202 to generate a tag response keyset . the security shim 202 then generates random numbers for use as the tag response keyset , stores the tag response keyset at 274 , and sends the tag response keyset to the interrogator &# 39 ; s security shim 201 . using the security officer keyset and the selected protection suite , the security officer can also instruct the tag &# 39 ; s security shim 202 to invalidate all of the keysets that are currently stored in the table 270 , including the security officer keyset 271 . this is a two - step procedure . first , the security officer sends a message instructing the tag &# 39 ; s security shim 202 to invalidate all of the local keysets stored in table 270 . the security shim 202 then sends back a message containing a random number . the interrogator &# 39 ; s security shim 201 then increments the random number by 1 modulo 2 96 , and sends the result to the tag &# 39 ; s security shim 202 . the security shim 202 checks the incremented value and , if it is correct , the security shim 202 invalidates all of the keysets stored in the table 270 . using the security officer keyset 271 and the selected protection suite , the security officer can optionally install additional access control objects in the tag . for example , the security officer can optionally install one or more additional security officer access control objects in the list 211 , such as the certificate shown in broken lines at 220 . in addition , the security officer can optionally install one or more udb access control objects in the list 226 , such as those shown in broken lines at 227 and 231 . when the security officer installs an additional access control object 220 in the list 211 , the tag access rights for that additional object cannot be greater than the tag access rights of the existing access control object that was used to create the security officer keyset being used by the security officer . the security officer can view access control objects already installed on the tag , by sending a message that requests a list of the installed objects . in response , the tag will return a list containing the “ subject name ” field from the digital certificates in each of the access control objects currently installed in each of the lists 211 and 226 on the tag . the security officer can use the security officer keyset 271 and the selected protection suite to optionally remove any of the access control objects that are already installed in either of the lists 211 and 226 , except for the access control object 210 containing the root certificate 212 . the procedure for removing an access control object is similar to that for invalidating the keysets in table 270 . in particular , the security officer sends a request that a particular access control object be deleted , and the security shim 202 in the tag returns a random number . the security officer then increments the random number by 1 modulo 2 96 , and returns the result . the tag &# 39 ; s security shim 202 checks the incremented result and , if it is correct , the security shim deletes the specified access control object . the tag 16 maintains a not - illustrated log of all attempts to authenticate to or access the tag , including not only successful attempts , but also unsuccessful attempts . fig1 is a diagram showing three different sites 701 , 702 and 703 that are geographically spaced from each other . for the purpose of this discussion , it is assumed by way of example that the site 701 is a manufacturer &# 39 ; s facility , that the site 702 is a shipping hub , and that the site 703 is a customer &# 39 ; s facility . products manufactured at the site 701 are loaded into a container 704 , and the previously - described tag 16 is physically attached to the container 704 . the container 704 with the tag 16 will be shipped by truck from the manufacturer &# 39 ; s site 701 to the shipping hub 702 , where the container 704 will be switched from the original truck to a further truck . the container 704 with the tag 16 will then be transported by the further truck from the site 702 to the customer &# 39 ; s site 703 , where the products will be removed from the container . the site 701 has an interrogator 706 , the site 702 has an interrogator 707 , and the site 703 has an interrogator 708 . the interrogators 706 - 708 are each identical to the interrogator 12 that was described earlier , but have been given different reference numerals in fig1 so that they can be separately identified . the interrogators 706 - 708 are operatively coupled by the network 18 , which has already been discussed above . the site 701 has a person 711 who serves as a security officer ( so ), the site 702 has a person 712 who serves as a security officer , then the site 703 has a person 713 who serves as a security officer . with reference to fig5 and 14 , it is assumed for the purpose of this discussion that , when the tag 16 is attached to the container 704 at site 701 , the access control object 210 containing root certificate 212 has already been installed in the tag 16 by the tag owner . it is also assumed that , at that time , no other access control objects have been installed in either of the lists 211 and 226 , and that the keysets in table 270 have not yet been established . the security officer 711 at the site 701 uses the interrogator 706 to validate to the tag 16 , in the manner discussed above in association with fig1 . as explained above , this results in the selection of a protection suite ( fig7 ), and the generation of the security officer keyset 271 . the security officer 711 then proceeds to interact with the tag in order to also establish the read - only keyset 272 , the read / write keyset 273 and the tag response keyset 274 . the security officer 711 then distributes the read - only keyset 272 and the tag response keyset 274 to other not - illustrated persons at the site 701 who have operator status ( table 2 ). further , the security officer 711 distributes the read - only keyset 272 , the read / write keyset 273 and the tag response keyset 274 to other not - illustrated persons at the site 701 who have administrator status . this distribution of keysets will normally occur electronically under a secure protocol , but in some situations the keysets may be distributed in some other manner . for example , the binary values in a keyset could be converted into a printable format ( for example base 64 or base 32 ), and then printed out . the printed information could then be given to a user ( such as the user 24 in fig1 ) who would then manually enter the information into an interrogator ( for example using the manual keypad 66 of the handheld interrogator 13 ). the security officer 711 then installs two additional security officer access control objects in the list 211 . one of these is the access control object 220 . if the tag receives a communication from the security officer 712 at site 702 , the tag can use the certificate 221 in the object 220 to authenticate the security officer 712 . the third access control certificate in the list 211 is not shown in fig5 , but if the tag receives a communication from the security officer 713 at site 703 , the tag can use the third access control object to authenticate the security officer 713 . the security officer 712 at site 702 will be provided with a security officer certificate that corresponds to the certificate 221 in the access control object 220 , and that is similar in type to the security officer certificate 301 . the security officer 713 at site 703 will be provided with a further security officer certificate that corresponds to the certificate in the third access control object in the list 211 , and that is similar in type to the security officer certificate 301 . the security officer 711 may also optionally install one or more udb access control objects in the list 226 , for respective udb recipients . for the purpose of the exemplary situation being discussed here , it is assumed that the security officer 711 installs the udb access control object 227 , and that the certificate 225 in this object indicates a udb recipient 721 is to receive udb information . further , it is assumed that the security officer 711 installs the udb access control object 231 , and that the certificate 230 in this object indicates that a udb recipient 722 is to receive udb information . in this example , the udb recipients 721 and 722 are each a person or entity that does not fall within any of the four security levels listed in table 2 . the keysets in table 270 can remain in effect so long as the tag 16 remains at the site 701 , unless local security policy specifies that they should be invalidated and replaced sooner . it is assumed for the sake of this discussion that the keysets in table 270 are permitted to remain in effect so long as the tag is at the site 701 . while the tag 16 is at the site 701 , persons with operator status or administrator status can interact with the tag 16 . for example , a person with administrator status may install on the tag 16 a manifest ( inventory ) of the products that have been loaded into the associated container 704 . eventually , when the truck carrying the container 704 and tag 16 is ready to depart the site 701 , the security officer 711 uses the security officer keyset 271 to instruct the tag 16 to invalidate all four of the keysets 271 - 274 that are stored in table 270 . alternatively , the departure gate from the site 701 could be a choke point having an interrogator or reader that automatically invalidates the keysets in table 270 on every tag departing the site 701 . the container 704 with tag 16 will then be transported by the truck to the shipping hub site 702 . after the container 704 and tag 16 arrive at the site 702 , the security officer 712 at that site will use the interrogator 707 to authenticate to the certificate 221 in the tag 16 , using the technique described above in association with fig1 . this will result in the selection of a protection suite for use at the site 702 , and also the creation of a unique security officer keyset that will be stored in the tag at 271 , and used by the security officer 712 to communicate with the tag . the security officer 712 will then establish additional keysets 272 - 274 for use within the site 702 , and will distribute these keysets to other persons at the site 702 who have operator or administrator status with respect to the tag 16 . assume that , while the tag 16 is at the site 702 , the tag receives through the interrogator 707 an iso message that instructs the tag 16 to prepare and transmit udb information . the tag 16 will then create and transmit a message of the type shown at 501 in fig1 , including one udb block 506 that is based on the access control object 227 and intended for the udb recipient 721 , and a further udb block 506 that is associated with the access control object 231 and intended for the udb recipient 721 . the message 501 will also include two authentication blocks 508 , each of which is associated with a respective one of the two udb blocks 506 . interrogator 707 will forward the message 501 through the network 18 to each of the udb recipients 721 and 722 . the udb recipient 721 has a private key that corresponds to the public key 228 in the udb certificate 225 . the recipient 721 uses that private key to decrypt the random keys received at 524 and 545 in the udb block 506 and associated authentication block 508 that are intended for the udb recipient 721 . the recipient 721 can use the authentication information to authenticate the received message , and can access the udb data 516 . in a similar manner , the udb recipient 722 has a private key that corresponds to the public key 232 in the udb certificate 230 . the udb recipient 722 uses that private key to decrypt the random keys received at 524 and 545 in the udb block 506 and associated authentication block 508 that are intended for the recipient 722 . the udb recipient 722 can use the authentication information to authenticate the received message , and can access the udb data 516 . in this manner , udb recipient 721 can access the udb data in the message 501 for which the recipient 721 is the intended recipient , but not udb information intended for any other recipient , such as the udb recipient 722 . similarly , the udb recipient 722 can access the udb data in the message 501 for which the recipient 722 is the intended recipient , but not udb information intended for any other recipient , such as the udb recipient 722 . it should also be noted that , as the message 501 with encrypted udb information is passing through the network 18 from site 702 to the udb recipients 721 and 722 , the message 501 may pass through computers or systems of third parties , but those third parties will not be able to access or view any of the encrypted udb information that is present within the message . after the container 704 with the tag 16 has been shifted from the original truck to a further truck at the site 702 , and when the further truck is preparing to depart the site 702 , the security officer 712 will instruct the tag 16 to invalidate all of the keysets that are stored on the tag in table 270 . alternatively , the departure gate from the site 702 could be a choke point having an interrogator or reader that automatically invalidates the keysets in table 270 on every tag departing the site 702 . eventually , the further truck carrying the container 704 and the tag 16 will arrive at the customer &# 39 ; s site 703 . the security officer 713 at that site will use the interrogator 708 to authenticate to the third ( not - illustrated ) certificate in the list 211 , in order to select a protection suite and establish a security officer keyset that the tag stores at 271 . the security officer 713 will also establish all the additional keysets 272 - 274 for use at the site 703 , and distribute these additional keysets to appropriate persons at site 703 . after the container 704 has been unloaded , the tag 16 will be removed from the container . a person with administrator status may remove information from the tag that is viewed as sensitive or confidential , such as the manifest or inventory for the container 704 . the security officer 713 will then instruct the tag to invalidate all the keysets stored in table 270 . the security officer 713 may also remove one or more of the additional access control objects that are installed in the list 211 or in the list 226 , except that the security officer 713 cannot remove the access control object 210 containing the root certificate 212 . when the tag is eventually returned to the tag owner , the tag owner can remove and / or replace the access control object containing the root certificate 211 . the rfid system 10 of fig1 and 5 - 14 provides a high level of security for information exchanged between an interrogator and a tag , as well as information maintained in the tag , while remaining fully compatible with the existing iso 18000 - 7 standard . moreover , the security provisions are structured so that they can be implemented with just a firmware upgrade in existing interrogators and tags , without any hardware change . consequently , many existing interrogators and tags can be relatively easily and cheaply upgraded , while avoiding the expense of completely replacing them , or the expense and logistical problems involved in implementing hardware alterations . avoiding the need for extra hardware in tags also avoids the increased power consumption that would be associated with added hardware , and thus helps to avoid a reduction in the period of time that a tag can operate before its battery needs to be changed or recharged . although selected embodiments have been illustrated and described in detail , it should be understood that a variety of substitutions and alterations are possible without departing from the spirit and scope of the present invention , as defined by the claims that follow .

7Electricity

fig2 illustrates a box diagram of an example telco cpe 200 . the telco cpe 200 may include a digital network connector 210 , a digital network interface 220 , a controller 230 , a telco interface 240 , and a telco connector 250 . the digital network connector 210 is to receive a cable providing the connection to the digital network . the digital network may be a cable television ( catv ) network transmitting rf signals or may be a telephonic network transmitting optical signals . the digital network connector 210 may be an rf connector or an optical connector . the digital network connector 210 may be mounted to or be in communication with the digital network interface 220 that provides the communications link between the telco cpe 200 and the digital network . the controller 230 may control the operation of the telco cpe 200 . the controller 230 may be a processor that is in communication with a machine - readable storage medium 235 storing computer executable instructions . the machine readable storage medium 235 is illustrated as being located on the controller 230 but is not limited thereto . rather , the machine readable storage medium 235 may be located remote from the controller 230 . the machine readable storage medium 235 may be , for example , ram , rom , flash , a hard drive , a cd , a dvd , semiconductor memory or combinations thereof . the computer executable instructions may operate the controller 235 when executed by the controller 235 . the telco interface 240 may provide the communications link between the telco cpe 200 and the phone . the telco connector 250 may be mounted to or be in communication with the telco interface 240 and is to receive a cable providing the connection to the phone , either directly or via the phone wiring within the premise ( customer phone network ). the telco connector 250 may be , for example , an rj - 11 connector . the telco connector 250 may include conductive pins ( e . g ., two pins often referred to as the tip and ring pins or tip and ring conductors ) that receive signals transmitted over conductive wires ( e . g ., two wires often referred to as the tip and ring wires ) within the telephone cable . for ease of illustration , neither the conductive pins within the telco connector 250 or the telephone cable or conductive wires contained therewithin are illustrated . the operator of the digital network may initiate tests on the telco cpe 200 at defined intervals , or when a customer reports problems , in order to perform diagnostics . the tests initiated by the operator may temporarily take the line out of service and may detect faults in the telco cpe 200 . for example , a test may determine if there is a fault caused by the telco connector 250 being shorted or having power from an external source ( e . g ., from an active pots line ) being applied thereto . when a fault is detected , the operator may contact the customer or dispatch a technician to attempt to correct the fault ( e . g ., remove the connection to the active pots line ). the operator may deactivate the line until the fault can be corrected . the line may remain deactivated until the operator confirms that the fault has been corrected . furthermore , by the time the fault is detected the fault may have damaged the telco cpe 200 and require replacement thereof . rather then rely on the operator to initiate tests on the telco cpe 200 , the controller 230 may have the telco cpe 200 perform a sequence of tests to detect a fault , determine the type of fault and take necessary action ( remove the line from service ). according to one embodiment , computer implemented instructions may stored in the machine readable storage medium 235 and when executed by the controller the computer implemented instructions may cause the controller to perform a sequence of tests to detect a fault , determine the type of fault and take necessary action . the sequence of tests can be configured to have minimal service impact ( minimal down time ). the sequence of tests may be utilized to detect when a voltage from a foreign telephone service ( e . g ., analog phone service ) is being applied to the telco cpe 200 such as would happen the customer phone network was still connected to an active analog phone line ( still had pots service ). the controller 230 may deactivate the line ( remove the line from service ) when a voltage from a foreign telephone service is detected and notify the operator of the failure . a portion of the sequence of tests may continue to be performed when the line is deactivated and if the fault is removed the controller 230 may reactivate the line ( return the line to service ). the tests may include a ground fault test that is utilized to detect a ground fault associated with a short on any of the conductive pins within the telco connector 250 ( e . g ., tip conductor pin to ground , ring conductor pin to ground ). the telco interface 240 may have a ground fault detection test already implemented therein . the ground fault test may be a passive test that does not interfere with the operation of the line . the ground fault test of the telco interface 240 may measure longitudinal currents between the conductors ( e . g ., tip and ring ) in the telco connector 250 . the scaled longitudinal drive current measured may be compared to a threshold to determine if there is a ground fault . a short between either conductor ( e . g ., tip , ring ) and ground may reduce the resistance therebetween enough to cause the longitudinal current to exceed the threshold . in addition to a short causing the longitudinal current to exceed the threshold and indicate a ground fault , some instances of a foreign voltage being applied to the telco connector 250 may be the same . the polarity of the voltage applied across the conductors ( e . g ., tip and ring ) may determine whether the longitudinal current is increased past the threshold . when a fault is detected the telco interface 240 may indicate the fault in some fashion ( e . g ., set a bit in a register , issue an interrupt ). the ground fault test may not be able to determine whether the fault was caused by a short or a foreign voltage . accordingly , when a ground fault is detected additional testing should be performed to determine the cause of the fault . the controller 230 may monitor the telco interface 240 for the indication ( e . g ., bit set in register ) a ground fault exists and take action based thereon . alternatively , the telco interface 240 may be modified to act on the detection of a ground fault ( e . g ., notify the controller 230 ). since the ground fault test may only detect a foreign voltage in some instances ( based on the polarity of the voltage ), a loop current test may be performed as well to detect when current is flowing between the conductors ( e . g ., tip and ring ). the flow of current between conductors may indicate that the telco connector 250 is connected to a foreign voltage source . the loop current test may be periodically run to measure the metallic current ( current flowing between the tip and the ring , the loop current ) of the telco connector 250 . the loop current measured may be stored in a register and then compared to the threshold . the measurement may be limited to when an on - hook condition is detected ( when the telephone is on the hook and presumably not being utilized ) so as not to interfere with service . ideally there would be no current flowing between the conductors ( e . g ., tip and ring ), however if there is some type of resistance therebetween some current may flow . accordingly , the current flow test may determine if the current flow is above some threshold current . when the loop current measured is above the threshold it may be an indication that the telco connector 250 is connected to a foreign voltage source . the threshold may be set high enough so that a false indication of a foreign voltage source connection is not made . for example , a resistance of approximately 200 kω between the conductors ( e . g ., tip and ring ) may result in approximately 200 μa of current to flow therebetween . if a pots line was connected to the telco connector 250 a current of approximately 600 μa may be expected . accordingly , if the threshold was set at approximately 400 μa a determination that the loop current was above this threshold would presumably be a valid determination that the telco connector 250 was connected to a foreign voltage source ( pots line ). the threshold value may be a configurable value . the value may be programmed into the telco cpe 200 ( e . g ., the computer readable storage medium 235 ) based on the type of installation . the value may be modified by a technician during installation or may be modified remotely by an operator . if either of the first two above noted tests indicates a fault , a third test may be included that may determine the exact cause of the fault ( e . g ., if the fault is caused from a foreign voltage or resistive short ). this test may be a full line test suite such as the test suite that may typically be initiated by an operator of the digital network ( e . g ., when a customer reports a failure ). this test may take the line out of service during the running of the test . if the test confirms that there is a fault the line may remain out of service and the telco cpe 200 may notify the operator of the fault . the test may be run periodically after the line is deactivated and if the fault is removed ( e . g ., pots line is deactivated , connection is removed ) the line may be reactivated . fig3 illustrates an example high - level process flow for the telco cpe to monitor for the presence of a voltage from a foreign telephone service . the process may be performed by the controller . initially the telco cpe is powered on 300 . monitoring for an indication that a ground fault has occurred in the telco connector may continuously be performed 310 . the monitoring may be performed by the controller and may include monitoring a ground fault bit in a register within the telco interface to detect when a bit corresponding to a ground fault is activated . alternatively , the telco interface may inform the controller when a ground fault occurs . when a ground fault is detected , the controller may initiate further testing . at defined intervals , the telco interface may measure the loop current of the telco connector . the measurement intervals may be defined by the controller and the controller may instruct the telco interface to perform the measurements . the measured loop current may be compared to a threshold value 320 . the comparison of the measured value to the threshold may be performed by the controller ( or alternatively by the telco interface ). if the threshold is exceeded , the controller may initiate further testing . the telco interface may confirm that there is an on - hook condition prior to performing the loop current test . the controller may instruct the telco interface to check the on - hook condition . if the monitoring 310 detects a ground fault or the loop current test 320 determines that a threshold current is exceeded , the controller may initiate a test suite ( foreign voltage / resistive fault test ) 330 . this test 330 may determine the exact type of fault that exists in the telco connector . when the test 330 is being performed , the line will be deactivated ( e . g ., the controller may put the telco connector in a high impedance state ). if the test 330 determines that the fault is due to a foreign voltage being applied ( connected to an active pots line ) the line will be deactivated by , for example , by placing the line in a high impedance disconnect state 340 . when the line is deactivated , the controller may also notify the operator of the fault . if the test determines that there is no foreign voltage the line may be activated 350 . it should be noted , that if the test determines that a foreign voltage is present the test may be rerun at some defined interval . during the rerunning of the test , if a determination is made that the foreign voltage is no longer present the line may be reactivated . fig4 illustrates an example detailed process flow for the telco cpe to monitor for the presence of a voltage from a foreign telephone service . initially the telco cpe is powered on and the line is activated 400 . after the telco cpe is powered on and the line is activated , the controller may initiate the process by performing passive tests that do not effect the line status . the first test may be to continuously monitor the line for ground fault indications 401 . the second test may be to periodically check the loop current for an indication that there is a connection to an active pots line 402 . if either of these tests fails , a fault verification test suite may be initiated that requires the line to be deactivated 403 . the first test 401 may begin by monitoring the line for a ground fault 405 . this may include monitoring the status of a ground fault bit within a register in the telco interface . the telco interface may monitor the line and set a ground fault bit when a ground fault it determines a ground fault is present and the controller may monitor the ground fault bit . alternatively , the telco interface may record longitudinal currents measured for the connector and the controller may monitor the longitudinal currents recorded in the register . a determination is then made , as to whether there is a ground fault on the line 410 . if there was not a ground fault ( 410 no ), then the monitoring 405 is continued . if there was a ground fault detected ( 410 yes ) then the line may be disconnected 450 . in order to ensure that the ground fault was accurately detected the ground fault may be checked again after some delay 415 . the delay may be implemented by the controller or alternatively may be implemented by the telco interface . a determination is then made as to whether the ground fault still exists 420 ( e . g ., whether the ground fault bit is still set ). if the ground fault is no longer present ( 420 no ), then the monitoring 405 is continued . if the ground fault is still detected ( 420 yes ), then the fault verification test may be initiated 403 . the second test 402 may begin by checking an on - hook condition of the line 425 . an on - hook condition indicates that the customer is not utilizing the line and testing can be performed with interrupting service . the telco interface may determine when the line has a valid an on - hook condition and may set a valid on - hook bit in a register and the controller may monitor the on - hook bit . alternatively , the telco interface may record loop currents and / or voltages measured for the connector and the controller may monitor the voltages and / or loop currents recorded in the register . the controller may instruct the telco interface to make the on - hook determination or to measure and record the voltages and / or loop currents necessary to make an on - hook determination . a determination is then made , as to whether the line has an on - hook condition 430 . if the line does not have a valid on - hook condition ( 430 no ), then a delay interval is initiated 445 before the on - hook status is again checked 425 . the delay interval may be a period of time between test intervals ( e . g ., 60 seconds ). the delay interval may be set by initiating a counter . the delay may be implemented by the controller ( or alternatively may be implemented by the telco interface ). if the line has a valid on - hook status ( 430 no ), then the loop current is measured 435 . the loop current may be measured by the telco interface and stored in a register . the telco interface may make the measurements when instructed by the controller . a determination is then made as to whether the loop current measured exceeds some threshold 440 . the determination may be made by the controller ( or alternatively by the telco interface ). if it is determined that the loop current does not exceed the threshold ( 440 no ), then the delay interval is initiated 445 before the on - hook status is again checked 425 . if it is determined that the loop current exceeds the threshold ( 440 yes ), then the fault verification test may be initiated 403 . the fault verification test 403 may begin by disconnecting the line from service ( deactivating the line ) 450 . after the line is disconnected , the controller may initiate a test suite to determine if a fault exists and if a fault exists what type of fault it is 455 . a determination is made as to whether a foreign voltage fault occurred 460 . if a foreign voltage fault occurred ( 460 yes ), the line may remain deactivated and the controller may communicate the fault to a network operator 470 . after a delay interval 465 , the test suite may be rerun 455 . the delay interval may be set by initiating a counter . the delay may be implemented by the controller ( or alternatively by the telco interface ). the delay may be a configurable / programmable value . if there is no foreign voltage fault ( 460 no ), the line may be reactivated 475 . by retesting the telco cpe at defined intervals after a foreign voltage fault is found , it enables the telco cpe to be put back in operation if the fault is corrected . for example , if the customer removes the telco cpe from an active pots line after the line is deactivated the line may be reactivated . although the disclosure has been illustrated by reference to specific embodiments , it will be apparent that the disclosure is not limited thereto as various changes and modifications may be made thereto without departing from the scope . reference to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure or characteristic described therein is included in at least one embodiment . thus , the appearances of the phrase “ in one embodiment ” or “ in an embodiment ” appearing in various places throughout the specification are not necessarily all referring to the same embodiment . the various embodiments are intended to be protected broadly within the spirit and scope of the appended claims .

7Electricity

the above description is given by way of example , and not limitation . given the above disclosure , one skilled in the art could devise variations that are within the scope and spirit of the invention disclosed herein , including various ways of facilitating real estate transactions held as a tic , especially through reit - type transactions . further , the various features of the embodiments disclosed herein can be used alone , or in varying combinations with each other and are not intended to be limited to the specific combination described herein . thus , the scope of the claims is not to be limited by the illustrated embodiments . referring now to the figures and initially to fig1 , there is shown a method 10 for facilitating the conversion of a tic real property interest to reit status as contemplated by the present invention . specifically , fig1 depicts such conversion being made through an upreit - type process 10 . according to such method 10 , there will be provided a newly formed reit 12 which will be established via conventional means , such as through an initial public offering and the like . concurrent with the formation of the reit 12 will be the formation of an operating partnership ( op ) 14 . per conventional reit - type transactions , the reit 12 will most likely provide cash to the op 14 in return for a general partnership interest in op 14 . to acquire a real property interest , and in particular real estate held as a tic 16 , the op 14 will engage in a separate transaction whereby limited op partnership units ( lopu ) will be exchanged for a tic interest . advantageously , such transaction thus enables the holders of tic interests with means to convert a tic interest for a specific type of instrument , and in particular lopu . thereafter , per conventional reit - type transactions , the former holder of tic interest 16 can exchange the lopu for reit shares . referring now to fig2 , there is shown a downreit - type transaction by which property held as a tic and / or a tic interest can be converted to marketable reit shares . as illustrated , the process 20 centers around an established reit 22 , as opposed to a newly formed reit 12 depicted in fig1 . per conventional practices , the established reit 22 will create a separate op 24 and , per conventional reit practice , will typically involve the creation of an op 24 designed for the acquisition for a specific property , which in this case will involve property held as a tic . the established reit 22 and op 24 will engage in a transaction whereby cash and / or reit shares are exchanged for an op interest . thereafter , the op 24 will enter into a transaction with the tic and all the property owners whereby the latter &# 39 ; s interest will be exchanged for lopu . the lopu may then be converted by the tic interest holder 26 for reit shares per conventional transactions known in the art . accordingly , fig2 represents a process 20 whereby the downreit - type transaction may be readily applied to facilitate the liquidity of a tic interest . referring now to fig3 , there is shown a generalized process 30 which may be deployed to facilitate the ability of a property held as a tic to be integrated as part of a 1031 exchange 32 and thereafter later integrated as part of a standardized reit - type transaction to thus ultimately provided the holder of the tic interest with means to ultimately liquidate that interest in known , established financial markets and transactions . as illustrated , the process 30 essentially involves a standard 1031 property exchange 32 which involves the property held as a tic 34 . in this regard , such transaction merely involves a like kind exchange of property that merely involves property held as a tic , as is known and accepted practice . once having been exchanged as part of a 1031 exchange , the tic - held property 34 may thereafter ultimately have the tic interests converted to reit shares via those processes discussed above in relation to fig1 and fig2 , namely , through either an upreit or downreit transfer . as will be understood , in such process 30 , consideration will have to be given to avoid the step transaction and , as presently believed , will generally involve at least a two year holding period at valuations at the time of transfers . nevertheless , processes depicted in fig3 shows yet another way how a property held as a tic may not only be utilized as part of a 1031 exchange , but may also ultimately become integrated in a transaction involving either an upreit or downreit transaction that ultimately provides liquidity for the holder of the tic interest . as a consequence , property held as a tic can thus be integrated within the currently - existing framework by which reits can own and make other transactions related to real estate . along these lines , it is believed that such transaction will advantageously allow real estate held as a tic , and in particular those types of properties with multiple tenants , to liquidate their interests without being constrained by existing tic arrangements , and in particular large tic arrangements that include over ten investors . along these lines , it is believed that the transactions of the present invention will be well suited for tic arrangements for any number of tic interests , but will be extremely well suited for properties held from between 8 to 35 tenant in common interests . along these lines , it is considered especially advantageous for tic - held properties having between 15 to 35 tic interests , and more highly preferred for properties having from 20 - 35 tic interests , and in the most highly preferred applications tics having from 25 - 35 and 30 - 35 tic interests . additional modifications and improvements of the present invention may also be apparent to those of ordinary skill in the art . thus , the particular combination of parts and steps described and illustrated herein is intended to represent only certain embodiments of the present invention , and is not intended to serve as limitations of alternative devices and methods within the spirit and scope of the invention . along these lines , it will be well understood that the transactions discussed herein may be applicable for virtually all types of reits , whether publicly or privately held , and may involve an ultimate exchange of tic interests for preferred lopu or any other type of instrument that may be convertible to other instruments and the like .

6Physics

fig2 a shows the preferred configuration of the digital agc system disclosed . the system of fig2 a can be divided in two main blocks : an ac - to - dc converter 10 and a vga 8 . the vga 8 comprises three main subunits : an a / d converter 12 , a digital control circuit 14 with a register 18 , and a programmable - gain amplifier ( pga ) 16 . the ac - to - dc converter circuit 10 provides a dc control voltage vc having a direct , logarithmic relationship to input signal vi ( vc becomes larger as vi increases in amplitude , and vc becomes smaller as vi decreases ). the a / d converter 12 converts control voltage vc to a 5 - bit binary code ni , representing the amplitude of input signal vi . the binary code ni is then loaded to the output of register 18 by the digital control circuit 14 , and a binary code ci is presented to the digital control input of the pga 16 . because the binary code ci ( equivalent to ni ) has a direct relationship to vi , the pga 16 must obey an inverse control law such that , for example , binary code 11111 ( corresponding to a large value of vi ) sets the gain of the pga to minimum , while binary code 00000 ( corresponding to a small value of vi ) sets the gain of the pga to maximum . in general , a large input signal vi will cause the gain of the pga 16 to decrease , and a small input signal vi will cause the pga gain to increase . the same outcome would result if the pga control law was direct , and the relationship between ni ( or vc ) and vi inverse . the relationship between the gain of the pga 16 and the input signal vi can be formulated using mathematical expressions . control voltage vc is a function of vi , i . e ., vc = f ( vi ), and the gain ( gain ) of the pga ( the control law ) is a function of vc , i . e ., gain = g ( vc ). also , vo = gain , vi . to maintain vo = constant ( k ) for any input signal vi , it is necessary to satisfy the following equations : where gain ( db ) is the pga gain expressed in db and k1 is a constant . if vc is chosen to be a logarithmic function of vi , vc = k2 * log ( vi ), then log ( vi )= vc / k2 , and substituting in equation ( 1 ) above where k2 and k3 are constants . in other words , if the pga control law is exponential ( the gain is linear in decibels ) and vc is a logarithmic function of vi , the relationship between the pga gain and vc can be linear . this can be accomplished by using a standard , linear a / d converter 12 between the signal vc and the pga 16 , as shown in fig2 a . an alternative solution would be to combine a pga obeying a linear control law with an a / d converter having a non - linear , exponential output / input characteristic . the relationship between the pga gain and vc would still be linear and equation ( 2 ) would still be satisfied . the equation vo = k is satisfied for any function vc = f ( vi ), provided that the pga control law is gain = g ( vc )= invf ( vc ), where invf ( vc ) is the inverse function of f ( vi ). in the example hereinabove , logarithmic and exponential functions were chosen for vc and gain , respectively . alternatively , suppose that vc is chosen to be a linear function of vi . if the agc dynamic range is about 40 db , for example , the range of vi can vary by a factor of about 100 , say from about 10 mv to about 1v . this implies that the a / d converter has to resolve a 1v range in 10 mv steps ( at least 100 steps ) to accurately control the pga gain and keep vo constant , which would require a more expensive 7 - bit converter ( 128 steps ). on the other hand , if vc is compressed logarithmically as a function of vi , a small signal and a large signal will generate comparable increments that can be quantified sufficiently with only a 5 - bit a / d converter , thus reducing the system cost . alternatively , signal vc could be a linear function of vi and the compression would be accomplished by a logarithmic type a / d converter ( the digital output is a logarithmic representation of the input signal ). the resolution required in this case would still be 5 bits . the agc system shown in fig2 a is an open - loop system ( the control voltage vc is not derived as a function of the output vo ). an alternative closed - loop configuration is shown in fig2 b . the ac - to - dc converter 10 is connected to the output voltage vo and derives the control voltage vc as a function of vo vc = f ( vo )!. such a closed - loop system can be described mathematically by a linear differential equation , provided that vo and vi are expressed in decibels ( db ). with the same assumptions made for the function vc and the pga control law in the open - loop configuration , a solution to the equation exists , but the solution in general is not satisfied because the pga gain varies in discrete steps as a function of vc . for example , suppose that the solution required to satisfy the differential equation for a given constant input vi is a value of gain = 13 . 5 db . because the pga gain can be set only in discrete steps , for instance at 13 db or 14 db , the solution will not be satisfied at either setting and therefore the pga gain will oscillate from 13 db to 14 db and vice versa . as a result , the output vo will oscillate in amplitude by 1 db , even though the input vi is constant . in general , an intermediate value between two discrete gain settings is required to satisfy the differential equation for a given input vi , and instability is introduced in the output vo of the agc . the instability can be reduced by increasing the number of gain steps of the pga for a given dynamic range of the agc , thereby reducing the amplitude variation of vo when the gain oscillates between two discrete settings . however , this countermeasure would be costly because more resolution would be required in the a / d converter , and additional circuitry would be needed in the pga and digital control circuit . the open - loop agc configuration does not suffer this drawback , and therefore , only the open - loop agc system of fig2 a will be the subject of the present discussion . two factors that can compromise the agc performance are the accuracy of the a / d converter 12 and unwanted noise present in the agc physical system . in general , an inexpensive a / d converter provides a digital output that varies by +/- 1 least significant bit ( lsb ) from the correct digital representation of an input signal . for example , if an input voltage is correctly represented by decimal 10 , the a / d converter will represent it as decimal 9 , 10 , or 11 on repeated conversion cycles . this phenomenon occurs because of unwanted noise ( digital clock noise , hum , etc .) in the internal references of the converter and the input signal to be converted , and also because the a / d converter has to approximate an input signal to the nearest digital representation available . even in a sophisticated a / d converter , it is still possible to obtain two digital representations of the same input signal on repeated conversion cycles , because the converter is only accurate to the nearest 1 / 2 lsb and unwanted noise can cause the output to oscillate between two adjacent digital values . for a given control signal vc , the converter 12 will therefore make an error up to +/- 1 lsb . since the output of the a / d converter 12 affects the gain of the pga 16 , a variation of +/- 1 lsb will result in a random amplitude variation of output signal vo by +/- 1 gain step , even if a constant signal vi is applied to the agc input . this effect is undesirable ( the output vo should be steady for a constant input vi ) and must be corrected with a digital control circuit 14 . a storage register 18 ( fig2 a ) holds the current pga gain setting ci , and for each conversion cycle a digital magnitude comparator 30 ( fig5 ) indicates whether the new reading ni , representing vc , is smaller or larger than the value ci stored in the register 18 . when the new conversion reading ni is less than the current pga gain setting ci , indicating that signal vi is decreasing , a digital counter 32 ( fig5 ) is advanced by one count and the register 18 is not updated . if this condition occurs consecutively 15 times , the counter 32 becomes full and the register 18 is updated ( making the pga gain increase ). on the other hand , when the new conversion reading ni is larger than the current pga gain setting ci , indicating that signal vi is increasing , the register 18 is updated immediately ( making the pga gain decrease immediately ) and the digital counter 32 is reset . without conflicting with the requirements of a fast attack time and a slow recovery time , this scheme ensures that random positive and negative variations in the output of the a / d converter 12 are not reflected in the pga gain setting , and therefore it improves the output stability of the agc . as described in the foregoing discussion , the complete agc system shown in fig2 a has four main components : an ac - to - dc converter 10 , shown in detail in fig3 a ; an a / d converter 12 , shown in detail in fig4 ; a digital control circuit 14 , shown in detail in fig5 a , and 6b ; and a pga 16 . the ac - to - dc converter 10 of fig3 a generates the control voltage vc as a function of the amplitude of input signal vi . two circuits are necessary to accomplish this function : a logarithmic amplifier 20 , which introduces a logarithmic relationship between signals vc and vi , and an envelope detector circuit 22 , which extracts the amplitude information from input signal vi and converts it to control signal vc . although fig3 a shows the logarithmic amplifier stage 20 followed by the detector circuit stage 22 , the same characteristic would be obtained for vc if the order of the two stages was reversed , as shown in fig3 b . the logarithmic amplifier 20 is a standard operational amplifier ( op - amp ) with enough closed - loop gain to cover the dynamic range of input signal vi , and with one diode d1 in the feedback circuit . the diode d1 provides a logarithmic response in the positive swing of the output waveform . ( the detector 22 is driven only by the positive half of the waveform , and therefore it is not necessary to add another diode for the negative half .) the envelope detector 22 is simply a diode d2 in series with a resistor r2 driving a capacitor c1 in parallel with a resistor r1 . the product r2 * c1 ( time constant ) controls the agc attack time and should be about 20 ms , whereas the product ri * c1 controls the recovery time and should be about 1 s to 5 s ( seconds ), depending on the functional application of the agc . control signal vc is the voltage across capacitor c1 and feeds directly to the a / d converter 12 input . the a / d converter 12 can be a simple counter - controlled type converter , as shown in fig4 . a start signal resets a 5 - bit counter 26 and initiates a 32 - step count . the outputs of counter 26 drive a digital - to - analog ( d / a ) converter 24 that generates a &# 34 ; staircased &# 34 ; linear voltage ramp as the count increases from 00000 to 11111 . the upper and lower voltage limits of the ramp represent the upper and lower limits of the a / d converter range , respectively . control voltage vc and the linear ramp are then fed to a comparator 28 . when the ramp voltage becomes greater than vc , the output of comparator 28 changes state and stops the counter 26 ; the conversion is complete and an end - of - conversion ( eoc ) digital pulse is generated . the output of the counter 26 in this state is a binary representation of input voltage vc with an error of +/- 1 lsb . the cycle is repeated by a 500 hz clock that provides a start signal every 2 ms . in an ordinary a / d converter , the conversion result normally would be loaded to a digital register by signal eoc , so that the counter 26 can be reset to start another conversion . in the present application , however , a conversion reading is not necessarily accepted as valid until it is processed by the digital control circuit 14 of fig2 a . the digital control circuit , shown in detail in fig5 mediates the transmission of data from the a / d converter 12 to the pga 16 through a 5 - bit register 18 . at the end of each conversion cycle , the control circuit decides whether the register 18 should be updated with a new reading ni . the decision process is intended to stabilize the output vo against the +/- 1 lsb variation of the a / d converter . a start signal , occurring every 2 ms , initiates a conversion cycle in the a / d converter and at the same time increments a 4 - bit digital counter 32 by one count . the digital counter 32 can be a simple 4 - bit asynchronous counter , as shown in fig6 b . when the conversion is completed and the new reading ni is available to be read , an eoc pulse is generated by the a / d converter . a magnitude comparator 30 compares the new reading ni at the output of the converter 12 to the current setting ci of the pga 16 ( the output of the register 18 ), and provides an output comp according to the following rules : comp = 0 if ni is less than ci , and comp = 1 if ni is greater than or equal to ci . the magnitude comparator 30 can be simply a digital subtractor circuit , as shown in fig6 a . assume that the agc system is at maximum gain ( no input signal vi is applied ), and suddenly a constant input vi is applied that causes vc to be 1 v . further , suppose that the expected a / d converter reading for vc = 1v is 01010 ( decimal 10 ). depending on noise present in the a / d converter internal voltage references and in signal vc ( as previously discussed ), on repeated conversion cycles the reading ni can be 01001 ( decimal 9 ), 01010 ( decimal 10 ), or 01011 ( decimal 11 ), even though vc is still equal to 1v . if ni is equal to decimal 11 on the first conversion cycle after vc = 1v , then ni is greater than the previous setting ci ( equal to 0 or 1 because no signal vi was applied to the agc and vc was 0 v ) and the output comp of the magnitude comparator 30 is set to high . the eoc pulse then loads the control comp ( high ) to the output of a d - type flip - flop 34 , which causes the output update of an or gate 38 to go high and at the same time resets the 4 - bit counter 32 . control update then causes the new reading ni ( decimal 11 ) to be loaded to the output of the register 18 , thereby decreasing the pga gain . note that the pga gain is decreased immediately as soon as a high reading ( corresponding to a large signal applied ) is detected by the control circuit . this property of the decision circuit allows the agc system to comply with the requirement of a fast attack time . if the next reading of the a / d converter is decimal 9 or 10 ( even though vc is still equal to 1 v ), the output comp of the magnitude comparator 30 goes low ( ni is less than ci ), and a logic low is loaded to the output of flip - flop 34 . in this case the counter 32 is not reset , the control update remains low , and the register 18 is not updated . in other words , if the a / d converter reads decimal 9 or 10 due to noise or inaccuracy in the a / d converter , the register 18 is not updated immediately . the 4 - bit counter 32 is allowed to increment by one step ( out of 16 steps ) every time a reading is lower than decimal 11 , but it is reset every time the reading is equal to decimal 11 . if the counter 32 is incremented by 15 steps , an output full of the counter 32 is set to high and then loaded by the next eoc pulse to the output of a d - type flip - flop 36 , which sets the output update of the or gate 38 to high and updates the register 18 ( decreasing the gain of the pga ). however , it would take 15 consecutive readings lower than decimal 11 ( in this case decimal 9 or 10 ) to update the register 18 with a value less than 11 . due to the random nature of the a / d converter error , if signal vc remains constant at 1 v ( which is the case in this analysis ) a reading of decimal 11 most likely will occur in the a / d converter within 15 consecutive conversion cycles and the counter 32 will be reset . this condition does not allow the counter 32 to become full and update the register 18 with a value lower than decimal 11 , effectively maintaining the pga gain constant for a constant input vi ( and a constant control voltage vc ), as desired . finally , suppose that the input vi is decreased in amplitude such that vc = 0 . 5 v , corresponding to an a / d reading of 00101 ( decimal 5 ). in this case , for every conversion cycle after vc is set to 0 . 5 v the new reading ni ( equal to decimal 4 , 5 , or 6 ) will be less than the pga setting ci ( equal to 11 ), and therefore the counter 32 becomes full within 15 cycles or 30 ms ( 2 ms * 15 ). this condition causes the register 18 to be updated with a lower reading and the gain of the pga to increase , as desired . note that the 30 ms delay introduced by the control circuit when reducing the gain does not compromise the speed of the agc response because the recovery time is about 1 s to 5 s , which is much larger than the 30 ms delay . the pga 16 is a digitally programmable amplifier with 32 gain steps ( in the present example ) controlled by 5 logic bits . as explained earlier in the discussion , the gain characteristic of this amplifier as a function of the digital setting is exponential , and the gain range should be greater than or equal to the agc dynamic range . if a 32 db dynamic range is expected , for example , each digital step should increase the gain by 1 db . various design alternatives can be used to enable integration of a pga in an integrated circuit , but will not be discussed in this context because they depend on the fabrication process and device manufacturer selected . although the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character -- it being understood that only preferred embodiments have been shown and described , and that all changes and modifications that come within the spirit of the invention as defined in the appended claims are desired to be protected .

7Electricity

the present invention is further explained in detail with the accompanying drawings . it comprises the steps as below . ( 1 ) determine the region of interest for numerical reservoir simulation research and create the trace file ( called “ boundary trace file ”) of the simulation region boundary . the boundary trace file comprises the number of trace points , the serial number and x , y coordinates of each trace point . the region of interest is an enclosed area formed by connecting each trace point in turn . ( 2 ) form the trace file of large - aperture fractures which influence the fluid flow , based on the geologic research . the trace file of large - aperture fractures consists of the total number of the large - aperture fractures , the serial number and aperture of each fracture , the corresponding trace point coordinates and the vertical range of simulation layers crossed by each large - aperture fracture . when the fracture trace is a curve , according to the differential principle , it can be divided into a series of line segments which is called fracture trace segments , in other words , the fracture trace curve is approximated by a series of line segments . the above 13 rows of data form a trace file of two fractures , where numfrac in the first row is the key word of the number of fractures , the following quantity 2 is the number of the large fractures ; fracture in the second row is the key word of the serial number of a fracture , the following quantity 1 is the numbering of the fracture ; aperture in the third row is the key word of the fracture aperture , the following quantity 300 shows that the fracture aperture is 300 μm ; zscope in the fourth row is the key word of the range of the simulation layers , the following first quantity 1 shows that the numbering of the uppermost simulation layer crossed by the fracture is 1 , the following second quantity 3 shows that the numbering of the lowermost simulation layer crossed by the fracture is 3 ; start in the fifth row is the key word of coordinates of the starting point of the fracture trace segment , the following three quantities are x , y and z coordinates of the starting point ; end in the sixth row is the key word of coordinates of the end point of the fracture trace segment , the following three quantities are x , y and z coordinates of the end point ; − 9999 . 9999 is an end mark of the input for the trace information of a fracture ; ( 3 ) based on the trace data of the simulation region boundary obtained in step ( 1 ) and the trace information of each fracture trace segment obtained in step ( 2 ), make an unstructured grid division using a pre - processing software of numerical simulation . the divided grids are classified into two types : non - fracture grids and discrete fracture grids , here two sides of the horizontal projection for a discrete fracture grid have to be parallel to the corresponding fracture trace segment . furthermore , the width and length of a discrete fracture grid could be designated artificially , and could be allowed to be different from each other for different grids . in general , the width of a discrete fracture grid is controlled in the range of 1 m to 2 m . if the width of a discrete fracture grid is too small , the numerical solutions will probably not be converged . if the width of a discrete fracture grid is too large , the geometric similarity criterion will not be met , therefore the rapid fluid channeling along large - aperture fractures can not be effectively characterized . the length of a discrete fracture grid is controlled within a range from 10 m to 50 m . if the length of a discrete fracture grid is too small , the convergence of numerical solutions will be influenced ; if the length of a discrete fracture grid is too large , it is difficult to represent the variation features of pressure and fluid saturation in the fractures . ( 4 ) based on the grids obtained in step ( 3 ) and the geologic research , build the static model for the numerical reservoir simulation by an interpolation method . the static model consists of the specification of geometry of computational grid ( location of grid block corners ), and of rock properties ( effective thickness , porosity , absolute permeability ) in each grid block . ( 5 ) make the hydraulic similarity treatment of the large - aperture fractures , namely , adjust the static model obtained in step ( 4 ), and modify the permeability of the grid face crossed by a fracture for each discrete fracture grid , with a formula as below : permeability =( fracture aperture ) 2 / 12 , here the unit of the fracture aperture is jam , and the unit of the permeability is darcy ( μm 2 ). ( 6 ) based on the adjusted static model in step ( 5 ), create the reservoir simulation model by the conventional modeling method . the reservoir simulation model comprises the grid geometry data ( location of grid block corners ), the reservoir rock properties , fluid physical parameters , relative permeability and capillary pressure data , positions of injection and production wells , dynamic data , process parameters and the convergence control parameters needed by solving iteratively . ( 7 ) improve the traditional dual porosity numerical simulation software to be capable of accepting the unstructured grids formed in step ( 3 ). to realize the unstructured grid simulation , one key point is to find the adjacent grids of a grid . in the traditional rectangular grid simulation , the adjacent grids of a grid are searched only in the x , y and z directions ; then , the fluid exchange volumes between the grid and its each adjacent grid are calculated based on the relevant data of these two grids . however , in the reservoir simulation of unstructured grid , the number of the surfaces of each grid is calculated according to its vertex coordinates , then the adjacent grids are found by comparing the vertex coordinates of all the grids . if a surface of grid i coincides with a surface of grid j ( namely , the vertexes of the two surfaces are identical ), the grid j will be the adjacent grid of the grid i . the calculation of directional permeabilities is also required in the unstructured grid simulation . geological modeling can only provide the permeabilities of each grid in the directions of three coordinate axes . however , in the unstructured grid numerical simulation , the connecting line between the center points of two adjacent grids is not inevitably parallel to one of the three coordinate axes ; thus , the permeability between two grids can not directly use the input value in the geological model . here , the method given by gfwenkorn and johnson is used to determine the permeability in the direction of the connecting line between the center points of two adjacent grids ( a . gfwenkorn , c . r . johnson , “ directional permeability of heterogeneous anisotropic porous media ”, spe - 788 , 1963 ). after determining the directional permeability between two adjacent unstructured grids , in the process of spacial flow items , the fluid exchange volume between the two grids is calculated by the same method as that of rectangular grid numerical simulation . another difference between the unstructured grid simulation and the rectangular grid simulation is the input mode of perforation information of wells . in the rectangular grid simulation , the perforated grids of a well are generally designated by the grid numbering ( i , j , k ) in the directions of three coordinate axes , here i , j , k denotes the grid numbering in the x , y , z directions , respectively . however , in the unstructured grid simulation , the perforated grids of a well are designated by the planar grid numbering ixy and vertical grid numbering k . ( 8 ) run the reservoir simulation model obtained in step ( 6 ) with the unstructured grid simulator obtained in step ( 7 ), as a result , the rapid fluid channeling along large - aperture fractures can be characterized effectively . fig2 shows the distribution of six intersecting fractures with large - aperture and a simulation region of a reservoir . the boundary trace of the simulation region is made up of the line segments ab , bc , cd and da . the coordinates of a , b , c and d are a ( 0 , 0 ), b ( 300 , 0 ), c ( 300 , 300 ) and d ( 0 , 300 ), respectively . the traces of six large - aperture fractures are the line segments ef , gh , ij , kl , mn and op . the coordinates of the trace points are e ( 117 . 355 , 47 . 240 ), f ( 148 . 245 , 225 . 830 ), g ( 55 . 245 , 116 . 680 ), h ( 254 . 790 , 207 . 970 ), i ( 76 . 425 , 207 . 895 ), j ( 196 . 170 , 267 . 565 ), k ( 86 . 760 , 249 . 650 ), l ( 252 . 980 , 101 . 395 ), m ( 166 . 765 , 221 . 815 ), n ( 255 . 505 , 156 . 285 ), o ( 103 . 675 , 86 . 510 ), p ( 237 . 380 , 92 . 110 ), respectively . based on the trace data of the above simulation region boundary and large - aperture fractures , grid division is made by the special grid division software . here the grids are vertically divided into three layers . the grid thickness of each layer is 5 m . the top view of the divided grids is shown in fig3 . in the static geological model , the reservoir permeability is 3 . 2 md , the porosity is 0 . 13 , the total thickness of the reservoir is 15 m , the initial oil saturation is 0 . 79 , the initial water saturation is 0 . 21 , and the formation pressure is 31 . 47 mpa . during the hydraulic similarity treatments of the large - aperture fractures ( namely , modify the permeabilities of the grid faces crossed by the large - aperture fractures ), the apertures of the fractures ef , gh , ij , kl , mn , op are 200 μm , 210 μm , 230 μm , 290 μm , 300 μm , and 310 μm , respectively ; so the permeabilities of the grid faces crossed by the fractures ef , gh , ij , kl , mn and op are 3333 . 333d , 3675 . 000d , 4408 . 333d , 7008 . 333d , 7500 . 000d , and 8008 . 333d , respectively . fig4 shows the positions of an injection well and two production wells . the injection rate of the injection well is 29 m 3 / day , and the upper limit of the bhp ( bottom hole pressure ) for the injection well is 56 mpa . the liquid rate of the production well 1 is 21 m 3 / day , and 8 m 3 / day for production well 2 . the lower limits of the bhp are 18 mpa and water cut upper limits are 0 . 98 for both the production wells . the maximum number of newton iterations in a timestep is 18 , and the maximum number of linear iterations in a newton iteration is 81 , the maximum linear convergence error is 1e - 8 , and all the other control parameters use the default values . run the above model using the unstructured grid simulator obtained in the present invention . the results show that the injected water flows quickly along the large - aperture fractures . for the production well 1 which is far away from the injection well ( 233 . 9977 m ) but communicates with the injection well by large - aperture fractures , the water breakthrough occurs soon after producing for 21 days ( the water saturation field at water breakthrough is shown in fig5 , the lighter the color is , the greater the water saturation is ; the heavier the color is , the smaller the water saturation is ). the calculated average velocity of injected water in the large - aperture fractures is up to 13 . 698 m / day ( the total length of the large - aperture fractures which lies between the injection well and the production well 1 is 287 . 667 m ). the production well 1 will hardly produce oil after 150 days ( water cut is 95 . 187 %). however , for the production well 2 which is close to the injection well ( 72 . 3897 m ), the water breakthrough occurs much later , because the calculated water breakthrough time is 1800 days . the late water breakthrough of the production well 2 is because the reservoir is a low permeability reservoir ( only 3 . 2 md ), and the production well 2 is not fractured and produces by low liquid rate ( only 8 m 3 / day ), in addition , most of the injected water is produced by the production well 1 due to the fluid channeling along large - aperture fractures . if the large - aperture fractures are treated only with the geometric similarity , and not with the hydraulic similarity , namely , only the distribution characteristics of large - aperture fractures are reflected by the unstructured grid division , while the permeabilities of the grid faces crossed by large - aperture fractures are not adjusted , all the other model parameters are the same as those of the above example . the simulation results show that the water breakthrough of the production well 2 occurs after producing for 430 days ( the water saturation field at water breakthrough is shown in fig6 , the lighter the color is , the greater the water saturation is ; and the heavier the color is , the smaller the water saturation is ). when water breakthrough occurs for the production well 1 after producing 2111 days , the production well 2 almost only produces water ( the water cut is 94 . 91 %). obviously this simulation method with only the geometric similarity treatments of the large - aperture fractures can not characterize the rapid fluid channeling along large - aperture fractures . if the large - aperture fractures are treated only by the hydraulic similarity , and not by the geometric similarity , namely , a series of zigzag grids crossed by the large - aperture fractures are used to represent the distribution of these fractures , while the unstructured grid division which could reflect distribution features of the large - aperture fractures is not made ; based on the discrete aperture fracture network geological modeling , the equivalent treatments of transmissibilitis are made for the grid faces intersected by the large - aperture fractures , and all the other model parameters are the same as those of the first example . the simulation results show that the water breakthrough of the production well 1 occurs after producing for 430 days ( the water saturation field at water breakthrough is shown in fig7 , the lighter the color is , the greater the water saturation is ; and the heavier the color is , the smaller the water saturation is ). the water breakthrough time of the production well 2 is 540 days , and the calculated average velocity of injected water in the large - aperture fractures is only 0 . 533 m / day . it is obvious that this simulation method with only the hydraulic similarity treatments of the large - aperture fractures also can not characterize the rapid fluid channeling along large - aperture fractures . the above three examples show that only in the case of simultaneously making the geometric similarity and hydraulic similarity treatments of the large - aperture fractures , the simulation results can effectively reflect the fluid channeling along large - aperture fractures .

6Physics

the present invention provides a method for generating a directed design for a physical space requiring design comprising the steps of ( a ) maintaining a main computer , wherein the main computer is capable of exchanging data with a remote computer ; ( b ) providing a means for acquiring digitally encoded signals representing an image of the physical space ; ( c ) storing the digitally encoded signals in a imaging computer storage medium ; ( d ) transmitting the stored digitally encoded signals to a design center ; ( e ) designing an interior design plan using the transmitted digitally encoded signals ; ( f ) storing the design plan in a design computer storage medium ; ( g ) transmitting the stored design plan to the main computer ; and ( h ) providing for remote computer communication link access to the stored design plan . it is contemplated that stored images may accurately represent true image measurements and dimensions . it is further contemplated that design plan may represent actual measurements and images . according to still anther embodiment of the invention , wherein the remote computer is capable of transmitting a data request to the main computer . according to still yet another embodiment of the present invention , the method further comprises the step of transmitting an order request for the design product from the remote computer to the main computer . according to a further embodiment of the invention , a plurality of vendor computers exchange product data information with the main computer . still according to another embodiment of the invention , the method is further comprising the step of displaying the design plan on the remote computer . according to another embodiment of the invention , the method is further comprising the step of displaying a plurality of design products on the kiosk , corresponding to user search criteria . it is specifically contemplated that design products may be stored in a plurality of databases , which may be independently maintained by a plurality of vendors . according to this embodiment , a user may select from a variety of displayed vendor products and styles such as in the case of kitchen design : cabinetry , countertops , fixtures , appliances and hardware . according to this embodiment , the user selection may be effected through the use of a touch screen type kiosk . according to a variant embodiment , the user selection may be effected via a keyboard , keypad or pointing device . according to another variant embodiment , the selection may be effected at the user &# 39 ; s personal home computer via an online communications link such as the internet . according to another embodiment of the invention , the remote computer is an electronic computer kiosk , wherein the kiosk is electronically linked to a main computer . according to yet another embodiment of the invention , the method is further comprising the step of transmitting the stored digitally encoded signals to the main computer . according to still another embodiment , the design center comprises a human designer . according to yet still another embodiment of the invention , the design center comprises a design computer . it is specifically contemplated that the design computer may be a computing device dedicated specifically to design function and directed design plan generation . according to an alternative embodiment of this invention , the design computer is the main computer . the design computer is capable of executing software programs facilitating generation of the design plan . according to a further embodiment of the invention , the electronic computer kiosk is located at a physical location , the location being a vendor of design products . according to a particular embodiment of the invention , the directed design is a kitchen design plan . it is specifically contemplated that this invention may be embodied in generating a design for a variety of plans including but not limited to any field requiring design such as landscaping , building , interiors , exteriors , clothing and product placement . according to a preferred embodiment of the invention , the design product is a kitchen design product . according to yet a further embodiment of the invention , the main computer stores data related to a plurality of design products . according to a preferred embodiment of this invention , the method further comprises the step of displaying data related to the design product on the remote computer . according to still yet another embodiment of this invention , the means for accepting digitally encoded signals is a digital camera . alternative imaging devices such as digitizers and scanner are specifically contemplated by the invention . according to one embodiment of this invention , conventional photographs taken of the space requiring design are scanned into digital format for transmission to the design center . according to another embodiment , a user captures images using a portable cell phone based imaging device . according to still another embodiment of this invention , the digitally encoded signals encode a two - dimensional image of the space requiring design , reflected as the site - plan dimensions . according to one embodiment of this invention , the actual dimensions of the image represented by the digitally encoded signals are calculated as a scale factor , wherein the scale factor has units of length per pixel and is obtained by ( a ) establishing a known distance in the image , the known distance having a first point and an end point , and dividing the known distance by the number of pixels represented on the straight line between the first point and the end point of the known distance ; ( b ) measuring a pixel distance on the image , the pixel distance having a first pixel and a last pixel , wherein the pixel distance is the number of pixels represented on the straight line between the first pixel and the last pixel ; and ( c ) multiplying the pixel distance by the scale factor . the present invention specifically contemplates alternative methods of photogrammetry and pixel analysis in order to transform various two - dimensional images of the space into specific dimensions . the present invention contemplates that displays may include videographic audio representations in a real - time fashion , including streaming video and audio . the present invention further provides the method further comprising the step of displaying the design plan on a virtual reality device . in a particular embodiment , the virtual reality device is a device worn by a user . in a most preferred embodiment of this invention , the virtual reality device is a headset . it is also specifically contemplated that smells may be introduced into the virtual reality device , thus providing a user with a more complete sense of environment . according to one such embodiment , a user wearing a virtual reality headset can experience a virtual kitchen complete with the aromas of cooked food . the present invention also provides system for generating a directed design , the system comprising ( a ) a main computer , wherein the main computer is capable of exchanging data with a remote computer ; ( b ) a means for accepting digitally encoded signals representing an image of a physical space requiring design ; ( c ) a means for storing the digitally encoded signals in a imaging computer storage medium ; ( d ) a means for transmitting the stored digitally encoded signals to a design center ; ( e ) a designer for designing an interior design plan using the transmitted digitally encoded signals ; ( f ) a means for storing the design plan in a design computer storage medium ; ( g ) a means for transmitting the stored design plan to the main computer ; and ( h ) a means for providing for remote computer communication link access to the stored design plan . the present invention also provides a computer program product to effectuate the provided method . the present invention may be practiced on a single computer , preferably using a client - server architecture . however , because the present invention preferably involves storage and / or searching of large numbers of graphical images of design products , the present invention preferably is implemented on a client - server system , wherein at least one client computer and at least one server computer is connected over a network , such as the internet . the internet is a worldwide - decentralized network of computers having the ability to communicate with each other . the internet has gained broad recognition as a viable medium for communicating and for conducting business . the world - wide web ( web ) is comprised of server - hosting computers ( web servers ) connected to the internet that have hypertext documents ( referred to as web pages ) stored there within . web pages are accessible by client programs ( e . g ., web browsers ) utilizing the hypertext transfer protocol ( http ) via a transmission control protocol / internet protocol ( tcp / ip ) connection between a client - hosting device and a server - hosting device . while http and web pages are the prevalent forms for the web , the web itself refers to a wide range of protocols including secure hypertext transfer protocol ( https ), file transfer protocol ( ftp ), and gopher , and web content formats including plain text , hypertext markup language ( html ), extensible markup language ( xml ), as well as image formats such as graphics interchange format ( gif ) and joint photographic experts group ( jpeg ). a website is conventionally a related collection of web files that includes a beginning file called a “ home ” page . from the home page , a visitor can access other files and applications at a web site . a large web site may utilize a number of servers , which may or may not be different and which may or may not be geographically dispersed . for example , the web site of the international business machines corporation ( www . ibm . com ) includes thousands of web pages and files spread out over multiple web servers in locations worldwide . a web server ( also referred to as an http server ) is a computer program that generally utilizes http to serve files that form web pages to requesting web clients . exemplary web servers include international business machines corporation &# 39 ; s family of lotus domino ® servers , the apache server ( available from www . apache . org ), and microsoft &# 39 ; s internet information server ( iis ), available from microsoft corporation , redmond , wash . a web client is a requesting program that also generally utilizes http . a browser is an exemplary web client for use in requesting web pages and files from web servers . a web server waits for a web client , such as a browser , to open a connection and to request a specific web page or application . the web server then sends a copy of the requested item to the web client , closes the connection with the web client , and waits for the next connection . http allows a browser to request a specific item , which a web server then returns and the browser renders . to ensure that browsers and web servers can interoperate unambiguously , http defines the exact format of requests ( http requests ) sent from a browser to a web server as well as the format of responses ( http responses ) that a web server returns to a browser . exemplary browsers that can be utilized with the present invention include , but are not limited to , netscape navigator ® ( america online , inc ., dulles , va .) and internet explorer ® ( microsoft corporation , redmond , wash .). browsers typically provide a graphical user interface for retrieving and viewing web pages , applications , and other resources served by web servers . as is known to those skilled in this art , a web page is conventionally formatted via a standard page description language such as html , which typically contains text and can reference graphics , sound , animation , and video data . html provides for basic document formatting and allows a web content provider to specify anchors or hypertext links ( typically manifested as highlighted text ) to other servers . when a user selects a particular hypertext link , a browser running on the user &# 39 ; s client device reads and interprets an address , called a uniform resource locator ( url ) associated with the link , connects the browser with a web server at that address , and makes a request ( e . g ., an http request ) for the file identified in the link . the web server then sends the requested file to the client device , which the browser interprets and renders within a display screen . one of skill in the art will appreciate that the present invention may be embodied as methods , data processing systems , and / or computer program products . accordingly , the present invention may predominantly take the form of a hardware embodiment , a predominantly software embodiment running on general - purpose hardware or an embodiment predominantly combining software and hardware aspects . furthermore , the present invention may take the form of a computer program product on a computer - usable storage medium having computer - usable program code embodied in the medium . any suitable computer readable medium may be utilized including hard disks , cd - roms , optical storage devices , or magnetic storage devices . computer program code for carrying out operations of the present invention may be written in an object oriented programming language such as java ®, smalltalk or c ++. the computer program code for carrying out operations of the present invention may also be written in conventional procedural programming languages , such as “ c ”, javascript , visual basic , tsql , pen , or in a functional ( or fourth generation ) programming language such as lisp , sml , or forth . in addition , microsoft active server pages ( asp ) technology and java server pages ( jsp ) technology may be utilized . php is a widely used general - purpose scripting language that is especially suited for web development and can be embedded into html . the program code may execute entirely on one or more web servers and / or application servers , or it may execute partly on one or more web servers and / or application servers and partly on a remote computer ( i . e ., a user &# 39 ; s web client ), or as a proxy server at an intermediate point in the network . in the latter scenario , the remote computer may be connected to the web server through a lan or a wan ( e . g ., an intranet ), or the connection may be made through the internet ( e . g ., via an internet service provider ). the present invention is described below with reference to block diagram and flowchart illustrations of methods , apparatus ( systems ) and computer program products according to an embodiment of the invention . it will be understood that each block of the block diagrams and / or flowchart illustrations , and combinations of blocks , can be implemented by computer program instructions . these computer program instructions may be provided to a processor of a general purpose computer , special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions , which execute via the processor of the computer or other programmable data processing apparatus , create structures for implementing the functions specified in the block diagram and / or flowchart block or blocks . these computer program instructions may also be stored in a computer - readable memory that can direct a computer or other programmable data processing apparatus to function in a particular manner , such that the instructions stored in the computer - readable memory produce an article of manufacture including instructions which implement the function specified in the block diagram and / or flowchart block or blocks . the computer program instructions may also be loaded onto a computer or other programmable data processing apparatus to cause a series of operational steps to be performed on the computer or other programmable apparatus to produce a computer implemented process or method such that the instructions which execute on the computer or other programmable apparatus provide steps for implementing the functions specified in the block diagram and / or flowchart block or blocks . one of skill in the art will appreciate that a database is a collection of data that is organized in tables or other conventional forms of organization . a database typically includes a database manager and / or database server that facilitates accessing , managing , and updating data within the various tables of a database . exemplary types of databases that can be used to implement the product database of the present invention include relational databases , distributed databases ( databases that are dispersed or replicated among different points in a network ), and object - oriented databases . relational , distributed , and object - oriented databases are well understood by those of skill in the art and need not be discussed further herein . since the present invention preferably includes large quantities of design products such as kitchen design products in the preferred embodiment of the present invention , a database system that is particularly adapted for storing and searching large numbers of products , such as oracle 8i visual image retrieval ( vir ) available from oracle corp ., redwood shores , calif . may be used . see the oracle 8i visual information retrieval data sheet , march 1999 . however , other databases may be used , including ibm &# 39 ; s db2 ® database , microsoft &# 39 ; s sql server database , and database products from sybase and computer associates . the database server is an application server that operates as a “ middleman ” server between the web server and the plurality of databases . the database server generally includes program code and logic for retrieving data from the databases ( and from sources external to the web site ) in response to requests from the web server . the database server preferably is adapted for searching and storing of large numbers of kitchen design products , such as oracle vir . other commercial database servers that may be utilized as a database server in the illustrated system include microsoft &# 39 ; s sql server , ibm db2 ® universal database server , and the websphere ® net . commerce server , the latter two being available from international business machines corporation , armonk , n . y . virtual reality is the simulation of an environment that can be represented in a three - dimensional display representing width , height , and depth . a virtual reality device can provide a user a user with the ability to interact with the virtual simulated environment . such interaction may include full real - time motion with sound and possibly with tactile and other forms of feedback . the simplest form of virtual reality is a three dimensional image that can be explored interactively at a personal computer , usually by manipulating keys or the mouse so that the content of the image moves in some direction or zooms in or out . more sophisticated efforts involve such approaches as wrap - around display screens , actual rooms augmented with wearable computers , and joystick devices that provide a user with the “ feel ” of display images . a virtual reality device can simulate a real environment such as the interior of a building or a design space , such as a kitchen . moreover , the device can display the environment in a variety of formats and from a variety of angles . changing certain parameter such as the cabinet style in a kitchen will result in the changed display , giving the user the ability to “ virtually ” preview and tryout various combinations or environmental changes before actually performing physical changes in a real space . virtual reality devices have been widely described including in u . s . pat . no . 5 , 991 , 085 and references therein . one of skill in this art will appreciate that a kiosk is generally a terminal for performing tasks , which may be computerized , and which exists in a specific physical space . in the present invention , a kiosk is defined as a device capable of digitally transmitting digitally encoded signals to a main computer . digitally transmitting is the act of sending images , information , or other materials electronically from a device capable of sending digitally encoded signals to a device capable of receiving the signals , in a digital format . digital formats are known to those skilled in the art and will not be further discussed . similarly , a digitally encoded signal is an electronic signal in digital format . a main computer is a device capable of sending and receiving digitally encoded signals from kiosks . a main computer for purposes of the present invention has other capabilities , which may include accessing a database of kitchen design products , routing digitally - encoded signals to other devices , or serving as general electronic storage media . general electronic storage media is well known to those skilled in this art . again , the present invention may be practiced using a single main computer , or using a series of electronically linked computers , each having separate and distinct information . directed design is the practice and field of arranging and positioning fixtures in an efficient and aesthetically pleasing orientation . kitchen design is the practice and field of arranging kitchen areas in an efficient and aesthetically pleasing manner . design products are the elements and fixtures particular to a particular design application . for example , in the preferred embodiment , kitchen design products are known to those skilled in the art and are all those elements which found in a kitchen area , including but not limited to refrigerators , stoves , sinks , automatic dishwashers and other functional appliances ; cabinets , counter - tops , cabinet doors , and other structural elements ; tables , chairs , lighting fixtures , flooring material , and other decorative elements and furnishings . one of skill in the art will appreciate that photogrammetry generally refers to relativity of dimensions and measurements . in the present invention , photogrammetry is the practice of determining the physical dimensions of objects that appear in a digital image . in order to use photographs in a computer environment , they must be converted into digital format . there are several ways to convert photographs into digital format ; they can be obtained directly from a digital camera or scanned into the computer using a scanning device . once in digital format , photos can be enhanced for printing , or imported into specific software for dimension extraction ( photogrammetry ). specific areas in the photo can then be highlighted . thus , photogrammetry for purposes of this invention is the process of extracting dimensions from two - dimensional photographs . the object ( s ) from which dimensions need to be extracted must appear in more than one photograph and viewed from different angles , most preferably from ninety - degree intervals . also known as photogrammetry in the art , photogrammetry techniques thus allow conversion of images of an object into a 3d model . using a digital camera with known characteristic ( lens focal length , imager size and number of pixels ). a digital image is an image in digital format , defined by a rectangular matrix of pixels . a pixel is a single point on imaging media , which may include computer monitors , television screens , or other devices capable of displaying an image in digital format . conventionally , in photogrammetry , images of an existing structure or location are captured ; the images are then scanned into a computer . from the scanned images the computer can dimension the building to within an accuracy of a few millimeters . the dimensions of objects in the digital image can be determined directly by examining and converting corresponding pixel dimensions of the image by means of an appropriate scale factor . a pixel dimension is the distance between two pixels , measured as the number of pixels represented by the straight line between to pixels , and is therefore related to the real dimension of the image according to the following relationship : real dimension =( pixel dimension ) ( scale factor ). the scale factor is defined by a set of intrinsic parameters , which may be unique to each image , and has units of length / pixel . turning to fig1 shows a flow chart indicating an exemplary interaction of a client at a kiosk 1 for kitchen design . it is understood that the screens and options may be designed in a variety of ways providing a variety of options . the kiosk 1 presents the client / user with a screen of options including information about directed design at 110 , receiving a digital camera at 120 , kitchen design 130 , browsing catalogues for kitchen design products at 141 and for a quick price quote on selected items at 140 . in addition the client / user has the option to login to an already existing account at 111 . if the client / user is already a member , having previously established an account , he can access stored data 113 or check on other project information such as design products selected for the project , which are associated with the account 114 or store additional data or information such as digital images 115 . the data may be reviewed with a sales representative 126 or with a designer 127 . if product has been selected the client / user may confirm the purchase 128 . if the client / user opts to receive a digital camera 120 they create an account , thereby gaining membership 320 . entry of design requirements is stored at 124 and may be sent to a remote computer via electronic mail 125 . if the client elected to browse for design products at 141 they may also elect to display visual images of the products at the terminal 142 and select design products and confirm for ordering at 128 . purchase is complete and the transaction closed 145 . if a client user has elected to receive a quotation for selected design product 140 , the information is stored in the member account 143 and the quote is delivered 144 either to the kiosk or via mail , e - mail , telephone or other client / user selected means . fig2 details the interaction of the client / user who elects to receive a digital camera 120 in the example described in fig1 . account information is collected and stored 320 thereby creating membership . this information includes personal information 220 and credit card information 221 and may include a membership fee . live help is available at 222 at which time the client / user may elect to receive account information via electronic mail or other delivery means such as telephonic or hard copy via mail 231 . the selected digital camera is issued for the account and delivered to the client / user at the kiosk or by other conventional delivery means such as through the mail 232 . the client / user captures digital images of the space requiring design and transmits the images to the designer 251 either using his home personal computer 233 or at a kiosk 234 or by conventional mail delivery of the camera or the memory card there from 235 . the designer confirms and clarifies the images received by contacting the client / user 233 and proceeds to create the design and transmit the design to the main computer in a format accessible through client &# 39 ; s account but not accessible by other client accounts 224 . the client / user and the designer review together the prepared design and any selected design products 225 . turning now to fig3 , the client / user information is transmitted to the main computer 340 including account information 320 , kitchen design information 321 and selected design products 322 , digital images taken by the client / user 324 and information received by the designer 341 . in addition the approved design plan and any transactional information 333 are stored at the main computer 340 . fig4 - 12 show a preferred embodiment describing touch screen options at a kiosk . an initial “ splash ” screen also known as a welcome page is typically graphically appealing and simple and may involve a revolving movie , no sound , hitting the high points and advantages of directed design , in a preferred embodiment , directed kitchen design also known as virtual kitchen design or vkd . the splash screen invites a client / user to “ touch screen to begin ”. initial options are “ about us ” or in the preferred embodiment , “ about virtual kitchen design ” which provides a company profile , in this preferred embodiment , about vkd . additional options describe cabinet and countertop lines , short descriptions of each vendor company and lead to screens such as “ browse our catalogues ”. “ live help ” provides answers to questions from a human , advising a client / user to pick up a phone , which may be attached to the kiosk or which may be a virtual telephonic connection mediated via an internet connection . other screens provide information including a library of frequently asked questions also known as faq . an option is provided to “ meet my designer now ” initiating an interface with a directed design designer which may be effected electronically and with video and / or telephonic connection . a “ quick quote ” screen facilitates price comparisons with other design product vendors . “ preview design ” or in this preferred embodiment , “ preview kitchen design ” provides the client / user with a visual image of a paradigmatic design kitchen with average features for each level of cabinet line . price ranges may be selected by the client / user . a use of the present invention is illustrated by the following example . client arrives at vendor location and activates direct design kiosk , marked as “ kitchen cabinetry direct design with video and audio assist to a live vendor sales representative . using the kiosk touch screen , the client has options to choose from such as ( a ) “ get your digital camera now ” thereby creating an client user account ; ( b ) “ browse cabinetry catalogue ”; ( c ) “ talk to a representative ” with or without live video ; ( d ) “ call me back ”; ( e ) “ order now ”. client selects the digital camera option , which is provided by the vendor to meet certain specifications facilitating photogrammetric extraction of dimensional data from two - dimensional images . client creates a client user account including secure payment information such as credit card information and secure personal and contact information , thereby facilitating computer - mediated maintenance of client user specifications . the information is entered at the kiosk using the integrated video touch screen , which is well known in the art . the kiosk transmits the client information to a main computer , which stores on a computer media client information . client receives the digital camera either by mail or directly through the kiosk or by distribution of a vendor coupon voucher . client also receives specific instructions for obtaining images of the location client requires for design . client places a ruler in the visual field of the image to establish a measuring standard or reference point . however , photogrammetric analysis obviates the requirement of a dimensional standard . the instructions indicate that digital images may be transmitted to the main computer either through a direct phone link , by physically sending the memory media storing the images , or via internet transmission . client opts to transmit the images via the internet using his personal home computer . client is then contacted directly by the designer confirming receipt of the digital images and initiating the designer - client personal relationship . the designer then creates a plan conforming to client &# 39 ; s general specifications and requirements and transmits the design in digital form to the main computer in a form that is securely accessible from client &# 39 ; s specific account but not accessible from other client accounts . client is informed that the design and account information is also available at the kiosk location upon entry of required account security information . client reviews the design plan on his home computer and contacts the designer by telephone with several modifications . client and designer simultaneously view the design plan and make revisions in real - time as the designer operates the design software in response to client &# 39 ; s directions . client reviews the design plan and makes cabinet style selections and orders the selections from a provided vendor on - line catalogue , using a secure account algorithm . client visits a vendor location and views countertop styles in person and then logs onto his account using a kiosk located at the vendor location . client makes places his order . client takes the before and after “ after ” pictures using the provided digital camera , transmits the digital images to the main computer via his home personal computer internet connection and stores the images in his account for future reference . throughout this application , various publications and patents and patent applications are referenced . the disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art . this invention may be embodied in other forms or carried out in other ways without departing from the spirit or essential characteristics thereof . the present disclosure is therefore to be considered as in all respects illustrative and not restrictive , the scope of the invention being indicated by the appended claims , and all changes which come within the meaning and range of equivalency are intended to be embraced therein .

6Physics

a rectangular base plate 3 of uniform thickness is fastened to the ski 1 by means of four screws ( only the center lines have been indicated ) arranged in the region of the corners of the base plate 3 . the base plate 3 is designed slightly more narrow than the width of the ski 1 . as can be seen in the top view according to fig2 a bearing plate 4 with a circular upper contour 4a is provided approximately in the longitudinal center and on each side of the base plate 3 . the two bearing plates 4 are thereby arranged on the base plate 3 such that they form in direction toward the tip of the ski ( arrow pf ) an opening or diverging angle . furthermore the bearing plates 4 are positioned symmetrically with respect to the longitudinal axis of the ski . approximately in the center between the two bearing plates 4 and the rear end of the base plate 3 , an elongated holding bar 3a is fastened with its longitudinal axis extending perpendicular with respect to the longitudinal axis of the ski on the upper side 3b of the base plate 3 . the holding bar 3a is rectangular in cross section and is substantially half as wide ( or long ) as the width of the base plate 3 . it grips over a spring - steel band 5 , which will be described more in detail below , in the region of its end engaging the base plate 3 . the spring - steel band 5 has a rectangular design of uniform thickness , and two bent sections 5a , 5b . the terminal end of the spring - steel band 5 , which end is associated with the base plate 3 , extends in a direction toward the tip of the ski in front of the holding bar 3a and is fastened thereat to the base plate 3 by two rivets 6 arranged symmetrically with respect to the longitudinal axis of the ski . the other end of the spring - steel band 5 is riveted by means of two further rivets 6 to a control part 7 . these further rivets lie also symmetrically with respect to the longitudinal axis of the ski . the control part will yet be described more in detail . the control part 7 is an elongated member , the longitudinal axis of which is arranged perpendicular with respect to the longitudinal axis of the ski . its longitudinal ends form supports 7b which face the ski edges and are bent at a right angle in direction toward the base plate 3 so that they form an opening or diverging angle in direction toward the tip of the ski . the rearwardly facing corner between the bottom edge and rear edge of the supports 7b are constructed at a right angle . the opposite frontwardly facing corner has a radius . the supports 7b have the same thickness as the control part 7 . the spring - steel band 5 is riveted to the control part 7 on its upper side 7a , and terminates flush with the side edge of the control part facing the tip of the ski . each of the two supports 7b of the control part 7 carries approximately in its center , on the side thereof facing the ski edges , a cylindrical pin 8 , the axis of which extends perpendicularly away therefrom . the two pins 8 have cylindrical heads 8a . the pins 8 also have cylindrical sleeves 9a encircling same . the cylindrical sleeves are secured to the ends of braking bars associated with the control part 7 . through this type of support , it is possible for the braking bar 9 to swivel only in one plane perpendicular with respect to the cylindrical pin 8 . the braking bars 9 have , starting from the cylindrical sleeves 9a , a straight segment 9b . each straight segment 9b is followed by a first outwardly angled segment 9c in direction toward the ski edges . furthermore the first outwardly angled segment 9c projects from the plane defined by the longitudinal axis of the straight segment 9b and the axis of the pins 8 in direction toward the tail of the ski and upwardly away from the upper surface of the ski . in the region of the first segment 9c , the braking bar 9 extends through openings and , thence , is pivotally supported on the bearing plates 4 . the circular contour 4a of the bearing plate 4 makes it possible for the braking bar 9 in the region where the bearing plate 4 is gripped around by the braking bar 9 , to swing also into positions wherein the braking bar is not positioned perpendicularly on the bearing plate 4 . in other words , the pivotal support is something like a universal joint . a second angled segment 9d follows the first segment 9c , the length of which corresponds approximately with the extent of the spring - steel band 5 . the second segment 9d forms with the first segment 9c approximately an angle of 70 ° to 80 ° and defines the braking legs 9e of the ski brake . as a result , it is achieved that the braking bar 9 in the braking position of the ski brake 2 , as illustrated in fig1 and 2 , extends away from the ski . furthermore , the second segment 9d extends in the same direction as the straight segment 9b . the exemplary embodiment which is illustrated in fig1 and 2 illustrates the inventive ski brake 2 in the braking position . the upper surface 7a of the control part 7 is thereby held by the spring - steel band 5 in a position which is generally perpendicular to the straight segment 9b of the braking bar 9 . thus the greatest possible spreading of the braking legs 9e is achieved . if the control part 7 is swung counterclockwise about the axis of the first segment 9b by a not illustrated ski boot in direction toward the base plate 3 , the control part 7 also swings slightly in the clockwise direction about the axis of the pin 8 . the now sloped position of the surface 7a and supports 7b effects a slight , continuous pulling in of the braking legs 9e . in the position as is illustrated in fig3 and 4 , thus prior to an actual pulling in of the braking legs 9e , the braking bars 9 are already totally above the upper surface 1a of the ski 1 and above the upper surface 3b of the base plate 3 . if the control part 7 is further loaded by a ski boot 10 ( compare fig5 ), then it swings in the clockwise direction until its upper surface 7a will lie approximately parallel with respect to the upper surface 3b of the base plate 3 . this movement will cause the braking bars 9 to be pulled inwardly of the ski edges not separately identified . the spring - steel band 5 has in the position according to fig5 and 6 its strongest possible spring force . if the ski boot 10 becomes disengaged from the ski binding and removed from the control part 7 , the spring - steel band 5 will swing the control part 7 counterclockwise immediately into the position according to fig3 and 4 . through this swinging movement , the braking legs 9e will be swung outwardly beyond the ski edges . thereafter , the spring - steel band 5 will swing the ski brake 2 upwardly into the position according to fig1 and 2 . the ski brake 2 is now again in the braking position and is held by the spring - steel band 5 in this position . in the exemplary embodiment according to fig7 to 12 , a substantially rectangular base plate 3 &# 39 ; is also fastened to a ski 1 by means of schematically indicated screws arranged in the region of the corners . an elongated approximately rectangular and upstanding support 3c is formed in the region of the front end , that is the end which faces the tip of the ski ( arrow pf ), of the base plate 3 &# 39 ;, the longitudinal axis of which extends perpendicularly with respect to the longitudinal axis of the ski . the height of the support 3c is approximately as great as the thickness of the base plate 3 &# 39 ;. the base plate 3 &# 39 ; carries approximately in its longitudinal center an elongated bearing member 4 &# 39 ;, the longitudinal axis of which extends perpendicular to and symmetrical about the longitudinal axis of the ski . the width of the bearing member 4 &# 39 ; is approximately half the width of the base plate 3 &# 39 ;. the bearing member 4 &# 39 ; has furthermore a cylindrical opening 4b therethrough . the cylindrical opening 4b serves to pivotally support a pivotal securement device composed of a hollow pipelike sleeve 11 , the longitudinal extent of which must be approximately as large as the width of the ski 1 . the two opposite ends 11a , 11b of the sleeve 11 have a shape which differs from a plane surface and which will be yet described in more detail . the sleeve 11 has a diameter which will also be described in more detail . two axially aligned and separate axles 12 are provided on a braking bar 9 &# 39 ; which is formed in one piece and is made of spring - steel wire . each axle 12 is received in an end region 11a , 11b of the hollow pipelike sleeve 11 , the length of each axle being slightly less than the distance to the bearing member 4 &# 39 ; from the associated edge of the base plate 3 &# 39 ;. the braking bar 9 &# 39 ; is designed such that its side segments are straight approximately over two - thirds of their length and form the braking legs 9 &# 39 ; e . these are , starting out from the axles 12 , provided in direction toward the tail of the ski . the braking legs 9 &# 39 ; e extend in the braking position of the ski brake 2 &# 39 ; approximately parallel with respect to the side surface edges of the ski 1 . starting out from the axles 12 in a direction toward the tip of the ski , the braking bar 9 &# 39 ; has an upwardly tapering part 9h and subsequently transfers over into an approximately semicircular curved segment 9f . the radius of the semicircular curved segment 9f corresponds approximately to the distance between the bearing member 4 &# 39 ; and the side edge of the ski 1 . the semicircular curved segments 9f are followed also by a radiused segment and a straight connecting segment 9g , the longitudinal axis of which extends substantially perpendicular to and symmetrical with the longitudinal axis of the ski . starting approximately at the midpoint of the curved segments 9f , an inner portion of the curved segments 9f and the connecting segment 9g connecting them project in the nonoperated position of the braking bar 9 &# 39 ; away from the plane of the braking bar 9 &# 39 ; at an angle θ of approximately 35 ° to 40 ° ( see fig9 ), which angle opens up in direction toward the tail of the ski . through the curved segments 9f and the arrangement of the connecting segment 9g , the braking bar 9 &# 39 ; has an initial spring force which urges the braking legs 9 &# 39 ; e in a direction toward the center of the ski . the hollow pipelike sleeve 11 carries a control part composed of a substantially rectangular operating bar 13 , which in the braking position of the ski brake 2 &# 39 ; is positioned almost perpendicularly to the upper surface 1a is of the ski 1 . the operating bar 13 is designed sufficiently wide that it grips beyond the lateral ends of the bearing member 4 &# 39 ;. the tapering part 9h of the ski brake 2 &# 39 ; and the operating bar 13 define in the braking position of the ski brake 2 &# 39 ; according to fig1 an angle of approximately 30 ° ( see fig7 ). on one side of the operating bar 13 associated with an end region 11a of the hollow pipelike sleeve 11 , a torsion spring 14 encircles the pipelike sleeve 11 . one end of the torsion spring 14 encircles a leg on the operating bar 13 . the other end of the torsion spring 14 encircles the associated , tapering part 9h of the braking bar 9 &# 39 ;. the torsion spring 14 continually attempts to form an angle of approximately 30 ° between the tapering part 9h of the braking bar 9 &# 39 ; and the operating bar 13 . the two end regions 11a , 11b of the sleeve 11 each have a cam surface 11c and a recess or notch 11d , which are arranged such that the cam surfaces 11c spread apart the braking legs 9 &# 39 ; e in the upright position of the operating bar 13 so that the legs 9 &# 39 ; e will lie outside of the lateral edges of the ski 1 . if the operating bar 13 is swung in the counterclockwise direction into the plane of the braking legs 9 &# 39 ; e , the braking legs 9 &# 39 ; e will lie at the end region 11a , 11b of the sleeve in an aligned position with the recesses 11d . the recesses 11d are constructed such that the braking legs 9 &# 39 ; e terminate flush with the cam surfaces 11c , so that the entirety of each of the braking legs 9 &# 39 ; e will lie inside the lateral edges of the ski 1 . the hollow pipelike sleeve 11 has such a large inside diameter , that the separate axles 12 , which are rigidly connected to the braking legs 9 &# 39 ; e , are not hindered during a swinging movement of the braking legs 9 &# 39 ; e from a position outside of the lateral edges of the ski 1 into a position within the lateral edges of the ski 1 . a further torsion spring 15 is provided opposite of the torsion spring 14 also on the sleeve 11 . the torsion spring 15 grips with one leg around the tapering part 9h of the braking bar 9 &# 39 ; and is supported with the other leg on the base plate 3 &# 39 ;. the just described leg of the torsion spring 15 is prevented from lifting off from the base plate 3 &# 39 ; by a substantially rectangular holding block 3d which is arranged on the upper surface 3 &# 39 ; b of the base plate 3 &# 39 ;. the torsion spring 15 loads the braking bar 9 &# 39 ; in clockwise direction . the force which is applied by the torsion spring 15 onto the structural parts which are associated with the torsion spring 15 is substantially less than the force , which is applied by the torsion spring 14 onto the structural parts associated with said torsion spring 14 . as a result , first the operating bar 13 and only subsequently the braking bar 9 &# 39 ; is swung upwardly , so that the two braking legs 9 &# 39 ; e will not get caught on the upper surface 1a of the ski 1 . due to the fact that the torsion springs 14 , 15 grip around the braking bar 9 &# 39 ; or the operating bar 13 or are held on the base plate 3 &# 39 ; by a holding block 3c , they also simultaneously function as a resilient stop . if the braking bar 9 &# 39 ; is stepped down upon in the area of the semicircular curved segment 9f or of the straight connecting segment 9g by a ski boot 10 , the braking bar will swing counterclockwise until it rests on the support 3c of the base plate 3 &# 39 ;. the operating bar 13 and the pipelike sleeve 11 which is connected rigidly to the operating bar are swung along by the torsion spring 14 and no relative movement at all is created between the braking bar 9 &# 39 ;, pipelike sleeve 11 , operating bar 13 and the torsion spring 14 . there still exists a space between the ski boot 10 and the operating bar 13 , that is , up to this point in time only the braking bar 9 &# 39 ; has been operated or contacted by the ski boot 10 ( compare fig9 ). during a further stepping down of the ski boot 10 , the straight connecting segment 9g is swung clockwise into the plane of the braking bar 9 &# 39 ;. also into the plane of the braking bar 9 &# 39 ;, however , counterclockwise , the operating bar 13 is swung against the force of the torsion spring 14 . by swinging the operating bar 13 in the counterclockwise direction , the cam surfaces 11c of the sleeve 11 slide off from the braking legs 9 &# 39 ; e , so that the braking legs 9 &# 39 ; e which are under initial tension will lie in the recesses 11d in the end regions 11a , 11b of the sleeve 11 . due to the position change of the braking legs 9 &# 39 ; e from the position on the cam surfaces 11c into the position in the recesses 11d , it is also achieved that the braking legs 9 &# 39 ; e swing in a direction toward the center of the ski , that the braking legs 9 &# 39 ; e will lie with their entire length within the lateral edges of the ski 1 , as this can be recognized from fig1 and 12 . if the ski boot 10 disengages from the braking bar 9 &# 39 ; and the operating bar 13 , be it arbitrarily by stepping out of a ski binding ( not illustrated ) or automatically due to a fall , the following happens : the two torsion springs 14 and 15 will attempt to relax and assume the position illustrated in fig7 and 8 . since the torsion spring 14 which loads the operating bar 13 is designed stronger than the torsion spring 15 which loads the braking bar 9 &# 39 ;, the first working stage consists of the operating bar 13 and the sleeve 11 according to fig9 and 10 swivelling to a position approximately 30 ° with respect to the braking bar 9 &# 39 ;. this causes the cam surfaces 11c to engage the braking legs 9 &# 39 ; e and effect a spreading of these legs beyond the edges of the ski 1 . approximately when this working stage has been carried out , the weaker torsion spring 15 will swing the braking bar 9 &# 39 ; in a clockwise direction into the braking position according to fig7 and 8 . during this working stage , the straight connecting segment 9g of the braking bar 9 &# 39 ; is also swung into its relaxed position . the two torsion springs 14 or 15 which load the operating bar 13 and the braking bar 9 &# 39 ; form at the same time also an elastic stop for the just mentioned structural parts , because they always want to assume a position according to fig7 and 8 . although particular preferred embodiments of the invention have been disclosed in detail for illustrative purposes , it will be recognized that variations or modifications of the disclosed apparatus , including the rearrangement of parts , lie within the scope of the present invention .

0Human Necessities

referring to fig1 fastener 10 includes a plurality of hooks 12 that are integral with , and extend from , a sheet - form base 14 . the hooks and base may be formed from the same cross - linkable polymer or , alternatively , may be formed of different polymers . if they are formed from different polymers the hook - forming polymer is cross - linkable ; the other polymer can be either cross - linkable or non - cross - linkable . hooks 12 are cross - linked , while the base 14 is not cross - linked or is cross - linked to a lesser degree than the hooks . as a result , the hooks are tough and durable , while the base is soft and flexible . the base should be sufficiently strong to withstand its intended use without tearing or other damage , while also being relatively thin and flexible , to give good “ drape ”. preferably , the base is less than 0 . 005 inch thick , more preferably from about 0 . 001 to 0 . 003 inch thick . the hooks have a significantly higher flexural modulus than the base , preferably at least 25 % higher and more preferably at least 50 % higher . [ 0028 ] fig2 illustrates a suitable process for forming the fastener shown in fig1 . as shown in fig2 a cross - linkable polymer 16 is extruded by extruder 18 onto a roll 19 having hook forming cavities 20 ( e . g ., as described in u . s . pat . no . 4 , 872 , 243 , the disclosure of which is incorporated herein ), forming hooks 21 extending from a base 22 . it is noted that this step is shown merely as an example , and can be replaced by any desired method of molding hooks on a base , e . g ., the processes described in u . s . pat . nos . 4 , 894 , 060 , 4 , 794 , 028 and 5 , 441 , 687 , the disclosures of which are incorporated by reference herein . the resulting hook - carrying base 22 then passes to a cross - linking station a , shown in further detail in fig2 a . at cross - linking station a , the base 22 passes through a bath of an inert shielding fluid 24 , e . g ., a solution of salts of heavy metals such as barium , or a cooled bath of liquid mercury , while the hooks 21 remain above the surface 26 of the fluid . while the base 22 is in the bath , the hooks are exposed to radiation ( arrows e ), e . g ., electron beam radiation , causing the hooks to cross - link or partially cross - link . if it is desired that the base of the hooks remain flexible , the hooks can be partially submerged in the bath along with the base . an alternative process is shown in fig3 . in this process , the bath of shielding fluid is omitted , and instead the hook - carrying base 22 passes through a series of rolls 28 , 30 , 32 . the arrangement of the rolls causes the base 22 to bend around rolls 28 and 32 , forming bent areas . electron beams e 1 , e 2 , that point in the machine direction ( in the plane of the page , in fig3 ), are then directed at the bent areas . thus , the electron beams will cross - link the hooks without significantly affecting the base . if desired , more rolls can be provided downstream of roll 32 , in a similar arrangement , to provide more bent areas at which radiation can be directed . polymers that are suitable for use in this embodiment of the invention are those that can be molded to form fastener elements and can subsequently be selectively cross - linked , as described above . suitable polymers include polyvinyl chloride ( pvc ), polyvinylidene fluoride ( pvdf ), poly ( ethylene terephthalate ) ( pet ), polyacrylates , polyamides , thermoplastic elastomers , e . g ., hytrel elastomers and pebax elastomers , and mixtures thereof . polyester - based thermoplastic elastomers , e . g ., hytrel elastomers , and polyether / polyamide - based thermoplastic elastomers , e . g ., pebax elastomers , are preferred . many of these polymers will require suitable cross - linking agents in order to cross - link when exposed to radiation . suitable cross - linking agents are well known to those skilled in the art . suitable polymers that contain electron beam cross - linking agents include thermoplastic elastomers available from zylon corp ., monsey , n . y . 10952 , under the trade name “ zylon ebxl tpe ”. the cross - linkable polymer can also include additives such as fillers , stabilizers , accelerators , and the like , as is well known . cross - linking can be effected using various techniques , e . g ., electron beam or ultraviolet radiation , heat , or any other desired technique suitable for the selected polymer . the cross - linking conditions are selected based on the polymer used and the properties desired . in alternative embodiments , a first polymer is used to form the hooks and a second polymer is used to form the base . thus , the hook - forming polymer can be cross - linkable and the base - forming polymer can be non - cross - linkable ( or not cross - linkable under the conditions used to cross - link the hook - forming polymer ), so that it is not necessary to “ mask ” the base during cross - linking of the hooks . alternatively , the hook - forming polymer can be harder than the base - forming polymer , and both polymers can have the desired properties without cross - linking . a suitable process for forming such a two - polymer fastener is shown in fig4 . a first extruder 35 extrudes a first , hook - forming polymer 38 onto mold roll 40 , forcing some of the polymer into hook - forming cavities 42 and leaving a layer of polymer on the surface of the mold roll . as mold roll 40 rotates in the direction of arrow a , doctoring blade 44 removes some or all of the polymer on the surface of the mold roll without disturbing the polymer in cavities 42 . the removed polymer , which has been exposed to air while on the mold roll and may have begun to solidify , may be either discarded or returned to the hopper for remelting . the thickness of polymer left on the surface of the roll by the doctoring blade will depend , in part , on how close the blade is positioned to the surface of the mold roll ( the position is adjustable in the direction indicated by arrow b ). in some cases , the sharp , distal end of blade 44 rides against the mold roll , thereby literally scraping off essentially all of the polymer on the surface of the roll . in such cases it is recommended that the end of the blade be coated with a lubricious material to avoid damaging the surface of the mold roll . in other cases , the position of the blade is adjusted to leave a predetermined thickness of polymer on the roll , to become a part of the base of the product . in such cases , the doctoring blade effectively trims the polymer thickness rather than actually “ scraping ” against the surface of the roll . next , a second extruder 47 extrudes a second , base - forming polymer 50 onto the surface of the mold roll ( or onto any of polymer 38 left on the surface of the roll by blade 44 ). a gear pump 36 , 48 , is positioned at the outlet of each extruder , to accurately control the rate of polymer delivered to the mold roll . the final thickness of the base of the product is then adjusted by roll 52 , rotating in the direction of arrow c , and the finished fastener product 60 is stripped from the mold roll 40 by passing it around exit roll 54 . for forming a fastener product having a relatively stretchable base and relatively stiff fastener elements , a urethane may be employed for the hook - forming polymer 38 and a rubber - filled polyethylene or polyester based thermoplastic may be employed for the base - forming polymer 50 . an example of such a base - forming material is arnitel em400 , available from dsm . examples of various fasteners that can be formed using the process shown in fig4 ( or modifications of this process ) are shown in fig5 - 5d . [ 0037 ] fig5 shows a fastener 62 , in which the hooks 64 are formed of a first polymer and the base 66 is formed of a second polymer . using the process shown in fig4 such a fastener can be formed by scraping substantially all of the first polymer off of the surface of the mold roll prior to applying the second polymer . [ 0038 ] fig5 a shows a fastener 68 , in which the hooks 70 and the upper portion 72 of the base 74 are formed of a first polymer , and the lower portion 76 of base 74 is formed of a second polymer . using the process shown in fig4 such a fastener can be formed by adjusting doctoring blade 46 away from the mold roll surface so that a thin layer of the first polymer remains on the mold roll surface when the second polymer is applied . when using a stiff first polymer and a flexible or stretchable second polymer , the layer of first polymer is preferably sufficiently thin , as determined by the positioning of the doctoring blade , to enable the rupture of the thin layer of first polymer upon the initial stretch of the second polymer layer , such as during the initial engagement of a diaper tab . subsequently , the rigidity of the thin layer of the first polymer does not detract from the stretchability of the base of the fastener product . [ 0039 ] fig5 b shows a fastener 78 , in which the hooks 80 are formed of a first polymer 82 and a second polymer 84 , and the base 86 is formed of a third polymer 88 . to form this fastener , the process shown in fig4 is modified so that the first extruder 35 applies an amount of the first polymer that only partially fills the mold cavities , and then another extruder ( not shown in fig4 ) applies the second hook - forming polymer to completely fill the cavities . the process then continues as shown in fig4 with scraping and application of the base - forming polymer by extruder 47 . if the two polymers 82 , 84 are not compatible , or do not adhere well to each other , a thin tie layer of adhesive , or a third polymer that adheres well to both polymers 82 and 84 , can be applied between polymers 82 and 84 . this can be accomplished by replacing extruder 47 with a co - extrusion die , or by other known methods of applying tie layers . [ 0040 ] fig5 c shows a fastener 90 in which the hooks 92 are formed of three different polymers 94 , 96 , 98 . this fastener would be formed in a manner similar to that described below with reference to fig5 d , adding a further extruder to apply the third hook - forming polymer . this embodiment can provide combinations of properties difficult to obtain with only two polymers . alternatively , the middle polymer 96 may be used as a “ tie layer ” to bond polymers 94 and 98 if , for example , these polymers are incompatible or do not adhere well to each other . [ 0041 ] fig5 d shows a fastener 100 in which the base 102 and a lower portion 104 of hooks 106 are formed of a first polymer , and the upper portion 108 of the hooks is formed of a second polymer . this fastener would be formed by the process of fig4 by only partially filling the molding cavities using extruder 35 , and then completing the filling of the cavities with extruder 47 . [ 0042 ] fig6 and 7 show alternative processes for forming a two - polymer fastener . in the process shown in fig6 the first and second polymers are applied to the mold roll by a coextruder 110 . in the process shown in fig7 the hook - forming polymer is applied to the mold roll by an extruder 112 , and most of the polymer is scraped from the surface of the mold roll by a doctoring blade 114 , leaving a thin film of polymer , as described above with reference to fig4 . the base - forming polymer 116 is then laminated to the thin film of hook - forming polymer while the latter is still on the mold roll , such as in the nip between the mold roll and roll 118 , as shown . the hook - carrying base that is formed using any of the processes shown in fig4 and 7 can be partially cross - linked , if one of the polymers ( preferably the hook - forming polymer ) is cross - linkable . if the other polymer is not cross - linkable , or not cross - linkable under the same conditions , it is not necessary to mask or shield that component . thus , for example , an electron beam can be directed at the entire fastener ( positioned so that it hits at least the portions to be cross - linked ) at a station ( not shown ) that is downstream of the processes shown in fig4 and 7 . if both polymers have the desired properties for a given application without cross - linking , the hook - carrying base formed by the processes shown in fig4 and 7 can be used “ as - is ”, without a further cross - linking step . polymers that are suitable for use in the fasteners shown in fig5 - 5d include the above - described cross - linkable polymers , if cross - linking is used . if cross - linking is not used , suitable polymers for the relatively hard portions of the fastener include polypropylenes , e . g ., profax 7823 polymer , commercially available from montell usa , inc ., and other relatively hard polymers such as pet and polyamides , e . g ., polyamide 6 / 6 and polyamide 6 . preferably , the relatively hard polymer has a flexural modulus of at least 80 , 000 , more preferably at least 120 , 000 psi . suitable polymers for the relatively soft portions include vulcanized blends of polypropylene and epdm , e . g ., santoprene polymers , commercially available from advanced elastomer systems , inc ., and other relatively soft polymers such as those commercially available under the trade names hytrel and pebax . preferably , the relatively soft polymer has a flexural modulus of greater than 80 , 000 , more preferably about 10 , 000 to 60 , 000 psi . it is preferred that the two polymers be compatible , i . e ., that they adhere to one another and that they be relatively inert with respect to each other ( or , if they are reactive , that such reaction does not have a significant deleterious effect on the desired properties of the polymers ). if they are incompatible , a tie layer can be used to join them , as discussed above . other embodiments are within the claims . for example , while fig1 shows loop - engageable , hook - shaped fastener elements , the fastener elements may be of any desired shape ( e . g ., mushrooms , loops , multi - directional hooks , or spikes ). the touch fastener can also include other raised structures such as veins , ridges , or rip - stopping formations , which would preferably be selectively cross - linked with the fastener elements . moreover , while the touch fastener shown in fig1 includes a non - cross - linked base and cross - linked fastener elements , for other applications other regions of the fastener are cross - linked and non - cross - linked .

1Performing Operations; Transporting

referring to fig1 the present invention relates to a toaster apparatus 10 for simultaneously and evenly toasting articles of differing shapes and sizes , such as sliced portions of a hamburger bun , on a heated flat metal surface , i . e ., griddle 12 , more particularly to toast the inside surfaces of a cut hamburger bun in an even manner in as short a time as possible . as shown in fig5 to aid in this process , means are provided for applying gentle pressure to the top surfaces of the bun crown 26 and heel 28 to ensure that the crown and heel undersides are in intimate contact with the griddle surface 12 . the apparatus 10 comprises a hinged clamshell plate 14 perforated with a multitude of passageways 16 , into each of which are slideably arranged improved pins 18 , said clamshell plate 14 adapted to being raised above or lowered to a stand - off position in proximity to the heated griddle surface 12 whereby each pin 18 , moving independently floats , that is , rests and places a gentle pressure upon the upper surface of articles arranged upon the griddle , irrespective of the article &# 39 ; s contour . the toaster 10 has a plate or griddle 12 upon which crowns 26 and heels 28 of the sliced bun are placed to be toasted . the griddle plate 12 is manufactured from a high strength aluminum alloy which is hard - anodized to give the cooking surface 12 superior wear characteristics and excellent heat - transfer capacity . the toaster is heated by electric heater plates ( not shown ) and enclosed with stainless steel covers and a “ belly guard ” to prevent accidental contact with the griddle plate 12 . referring to fig2 the pin plate 14 is manufactured from acetal homopolymer material , noted for low friction , low moisture absorption and dimensional stability . a series of passageways 16 in a regular pattern with one inch spacing are drilled through the plate 14 . into these holes are inserted the fingers 18 in the form of pins , manufactured from 5052 aluminum alloy with a clear anodize finish for corrosion resistance . the design of the pin , best shown in fig3 a , 3 b , and 3 c features multiple radii at the formed end 20 , so the pins do not mark the buns during initial contact or withdrawal . fig4 shows the positioning of the pins 18 within the passageway 16 of the plate 14 , with the formed rounded ends 20 extending downwardly . the other ends of the pins 22 are flattened to two different heights 22 a , 22 b , shown in fig5 to allow for the different thickness between the top and bottom halves of the buns 26 , 28 . the pins 18 are thus free to move up and down in their respective passageway 16 as they come into contact with the upper surfaces of the buns , applying pressure without damaging the delicate baked surface . in the preferred embodiment , four hundred eighty six ( 486 ) pins 18 were deployed within a plate surface area 14 of approximately two hundred eighty four ( 284 ) square inches , a ratio of 1 . 7 plus pins per square inch . while the ratio of number of pins per unit of plate area may vary , the useful range varies from one ( 1 ) pin per square inch ( for large buns ) to three ( 3 ) pins per square inch for smaller buns . as further illustrated in fig2 two handles 30 , 31 are furnished to facilitate attachment and removal of the pin plate 14 for cleaning . the pin plate 14 is mounted into a frame assembly 32 , reinforced by a supporting angle 34 , which is constrained by four arms arranged in pairs evenly about the centerline of the frame 32 . the lever arms 42 , 43 guide the lower side of the frame 32 and also provide a counter balancing force through two torsion springs 48 a , 48 b associated with spring collars 49 . a tubular connector 45 , held in place with setscrews 41 to ensure equal movement of both arms in unison , joins the lever arms 42 , 43 . the connecting arms 46 , 47 guide the top of the frame 32 . the lever and connecting arms 42 , 43 , 46 , 47 are connected to the frame assembly 32 by shoulder bolts 55 passing through bushings 51 , secured by locking pins 57 , capped by dome nuts 56 and are attached to a pair of support bracket 44 a , 44 b through bushings 52 a , 52 b and secured by shoulder bolts 53 a , 53 b , said support brackets providing the lower pivot points 50 d . the normal operation of the pin plate mechanism 40 is to rotate the pin plate 14 clockwise using the attached handle 30 . the initial rotation is rapid until the plate 14 is at approximately 45 ° to the horizontal when the speed of rotation decreases . when the plate reaches approximately two inches above a lower stop position , the movement becomes largely vertical . at a position approximately one inch from the lower stop position the formed ends 20 of the bun pins 18 float , i . e ., make contact with and rest upon the upper surfaces of the bun halves 26 , 28 , causing the bun pins 18 to slide upwardly through the bun plate 14 . as the plate continues to move towards its lowest horizontal position the weight of the bun pins 18 is brought fully to bear on the bun halves 26 , 28 thereby pressing the lower surfaces fully against the grill surface 12 to ensure quick and even toasting . referring to fig2 and 6 - 9 , the geometry of the pin plate mechanism 40 is such that the length of the connecting arms 46 , 47 is shorter than the length of the lever arms 42 , 43 . also , the position of the pivot points 50 a for the connecting arms 46 , 47 and the position of the pivot points 50 b for the lever arms 42 , 43 on the frame 32 are offset both horizontally and vertically . similarly , the position of the pivot points 50 c for the connecting arms 46 , 47 and the position of the pivot points 50 d for the lever arms 42 , 43 on the support brackets 44 a , 44 b are offset both horizontally and vertically . this arrangement constrains the movement of the frame 32 and also the griddle plate 14 so that from the lowest position ( fig6 ) for the first two inches of upward movement the frame 32 and plate 14 remain largely horizontal ( see fig7 ). in the preferred embodiment , when the frame 32 and plate 14 reach a height of three inches they start to rotate anti - clockwise , as viewed in fig8 . the anti - clockwise rotation continues slowly until such time as an imaginary line drawn through the centerline of the lever arm 42 passes above the support bracket connecting arm pivot 50 c . at this point , the speed of rotation increases considerably such as the final fifteen degrees of rotation of the lever arm generates forty - five degrees of rotation of the frame 32 and plate 14 . as shown in fig . 9 , at the end of travel the frame 32 and plate 14 are in a substantially vertical position . mechanical stops ( not shown ) are positioned to limit arc of travel to required positions . and , as illustrated in fig . 1 the pin plate mechanism 40 is mounted onto and above the griddle plate 12 . as seen in fig2 a cover 54 is provided to protect the moving parts of the mechanism and screws 33 connect the handles 30 , 31 and the supporting angle 34 to the frame 32 . the pin plate 14 , pin plate mechanism 40 and cover 54 are all removable for cleaning without the use of tools , a requirement for regulatory approval . while the preferred embodiment of the invention has been shown and described , it will be apparent to those skilled in the art that changes and modifications may be made thereto without departing from the spirit of the invention , the scope of which is defined by the appended claims .

0Human Necessities

this computer readable medium 10 of the present invention comprises instructions 12 for a processor 13 that cause a computer 14 to make use of a pre - classified data set 16 ( see fig1 ). data set 16 comprises a plurality of records 18 and that includes a plurality of attributes 20 - 21 wherein each of said plurality of attributes 20 - 21 for each record 18 may include one of a plurality of descriptors 32 - 33 and 24 - 26 for that attribute 20 - 21 . the computer 14 is also instructed to make use of a new record 40 to be classified . generally , during classification , each attribute 20 - 21 is considered to be of equal importance . however , it is logical that the importance of attributes 20 - 21 in deciding the classification may vary depending on distribution of the attribute descriptors 32 - 33 and 24 - 26 across the pre - classified data set and also depending on the attribute descriptors in the record 40 to be classified . an importance to an attribute 20 - 21 is typically translated into a weight assigned to that attribute . traditionally equal weights have been assigned to attributes resulting in static weight allocation ; however , varying the weights ( dynamic allocation of weights ) depending on the record to be classified , improves overall classification results . thus for different records , attributes play a role in accordance with their importance ( or weights ). example : as an example to illustrate this , consider the following said data set : looking at the data , we can observe that knowledge of vendor name 20 for this record set plays a more deciding role with certainty of the category 22 by a larger amount than the knowledge of gl description 21 . thus we can claim that vendor name 20 attribute has more importance for deciding category 22 , than gl description 21 . going further , the case where vendor name 20 has value of “ company 1 ” 32 is different than the case where vendor name 20 has value of “ company 2 ” 33 . in the earlier case , vendor name 20 alone can decide category 22 , whereas in later case vendor name 20 alone is not sufficient for the decision . thus the importance of vendor name 20 attribute is different in either of these cases . one mechanism to achieve the advantages of dynamic allocation of weight is by using information gain of attributes . in the information theoretic sense , information gain 80 of an attribute 20 - 21 is equal to the reduction in overall entropy of the system due to knowledge of particular attribute 20 - 21 . the more the information gain 80 , the more important is the attribute 20 - 21 . this results in static weights 50 - 51 ( or fixed importance ) to the attributes 20 - 21 . then , for every new record 40 to classify , the present invention takes into account the importance of attribute values 32 - 33 and 24 - 26 and varies the corresponding static weights 50 - 51 ( or fixed importance ), thus assigning the weights dynamically 62 - 63 to every attribute 20 - 21 of classification . based on these dynamic weights 62 - 63 , a new record 40 can be classified using posterior probability calculations . the computer - readable medium 10 of the present invention contains the instructions 12 for a processor 13 that can be described generally as follows : 1 . read a pre - classified data set 16 including a plurality of attributes 20 - 21 , along with its classification code 22 and , for each said attribute , a plurality of descriptors or values 32 - 33 and 24 - 26 . 2 . calculate a static weight 50 - 51 for each of the plurality of attributes 20 - 21 in the data set 16 . 3 . determine an interval of variation 60 - 61 for each of said plurality of attributes 20 - 21 in the data set 16 . 4 . for each new record 40 to be classified : a . calculate a dynamic weight 62 - 63 for each of said plurality of attribute descriptors or values 32 - 33 and 24 - 26 using the static weight 50 - 51 and the interval of variation 60 - 61 for each of said plurality of attributes 20 - 21 . this yields the attribute importance score of the current attribute by employing the actual attribute value in the new record . then transform and normalize the set of attribute importance scores to obtain the dynamic weight of each of said plurality of attributes . b . classify the new record 40 considering the dynamic weight 62 - 63 of each of said plurality of attribute values . for naïve bayes classification , the dynamic weight 62 - 63 value is used as an exponent of the individual conditional probabilities . the posterior probability based classification is thus as per : w i s are the dynamic weight 62 - 63 values for each of the n attributes a 1 to a n . more specifically , the objective of the present invention is achieved by the computer readable medium 10 comprising the instructions 12 for a processor 13 to cause the computer 14 to perform the following transformations of attribute values and attribute descriptors to result in the predictive classification of the new record 40 . assign static weight 50 - 51 to attributes 20 - 21 of classification based on data set 16 output : static weight 50 - 51 of each attribute 20 - 21 1 . calculate overall entropy in the data set 16 . 2 . for each attribute 20 - 21 in the data set 16 , do the following : a . for each distinct value of the attribute 32 - 33 and 24 - 26 , calculate conditional entropy . b . calculate weighted average of conditional entropy values and call it as the conditional entropy for the attribute 20 - 21 . c . calculate information gain 80 - 81 of the attribute 20 - 21 using the conditional entropy for the attribute 20 - 21 and the overall entropy . normalize the information gain 80 - 81 values of all the attributes 20 - 21 , so that they sum up to the number of attributes 20 - 21 . the normalized information gain 80 - 81 values now indicate the static weight 50 - 51 of each attribute 20 - 21 . for the data set above , the calculations are : information gain 80 for vendor name 20 = initial entropy − total entropy after knowledge of vendorname information gain 81 for gl description 21 = initial entropy − total entropy after knowledge of gl description = 0 . 4515 − 0 . 3524 = 0 . 0991 static weights to attributes overall attribute conditional information normalized entropy name entropy gain weights 0 . 4515 vendor name 0 . 1505 0 . 3010 1 . 5046 gl description 0 . 3524 0 . 0991 0 . 4954 get interval for variation about static weights 50 - 51 input : data set 16 above , static weights 50 - 51 of each attribute 20 - 21 output : interval of variation for each attribute 20 - 21 in the data set 16 1 . for each attribute i 20 - 21 with static weight 50 - 51 in the data set 16 : a . find conditional entropy of each of the descriptors or values 32 - 33 and 24 - 26 for current attribute 20 - 21 . b . ( note : since conditional entropy indicates uncertainty about classification given some attribute value or descriptor , the lower the conditional entropy the lower would be uncertainty and hence more important would be the value or descriptor of attribute . thus , the contribution of this value of attribute in the corresponding attribute &# 39 ; s importance is inversely proportional to the conditional entropy .) one way to achieve this is to make attribute value importance score 85 - 86 as an inverse of the corresponding conditional entropy . c . q1 is 25 percentile of attribute value importance scores 85 - 86 , q2 is 50 percentile of attribute value importance scores 85 - 86 and q3 is 75 percentile of attribute value importance scores 85 - 86 . d . lower bound scaling factor for interval of variation 60 is calculated as : lbsf i =( q2 − q1 )/ q2 . e . lower bound of interval of variation 60 for current attribute 20 - 21 is calculated as : lb i = w i − w i · lbsf i f . upper bound scaling factor for interval of variation 60 is calculated as : ubsf i =( q3 − q2 )/ q2 . g . upper bound of interval of variation 60 for current attribute 20 - 21 is calculated as : ub i = w i + w i * ubsf i . interval of variation attribute percentile values scaling factor bounds name q1 ( 25 %) q2 ( 50 %) q3 ( 75 %) lower upper lower upper vendor 2 5 10 0 . 6 2 0 . 6018 4 . 5138 name gl 1 . 5 3 5 0 . 5 0 . 67 0 . 2477 0 . 8273 description get dynamic weight values 62 - 63 for attribute 20 - 21 of a new record 40 input : new record 40 , interval of variation 60 - 61 for each attribute 20 - 21 in data set 16 , data set 16 output : dynamic weights of each attribute 20 - 21 : 1 . for each attribute i 20 - 21 in the record 40 : a . calculate conditional entropy in the pre - classified data set 16 for the descriptors or values of the current attribute 20 - 21 . ( note : since conditional entropy indicates uncertainty about classification given some attribute value , the lower the conditional entropy the lower would be uncertainty and hence more important would be the value of attribute . thus , the contribution of this value of attribute in the corresponding attribute &# 39 ; s importance score is inversely proportional to the conditional entropy .) one way to achieve this is to make attribute importance score 85 - 86 as an inverse of the corresponding conditional entropy . b . attribute importance score 85 - 86 is then transformed using linear transformation in the interval of variation 60 - 61 for current attribute 20 - 21 . the transformed score is calculated using the formula : l i = lowest of attribute value importance scores 85 - 86 for attribute i 20 - 21 in data model h i = highest of attribute value importance scores 85 - 86 for attribute i 20 - 21 in data model ub i = upper bound of interval of variation 60 - 61 for attribute i 20 - 21 lb i = lower bound of interval of variation 60 - 61 for attribute i 20 - 21 t h i = attribute importance score in interval of variation for attribute i 2 . normalize the attribute importance scores 85 - 86 of all the attributes 20 - 21 , so that they sum up to the number of attributes 20 - 21 . the normalized values are the dynamic weights 62 - 63 of each of the attributes . thus , the present invention has been described in an illustrative manner . it is to be understood that the terminology that has been used is intended to be in the nature of words of description rather than of limitation . many modifications and variations of the present invention are possible in light of the above teachings . for example , any number of attributes and values of attributes may be considered . the instructions may partially be performed by several different computers or in several different stepwise configurations . therefore , within the scope of the appended claims , the present invention may be practiced otherwise than as specifically described .

6Physics

the following detailed description is provided to assist the reader in gaining a comprehensive understanding of the methods , apparatuses , and / or systems described herein . accordingly , various changes , modifications , and equivalents of the systems , apparatuses and / or methods described herein will be suggested to those of ordinary skill in the art . also , descriptions of well - known functions and constructions may be omitted for increased clarity and conciseness . an adaptive writing circuit , as shown in fig2 , includes a data discriminator 102 , a write waveform controller 104 , a microcomputer 106 , a write pulse generator 108 and a current driver 110 . in other words , the data discriminator 102 discriminates input nrzi data . the write waveform controller 104 corrects the waveform of a write pulse in accordance with the discrimination result of the data discriminator 102 and land / groove signal . the microcomputer 106 initializes the write waveform controller 104 or controls the data stored in the write waveform controller 104 to be updated in accordance with write conditions . the write pulse generator 108 generates an adaptive write pulse in accordance with the output of the write waveform controller 104 . the current driver 110 converts the adaptive write pulse generated from the write pulse generator 108 into a current signal in accordance with the light power levels of the respective channels to drive a light source . next , the operation of the apparatus shown in fig2 will be described with reference to fig3 through 7 . in fig2 , the data discriminator 102 discriminates the magnitude of a mark corresponding to the present write pulse ( to be referred to as a present mark ), the magnitude of the front - part space corresponding to the first pulse of the present mark ( to be referred to as a leading space , hereinafter ) and the magnitude of the rear - part space corresponding to the last pulse of the present mark ( to be referred to as a trailing space ) from input nrzi data , and applies the magnitudes of the leading and trailing spaces and the magnitude of the present mark to the write waveform controller 104 . here , the magnitudes of the leading and trailing spaces and the magnitude of the present mark may range from 3t to 14t . there can be more than 1 , 000 possible combinations . thus , circuits or memories for obtaining the amounts of shift in rising edges of the first pulses and falling edges of the last pulses are necessary with respect to all cases , which complicates the system and hardware . therefore , the magnitudes of the present mark and the leading and trailing spaces of input nrzi data are grouped into a short pulse group , a middle pulse group and a long pulse group and the grouped magnitudes of the present mark and the leading and trailing spaces are used . the write waveform controller 104 shifts the rising edge of the first pulse back and forth in accordance with the magnitudes of the leading space and the present mark , supplied from the data discriminator 102 , or shifts the falling edge of the last pulse back and forth in accordance with the magnitudes of the present mark and the trailing space , to thus form a write waveform having an optimal light power . here , the multi - pulse train of a mark takes the same shape as shown in fig3 b , that is , 0 . 5 t . also , the write waveform controller 104 can correct the rising edge of the first pulse of the present mark and the falling edge of the last pulse of the present mark into different values in accordance with externally applied land / groove signals ( land / groove ) indicating whether the input nrzi data is in a land track or a groove track . this is for forming a write waveform in consideration of different optimal light powers depending on the land and groove . a difference of 1 - 2 mw in the optimal light powers between the land and the groove , and may be specifically set or managed by the specifications . therefore , the write waveform controller 104 may be constituted by a memory in which data corresponding to a shift value of the rising edge of the first pulse and a shift value of the falling edge of the last pulse in accordance with the magnitude of the present mark of input nrzi data and the magnitudes of the leading and trailing spaces thereof , is stored , or a logic circuit . in the case that the write waveform controller 104 is constituted by a memory , the widths of the first pulse and the last pulse are determined as channel clocks ( t ) plus and minus a data value ( shift value ) stored in the memory . also , in this memory , shift values of the first and last pulses of the mark for each of a land and a groove may be stored . a table in which the shift value of the rising edge of the first pulse is stored and a table in which the shift value of the falling edge of the last pulse is stored may be incorporated . alternatively , as shown in fig6 and 7 , two separate tables may be prepared . a microcomputer 106 initializes the write waveform controller 104 or controls the shift values of the first and / or last pulse ( s ) to be updated in accordance with recording conditions . in particular , in accordance with zones , the light power can vary or the shift values of the first and last pulses can be reset . the pulse width data for controlling the waveform of the write pulse is provided to the write pulse generator 108 . the write pulse generator 108 generates an adaptive write pulse , as shown in fig3 f , in accordance with the pulse width data for controlling the waveform of the write pulse supplied from the write waveform controller 104 and supplies control signals shown in fig3 c , 3 d and 3 e , for controlling the current flow for the respective channels ( i . e ., read , peak and bias channels ) for the adaptive write pulse , to the current driver 110 . the current driver 110 converts the driving level of the light power of the respective channels ( i . e ., read , peak and bias channels ) into current for a control time corresponding to the control signal for controlling the current flow of the respective channels to allow the current to flow through the laser diode so that an appropriate amount of heat is applied to the recording medium by continuous on - off operations of the laser diode or a change in the amounts of light . here , a record domain as shown in fig3 g is formed on the recording medium . fig3 a shows input nrzi data , which is divided into mark and space . fig3 b shows a basic write waveform , in which the rising edge of the first pulse of the write pulse lags behind by 0 . 5 t , compared to the rising edge of the present mark . fig3 c shows the waveform of a read power of the adaptive write pulse , fig3 d shows the waveform of a peak power of the adaptive write pulse , and fig3 e shows the waveform of a bias power of the adaptive write pulse . fig3 f shows the waveform of the adaptive write pulse . the rising edge of the first pulse of the write waveform of the adaptive write pulse may be shifted back and forth in accordance with a combination of the magnitude of the leading space and the magnitude of the present mark . an arbitrary power ( here , a read power or a write power ) is applied during the period corresponding to the shift . likewise , the falling edge of the last pulse of the adaptive write pulse may be shifted back and forth in accordance with a combination of the magnitude of the present mark and the magnitude of the trailing space . also , an arbitrary power ( here , a read power or a write power ) is applied during the period corresponding to the shift . alternatively , the falling edge of the last pulse may be shifted back and forth in accordance with the magnitude of the present mark , regardless of the magnitude of the trailing space of the present mark . also , rather than shifting the rising edge of the first pulse and the falling edge of the last pulse , the edge of any one pulse may be shifted . also , in view of the direction of shift , shifting may be performed back and forth , only forward or only backward . fig4 illustrates grouping of input nrzi data , showing two examples of grouping . in the first example , if a low grouping pointer is 3 and a high grouping pointer is 12 , then the mark of a short pulse group is 3t , the marks of a middle pulse group are from 4t to 11t and the mark of a long pulse group is 14t . in the second example , if a low grouping pointer is 4 and a high grouping pointer is 11 , then the marks of a short pulse group are 3t and 4t , the marks of a middle pulse group are from 5t to 10t and the marks of a long pulse group are 11t and 14t . as described above , since both the low grouping pointer and the high grouping pointer are used , utility efficiency is enhanced . also , grouping can be performed differently for the respective zones . fig5 illustrates the number of cases depending on combinations of leading and trailing spaces and present marks , in the case of classifying input nrzi data into three groups , as shown in fig4 , using grouping pointers . fig6 illustrates a table showing shift values of rising edges of the first pulse depending on the magnitude of the leading space and the magnitude of the present mark . fig7 illustrates a table showing shift values of falling edges of the last pulse depending on the magnitude of the present mark and the magnitude of the trailing space . fig8 is a flow chart illustrating an embodiment of an adaptive writing method . first , a write mode is set ( step s 101 ). if the write mode is set , it is determined whether it is an adaptive writing mode or not ( step s 102 ). if it is determined in step s 102 that the write mode is an adaptive write mode , a grouping pointer is set ( step s 103 ). then , a grouping table depending on the set grouping pointer is selected ( step s 104 ). the selected grouping table may be a table reflecting land / groove as well as the grouping pointer . also , the selected grouping table may be a table reflecting zones of the recording medium . shift values of the rising edge of the first pulse are read from the table shown in fig6 in accordance with a combination of the present mark and the leading space ( step s 105 ), and shift values of the falling edge of the last pulse are read from the table shown in fig7 in accordance with a combination of the present mark and the trailing space ( step s 106 ). the adaptive write pulse in which the first pulse and the last pulse are controlled in accordance with the read shift value is generated ( step s 107 ). then , the light powers of the respective channels for the generated adaptive write pulse , i . e ., read , peak and bias powers , are controlled to drive a laser diode ( step s 108 ) to then perform a write operation on a disc ( step s 109 ). if the write mode is not an adaptive write mode , a general write pulse is generated in step s 107 . fig9 is a graph for comparing jitter generated by the adaptive writing method according to fig8 and the conventional writing method . it is understood that , assuming that the peak light is 9 . 5 mw , the bottom power of a multi - pulse train is 1 . 2 mw , the cooling power is 1 . 2 mw and the bias power is 5 . 2 mw , there is less jitter generated when writing the adaptive write pulse according to fig8 than when generated writing the fixed write pulse according to the conventional writing method . the initialization conditions are a speed of 4 . 2 m / s , an erase power of 7 . 2 mw and 100 write operations . in other words , according to the examples described above , in adaptively varying the marks of a write pulse , the rising edge of the first pulse is adaptively shifted in accordance with the magnitude of the leading space and the magnitude of the present mark of input nrzi data to thus control the waveform of the write pulse , and / or the falling edge of the last pulse is adaptively shifted in accordance with the magnitude of the present mark and the magnitude of the trailing space of input nrzi data to thus control the waveform of the write pulse , thereby minimizing jitter . also , the waveform of the write pulse may be optimized in accordance with land / groove signals . also , in the examples described above , grouping may be performed differently for the respective zones , using grouping pointers . a new adaptive writing method according to the examples described above can be adopted to most high - density optical recording apparatuses using an adaptive writing pulse . as described above , the widths of the first and / or last pulses of a write pulse waveform are varied in accordance with the magnitude of the present mark of input nrzi data and the magnitude of the leading or trailing space , thereby minimizing jitter to enhance system reliability and performance . also , the width of a write pulse is controlled by grouping the magnitude of the present mark and the magnitude of the leading or trailing spaces , thereby reducing the size of a hardware . according to the examples described above , an adaptive writing method of a write pulse generated in accordance with the magnitude of the present mark of input data and the magnitudes of the leading and / or trailing spaces thereof may be provided . further , according to the examples described above , an adaptive writing circuit for a high - density optical recording apparatus may be provided for optimizing light power of a laser diode by generating an adaptive write pulse in accordance with the magnitude of the present mark of input data and the magnitudes of the leading and trailing spaces thereof . a number of examples have been described above . nevertheless , it will be understood that various modifications may be made . for example , suitable results may be achieved if the described techniques are performed in a different order and / or if components in a described system , architecture , device , or circuit are combined in a different manner and / or replaced or supplemented by other components or their equivalents . accordingly , other implementations are within the scope of the following claims .

6Physics

the following description describes in detail , a new , low cost abs system that deviates from the baseline prior art eight / six - valve type that uses two solenoid valves per abs control channel , to a four / three - valve type that uses one solenoid valve per abs control channel . this is achieved in - part , by focusing cost reduction efforts on changing from the conventional apply - hold - release type of wheel rotational control to an apply - release type of wheel rotational control . additional cost reductions are achieved through the preferred elimination of pump inlet accumulators that are normally associated with closed - loop hydraulic recirculation type systems , and by subsequent sizing of pump capacity for instantaneous wheel brake release flow rates . this concept also has the additional benefits of improving back - up operations , eliminating normally closed valves and their associated stringent , static leak rate requirements , and making the unit easier to process at vehicle manufacturing assembly plants through the elimination of discrete , normally closed hydraulic passageways in the modulator . referring to the drawings , illustrated in fig1 is a braking system 10 that is hydraulically arranged in a diagonally split configuration . the braking system 10 includes a conventional master cylinder assembly 12 and four wheel brakes 14 - 17 . a front wheel brake 15 and a rear wheel brake 17 are connected to the primary chamber of the master cylinder 12 through port 18 . additionally , a front wheel brake 14 and a rear wheel brake 16 are connected to the secondary chamber of master cylinder 12 through port 19 . a series of conduits provide a passageway between the port 18 and wheel brake 15 through a normally open solenoid operated valve 20 . in addition , the wheel brake 15 is connected directly to the inlet of a motor driven pump assembly 21 with no valves and no flow restrictive orifices of any kind existing in the fluid passageway between the wheel brake 15 and the pump assembly 21 . a flow restrictive orifice is a device such as an orifice plate or a valve that has a reduced or reduceable cross sectional opening in the flow stream when compared to the passageway . the outlet of the pump assembly 21 communicates with the master cylinder 12 at port 18 and with the normally open valve 20 , through flow passageways provided by a series of interconnected conduits . port 18 of master cylinder 12 is also connected with wheel brake 17 through normally open solenoid operated valve assembly 22 . additionally , wheel brake 17 is connected to the inlet of motor driven pump assembly 23 with no valves and no flow restrictive orifices of any kind existing in the fluid passageway between the wheel brake 17 and the pump assembly 23 therebetween . the outlet of pump assembly 23 is connected to port 18 of master cylinder 12 and to solenoid valve 22 through fluid passageways provided by a series of interconnected conduits . an optional damper assembly 24 is provided near the outlets of pump assemblies 21 and 23 if preferred , and operates to reduce the effects of any noise created by the operation of pumps . in a similar manner , wheel brake 14 is connected with port 19 of master cylinder 12 through a flow passageway consisting of a number of interconnected conduits that includes normally open solenoid operated valve 25 . wheel brake 14 is connected directly with the inlet of motor driven pump assembly 26 with no valves and no flow restrictive orifices of any kind existing in the fluid passageway between the wheel brake 14 and the pump assembly 26 . the outlet of pump assembly 26 is connected with the port 19 of master cylinder 12 and the valve 25 through fluid passageways provided by a series of interconnected conduits . additionally , wheel brake 16 is connected with port 19 of master cylinder 12 through a flow passageway provided by a series of interconnected conduits that includes normally open solenoid operated valve assembly 27 . wheel brake 16 is also connected directly to the inlet of motor driven pump assembly 28 with no valves and no flow restrictive orifices of any kind existing in the flow passageway between the wheel brake 16 and the pump assembly 28 . the outlet of pump assembly 28 is connected back with the port 19 and with the valve 27 through flow passageways consisting of a series of interconnected conduits . an optional damper assembly 29 is provided near the outlets of pumps 26 and 28 if preferred , and operates to reduce the effects of any noise generated by the operation of pumps . the braking system 10 provides four abs control channels so that each of the wheel brakes 14 - 17 is independently modulated as determined by the operation of an electronic controller as is known in the art . referring to fig2 another braking system 30 is arranged in a three - channel front - to - rear split configuration . the primary chamber of master cylinder assembly 31 is connected to wheel brake 32 and wheel brake 33 through port 34 . the secondary chamber of master cylinder assembly 31 is connected to wheel brake 35 and wheel brake 36 through port 37 . wheel brake 32 is connected to port 34 through a flow passageway consisting of a series of interconnected conduits which include a normally open solenoid operated valve 38 . wheel brake 32 is also directly connected to the inlet of motor driven pump assembly 39 through a flow passageway consisting of a series of interconnected conduits with no valves and no flow restrictive orifices of any kind existing in the passageway between wheel brake 32 and pump assembly 39 . the outlet of pump assembly 39 is connected back with port 34 of master cylinder assembly 31 and with the valve 38 through flow passageways consisting of a series of interconnected conduits . wheel brake 33 is connected with port 34 of master cylinder assembly 31 through a flow passageway consisting of a series of interconnected conduits that include normally open solenoid operated valve 40 . wheel brake 33 is also connected to the inlet of motor driven pump assembly 41 through a flow passageway consisting of a series of interconnected conduits with no valves and no flow restrictive orifices of any kind existing in the passageway between wheel brake 33 and pump assembly 41 . the outlet of pump 41 is connected back with the port 34 and the valve 40 through flow passageways consisting of a series of interconnected conduits . an optional damper assembly 42 is provided near the outlets of pumps 39 and 41 if preferred , and operates to reduce the effects of noise generated by operation of the pumps . wheel brakes 35 and 36 are interconnected and are commonly connected with the port 37 of master cylinder assembly 31 through a flow passageway consisting of a series of interconnected conduits that include the normally open solenoid operated valve 43 . wheel brakes 35 and 36 are also directly connected with the inlet of motor driven pump assembly 44 through a flow passageway comprising a series of interconnected conduits that do not contain any valves or flow restrictive orifices of any kind . the outlet of pump 44 is connected back with the port 37 and the valve 43 through flow passageways consisting of a series of interconnected conduits which may include an optional damper assembly 45 positioned near the outlet of pump 44 . referring to fig3 the braking system 10 of fig1 is schematically illustrated in greater detail . the master cylinder 12 and the wheel brakes 14 - 17 are hydraulically connected to various ports of the modulator assembly 50 . the valves 20 , 22 , 25 , and 27 along with the optional damper assemblies 24 and 29 and the pumps 21 , 23 , 26 and 28 are all carried in the modulator assembly 50 . the valves 20 , 22 , 25 and 27 each include a body 71 that is received within a stepped bore of the modulator 50 . each body 71 includes a longitudinal bore and a transverse bore intersecting the longitudinal bore . an opening of each longitudinal bore is covered by a filter and an opening of each transverse bore is covered by an annular filter that exists in the various annular spaces 54 , 58 , 62 and 67 . a seal is provided between the body 71 and the modulator 50 within the step bore . the body 71 includes an annular shoulder that sits within a step for accurately setting the depth of the valves 20 , 22 , 25 and 27 within the modulator 50 . peening , staking , or other suitable processes are used to form the modulator base material over the top of the solenoid valve body shoulder to positively retain the valve body 71 in the stepped bore . a cylindrical sleeve with a closed end is received over the body 71 . an armature 72 is slidably received in the cylindrical sleeve and is biased towards the closed end by a spring . the spring bears against a fixed support . a rod is carried by the armature and extends through the spring and support with an end interacting with the valve seat to provide a flow control mechanism in the hydraulic componentry of the valves 20 , 22 , 25 and 27 between the internal longitudinal and transverse bores . a seal is carried by the valve body 71 and provides a one - way bypass around the valve seat acting as an internal check for flow from the various wheel brakes to the master cylinder . the magnetic circuit of the solenoid valves 20 , 22 , 25 and 27 each includes an end plate , a case , the valve body 71 and the armature 72 . the primary air gap is provided between the armature 72 and the valve body 71 . the secondary air gaps are provided by the nonmagnetic sleeve and the space between the armature 72 and the end plate , and at the juncture between a case extension and valve body 71 . a preferred configuration of the valves 20 , 22 , 25 and 27 are more fully described in u . s . patent application ser . no . 08 / 763137 entitled solenoid coil positioning assembly , which is assigned to the assignee of the present invention and is specifically incorporated herein by reference . port 18 of master cylinder 12 is open directly to the cavities of modulator 50 that carry valves 20 and 22 . since the valves 20 and 22 are normally open , a normally open connection is provided directly to the wheel brake 15 and 17 . the wheel brake 15 is connected directly back to the pump assembly 21 through conduit 51 , port 52 and conduit 53 . fluid freely flows through the conduit 53 around the valve 20 via annular space 54 . wheel brake 17 is connected directly back to the pump assembly 23 through conduit 55 , port 56 and conduit 57 . fluid freely flows through conduit 57 around the valve 22 via the annular space 58 . port 19 of master cylinder assembly 12 is connected directly to the cavities of modulator 50 that carry the valves 25 and 27 . wheel brake 14 is connected to the pump assembly 26 through conduit 59 , port 60 and conduit 61 . fluid freely flows through the conduit 61 around valve 25 via annular space 62 . wheel brake 16 is connected to pump assembly 28 through conduit 63 , port 64 and conduit 65 . fluid freely flows through the conduit 65 around valve 27 via annular space 67 . an electronic control unit 68 is associated with the braking system 10 and communicates with wheel speed sensors at each of the wheels corresponding to the wheel brakes 14 - 17 and with the valves 20 , 22 , 25 , and 27 to control wheel brake pressure in a pre - programmed manner as is known in the art . the internal conduits of the modulator 50 are shown to clarify operation of the braking system 10 but will likely be provided out of a single plane in the modulator 50 and will be provided by simplified straight bore segments . the abs design approach as shown in fig1 - 3 allows for the elimination of relatively expensive components , including normally closed abs release valves , pump inlet accumulators , and as previously noted , leads to the optional elimination of pump outlet damper assemblies . one method for packaging the four pump element approach is shown in fig3 . this design uses an abs radial piston pump with the four pumps 21 , 23 , 26 and 28 arranged at 90 degrees relative to one another . this arrangement is an advantageous design for high volume manufacturability due to the completely orthogonal layout for ease of machining and assembly . other possibilities include radial designs with other - than 90 degree layout and an &# 34 ; opposed four &# 34 ; layout where the elements are side - by - side . for front - rear hydraulic split configurations ( as shown in fig2 ), that are normally associated with rear - wheel - drive vehicles , a preferred 120 degree symmetric , and other non - symmetric layouts are also possible . still another scheme is to utilize an axial piston pump with 3 or 4 pistons and corresponding independent inlets and outlets to keep channels separated ( not illustrated ), that run on an appropriate dry swash plate with roller thrust bearings . these arrangements allow a competitively packaged unit for a low cost market . referring to fig4 - 6 , an individual abs control channel representative of the abs control channels of the braking systems 10 and 30 , is shown without the optional damper assemblies . the hydraulic configuration is such that in the base brake mode of operation , no electrical power for the hydraulic modulator 50 is required for manual operation . in fig4 it can be observed that with no power being supplied to the pump 81 , and with the normally open valve 82 de - energized , fluid flow and pressure transmission occurs directly between the master cylinder 80 and the wheel brake 83 in both the apply and release directions , allowing normal base brake operation . fluid flow is prevented through the passageway between wheel brake 83 and pump assembly 81 , by the pump assembly 81 . abs is initiated for example , when an excessive amount of wheel rotational error such as skid or slip is detected by the electronic control unit that continuously monitors wheel speed sensors as shown in fig3 . the electronic control unit in turn commands the hydraulic unit to begin wheel pressure modulation . as demonstrated by fig5 the pump 81 is immediately turned on and the normally open valves of all wheels where immediate pressure reduction is required are energized to close . this is represented in fig5 by the energization of valve 82 . fluid flow and pressure transmission from the master cylinder 80 to the wheel brake 83 is prevented by the valve 82 . abs release action has the effect of reducing the line pressure at the pump inlet and in response , at the wheel brake ( s ) where pressure reduction is required . the instantaneous pressure release rate is kinematically defined by pump flow rate and by caliper compliance . once sufficient pressure reduction has occurred at the wheel brake ( s ) that have fallen under abs control , the associated wheel is allowed to begin to re - accelerate . as demonstrated by fig6 the normally open valve 82 is de - energized and fluid is forced to the wheel brake 83 by the pressure differential between the master cylinder / pump outlet and the wheel brake . the valve 82 is sized sufficiently large so that a fully open valve allows a predetermined pressure apply rate at the wheel for fast disturbance recovery . additionally , the valve &# 39 ; s opening is sized so that when the valve is fully open during an abs cycle , and simultaneously the pump is continuously running , the pressure drop across the valve due strictly to pump flow rate is sufficiently small so that high wheel pressures are maintained during the period of full circulation . with these solenoid valve design conditions in place , periodically pulsing the valve open ( i . e . momentarily de - energizing and re - energizing in prescribed patterns ), obtains the desired apply pressure build rate . if the valve is pulsed fast enough , at a high enough frequency through known pulse width modulation control , the inlet flow to the wheel is regulated in an analog fashion . this is similar to having an instantaneously variable orifice , as opposed to a more discrete on / off type of conventional control which tends to be less smooth and more noise - prone in operation . this type of valve control is especially beneficial for the present apply - release type of system . this is because there is usually a fairly high period of activity defining the duty cycle , which is associated with flow control during wheel pressure apply cycles . when required , the electronic control unit uses pulsed operation of the valve 82 to adjust the valve equivalent flow rate so that it equals the pump flow rate . as a result , the system maintains a set pressure at the wheel brake 83 for improved algorithm control . new abs systems according to the present invention use the design concept of an independent , normally open valve and a single pump element hydraulic circuit for each abs control channel . this simplified and direct approach to wheel control has a number of inherent design advantages . the maintenance of independent wheel pressure modulation control results from the pump and valve arrangement . the provision of a simplified hydraulic default to base brakes condition results from the hydraulic layout . hydraulic system complications related to leakage and debris handling are reduced with the removal of the normally closed valves from the hydraulic circuit . eliminating the cost of pump inlet accumulators is made possible . the optional elimination of pump outlet dampers which are typically used to reduce noise and brake pedal pulsations generated by pump outlet flow surges , is possible since the three or four total pump flow pulses per revolution will be individually smaller and in the case of four pumps , may be spaced at 90 degree intervals versus the usual conventional two larger pump flow pulses per revolution spaced at 180 degree intervals . additionally , the pump elements can be sized for individual wheel compliance conditions to minimize total power consumption .

8General tagging of new or cross-sectional technology

systems and methods for molecular self - assembly are described below for use in forming material ( s ) on a substrate . the use of the systems and methods for molecular self - assembly , collectively referred to herein as “ molecular self - assembly ,” enables production of very small structures and features on substrates ( e . g ., at the nanometer size scale ) at very low cost , which can be useful in the commercial manufacturing of a variety of products , such as electronic components and flat panel displays . a system for performing molecular self - assembly is referred to herein as a “ molecular self - assembly system ” or “ msas ” and examples of such systems are described in the related applications and elsewhere herein . the molecular self - assembly described herein includes thin film deposition methods for use in the manufacture of integrated circuits , semiconductor devices , flat panel displays , optoelectronic devices , data storage devices , magnetoelectronic devices , magnetooptic devices , molecular electronic devices , solar cells , photonic devices , packaged devices , and the like . the molecular self - assembly of an embodiment provides for formation of a conformal thin film of a desired composition and thickness on a substrate by initially forming a layer comprised of nanometer scale particles and subsequently treating the formed layer so as to coalesce the nanometer scale particles and remove any undesired constituents to form a conformal thin film with the desired composition and thickness . the molecular self - assembly of an embodiment provides a molecularly self - assembled layer ( referred to herein as a msal ) on a substrate . the msal is formed using one or more processes described herein between at least one dielectric material and at least one electrically conductive material and creates one or more of an interfacial layer , diffusion barrier and / or adhesion layer between the dielectric ( s ) and electrically conductive material ( s ). the msal is for use in forming metal interconnections between electrical elements ( e . g ., transistors , capacitors ) formed in or on a semiconductor substrate but is not so limited . the msal of an embodiment is produced by forming a layer of material ( referred to as msal material ) on one or more regions of a dielectric , where constituents of the msal material have a characteristic dimension relative to the size of the pores in the dielectric material that inhibits diffusion into the dielectric material . the msal formation continues with annealing of the formed msal to effect desired chemical , electrical , and / or mechanical changes . the msal of an embodiment formed in this manner can eliminate the need to provide a deposited barrier layer together with the molecularly self - assembled layer between the dielectric and electrically conductive materials . the msal of an alternative embodiment is formed on a substrate , together with a deposited barrier layer , between dielectric material and electrically conductive material , as described below . the combination of the msal together with the deposited barrier layer can produce diffusion barrier and / or adhesion layer capabilities comparable to , or better than , those provided by a deposited barrier layer produced in a conventional manner ( e . g ., using pvd , ald , or a combination of the two ). the msal of an embodiment is formed to seal pores at the surface of a porous dielectric material to prevent or inhibit diffusion of material into the dielectric material via the exposed pores . as an example , use of the msal to seal pores provides a barrier to reactants used in an ald process or other chemical - based process that forms a deposited barrier layer . the msal that seals pores is formed using a molecule having an appropriate inorganic or organic backbone and / or appropriate head group , as described in detail below . this pore sealing msal seals pores formed in a porous dielectric material so that the barrier to reactant diffusion into the porous dielectric material is about the same as , or better than , that into a non - porous dielectric material ( e . g . silicon dioxide , fsg , etc .) without the msal . the pore sealing msal therefore enables or facilitates use of porous dielectric materials with relatively low dielectric constants that are increasingly being used in semiconductor substrates . the msal of an embodiment provides good adhesion properties with respect to one or more materials adjacent to the msal ( e . g ., dielectric material , deposited barrier layer , electrically conductive material , etc .). for example , the msal can provide adhesion properties between the electrically conductive material and the dielectric material that are better than those provided by a conventional deposited barrier layer . the msal adhesion properties thus can inhibit delamination of the electrically conductive material from the dielectric material . the msal also can provide good adhesion properties to a barrier layer that is formed on the msal . this can be accomplished , for example , by forming the molecularly self - assembled layer using a molecule having an appropriate head group ( for covalent bonding to dielectric material ) and an appropriate terminal group ( for covalent bonding to the barrier layer ), as described in detail below . the improved adhesion provided by the msal improves the reliability of the structure and , therefore , the host device as a result of the increased strength of the bonds at parts of the device where one or more interfaces connect an electrically conductive material to a dielectric material ( e . g ., as occurs for metal interconnections between electrical elements ). the msal of an embodiment can be selectively formed on a dielectric material and not on any exposed electrically conductive material ( e . g ., metal at the bottom of vias ), as described below . the selective formation of the msal allows the msal to act as a passivation layer during a subsequent wet cleaning process . the wet cleaning process , for example a reactive wet etch process , is typically used to clean electrically conductive material exposed by an opening in the dielectric material . the selectively formed msal can prevent damage to the dielectric material and / or absorption of moisture or etch chemicals into the dielectric layer during this process . the substrate can include any type of material or substrate , for example silicon substrates , silicon - on - insulator substrates , silicon carbide substrates , strained silicon substrates , silicon germanium substrates , and gallium arsenide substrates , etc . in particular , the molecular self - assembly of an embodiment can be used in the processing of semiconductor substrates as is commonly done in the manufacture of components for use in the electronics industry . the molecular self - assembly can also be used in the processing of a substrate for use in the production of a flat panel display . the term “ substrate ” is used herein to refer to a material having a rigid , semi - rigid , or flexible surface . in one embodiment , the substrate can include supporting material ( s ) ( such as a wafer ) upon or within which a component or number of components is fabricated or to which a component is attached . in another embodiment , the substrate can include the supporting material ( s ) and the component ( s ). the substrate includes for example a plate , wafer , panel and / or disk of suitable material on and / or in which the components of a unit , such as an integrated or printed circuit , are deposited or formed . a flexible substrate can include plastic or polymeric material , for example flexible materials used in displays or other flexible integrated circuit ( ic ) applications . at least one surface of the substrate of embodiments will be substantially flat , although in some embodiments it may be desirable to physically separate synthesis regions for different materials with , for example , dimples , wells , raised regions , etched trenches , or the like . in some embodiments , the substrate itself contains wells , raised regions , etched trenches , etc . the term “ process ” or “ processing ” is used herein to refer to a finite course of actions , operations , events , and / or changes defined by purpose or effect . “ process ” or “ processing ” is used herein to include , but not be restricted to , providing a processing material to a region and / or modifying a region . processing specifically includes physical modifications , chemical modifications , electrical modifications , thermal modifications , magnetic modifications , and photolytic modifications , more specifically cleaning , surface modification , surface preparation , deposition , dispensing , reaction , functionalization , etching , planarization , chemical mechanical planarization , electrochemical mechanical planarization , lithography , patterning , implantation , thermal treatment , irradiation , such as infrared ( ir ) treatment , ultraviolet ( uv ) treatment , electron beam treatment , and x - ray treatment , and more specifically electrochemical deposition , electroless deposition , physical vapor deposition , chemical vapor deposition , atomic layer deposition , and evaporation . processing conditions are those conditions , such as temperature , time , pressure , material phase , amount , component ratio , etc ., under which processing occurs . processing as used herein can refer to a series of processes performed in a unique order and / or combination to effect a desired end result , for example , to form or modify structures , test structures , devices , integrated circuits , etc . processing includes conditions that are those conditions such as temperature , time , pressure , material phase , amount , component ratio , etc ., under which a sequence of processes occurs . processing as used herein further includes combinatorial process sequence integration for i ) evaluating different materials , ii ) evaluating different processing conditions , iii ) evaluating different sequencing and integration of processes ( with respect to both modules within a tool and to a plurality of tools in a process flow ), and combinations thereof , for such used as in the manufacture of devices such as ics . the term “ structure ” is used herein to refer to an arrangement , organization , and / or placement of one or more parts and / or elements . the structure can include topographical features , such as vias , holes , lines , trenches , and test structures , useful for extracting information about a process , identifying process problems , and improving a process as well as device performance . in the following description , numerous specific details are introduced to provide a thorough understanding of , and enabling description for , embodiments of the molecular self - assembly . one skilled in the relevant art , however , will recognize that these embodiments can be practiced without one or more of the specific details , or with other components , systems , etc . in other instances , well - known structures or operations are not shown , or are not described in detail , to avoid obscuring aspects of the disclosed embodiments . fig1 is a flow diagram for use of a msal with a barrier layer in producing 100 an interconnection ( e . g ., a copper interconnection ) between electrical elements formed in or on a semiconductor substrate , under an embodiment . generating 100 the interconnections includes forming 101 a structure ( e . g ., trenches , vias , etc .) in a dielectric material ( e . g ., silicon dioxide ). the structure can be formed for example by etching but is not so limited . a msal is formed 102 on the dielectric material , as described in detail below . a deposited barrier layer is formed 103 on the msal . the deposited barrier layer of an embodiment is a tantalum , tantalum nitride , tantalum carbon nitride , tungsten nitride , tungsten carbon nitride , or ruthenium layer formed using ald , but the embodiment is not so limited . electrically conductive material is formed 104 on the deposited barrier layer to fill in vias and trenches . the electrically conductive material can include metals like copper , ruthenium , tungsten , and / or aluminum , etc . the electrically conductive material of an embodiment can be formed 104 at one time using one process or , alternatively , the electrically conductive material can be formed in two or more steps using two or more processes . for example , the electrically conductive material of an embodiment can be formed 104 by forming a seed layer of copper ( via e . g . pvd , ald , cvd , etc .) on the deposited barrier layer and then filling the vias and trenches with copper using a bulk formation process ( e . g . electroless deposition , electroplating , and combinations thereof , etc .). alternatively , for example , if the barrier layer is formed using a material such as ruthenium , the electrically conductive material of an embodiment can be formed 104 by forming copper to fill the vias and trenches in a single process . fig2 a through 2d are cross - sectional views of a substrate 200 showing use of a msal in the formation 100 of interconnects between elements in or on the substrate , under an embodiment . fig2 a is a cross - sectional view of the substrate 200 that includes trenches 201 and vias 202 formed in a dielectric material 203 of the substrate 200 . an electrically conducting material layer 299 ( e . g ., copper line ) underlies the dielectric material 203 in this example . also , the structure shown is a dual damascene interconnect structure but the molecular self - assemble described herein is not limited to this interconnect structure . fig2 b is a cross - sectional view of the substrate 200 including a msal 207 formed on the dielectric material 203 , under an embodiment . fig2 c is a cross - sectional view of the substrate 200 including a barrier layer 204 formed on the msal 207 , under an embodiment . fig2 d is a cross - sectional view of the substrate 200 including electrically conductive material 206 formed in the trenches 201 and vias 202 over the barrier layer 204 , under an embodiment . the msal of an alternative embodiment is formed on a substrate between dielectric material and electrically conductive material , and does not include use of a deposited barrier layer . fig3 is a flow diagram for use of a msal in producing 300 an interconnection ( e . g ., a copper interconnection ) between electrical elements formed in or on a semiconductor substrate , under an embodiment . generating 300 the interconnections of an embodiment includes forming 301 one or more structures ( e . g ., trenches , vias ) in a dielectric material ( e . g ., silicon dioxide ). a msal is formed 302 on the dielectric material . electrically conductive material ( e . g ., a metal such as copper ) is formed 303 on the msal to fill in the vias and trenches . the electrically conductive material of an embodiment can be formed 303 at one time using one process or , alternatively , the electrically conductive material can be formed in two or more steps using two or more processes . for example , the electrically conductive material of an embodiment can be formed 303 by first forming a seed layer of copper on the deposited barrier layer and then filling the vias and trenches with copper using a bulk formation process . alternatively , for example , if the barrier layer is formed using a material such as ruthenium , the electrically conductive material of an embodiment can be formed 303 by forming copper to fill the vias and trenches in a single process . fig4 a through 4c are cross - sectional views of a substrate 400 showing use of a msal in the formation 300 of interconnects between elements in or on the substrate , under an embodiment . fig4 a is a cross - sectional view of a substrate 400 in which a trenches 401 and vias 402 are formed in a dielectric material 403 of the substrate 400 . an electrically conducting material layer 499 ( e . g ., copper line ) underlies the dielectric material 403 in this example . also , the structure shown is a dual damascene interconnect structure but the molecular self - assemble described herein is not limited to this interconnect structure . fig4 b is a cross - sectional view of the substrate 400 with a molecularly self - assembled layer 407 formed on the dielectric material 403 , under an embodiment . fig4 c is a cross - sectional view of the substrate 400 including electrically conductive material 406 formed in the trenches 401 and vias 402 over the molecularly self - assembled layer 407 , under an embodiment . fig5 is a flow diagram for forming 500 a msal as a diffusion barrier and / or adhesion layer between electrically conductive and dielectric materials , under an embodiment . a structure ( s ) ( e . g ., trenches , vias , etc .) is formed in a dielectric material of a substrate ( as described above ), and generation of the msal includes preparing 501 the exposed surface of the dielectric material prior to formation of the msal . preparation 501 of the exposed surface can include preparation of the surface of electrically conductive material exposed at the bottom of the structure formed in the dielectric material , as described below . a layer of material is formed 502 on the dielectric material using molecular self - assembly as described herein . the msal can be formed as a monolayer ( e . g ., a self - assembled monolayer ( sam )) or a multilayer . the material of the msal can be organic or inorganic material , but is not so limited . formation 502 of the material of the msal can include functionalizing a terminal group of the molecularly self - assembled layer but is not so limited . functionalization of a material as used herein refers to modifying the characteristics of an exposed part of the material to achieve a desired interaction with another material subsequently formed on the exposed part of the material . post - processing 503 is performed on the material of the msal prior to formation of additional material ( e . g ., barrier layer , electrically conductive interconnect material ) on the msal . generation 500 of the msal can be implemented using any of a variety of processes and techniques , such as are described in the related applications referenced above . for example , the msal can be generated 500 using wet processing ( e . g ., immersion of a substrate in a chemical bath , spraying or spinning of chemical fluid on to a substrate ), dry processing ( e . g ., vapor deposition ), and / or various combinations of wet and dry processing . the preparation 501 of an exposed surface of a dielectric material for formation 500 of a msal can include one or more of a variety of processes . for example , the surface of the dielectric material can be cleaned using any of a variety of processes ( e . g . acidic chemistries , basic chemistries , and / or combinations thereof ) to remove any contaminants ( e . g . organic , inorganic , metallic , etc .) produced during formation of the structure in which the electrically conductive material is to be formed . these contaminants can include , for example , residual material left after etching of the dielectric material or ashing used to remove photoresist . preparation 501 can also include functionalization of the surface of the dielectric material to inhibit the diffusion of chemicals used in subsequent processing of the substrate into the dielectric material . functionalization can be necessary or desirable , for example , if subsequent processing of the substrate makes use of aggressive chemistries that may otherwise diffuse into and / or damage the dielectric material . such functionalization can itself inhibit diffusion into the dielectric material of other materials . additionally , functionalization of the surface of the dielectric material can facilitate selective formation of the msal on the dielectric material and / or improve the adhesion of the dielectric material to the msal . the particular manner in which the dielectric material is functionalized can depend on the nature of the dielectric material , the nature of the msal to be formed , and the desired characteristics ( s ) ( e . g ., adhesion properties ) to be produced . for example , the surface of a silicon dioxide - based dielectric material can be functionalized to produce a large number of hydroxyl ( i . e . oh ) groups at the surface of the dielectric material to which the msal has an affinity for attachment , thus promoting formation of the msal on the dielectric material . surface preparation 501 can also include performing an etch process ( e . g ., wet process ) to remove unwanted material formed on exposed electrically conductive material ( e . g ., metal at the bottom of vias ). the unwanted material may be present from prior processing of the substrate . the etch process can include , for example , a reactive etch process ( e . g ., wet ) but is not so limited . such etching can also be performed to etch down into exposed electrically conductive material to enhance mechanical attachment of electrically conductive material subsequently formed thereon and improve electro - migration reliability . if the surface preparation includes such etching , then cleaning can also be performed again after the etching . regarding formation 502 of the msal as described above with reference to fig5 , the type and characteristics of the molecule ( s ) used to form the msal can be chosen to produce desired properties of the molecularly self - assembled layer . the characteristics of the molecule can include such characteristics as the head group , terminal group and / or length ( e . g ., the number of carbon atoms in the organic backbone portion of the molecule ) of the molecule . the characteristics of the msal of an embodiment can thus be established to produce desired adhesion properties , pore sealing capabilities , diffusion barrier capabilities , and / or passivation capabilities of the msal . to produce desired properties of the msal , the manner in which the msal is tailored ( i . e ., the characteristics that are established ) can depend on the nature of the dielectric material on which the msal is to be formed and the nature of the material ( e . g ., deposited barrier layer ) to be subsequently formed on the msal . for example , a msal can be formed that seals the pores of a porous dielectric material . the porous dielectric material can have pores that are open or closed , oriented in any direction and with any shape , and possess various levels of interconnectivity . in addition , the volumetric pore fraction in the dielectric material can vary , typically less than or equal to approximately 50 percent ( 50 %) in order to maintain structural integrity . the chain length ( e . g ., the number of carbon atoms formed in a chain ) and / or the head group of the molecule used to form the msal can be established so that the presence of the msal will seal some or all of the pores at the surface of the dielectric material . for example , the length of the carbon chain in an organic molecule can be specified to be long enough relative to the size ( typically ranging from greater than or equal to approximately 10 å to less than or equal to approximately 25 å in diameter ) of the exposed pores at the surface of a porous dielectric material to ensure that those pores ( at least an adequate number ) are sealed . additionally , the msal can be formed so that the molecules are cross - linked . this can be done during formation , functionalization , or post - processing of the msal . the msal can also be tailored to produce desired adhesion properties with respect to the dielectric material . in particular , the head group of the molecule used to form the msal can be established to provide good adhesion to the dielectric material . for example , a head group can be established that covalently bonds with an exposed hydroxyl group of a dielectric material . the msal can also be tailored to produce desired adhesion properties with respect to a material to be formed on the msal ( e . g ., a deposited barrier layer , electrically conductive interconnect material , etc .). in particular , the terminal group of the molecule used to form the msal can be established ( e . g ., the molecule specified to include a particular terminal group and / or the terminal group of a molecule functionalized ) to provide good adhesion to the material to be formed on the msal ( e . g ., deposited barrier layer ). the particular terminal group used , or manner of functionalization of a terminal group , can depend on the type of material ( s ) formed on the msal and / or the precursors , reactants , etc . used to form such material ( s ). as an example , a nr x , ( e . g . nh , nh 2 , nrh , etc .) terminal group , where r = h , an organic group , and / or combinations thereof , provides good adhesion to titanium - based materials , tantalum based materials , ruthenium based materials , tungsten - based materials , and / or precursors ( e . g . tdmat , tdeat , pdmat , tbtdet , tbtemt , wf6 , ruthenocenes and their derivatives , metalorganic precursors , etc .) used to form such barrier layer materials . additionally , a thiol terminal group provides good adhesion ( facilitates covalent bonding ) to a copper seed layer , for example , when the msal is implemented without the formation of a deposited barrier layer between the dielectric and electrically conductive materials . molecular self - assembly of an embodiment also forms a msal having good selectivity to a particular type of dielectric material ( which may be without regard to structure or geometry ) and / or to a dielectric material having a particular structure or geometry . the selective msal will have relatively poor affinity to other materials to which it is not selective , for example , exposed electrically conductive material ( e . g ., metal at the bottom of a via ). formation of the selective msal of an embodiment includes , for example , forming and / or functionalizing the dielectric material on which the material of the msal is to be formed and performing the molecular self - assembly in a manner tailored to such formation and / or functionalization . as an example , the dielectric material can be functionalized to promote adhesion to the material of the msal , as discussed above . forming the msal with good selectivity for dielectric material enables the msal to be formed so that it can act as a passivation layer during a subsequent wet cleaning process , preventing for example , etching of the dielectric material , diffusion of etching chemistries into the dielectric material , and / or damage to the dielectric material . a msal is generally a layer that results from the coordinated action of independent molecules under distributed control . molecular self - assembly can refer to the joining of complementary surfaces in nano - molecular action . the characteristics of the msal can be affected by the type of molecule used to form the msal . in general , a molecule can be chosen for use in forming the msal depending on the particular application in which the msal is used , i . e ., the nature of the dielectric material on which the msal is to be formed , the nature of the material ( e . g ., barrier layer ) to be subsequently formed on the msal , and the desired characteristics ( s ) ( e . g ., adhesion properties , pore sealing capabilities , diffusion barrier capabilities , passivation capabilities ) to be produced . for example , thiols are a type of molecule that can be used to form a msal in an embodiment . thiols are advantageous in that they are very well characterized ( e . g ., they are known to grow well on certain materials , they can include any of a number of different groups that can be functionalized to produce particular properties ). certain thiols ( e . g . r — sh , where the organic group r = alkyl , aryl , heteroaryl , functionalized alkyl , functionalized aryl , functionalized heteroaryl , etc .) can be chosen for their relative low thermal break down temperature range ( e . g . approximately 150 ° c .- 250 ° c . range ) which makes them compatible with low dielectric constant and / or porous low dielectric constant materials processing and integration where thermal budget is a concern . for example , a thiol - based msal can be functionalized with an organo - metallic terminal group that leaves only metal ( having a sufficiently high breakdown temperature ) exposed after vaporization of the carbon species of the group . not all thiols have low breakdown temperatures ; for example , some thiols ( e . g . r — sh , where r = fluorinated alkyl , fluorinated aryl , etc .) have a thermal breakdown temperature greater than about 300 degrees celsius . silicon - based molecules ( e . g ., silanes ) are an example of another type of molecule that can be used to form a msal under an embodiment . silicon - based molecules advantageously have higher breakdown temperatures due to the formation of strong si — o covalent bonds ( e . g ., in a range of approximately 250 ° c . to 350 ° c . or above ) than thiols ( typically 150 ° c .- 250 ° c . range ). other covalent bonds which can be formed between a substrate ( e . g . dielectric ) and a msal include si — n , si — c , si — s , o to c groups , etc ., and combinations thereof . the msal can be formed using organosilanes r n — si — x 4 − n , where n = 1 , 2 , 3 , and where the organic group r = h , alkyls , alkenyls , alkynyls , aryls , fluoroalkyls , heteroaryls , fluoroheteroaryls , alcohols , thiols , amines , amides , imines , carboxylic acids , thiocarboxylic acids , thiocarbamates , esters , ethers , sulfides , nitriles , etc . the hydrolyzable group x = halides ( cl , f , br , i , etc . ), carboxylates (— o — co — r 1 ), amines (— nr 2 r 3 ), alkoxides (— o — r 4 , e . g . methoxide , ethoxide , propyloxide , butoxide , phenyloxide , etc . ), sulfides (— s — r 5 ), heteroaryls , fluroroaryls , etc ., and r 1 , r 2 , r 3 , r 4 , r 5 can be independently selected organic groups ( e . g . alkyl , aryl , etc .) as described above for r . the organic substituent r can be selected from linear and / or branched groups having from 1 to about 30 or more carbon atoms . the organic group r n is comprised of a terminal group ( i . e . tail group ) and a linking ( i . e . linker ) group . the linker connects the head group ( e . g . si atom ) to the terminal group . the linker can be of the form ( ch 2 ) n , whereby , n = 0 , 1 , 2 , 3 , 4 . . . or higher , etc . and can be chosen to tailor the effective length and / or size of the msal . the terminal group is attached to the “ tail end ” of the linker . the terminal group can be chosen for particular chemical properties and / or affinity to the subsequent material to be deposited over the msal . the terminal group can also be used to adjust the effective size and / or length of the msal . in some embodiments , the linker and the terminal group are part of and / or are the same substituent . the hydrolyzable group ( e . g . leaving group ) x can be used to adjust the reactivity of the organosilane to the substrate of interest to effect deposition . the hydrolyzable group , in particular , reacts with the surface hydroxyl groups ( oh ) of the substrate to form the msal layer and is liberated in the formation process . certain dielectric films ( e . g . substrates ) have varying amounts of surface hydroxyl groups . the terminal and / or linking groups can be chosen to account for the lower number of hydroxyl attachment sites by choosing polymerizable substituents and / or larger and / or branched substituents ( e . g . phenyls , adamantanes , dendrimers , star polymers , etc .). for cases when n = 1 , i . e . r — si — x 3 , the silanes tend to oligomerize , polymerize and / or crosslink , etc . during and / or after deposition on the substrate . this can result in a more thermally , chemically , and / or physically stable msal layer , in particular after a drying and / or curing process . this can also be advantageous when the msal layer is used to seal the exposed pores of porous dielectric materials . fig6 a shows an organosilane 600 that includes three hydrolyzable groups , under an embodiment . the terminal group 602 ( e . g . organofunctional or functional group ), the linker 604 , the silicon head group 606 , and the hydrolyzable groups 608 of the organosilane 600 are shown . fig6 b shows a msal formation process 610 using an organosilane with three hydrolyzable groups , under an embodiment . the msal formation process 610 includes hydrolysis 620 , condensation 640 ( e . g . oligomerization , polymerization , and / or crosslinking , etc . ), hydrogen bonding 660 , and bond formation 680 ( via e . g . drying , and / or curing , etc . ), but is not so limited . water used for hydrolysis 620 of the organosilane can be from the substrate ( e . g . on the surface ), the ambient , and / or deliberately introduced . alternatively , surface hydroxyl groups of the substrate ( e . g . dielectric material ) can also enable the hydrolysis reaction 620 . the free hydroxyl groups of the silane can condense 640 to form oligomers , polymers , etc . which in turn can attach to the surface of the substrate via hydrogen bonding 660 . finally , dehydration via drying and / or curing , etc . can be used to induce bond formation 680 between the now deposited msal layer and the substrate . in particular , the silicon head group (“— si —”) can covalently bond to the surface of the substrate via such a bond formation process . some particular examples of polymerizable organosilanes include but are not limited to c 12 h 25 sicl 3 and c 18 h 37 si ( och 3 ) 3 . silanes with n = 2 , i . e ., r 1 r 2 — si — x 2 , can also be used to form the msal . for cases when n = 3 , i . e ., r 1 r 2 r 3 — si — x , the silanes do not tend to oligomerize , polymerize and / or crosslink , etc . during and / or after deposition on the substrate which may lead to lower undesired byproducts formation . an example includes r 1 r 2 r 3 — si — x , where x = or ′, nr 1 r 2 , cl , etc . in an embodiment , the organosilanes with one hydrolyzable group are preferred for anhydrous ( e . g . when external source ( s ) of water is not used ) environments . the surface hydroxyl groups of the substrate can drive the msal formation process . fig7 is an example of msal formation 700 using an organosilane with one hydrolyzable group , under an embodiment . silanes including the r 1 r 2 r 3 — si — x type can also be hydrolyzed to form free oh , and / or di - merize to di - siloxanes which in turn can react with the free hydroxyl species of the substrate material to form the msal . organosilanes which do not produce any corrosive byproducts ( e . g . hcl , hf , hbr , etc .) are used as such corrosive byproducts may corrode or otherwise damage conductive and / or metallic surfaces ( e . g . copper , cobalt containing layers , tantalum containing layers , etc .). organosilanes can be chosen with benign leaving ( hydrolyzable ) groups like alkoxy or amines . octadecyldimethyl ( dimethylamino ) silane c 18 h 37 ( ch 3 ) 2 si — n ( ch 3 ) 2 and dodecyldimethyl ( methoxy ) silane c 12 h 25 ( ch 3 ) 2 si — och 3 are some preferred embodiments . trimethoxysilanes and triethoxysilanes are other preferred embodiments . all the aforementioned organosilanes can be tailored to form covalent bonds to hydroxyl ( oh ) containing substrates ( e . g . dielectrics ) by manipulating the hydrolizable groups of the organosilanes . dendrimers , hyper - branched polymers , polymer brushes , and block co - polymers can also be used to form a msal under an embodiment . additionally , ionic or electrochemically - enhanced self - assembled multilayers or monolayers can embody a msal . each of the foregoing can be used to form a msal that has good diffusion barrier properties ( including pore sealing and diffusion barrier capabilities ) and has good adhesion to many types of dielectric materials . as indicated above , the characteristics of the msal ( e . g ., the type of molecule used to form the msal and the characteristics of the molecule , such as the head group , terminal group and / or length , etc .) can be established to produce desired properties of the molecularly self - assembled layer . the desired properties can include but are not limited to adhesion properties , pore sealing capabilities , diffusion barrier capabilities , and passivation capabilities . further , the characteristics of the msal needed to produce desired properties can depend on the nature of the dielectric material on which the msal is to be formed and the nature of the material ( referred to hereinafter as the overlying material ) to be subsequently formed on the msal . thus , given a particular dielectric material and overlying material , the characteristics of the msal can be established based on a specification of the desired properties of the msal . this can be done in a number of ways , some of which are described below . specification of a desired property of the msal can be made by identifying an allowable value or range of values for one or more metrics that represent the presence or absence of that property in the msal . the characteristics of the msal ( e . g ., type of molecule type , molecule head group , molecule tail group , molecule length ) can then be established , for example , as a set of characteristics that produce allowable value ( s ) for the metric ( s ) for each property being specified for the msal ( e . g ., adhesion propert ( ies ), pore sealing capability , diffusion barrier capability , passivation capability ). the desired properties for a msal can have different degrees of importance . this may be reflected , for example , by the use of a particular property or properties to screen sets of characteristics in order to identify candidate sets of characteristics ( and , perhaps , by successively screening sets of characteristics for a series of properties in order of decreasing importance ). for example , in some embodiments , the desired properties of the msal are good pore sealing capability , good adhesion properties ( both to the dielectric and to the overlying layer ), good diffusion barrier capability and good passivation capability , listed in order of decreasing importance . in such embodiments , possible characteristics for a msal could be identified by identifying a first group of sets of characteristics ( each set of characteristics can include , for example , a particular type of molecule , molecule head group , molecule tail group and molecule length ) that can produce desired pore sealing capability . from the first group , a second group of sets of characteristics is identified that can produce desired adhesion properties . continuing , a third group of sets of characteristics is identified from the second group that can produce desired diffusion barrier capability and , from the third group , a fourth group of sets of characteristics is identified that can produce desired passivation capability . the fourth group of sets of characteristics represents the possible characteristics for the msal for a particular application , from which a particular set of characteristics can be chosen for use in that application . the post - processing 503 of the msal , described above with reference to fig5 , includes cleaning of the substrate ( e . g ., cleaning with tmah , tbah , tpah , lioh , koh , and other high ph chemistries , deionized water rinse , ipa rinse , n2 dry ) to remove any undesired material ( e . g ., unreacted molecules used in formation of the molecularly self - assembled layer ). in some circumstances , the cleaning can be effected in such a fashion so as to remove a substantial portion ( e . g ., from about 50 å to 400 å , and more preferably from about 100 å to 250 å ) of the copper at the bottom of the vias or structures of the substrate . this removal of portions of copper from structure bottoms can be used to create the framework for the formation of structural anchors which can be filled during subsequent barrier layer deposition , seed layer deposition , and bulk copper fill . these structural anchors serve to improve ( e . g ., lower ) via resistance and / or via resistance distribution ( e . g ., tighter distribution ), relieve stress concentrations at the via bottom corners , and can provide improved reliability ( e . g . improved electromigration and / or stress migration resistance ). the post - processing can also include other processes as appropriate to the msal . the post - processing 503 can also include a reactive etch process ( e . g ., wet ) using nitric or citric acid for example . this can be done , as described above , to remove unwanted material formed on exposed areas of electrically conductive material . the etching can also be performed to etch down into exposed electrically conductive material to enhance mechanical attachment of electrically conductive material subsequently formed thereon and improve electro - migration reliability . when the post - processing includes etching , cleaning can be performed after the etching . in another embodiment , the msal can be used as a sacrificial layer which can be removed after the exposed electrically conductive material ( e . g . via bottoms ) has been cleaned and / or etched . the post - processing can also include one or more of a vaporization , annealing and / or curing ( e . g ., electron beam or ultraviolet radiation curing ) process under an embodiment . for example , as described above with reference to fig3 , a layer of msal material can be formed and annealed to provide a good barrier to diffusion of material ( e . g . reactants , precursors used in ald , cvd , and the like ) into a porous dielectric material . the msal is formed with material having a characteristic dimension similar to the size of the exposed pores ( typically a maximum of 20 - 50 å in diameter , but more typically , ranging from greater than or equal to approximately 10 å to less than or equal to approximately 25 å in diameter ) in the dielectric material so as to seal and hence , inhibit material diffusion into the dielectric material . the msal can comprise organic material ( s ) possessing carbon chain ( s ) wherein the length ( s ) of said carbon chain ( s ) can be adjusted to effectively control the size of the organic material ( s ) so as to match the pore size and size distribution of the dielectric material and effect efficient sealing of the exposed pores or at least a specified percentage of the exposed pores at the surface of a dielectric material . in an embodiment , the msal can be formed using an organic material having a carbon chain with a length greater than approximately 20 å or greater than approximately 50 å for example . in a particular embodiment , the molecularly self - assembled layer can be formed using an organic material having a carbon chain including a number of atoms approximately in a range of 6 to 25 atoms but is not so limited . in another embodiment , the msal can be formed using an organic material having a carbon chain with a length ranging from approximately 10 å to 30 å . the msal material is annealed after formation for a time and at a temperature sufficient to break down the msal material ( e . g ., to break down the carbon chain ( s ) of a msal made of an organic material ) so that parts of the msal seal pores in the underlying dielectric material . the msal could be functionalized prior to annealing to include a terminal group that , once the msal is broken down , provides a surface having desired adhesion characteristics to facilitate subsequent formation of material on the msal ( e . g ., a metal oxide terminal group can form a nucleation surface for ruthenium subsequently formed on the molecularly self - assembled layer using ald ). the annealing of msal material of an embodiment enables large molecules ( including , but not limited to , the use of clusters of atoms , clusters of functionalized atoms , nanoparticles , functionalized nanoparticles , and the like ) to be used in forming the msal ; this can enhance the sealing of pores in a porous dielectric material while providing a relatively thin msal which facilitates implementation in increasingly small structures . additionally , the thickness of the msal prior to annealing can be tailored to ensure continuity of the msal after annealing . further , materials that break down at relatively low temperatures ( which would otherwise make those materials unusable for some applications ) can be used in forming a msal . as described above , the manufacture of integrated circuits , semiconductor devices , flat panel displays , optoelectronic devices , data storage devices , magnetoelectronic devices , magnetooptic devices , molecular electronic devices , solar cells , photonic devices , packaged devices , and the like require the use of thin film deposition techniques . many of the thin film deposition techniques including but not limited to evaporation , laser ablation , e - beam evaporation , physical vapor deposition ( pvd ) or sputtering , ionized pvd , molecular beam epitaxy ( mbe ), and their derivatives used for such manufacturing allow the formation of substantially pure films with controlled compositions as the deposition species are essentially generated from source material ( s ) substantially representing the desired composition of the resulting deposited film . moreover , these deposition techniques generally rely on the transport of the deposition species in vapor form from the source material ( s ) to the substrate to be coated , whereby the deposition process is essentially line - of - sight . as a result , these aforementioned techniques suffer from step coverage and conformality issues ( e . g . the ability to deposit a film of uniform thickness regardless of the geometry of the substrate and / or features on the substrate to be coated with said film ) as the deposition profile is dependent on the flux and angular distribution of the incoming deposition species . the step coverage and conformality issues are exacerbated when high aspect ratio ( i . e . ratio of feature depth to width ) submicron dimension structures ( e . g . lines , trenches , vias , holes , and combinations thereof ) need to be covered . other thin film deposition techniques such as chemical vapor deposition ( cvd ), plasma enhanced chemical vapor deposition ( pecvd ), sub - atmospheric chemical vapor deposition ( sacvd ), metal organic chemical vapor deposition ( mocvd ), laser assisted or induced cvd , e - beam assisted or induced cvd , atomic layer deposition ( ald ), plasma enhanced atomic layer deposition ( peald ), ion induced atomic layer deposition , and their derivatives may provide in principle advantages in improved step coverage and conformality as these processes are not generally line - of - sight but substantially rely on chemical reaction pathway ( s ) which can be tailored to be substantially less sensitive to the geometry of the substrate and / or features on the substrate to be coated . however , these deposition techniques suffer from the complexities associated with the gaseous precursor ( s ) and chemical reaction pathway ( s ) required to create the thin film which make the formation of substantially pure films of desired composition ( s ) difficult . many of the aforementioned techniques do not offer adequate control of deposition thickness as they can be generally classified as flux and / or time dependent processes as opposed to self - limiting ( as in the case for ald and its derivatives ). as device feature geometries decrease , the ability to accurately control the thickness of the deposited thin films becomes increasingly important . these films may be less than or equal to about 100 å , and more specifically less than or equal to about 50 å , and in some cases less than or equal to about 20 å . moreover , the aforementioned techniques generally require operation under specified environments ranging from sub - atmospheric ( less than 760 torr pressure ) through vacuum levels as low as 10 − 8 torr or below pressures . in addition , many of the aforementioned techniques require the use of plasmas or plasma environments . operation under vacuum and / or the need for plasmas pose additional manufacturing cost , throughout , scaling , and / or other implementation challenges which increase in severity as the size of the substrate increases . the molecular self - assembly of an embodiment provides a number of thin film deposition methods which enable for example compositional control , formation of pure films , formation of highly conformal films , accurate control of film thickness , and scaling to increasing substrate sizes . the thin film deposition methods enabled under the molecular self - assembly described above include molecularly self - assembled layers for pore sealing , improved copper interconnect integration , and copper seed layer formation as more specific examples . each of these thin film deposition methods are described in detail below . the msal of an embodiment provides a method for sealing exposed pores of low - k dielectric materials . the use of low dielectric constant ( i . e . low - k ) materials enable reduction in rc delay , line - to - line capacitance , and power consumption for advanced interconnect technologies such as for copper interconnects . one of the primary means of reducing the dielectric constant is through the introduction of pores or porosity in the dielectric film . this becomes increasingly important for achieving films with dielectric constants less than or equal to approximately 2 . 5 , and more specifically for dielectric constants less than or equal to approximately 2 . 2 . a major challenge in using porous low - k dielectrics in advanced interconnects is their integration with subsequent processing steps . as an example , porous low - k dielectrics are susceptible to precursor penetration during barrier layer formation such as in atomic layer deposition ( ald ), chemical vapor deposition ( cvd ), and other vapor phase deposition processes . this can lead to poisoning of the low - k dielectric , an increase in the effective dielectric constant of the low - k , the inability to form a continuous barrier layer over the low - k , the inability to form a thin and continuous barrier layer over the low - k , etc ., all of which can subsequently lead to poor device performance . porous low - k dielectrics also typically exhibit poor ( e . g ., weaker ) adhesion characteristics to barrier layers and / or liners ( e . g ., ta , ta x c y , ta x n y , ta x c y n z , w , w x c y , w x n y , w x c y n z , ru , etc .) as compared to standard dielectrics ( e . g . sio2 , fsg , etc .) which can lead to poor device reliability ( e . g . degradation in stress migration resistance and / or electromigration resistance ). plasma techniques ( e . g ., post - etch treatments ) can be used to modify the exposed surfaces of the porous low - k material so as to effectively close the pores . however such techniques often lead to structural damage and / or effective chemical damage ( e . g ., removal of si — c , si — chx , etc . type bonds and conversion to si — o , si — oh type bonds ) to the near surface layer ( ranging from 50 å to 200 å in depth ) so as to increase the effective dielectric constant to make implementation of the porous low - k dielectric unattractive . other techniques require the deposition of a conformal physical layer to effectively seal the exposed pores . such techniques require a subsequent etch - back step to remove the material from the bottom of vias , and the subsequent etch - back step adds to cost and complexity , may undesirably also “ de - seal ” the bottom of trenches , and still may suffer from precursor penetration when an ald or cvd related process is used to deposit such a conformal sealing layer . another approach is to choose ald or cvd precursors with larger molecular sizes approaching that of the exposed pores such that the precursor molecules do not readily diffuse into the exposed pores . however , this greatly limits the precursors which can be used and precludes precursors which may be more cost - effective and / or desired in the formation of the barrier layer and / or liner with the desired materials and / or electrical properties . the molecular self - assembly described herein provides a method for sealing the exposed pores of porous low - k dielectrics and / or improving the adhesion properties of porous low - k dielectrics to barrier layers used in copper interconnect formation without any undesired physical and / or chemical damage to the porous low - k dielectric . the molecular self assembly also allows for selective sealing without undesired material formation on conductive surfaces . fig8 is a flow diagram for sealing 800 porous low - k dielectrics , under an embodiment . these porous low - k dielectrics can be used for example in the formation of copper interconnects . the pore sealing 800 of an embodiment includes removing 802 organic and metallic contamination from exposed dielectric surfaces by delivering cleaning solution ( s ) to a target material like exposed dielectric surfaces . copper oxide and contamination are removed 804 from exposed copper surfaces using delivered cleaning and / or reducing solution ( s ). a molecularly self - assembled layer ( s ) is formed 806 on the exposed dielectric surfaces so as to substantially fill and / or seal the exposed pores of the exposed dielectric surfaces . the msal is formed by delivering wetting , functionalization , and / or coating agents to the exposed dielectric surfaces . contamination and / or residue is removed 808 from exposed copper surfaces using cleaning solution ( s ) delivered 808 to the substrate ; the contamination and / or residue results from formation 806 of the msal . the substrate is then rinsed 810 and dried 812 . any optional post - processing 814 treatment ( s ) ( e . g ., thermal , uv , ir , etc .) is then performed on the dried substrate . the molecular self - assembly of an embodiment provides a method for improved copper interconnect integration . copper damascene ( single and / or dual ) interconnect formation requires the cleaning of the bottoms of vias to enable good adhesion ( e . g ., barrier layer to underlying copper ), electrical performance ( e . g ., low contact and / or via resistance ), and reliability performance ( e . g ., stress migration and / or electromigration resistance ). a typical interconnect integration scheme used is as follows : degas ( e . g . thermal vacuum anneal ); plasma - based preclean ( e . g . reactive , physical , and / or combinations thereof ); barrier layer deposition ( e . g . pvd tan , ta , and / or combinations thereof ); copper seed layer deposition ( e . g . pvd cu , ald cu , cvd cu , and / or combinations thereof ); and bulk copper fill ( e . g . electroplating , electroless cu deposition , and / or combinations thereof ). an issue with this typical process is that copper , copper oxide , carbonaceous post etch residue , and / or other contamination removed from the bottom portions of the via during the preclean process may be undesirably re - deposited on the sidewalls of the via during the preclean process . the re - deposited copper can diffuse into the dielectric and cause device performance and / or reliability issues ( e . g . leakage and / or poor time dependent dielectric breakdown or tddb performance ). in addition , the undesirably re - deposited material ( s ) may lead to poor adhesion of the subsequent barrier layer to the dielectric leading to poor device performance and / or reliability issues ( e . g . poor stress migration resistance ). attempts to avoid the above - stated issues include performing the preclean step ( either in - situ in a pvd chamber or in a separate plasma based preclean chamber ) following the initial deposition of a pvd barrier layer in a resputtering process wherein the initially deposited barrier layer will serve as to protect the dielectric via sidewalls . the issue with this approach is that the effective extent of material removed from the bottom of vias is size - dependent and aspect ratio - dependent as both the initially deposited barrier layer ( e . g . generally more material is deposited on the bottom of wide , low ar features as compared to small , high ar features for a given pvd barrier layer deposition process on a substrate containing both feature types ) and the subsequent etching ( e . g . generally the extent of punch through at the bottom of wide , low ar features occurs is less than that at the bottom of small , high aspect ratio features ) are both geometry and / or aspect ratio dependent . fig9 shows examples that the effective extent of material removed from the bottom ( s ) of vias ( and / or trenches ) is size - dependent and aspect ratio - dependent . if a particular interconnect layer contains for example , both wide , low aspect ratio vias 902 ( e . g . 0 . 25 m diameter , 2 : 1 ar vias ) and small , high aspect ratio vias 904 ( e . g . 0 . 1 m diameter , 5 : 1 ar vias ), the requirement to be able to punch through the initial layer of barrier material at the bottom of the wide , low ar vias 902 in order to effect desired via bottom cleaning can cause removal of excess material and / or damage 942 to the bottom portions of the small , high ar vias 904 leading to poor reliability . if optimal removal is targeted for the small , high ar vias 904 , then the wide , low ar vias 902 may not receive sufficient cleaning leading to poor via resistance and / or poor device reliability such as poor stress migration resistance due to remaining contamination 922 at the bottom of the via 902 . moreover , the requirement to be able to punch through the initial layer of barrier material at the bottom of the wide , low ar vias 902 in order to effect desired via bottom cleaning may also cause the complete removal of barrier material and / or dielectric loss and damage 962 at the bottom of small , high aspect ratio trenches 906 . this can lead to device reliability issues such as poor electromigration resistance . similar excess barrier removal and / or dielectric loss / damage can occur on the other horizontal surfaces such as the field which can lead to subsequent integration challenges due to dielectric roughening and / or poor device performance due to increased layer - to - layer capacitances . furthermore , all of the above issues become further exacerbated when the features to be cleaned are formed in low - k films with dielectric constants less than or equal to approximately 2 . 5 , and more specifically for dielectric constants less than or equal to approximately 2 . 2 . low - k films are generally of lower density and exhibit lower structural integrity as compared to standard dielectrics such as sio 2 and / or fsg and hence are more easily removed , damaged , and / or roughened . the molecular self - assembly of an embodiment provides a method for improved copper interconnect integration that effects proper cleaning of features ( especially of via bottoms ) independent of feature geometry and / or aspect ratio , without dielectric loss / damage , and without re - deposition of undesired material ( s ) removed and / or generated during the cleaning process . the molecular self - assembly achieves the above desired aspects through the use of a sacrificial masking layer on the patterned dielectric surfaces as described below and in the related applications referenced above . fig1 a is a flow diagram for interconnect integration 1000 using molecular self - assembly , under an embodiment . the interconnect integration 1000 of this example is copper interconnect integration but the molecular self - assembly described herein is not limited to copper interconnects . the interconnect integration 1000 of an embodiment includes forming 1002 a masking layer on the dielectric portions of the substrate by delivering 1002 wetting , functionalization , and / or organic coating agents to the substrate . the copper oxide and other contamination is removed 1004 from exposed copper surfaces and / or a portion of the exposed copper at the bottom portions of the vias is removed using cleaning , reducing , and / or etching solution ( s ) delivered to the substrate . the sacrificial masking layer is removed 1006 using cleaning and / or etching solution ( s ) delivered to the substrate . sacrificial masking layer removal 1006 removes contaminants which otherwise would have been re - deposited over the dielectric portion ( s ) of the substrate . removal 1006 of the sacrificial masking layer removes re - deposited material ( s ) such as copper , copper oxide , carbonaceous post etch residue , and / or other contamination removed from the bottom portions of the vias during removal 1004 of the copper oxide and other contamination from exposed copper surfaces , and / or a portion of the exposed copper . the substrate is then rinsed 1008 and dried 1010 . other processes 1012 like barrier layer deposition , copper seed layer deposition , and / or bulk copper fill processes can be performed following the interconnect integration 1000 . cleaning solution ( s ) can be optionally used to remove organic and / or metallic contamination from exposed dielectric surfaces prior to masking layer formation 1002 . fig1 b - 10f show an example of interconnect integration 1000 using molecular self - assembly , under an embodiment . fig1 b shows a substrate 1020 that includes a dielectric material 1050 comprising vias 1052 and trenches 1054 , under an embodiment . the copper surfaces and / or portions of copper surfaces 1056 at the bottom portion or region of the vias 1052 are covered with contaminants 1024 that include oxides and / or other materials . the interconnect integration 1000 of an embodiment includes forming a masking layer 1022 on the dielectric portions 1050 of the substrate 1020 by delivering wetting , functionalization , and / or organic coating agents to the substrate . fig1 c is the substrate 1020 with the formed masking layer 1022 , under an embodiment . the contamination 1024 is removed 1024 r from the exposed copper surfaces 1056 and / or a portion of the exposed copper at the bottom portions or regions of the vias 1052 is removed using cleaning , reducing , and / or etching solution ( s ) delivered to the substrate . fig1 d is the substrate 1020 following removal of the contamination 1024 from the bottoms of the vias 1052 , under an embodiment . some amount of the contamination 1024 r removed from the via bottom regions is trapped on and / or in the masking layer 1022 . the sacrificial masking layer 1022 is removed using cleaning and / or etching solution ( s ) delivered to the substrate . removal of the sacrificial masking layer removes material ( s ) 1024 r such as copper , copper oxide , carbonaceous post etch residue , and / or other contamination removed from the bottom portions of the vias during removal 1004 of the copper oxide and other contamination . fig1 e is the substrate 1020 following removal of the masking layer 1022 and the contamination 1024 and 1024 r , under an embodiment . as described above , other layers 1030 ( e . g ., barrier layer , copper seed layer ) can then be formed on the substrate and / or the exposed material at the bottom portions of the vias 1052 . fig1 f is the substrate 1020 following optional processing to form other layers 1030 ( e . g ., barrier layer is shown ), under an embodiment . the liquid - based via bottom clean described above for copper oxide and contamination removal 1004 can be made to be geometry and / or aspect ratio independent . wetting agents and / or surfactant can be used to promote uniform reaction . since physical sputtering is not employed , dielectric loss and / or damage are avoided . the sacrificial masking layer provides a means by which material ( s ) such as copper , copper oxide , carbonaceous post etch residue , and / or other contamination removed from the bottom portions of the vias during contamination removal 1004 ( which would otherwise have been re - deposited over the dielectric portion ( s )) are removed through the removal of the masking layer . furthermore , the sacrificial masking layer can serve to protect the dielectric during via bottom cleaning . in some circumstances , the cleaning can be effected in such a fashion so as to remove a substantial portion ( e . g . from approximately 50 å to 400 å , and more preferably from approximately 100 å to 250 å ) of the copper at the bottom of the vias . this can be used to create the framework for the formation of structural anchors which can be filled during subsequent barrier layer deposition , seed layer deposition , and bulk copper fill . these structural anchors serve to improve ( e . g . lower ) via resistance and / or via resistance distribution ( e . g . tighter distribution ), relieve stress concentrations at the via bottom corners , and can provide reliability advantages ( e . g . improved electromigration and / or stress migration resistance ). the molecular self - assembly of an alternative embodiment provides a method for improved copper interconnect integration that deposits an electroless metal alloy after cleaning the via bottoms . the electroless metal alloy , which can include materials like a cobalt containing alloy , cow , cowp , cowb , cob , cobp , cowbp , ni containing alloys , etc ., passivates and protects the now cleaned copper surfaces at the bottom of the vias . this provides an improved adhesion layer , hermetic layer , barrier layer , and / or reliability enhancement layer ( e . g . for stress migration resistance and / or electromigration resistance ) but is not so limited . fig1 a is a flow diagram for interconnect integration 1100 using molecular self - assembly , under an alternative embodiment . the interconnect integration 1100 of an embodiment includes forming 1102 a masking layer on the dielectric portions of the substrate by delivering wetting , functionalization , and / or organic coating agents to the substrate . the copper oxide and other contamination is removed 1104 from exposed copper surfaces and / or a portion of the exposed copper at the bottom portions of the vias is removed using cleaning , reducing , and / or etching solution ( s ) delivered to the substrate . electroless plating 1106 of a metal alloy capping layer over the exposed copper surface at the bottom portions of the vias is effected through delivery of a multi - component plating chemistry to the substrate . the multi - component plating chemistry of an embodiment includes but is not limited to co containing agents , ni containing agents , transition metal containing agents , reducing agents , ph adjusters , surfactants , wetting agents , di water , dmab , tmah , etc . contamination and / or excess plating material is removed 1108 using post - cleaning solution ( s ) delivered to the substrate following the electroless plating 1106 . the sacrificial masking layer is then removed 1110 using cleaning and / or etching solution ( s ) delivered to the substrate . removal 1110 of the sacrificial masking layer removes i ) re - deposited material ( s ) such as copper , copper oxide , carbonaceous post etch residue , and / or other contamination removed from the bottom portions of the vias during removal 1104 of the copper oxide and other contamination from exposed copper surfaces , and / or a portion of the exposed copper , ii ) contamination resulting from the electroless plating 1106 , and / or iii ) contamination resulting from the post plating clean 1108 . masking layer removal 1110 removes contaminants which otherwise would have been re - deposited over the dielectric portion ( s ) of the substrate . removal 1108 of contamination and / or excess plating material and removal 1110 of the sacrificial masking layer can be performed in a single removal process or operation but are not so limited . the substrate is rinsed 1112 and dried 1114 following removal 1110 of the sacrificial masking layer . other processes 1116 like barrier layer deposition , copper seed layer deposition , and / or bulk copper fill processes can be performed following the interconnect integration 1100 . cleaning solution ( s ) can be optionally used to remove organic and / or metallic contamination from exposed dielectric surfaces prior to masking layer formation 1102 . fig1 b - 11g show an example of interconnect integration 1100 using molecular self - assembly , under an embodiment . fig1 b shows a substrate 1120 that includes a dielectric material 1150 comprising vias 1152 and trenches 1154 , under an embodiment . the copper surfaces and / or portions of copper surfaces 1156 at the bottom portion of the vias 1152 are covered with contaminants 1124 that include oxides and / or other materials . the interconnect integration 1100 of an embodiment includes forming a masking layer 1122 on the dielectric portions 1150 of the substrate 1120 by delivering wetting , functionalization , and / or organic coating agents to the substrate . fig1 c is the substrate 1120 with the formed masking layer 1122 , under an embodiment . the contamination 1124 is removed 1124 r from the exposed copper surfaces 1156 and / or a portion of the exposed copper at the bottom portions of the vias 1152 is removed using cleaning , reducing , and / or etching solution ( s ) delivered to the substrate . fig1 d is the substrate 1120 following removal of the contamination 1124 from the bottoms of the vias 1152 , under an embodiment . some amount of the contamination 1124 r removed from the via bottoms is trapped on and / or in the masking layer 1122 . electroless plating forms a metal alloy capping layer 1132 over the exposed copper surface at the bottom portions of the vias is effected through delivery of a multi - component plating chemistry to the substrate . fig1 e is the substrate 1120 following formation of the capping layer 1132 , under an embodiment . contamination and / or excess plating material is removed following the electroless plating and the sacrificial masking layer 1122 is removed using cleaning and / or etching solution ( s ) delivered to the substrate . removal of the sacrificial masking layer 1122 removes material ( s ) 1124 r such as copper , copper oxide , carbonaceous post etch residue , and / or other contamination removed from the bottom portions of the vias during removal 1104 of the copper oxide and other contamination . fig1 f is the substrate 1120 including the capping layer 1132 following removal of the masking layer 1122 and the contamination 1124 and 1124 r , under an embodiment . as described above , other layers 1130 ( e . g ., barrier layer , copper seed layer ) can then be formed on the substrate and / or the exposed material at the bottom portions of the vias 1152 . fig1 g is the substrate 1120 following optional processing to form other layers 1130 ( e . g . barrier layer is shown ), under an embodiment . the molecular self - assembly of an embodiment provides a method for forming a copper seed layer as described below . copper interconnect technology relies on the use of a copper seed layer to act as the nucleation layer for subsequent copper bulk fill by electrochemical deposition or electroplating and serves to carry the plating current . the copper seed layer should be thin , conformal , continuous , and possess sufficient film purity to achieve good adhesion to the underlying barrier material ( e . g ., tantalum and its nitrides , ruthenium , tungsten and its nitrides , titanium nitride , tantalum carbon nitride , tungsten carbon nitride , etc .). furthermore , the copper seed layer should not degrade the electrical performance ( e . g . effective copper resistivity , em resistance , stress migration resistance , etc .) of the interconnect structure . pvd techniques suffer from inadequate step coverage and / or poor film conformality which lead to void formation during electroplating and subsequent device reliability issues . cvd cu techniques offer conformality , but suffer from impurity incorporation ( e . g ., f , cl , c ) which lead to poor adhesion and electrical performance ( e . g ., via resistance , em resistance , stress migration resistance ) as compared to pvd . in addition , nucleation issues make the formation of a thin continuous film of less than or about 200 å difficult . ald cu suffers from similar impurity and nucleation issues as cvd cu . the molecular self - assembly of an embodiment provides a process for use in forming a copper seed layer . the copper seed layer can be formed using a bifunctional process , a monofunctional process , or an oxide process . fig1 is a flow diagram for seed layer formation using bifunctional molecular self - assembly 1200 , under an embodiment . the substrate is initially cleaned 1202 to remove any unwanted impurities such as organic and / or metallic contamination . once the substrate is cleaned , the functionalized nanoparticles are deposited 1204 on the cleaned substrate . the functionalized nanoparticles are self - bonding to the substrate and represent the thickness target of the desired thin film . one or more post - processing treatment ( s ) 1206 are then performed on the substrate . fig1 is a flow diagram for seed layer formation using monofunctional molecular self - assembly 1300 , under an embodiment . the substrate is initially cleaned 1302 to remove any unwanted impurities such as organic and / or metallic contamination . once the substrate is cleaned , the substrate is functionalized 1304 as described above . the functionalization 1304 creates for example desired bonding sites for monofunctional copper and / or other nanoparticles . copper nanoparticles representing the thickness target of the desired thin film are deposited 1306 on the substrate . one or more post - processing treatment ( s ) 1308 are then performed on the substrate . fig1 is a flow diagram for seed layer formation using oxide particle molecular self - assembly 1400 , under an embodiment . the substrate is initially cleaned 1402 to remove any unwanted impurities such as organic contamination . once the substrate is cleaned , the oxide nanoparticles are deposited 1404 on the cleaned substrate . the oxide nanoparticles upon reduction are self - bonding to the substrate and represent the thickness target of the desired thin film . one or more post - processing treatment ( s ) 1406 are then performed on the substrate . fig1 shows example depictions of seed layer formation using bifunctional 1200 , monofunctional 1300 , and oxide particle 1400 molecular self - assembly , under an embodiment . post processing ( as it pertains to 1206 , 1308 , and / or 1406 ) in an embodiment serves as to coalesce the deposited copper containing nanoparticles and / or drive out any undesired species ( e . g . oh species , nhx species , chx species , carbonaceous species , etc .). in another embodiment , the post - processing can be further used to form a pure , solid , continuous copper film . the post processing ( 1206 , 1308 , and / or 1406 ) can include thermal treatment , uv treatment , ir treatment , electron treatment , ion treatment , x - ray treatment , and / or combinations thereof . radiation can be chosen with the appropriate wavelength to match the size of the particles to maximize energy transfer and / or removal of undesired species . the treatment may be performed in a reducing ( e . g . h containing , forming gas , etc .) and / or non - oxidizing , inert ( e . g . ar , he , n containing , etc .) ambient environment at , above , or below atmospheric pressure . for thermal and thermal related treatments , the size of the particles generally will allow coalescence of the nanoparticles at temperatures less than the melting point of the bulk material , nominally at less than or equal to approximately ⅔ melting point of the bulk material , and more nominally at less than or equal to approximately ½ the melting point of the bulk material . the smaller the particle size , generally the lower the temperature required to achieve particle coalescence . the thickness of the deposited layer will be largely determined by the nominal size of the nanoparticle ( s ). by controlling the size and size distribution of the nanoparticles , the thickness of the resulting film can be controlled with sub - nanometer ( e . g . angstrom ) scale resolution . the process can also be repeated to increase film thickness in a layer by layer process with compositional control analogous to gas phase ald type processes . different nanoparticles can be used per layer and / or combinations of nanoparticle types can be used per layer to adjust film composition per stack and per composite stack . in such a fashion , this same approach can be used to deposit barrier layers ( e . g . with tantalum containing nanoparticles , tantalum nitride containing nanoparticles , tungsten nitride containing nanoparticles , titanium nitride containing nanoparticles , etc . ), adhesion layers ( tantalum containing nanoparticles , ruthenium containing nanoparticles , cobalt containing nanoparticles , etc . ), passivation layers , other seed layers ( e . g . tungsten containing nanoparticles , ruthenium containing nanoparticles , platinum containing nanoparticles , palladium containing nanoparticles , nickel containing nanoparticles , titanium containing nanoparticles , aluminum containing nanoparticles , etc . ), and combinations thereof . as described above , the molecular self - assembly of an embodiment is performed using a msas , as described in the related applications referenced above . as such , and with reference to fig1 and fig3 , each of the processes for forming a structure in a dielectric material , forming a msal on the dielectric material , forming a deposited barrier layer on the msal , and forming electrically conductive material on the msal and / or the deposited barrier layer can be implemented in a single or multiple processing modules . additionally , each of the molecular self - assembly processes can be implemented in module ( s ) that are entirely different from , partly different from , or the same as module ( s ) used to implement , in whole or in part , one or both of the other of the molecular self - assembly processes . as will be understood from the description herein , the number and type of modules used , as well as whether process steps are performed in the same module can depend on the particular processes performed . the molecular self - assembly described herein is implemented in a msas , as described above . descriptions follow for several embodiments of an msas along with associated processes . fig1 is a substrate processing system 1600 using molecular self - assembly , under an embodiment . the substrate processing system 1600 includes a pre - processing module 1601 , a molecular self - assembly processing module 1602 , and a post - processing module 1603 . each of the pre - processing 1601 , molecular self - assembly processing 1602 , and post - processing 1603 described above are implemented in a single module that is different from the modules used to implement the other of the pre - processing 1601 , molecular self - assembly processing 1602 , and post - processing 1603 , but the embodiment is not so limited . for example , any of the modules 1601 , 1602 , and 1603 may include functions of the pre - processing , molecular self - assembly , and / or post - processing modules . the system 1600 is not required to include at least one of each of the preceding module types ; for example , a particular process flow may include only the molecular self - assembly processing module 1602 and means for moving a substrate into and out of the system 1600 . also , functions of all of the pre - processing , molecular self - assembly , and post - processing modules may be embedded within a single module . the modules 1601 , 1602 and 1603 can each be implemented using apparatus ( in particular , conventional commercial substrate processing apparatus ) as appropriate to the types of substrate processing for which the modules 1601 , 1602 and 1603 are to be used . the modules 1601 , 1602 , and 1603 may be implemented with modification ( s ) and / or addition ( s ) depending on the particular characteristics of the molecular self - assembly . for example , when the molecular self - assembly is used to process semiconductor wafers , the modules 1601 , 1602 and 1603 are implemented using conventional commercial semiconductor wafer processing apparatus and methods . substrates enter and leave the system 1600 via a system interface 1604 , also referred to as a factory interface 1604 . a single substrate can be processed at one time in the system 1600 or multiple substrates can be processed at one time in a batch . the system interface 1604 includes a substrate handler 1604 a ( which can be implemented , for example , using a robot ) that moves substrate ( s ) into and out of the system 1600 . to facilitate moving substrates into and out of the system 1600 , the system interface 1604 includes a substrate load station 1604 b and a substrate unloading station 1604 c ( also referred to as a wafer cassette ( foup ) load station 1604 b and a wafer cassette ( foup ) unload station 1604 c , respectively ). after substrate ( s ) that have been processed are removed from the system 1600 and placed on the substrate unload station 1604 c ( for eventual movement to another location ) by the substrate handler 1604 a , new substrate ( s ) that have previously been placed on the substrate load station 1604 b are taken from the substrate load station 1604 b by the substrate handler 1604 a and moved into the system 1600 for processing . the system interface 1604 ( including the substrate handler 1604 a , substrate load station 1604 b and substrate unload station 1604 c ) can be implemented using conventional apparatus and methods known to those skilled in the art of processing substrates . for example , when the molecular self - assembly is used to process semiconductor wafers , the system interface 1604 can be implemented using conventional apparatus and methods known to those skilled in the art of processing semiconductor wafers to enable movement of a wafer and / or a cassette of wafers into and out of the semiconductor wafer processing system . the system 1600 of one or more alternative embodiments can include multiple system interfaces , each of which can be constructed and operate as described above . once in the system 1600 , a substrate handling system 1605 can be used to move substrate ( s ) processed by the system 1600 between different modules 1601 - 1603 of the system 1600 . like the substrate handler 1604 a of the system interface 1604 , the substrate handling system 1605 can be implemented , for example , using one or more robots . if the modules 1601 , 1602 and 1603 include both wet and dry processing modules , then the substrate handling system 1605 includes at least two types of apparatus : a dry substrate handler for moving substrate ( s ) into and out of dry processing modules and the system interface 1604 and out of a drying module , and a wet substrate handler for moving substrate ( s ) into and out of wet processing modules and into a drying module . the substrate handling system 1605 can be implemented using apparatus and methods known to those skilled in the art of processing substrates . for example , when the molecular self - assembly is used to process semiconductor wafers , the substrate handling system 1605 can be implemented using conventional apparatus and methods known to those skilled in the art of processing semiconductor wafers to enable movement of a wafer and / or a cassette of wafers between different modules of the semiconductor wafer processing system . other than when substrate ( s ) are being moved into or out of the system 1600 through the system interface 1604 , the system 1600 is sealed from the external environment . depending on the processing to be performed by the system 1600 , the environment within the system 1600 that is outside of the pre - processing module 1601 , molecular self - assembly processing module 1602 , and post - processing module 1603 ( for convenience , sometimes referred to hereinafter as the “ system environment ”) can be maintained at atmospheric pressure , held at a vacuum pressure , and / or pressurized ( i . e ., held at a pressure above atmospheric pressure ). similarly , the system environment can be maintained at the ambient temperature of the environment outside of the system 1600 , or at a temperature that is higher or lower than that ambient temperature . further , the gaseous composition of the system environment can be controlled as desired . for example , the system environment can be ambient air ( typically , controlled to reduce contamination from the external environment ). the system environment can also be controlled to include , in whole or in part , a specified gas or gases , e . g ., in a system used to process semiconductor wafers , the system environment can be controlled to be nitrogen or an inert gas . the system environment can also be controlled to exclude a specified gas or gases , e . g ., oxygen can be excluded from the system environment to reduce the occurrence of oxidation of substrate ( s ) ( or material ( s ) formed thereon ) processed in the system . fig1 is a substrate processing system 1700 using molecular self - assembly , under an alternative embodiment . the system 1700 includes a system interface 1704 . the system interface 1704 of an embodiment includes but is not limited to a substrate handler 1704 a , substrate load station 1704 b and a substrate unload station 1704 c for moving substrate ( s ) into and out of the system 1700 . the system 1700 includes a substrate handling system 1705 for moving substrate ( s ) processed by the system 1700 between different modules of the system 1700 . each of the system interface 1704 , substrate handler 1704 a , substrate load station 1704 b , substrate unload station 1704 c and substrate handling system 1705 can be implemented and operate as described above for the corresponding components of the system 1600 ( fig1 ). additionally , the system environment described above with respect to the system 1600 applies to the system environment of the system 1700 . the substrate processing system 1700 includes two pre - processing modules 1701 a and 1701 b , two molecular self - assembly processing modules 1702 a and 1702 b , and two post - processing modules 1703 a and 1703 b , but is not so limited . alternative embodiments of system 1700 can include any number of each of the pre - processing modules 1701 a and 1701 b , molecular self - assembly processing modules 1702 a and 1702 b , and post - processing modules 1703 a and 1703 b . as described above , in substrate processing according to the molecular self - assembly , pre - processing can include both wet processing and dry processing . in the system 1700 , the pre - processing modules 1701 a and 1701 b can be dry and wet processing modules , respectively , for performing pre - processing of substrates ( e . g ., pre - processing module 1701 a includes a plasma ( dry ) surface preparation module , and pre - processing module 1701 b includes a wet clean / surface preparation module ). any of the wet pre - processing and dry pre - processing described above can be performed in the modules 1701 a and 1701 b . the pre - processing modules 1701 a and 1701 b of various alternative embodiments can include an pre - processing processes . the molecular self - assembly processing modules 1702 a and 1702 b can include , for example , a module 1702 a for forming self - assembled molecular material ( e . g ., self - assembly growth module ) and a module 1702 b for performing subsequent processing that functionalizes that material ( e . g ., functionalization module ). any of the types of molecular self - assembly and subsequent functionalization described above can be performed in the modules 1702 a and 1702 b . the molecular self - assembly processing modules 1702 a and 1702 b of various alternative embodiments can include any self - assembly processes . the post - processing modules 1703 a and 1703 b can include , for example , a module 1703 a for cleaning the substrate after forming material using molecular self - assembly ( e . g ., post - processing clean module ) and a module 1703 b for annealing and / or vaporizing that material ( e . g ., post - processing anneal / vaporization module ). any of the types of cleaning , annealing and vaporizing described above can be performed in the modules 1703 a and 1703 b . the post - processing modules 1703 a and 1703 b of various alternative embodiments can include any post - processing processes . fig1 is a substrate processing system 1800 using molecular self - assembly , under another alternative embodiment . the substrate processing system 1800 includes one pre - processing module 1801 ( e . g ., plasma ( dry ) surface preparation module ), four molecular self - assembly processing modules 1802 , and one post - processing module 1803 . the system 1800 of alternative embodiments can include any number , type , and / or combination of modules . the pre - processing module 1801 of an embodiment can include a plasma ( dry ) surface preparation module , but is not so limited . however , any of the wet pre - processing and dry pre - processing described herein can be performed in the pre - processing module 1801 . the molecular self - assembly processing modules 1802 can include , for example , a wet clean / surface preparation module , a module for forming self - assembled molecular material ( e . g ., self - assembly growth module ), a module for performing subsequent processing that functionalizes that material ( e . g ., functionalization module ), and a module for cleaning the substrate after forming material using molecular self - assembly ( e . g ., post - processing clean module ). the post - processing module 1803 can include , for example , a module 1803 for annealing and / or vaporizing that material ( e . g ., post - processing anneal / vaporization module ). any of the types of cleaning , annealing and vaporizing described herein can be performed in the module 1803 . the system 1800 also includes a system interface 1804 , which , in turn , includes a substrate handler 1804 a , substrate load station 1804 b and a substrate unload station 1804 c for moving substrate ( s ) into and out of the system 1800 . the system 1800 includes a substrate handling system 1805 for moving substrate ( s ) processed by the system 1800 between different modules of the system 1800 . each of the system interface 1804 , substrate handler 1804 a , substrate load station 1804 b , substrate unload station 1804 c and substrate handling system 1805 can be implemented and operate as described above for the corresponding components of the system 1600 ( fig1 ). additionally , the description above of the system environment for the system 1600 also applies to the system environment of the system 1800 . like the substrate processing system 1600 described above , the substrate processing system 1800 includes three processing modules 1801 , 1802 and 1803 . however , to illustrate that different types of processing steps can be performed in the same module , the module 1802 of system 1800 is shown four times , one for each type of processing that takes place in that module . for example , the module 1802 can be used to perform the types of processing that , in system 1700 , take place in the four separate modules 1701 b , 1702 a , 1702 b and 1703 a , i . e ., wet pre - processing , molecular self - assembly , functionalization of molecularly self - assembled material and post - processing cleaning , respectively . the system 1800 can take advantage of the capability of commercial substrate processing apparatus and methods to rapidly change from one process chemistry to another in a module to facilitate the use of a single processing module for the performance of different types of process steps . in particular , in a substrate processing method including molecular self - assembly , multiple processing steps and multiple types of processing can be performed in the same processing chamber . in general , any number and combination of processes can be performed in a single processing chamber under the embodiments described herein . a spin processor coupling a chemistry dispense mechanism with substrate rotation is an example of such a processing chamber . the chemistry can be provided via a single dispense , a multi - port dispense , a spray dispense , and combinations thereof . substrate rotation assists in uniform application of the process chemistries and can be used to dry the substrate . in describing the substrate processing systems 1600 , 1700 and 1800 , it has been assumed that a single wafer or a single batch of wafers is processed at one time . however , each of the substrate processing systems 1600 , 1700 and 1800 can be modified to include a multiplicity of each of the types of modules used to process a single wafer or single batch of wafers , i . e ., multiple versions of a substrate processing system in accordance with the invention can operate in parallel as a single system . this can be desirable to improve the throughput of substrates processed by a substrate processing system . this can also be desirable to add redundancy in the substrate processing system so that system availability can be maintained even when one or more of the modules of the system are rendered non - operational for a period of time ( e . g ., for preventative maintenance or repair ). the molecular self - assembly systems described above are presented as examples , and systems including other numbers of processing modules can be used . furthermore , types of processing modules other than those described above can be used . manual loading and unloading of substrate ( s ) may be used in some processing systems instead of a substrate handler for moving substrate ( s ) into and out of the system . the molecular self - assembly systems and methods described above can be used to form a masking layer on a dielectric region to facilitate forming of a capping layer on electrically conductive regions separated by the dielectric region , as described in the related applications . the capping layer inhibits electromigration in the electrically conductive regions ( and , in some cases , enhances inhibition of diffusion of material from the electrically conductive regions ). as an example , the msas of an embodiment forms a masking layer on one or more dielectric regions of a substrate , where the substrate includes ( i . e ., as part of , or having formed on and / or in ) electrically conductive regions separated by the dielectric region ( s ) ( such a substrate is sometimes referred to herein as an “ electronic device ”). the electrically conductive regions can be electrical interconnections between electrical elements ( e . g ., transistors , capacitors , resistors ) of the electronic device . the masking layer can be formed selectively on the dielectric region so that no or negligible masking layer material is formed on the electrically conductive regions . alternatively , the masking layer can be formed non - selectively on both the dielectric regions and the electrically conductive regions , and masking layer material formed on the electrically conductive regions subsequently removed . as used herein , a “ capping layer ” ( also sometimes referred to as a “ self - aligned barrier layer ”) is a layer of material formed on electrically conductive regions of an electronic device ( e . g ., after planarization of the top of the electrically conductive regions ) to inhibit electromigration in the electrically conductive regions . in particular , the capping layer inhibits electromigration in the electrically conductive regions better than a dielectric barrier layer that would otherwise be formed on the electrically conductive regions . additionally , in some cases , a capping layer may inhibit diffusion of material from the electrically conductive regions and , in particular , may inhibit such diffusion to an extent that enables elimination , or reduction of the thickness , of a dielectric barrier layer that would otherwise be formed on the capping layer . the capping layer can be formed selectively on the electrically conductive regions so that no or negligible capping layer material is formed on the masking layer . in particular , the material ( s ) and / or one or more process used to form the masking layer and / or the capping layer can be tailored to inhibit formation of capping layer material on the masking layer , thus fostering the selective formation of the capping layer on the electrically conductive regions . alternatively , the capping layer can be formed non - selectively on both the electrically conductive regions and the masking layer , and capping layer material formed on the masking layer subsequently removed ( this can be done , for example , by removing some or all of the masking layer and , with it , capping layer material formed thereon ). the msas of an embodiment includes forming the masking layer or capping layer with any degree of selectivity . as indicated above , “ selective ” formation of a material on a region or surface means that the material forms on that region or surface with better coverage of the region or surface than that with which the material forms on other region ( s ) or surface ( s ). in any embodiment of the msas , masking layer material formed on electrically conductive regions or capping layer material formed on the masking layer can be removed if deemed necessary or desirable . however , as discussed further below , removal of masking layer material formed on electrically conductive regions or capping layer material formed on the masking layer may not be necessary in some cases , e . g ., when negligible amounts of masking layer material are formed on electrically conductive regions or negligible amounts of capping layer material are formed on the masking layer , such as may be the case when the masking layer is formed selectively on the dielectric regions or the capping layer is formed selectively on electrically conductive regions , respectively . the msas of an embodiment inhibits capping layer material from being formed on the masking layer over the dielectric region ( in addition to the inhibition of formation of capping layer material on or in the dielectric region , due to the presence of the masking layer on the dielectric region ). consequently , unlike previous approaches to forming a capping layer in which a layer of electrically conductive material ( e . g ., a cobalt alloy , nickel alloy or tungsten ) is selectively deposited on electrically conductive regions , the msas prevents the occurrence of unacceptable current leakage between electrically conductive regions when electrically conductive material is used to form the capping layer . since the msas inhibits formation of capping layer material over , on or in the dielectric region , the msas enables a great deal of flexibility in the selection of material ( s ) and / or one or more process for forming the capping layer , without regard for the selectivity of the capping layer material for the electrically conductive regions vis - à - vis the dielectric region ( and , in some embodiments , without regard for the selectivity of the capping layer material for any material ). the msas thus enables , for example , the use of material ( s ) and / or process ( es ) and / or process regime ( s ) in the formation of the capping layer that would otherwise be undesirable due to a lack of sufficient selectivity . this serves to widen the material choices and / or process ( es ) and / or process regime ( s ) available for effecting other desired attributes . for example , the material and / or processes used to form the capping layer can be chosen to enhance adhesion of the capping layer to the electrically conductive regions ( thus improving inhibition by the capping layer of electromigration in the electrically conductive regions ). the materials and / or processes used to form the capping layer can also be chosen to produce a capping layer that does not unacceptably or undesirably increase resistance in the electrically conductive regions ; for example , the capping layer can be formed without replacing any of the material of the electrically conductive regions with capping layer material having a higher resistivity . the materials and / or processes used to form the capping layer can also be chosen so that very little poisoning ( undesired diffusion of constituents into and / or adverse modifications ) of the electrically conductive regions occurs . poisoning can lead to undesirable changes in electrical characteristics such as an increase in resistance of the electrically conductive regions . in yet another embodiment , the materials and / or processes used to form the capping layer can be chosen to protect the underlying electrically conductive regions from moisture containing environments , oxygen containing environments , oxidizing environments , and the like . additionally or alternatively , the materials and / or processes used to form the capping layer can be chosen to produce a capping layer that is sufficiently effective in inhibiting diffusion of material used to form the electrically conductive regions ( e . g ., copper ) so that a dielectric barrier layer can be eliminated from the electronic device or , at least , reduced in thickness ( with attendant decrease in capacitance and associated benefits ). further , since the masking layer inhibits formation of capping layer material in the dielectric region , the msas facilitates the use of porous dielectric materials that are increasingly deemed desirable for use in electronic devices . additionally , the msas enables production of a thermally stable capping layer on copper so that the capping layer remains continuous and defect - free ( i . e ., having sufficiently few defects according to one or more criteria ) under typical operating conditions of many electronic devices . fig1 is a flow diagram for using the msas to form or produce 1900 a capping layer on electrically conductive regions separated by a dielectric region , under an embodiment . a masking layer is formed 1901 and 1902 on the electronic device so that the masking layer is formed on the dielectric region , but not the electrically conductive regions . after formation of the masking layer , a capping layer is formed 1903 , 1904 , 1905 , and 1906 on the electronic device . optionally , a dielectric barrier layer can be formed 1907 on the electronic device , depending on the properties of the capping layer , as discussed further below . the capping layer of an embodiment is formed on the electrically conductive regions but not on or in the dielectric region or the masking layer . the presence of the masking layer inhibits formation of capping layer material on or in the dielectric region that may otherwise have occurred without the masking layer . consequently , the capping layer produced 1900 forms capping layer material only on the electrically conductive regions ( no or negligible capping layer material is formed over , on or in a dielectric region separating electrically conductive regions ). this selective capping layer production 1900 therefore reduces or eliminates unacceptable current leakage between electrically conductive regions of the substrate . fig2 a through 20e show cross - sectional views of an electronic device 2000 undergoing formation of a capping layer 2040 on electrically conductive regions 2010 separated by a dielectric region 2020 , under the molecular self - assembly of an embodiment . the electrically conductive regions 2010 can be interconnections between electrical elements of the electronic device , such as , for example , transistors , capacitors and resistors . the dielectric region 2020 is illustrated with a hard mask layer 2020 a formed as a top part of the dielectric region 2020 , as is commonly the case in current electronic devices ; however , the dielectric region 2020 need not necessarily include the hard mask layer 2020 a . as described herein , the method 1900 can produce a capping layer in accordance with various alternative embodiments not shown . in particular , due to imperfect selectivity or non - selectivity of the formation of the masking layer 2050 , masking layer material can be formed on the electrically conductive regions 2010 that is subsequently removed prior to forming the capping layer 2040 . however , the formation of the masking layer 2050 may also be accomplished with greater selectivity i ) so that no masking layer material is formed on the electrically conductive regions 2010 ( in that case , the intermediate structure shown in fig2 a would not occur ) or ii ) so that a negligible amount of masking layer material is formed on the electrically conductive regions 2010 that need not necessarily be removed from the electrically conductive regions 2010 ( in that case , the intermediate structure shown in fig2 b would not occur and the subsequently formed structures shown in further figures would include the negligible amount of masking layer material formed on the electrically conductive regions 2010 ). generally , a masking layer 2050 is formed non - selectively on both the dielectric region 2020 and the electrically conductive regions 2010 . the masking layer material is removed from the electrically conductive regions 2010 , and capping layer material is formed selectively on the electrically conductive regions 2010 . the masking layer material is removed from the dielectric region 2020 , and a dielectric barrier layer 2030 is formed over the capping layer 2040 and dielectric region 2020 . prior to forming a masking layer in accordance with the embodiments described herein , the exposed surfaces of the electrically conductive regions and the exposed surface of the dielectric region are prepared for processing as described elsewhere herein . this surface preparation includes at least one or more cleaning steps ( e . g ., a deionized water rinse and / or any of a variety of other well - known surface cleaning step ( s )) to remove contaminants left from previous processing . in particular , a low - ph solution chemistry can be used to remove copper oxides and a high ph solution chemistry can be used to remove post cmp residue ( s ). the surface preparation can include other processing steps as well . for example , the exposed surfaces of the electrically conductive regions and / or the exposed surface of the dielectric region can be functionalized to facilitate selective formation of the masking layer . in particular , the surface of the dielectric region can be functionalized to promote formation of the masking layer and the exposed surfaces of the electrically conductive regions can be functionalized to inhibit formation of the masking layer . similarly , the exposed surfaces of the electrically conductive regions and / or the exposed surface of the dielectric region can also be functionalized to facilitate selective formation of the capping layer . in particular , the surface of the dielectric region can be functionalized to inhibit formation of the capping layer ( though the use of a masking layer in accordance with the molecular self - assembly described herein may render this unnecessary or , at least , of greatly reduced importance ) and the exposed surfaces of the electrically conductive regions can be functionalized to promote adhesion of the capping layer . in general , the particular manner in which the surfaces of the electrically conductive regions and / or the surface of the dielectric region are functionalized depends on the nature of the materials used to form the electrically conductive regions , the dielectric region and the masking layer , and the desired properties to be produced ( e . g ., passivation , promotion of material formation ). for example , a dielectric region formed of a silicon dioxide - based dielectric material can be functionalized to produce a large number of hydroxyl groups at the surface of the dielectric region to which a self - assembled monolayer has an affinity for attachment , thus promoting formation of the masking layer on the dielectric region . additionally , a molecule used to form a molecularly self - assembled layer can be established to include a head group that covalently bonds with an exposed hydroxyl group of the material used to form a dielectric region . with reference to fig1 , a masking layer is formed 1901 and 1902 on an electronic device so that the masking layer is formed on a dielectric region of the electronic device , but not on the electrically conductive regions of the electronic device that are separated by the dielectric region . the masking layer can be formed 1901 selectively on the dielectric region or the masking layer can be formed non - selectively on both the dielectric region and the electrically conductive regions . selective formation of a masking layer on a dielectric region encompasses negligible formation of masking layer material on the electrically conductive regions , i . e ., masking layer material coverage that does not impair performance of a method according to the molecular self - assembly or the functionality of an electronic device produced using molecular self - assembly . non - selective formation of a masking layer on both the dielectric region and the electrically conductive regions encompasses formation of the masking layer with no preference for the dielectric region or electrically conductive regions , with some degree of preference for the electrically conductive regions , or with preference for the dielectric region that is inadequate to result in the formation of no or negligible masking layer material on the electrically conductive regions . when the masking layer is formed non - selectively on the dielectric region and the electrically conductive regions , all masking layer material formed on the electrically conductive regions is subsequently removed 1902 . removal of all masking layer material formed on the electrically conductive regions encompasses leaving negligible masking layer material formed on the electrically conductive regions . referring again to the electronic device 2000 , non - selective formation of a masking layer 2050 on both the dielectric region 2020 and the electrically conductive regions 2010 is followed by removal of all masking layer material formed on the electrically conductive regions 2010 , leaving the masking layer 2050 formed only on the dielectric region 2020 . in general , the masking layer can be formed using any number , type , and / or combination of materials and processes that form a masking layer . the masking layer can be formed using either wet processing ( e . g ., immersion of a substrate in a chemical bath , spraying or spinning of chemical fluid on to a substrate ) or dry processing ( e . g ., vapor deposition ). if wet processing is used , a rinsing process may be used afterwards to clean the electronic device , which is then followed by a drying process . additionally , if wet processing is used , vibration of specified amplitude and / or frequency ( e . g ., high frequency vibration , such as ultrasonic or megasonic vibration ) can be imparted to the electronic device during the processing to facilitate ( e . g ., speed up ) the processing . the masking layer can be deposited or grown on the dielectric region . the masking layer can also be formed by stamping . the masking layer of an embodiment is formed comprising an electrically insulative ( effectively non - conductive ) material , since the masking layer is formed in regions that , in the finished electronic device , are electrically non - conductive . however , in embodiments in which the masking layer is completely removed from the electronic device ( e . g ., fig2 d ), the masking layer can be formed of an electrically conductive or semiconductor material . after formation of the masking layer , the masking layer can be functionalized or otherwise modified ( e . g ., chemically , thermally and / or photo - chemically modified ) in a desired manner to produce desired properties ( e . g ., to produce a desired propensity for formation on the masking layer of material to subsequently be formed on the electronic device , such as a capping layer or a dielectric barrier layer , or to enable some or all of the masking layer to be removed after formation of the capping layer so that capping layer material formed on the masking layer can be removed ). the masking layer can be , for example , a molecularly self - assembled layer , which can be formed as a monolayer ( e . g . sam ) or a multilayer , and can be formed of organic and / or inorganic material . a molecularly self - assembled layer can be produced by forming ( e . g ., depositing or growing ) additional material on the surface of the dielectric region , or by chemically activating or modifying the material of the dielectric region to produce a new distinct layer of material . the ability to tailor the molecule type , head group , terminal group and / or chain length of a molecularly self - assembled layer as described above provides flexibility in establishing the characteristics of a masking layer , which can be used to produce desired masking layer properties , as described herein . the masking layer can also be , for example , a layer formed from any class of materials known to form with controlled film thickness , such as , for instance , multi - layer polyelectrolytes . the masking layer can also be , for example , a layer formed on the surface of the dielectric region through the catalytic growth of inorganic or organic materials . the masking layer can also be , for example , a layer formed from dendrimers , hyper - branched polymers , and / or block co - polymers as described above . the masking layer can also be , for example , an ionic or electrochemically - enhanced self - assembled multilayer or monolayer . the characteristics of a masking layer formed using the molecular self - assembly can be established to produce desired properties of the masking layer as described above . for example , the type of molecule ( s ) used to form a molecularly self - assembled layer can be chosen , and the characteristics of the molecule , such as the head group , terminal group and / or length , can be established to produce desired properties of the molecularly self - assembled layer . the particular manner in which the characteristics of a masking layer are tailored include for example one or more of the properties of the dielectric region , the necessity or desirability of avoiding formation of masking layer material on the electrically conductive regions , the characteristics of the materials and / or processes used to form the capping layer , and / or the characteristics of the materials and / or processes used to subsequently form material on the masking layer , but are not so limited . as further examples , the materials and / or processes used to form the masking layer can be selected to facilitate achievement of one or more of the following properties : high selectivity for the dielectric region ; high selectivity for a sicoh dielectric material ; high selectivity for a silicon - based hard mask layer ; adheres to a dielectric barrier layer ( commonly formed of a composition including silicon together with carbon and / or nitrogen , i . e ., sic x , sin x , sic x n y ) or other material to be subsequently formed on the masking layer ; provides a good barrier to diffusion of the capping layer material ( e . g ., a cobalt alloy , such as a cobalt - tungsten - phosphorous alloy ), both during production of the capping layer and during operation of the finished electronic device ( if the masking layer is left as part of the finished electronic device ); facilitates removal of some or all of the masking layer ( and , with it , any capping layer material that may have been formed thereon ), e . g ., that produce a terminal group of a molecularly self - assembled layer that can be cleaved from the rest of the molecularly self - assembled layer or that produce an organic backbone of a molecularly self - assembled layer that can be broken down and removed ; produces a continuous and defect - free layer and that , if to be left as part of the electronic device , remains so even when subjected to the thermal and chemical environment associated with further processing to produce the electronic device and / or operation of the finished electronic device ; enables rapid ( e . g ., less than about 60 seconds ) production of a masking layer . as one example , silane - based materials can be used to form a masking layer in one or more embodiments of the molecular self - assembly . for example , it is known that a silane with one or more hydrolysable substituents of the general formula r n six 4 − n ( where r can be , for example , alkyl , substituted alkyl , aryl or substituted aryl , and x can be , for example , halo , alkoxy , aryloxy or amino ) can form a sam that can exhibit strong covalent or non - covalent attachment to particular surfaces . typically , sam surface attachment is enhanced on a surface having a relatively high density of acidic functionalities such as hydroxyl or hydroxysilyl groups . silicon - based material surfaces such as sio 2 , sioh and sioc surfaces possess relatively high densities of hydroxyl groups . thus , a silane - based sam can be expected to form with greater adhesion to a surface of a silicon - based material ( of which a dielectric region is commonly formed ) than to a surface of a metallic material ( of which electrically conductive regions are commonly formed ). furthermore , a silane - based sam can also be tailored to reversibly adhere to a surface depending on the nature and substitution of a silane precursor material . for example , silicon - based sam precursors with a single hydrolysable substituent ( e . g ., of the general formula r 1 r 2 r 3 six ) are known to produce a sam that can be formed on , and reversibly detached from , a functionalized surface ( e . g ., a surface having a relatively high density of acidic functionalities ) under specific reaction conditions . silanization of surfaces is discussed in detail in , for example , silanes , surfaces and interfaces ( chemically modified surfaces , vol . 1 ), edited by donald e . leyden , gordon & amp ; breach science publishers , 1986 . with reference to fig1 , subsequent to forming 1901 and 1902 the masking layer the molecular self - assembly of an embodiment forms 1903 , 1904 , 1905 , and 1906 a capping layer on the electronic device . the capping layer is formed on the electrically conductive regions , but not on or in the masking layer and / or the dielectric region . the capping layer can be formed 1903 selectively on the electrically conductive regions or the capping layer can be formed non - selectively on both the masking layer and the electrically conductive regions . selective formation of a capping layer on electrically conductive regions encompasses negligible formation of capping layer material on or in the masking layer and / or dielectric region . non - selective formation of a capping layer on both the masking layer and the electrically conductive regions encompasses formation of the capping layer with no preference for the electrically conductive regions or masking layer , with some degree of preference for the masking layer , or with preference for the electrically conductive regions that is inadequate to result in the formation of no or negligible capping layer material on or in the masking layer and / or dielectric region . when the capping layer is formed non - selectively on the masking layer and the electrically conductive regions , all capping layer material formed on the masking layer is subsequently removed 1904 and 1905 . referring again to fig2 c , the electronic device 2000 includes selective formation of a capping layer 2040 on the electrically conductive regions 2010 ; non - selective formation of a capping layer on the masking layer and the electrically conductive regions , followed by removal of all capping layer material formed on the masking layer is further described in the related applications . the capping layer is generally formed using any of a number , type , and / or combination of materials and processes as appropriate to the electronic device ( e . g ., that inhibits electromigration in electrically conductive regions on which the capping layer is formed , that inhibits diffusion of material from electrically conductive regions on which the capping layer is formed ). the capping layer can be formed of an electrically conductive , semiconductor or electrically insulative ( effectively non - conductive ) material . for example , materials ( e . g ., cobalt alloys , such as an alloy of cobalt , tungsten and phosphorous or an alloy of cobalt and boron ; nickel alloys , such as an alloy of nickel , molybdenum and phosphorous ; tungsten ; tantalum ; tantalum nitride , etc .) and processes ( e . g ., electroless deposition ; chemical vapor deposition ; physical vapor deposition ( sputtering ); atomic layer deposition ; etc .) that have previously been used to selectively deposit a capping layer on electrically conductive regions of a semiconductor device can be used . the capping layer can be functionalized but is not so limited . the presence of the masking layer prevents formation of capping layer material on or in ( through diffusion ) the dielectric region , thus enforcing good selectivity of the capping layer material for the electrically conductive regions compared with the dielectric region regardless of the selectivity otherwise associated with the material ( s ) and process ( es ) used to form the capping layer . thus , the molecular self - assembly described herein provides increased flexibility in the materials and processes that can be used to form the capping layer . for example , the molecular self - assembly enables use of materials and processes for depositing an electrically conductive material to form a capping layer that have previously been inadequate to form a capping layer without producing unacceptable current leakage between electrically conductive regions , but that are effective in inhibiting electromigration because of good adhesion to electrically conductive regions . additionally , since the presence of the masking layer enables production of a capping layer by forming additional material on an electrically region , there is no need to create a capping layer by chemically modifying a top part of the electrically conductive region . thus , the undesirable increase in resistance in the electrically conductive region that is associated with creation of a capping layer in that manner is avoided using the molecular self - assembly described herein . as described above with reference to fig1 and 20 , when the capping layer is formed non - selectively on both the masking layer and the electrically conductive regions , all capping layer material formed on the masking layer is subsequently removed 1904 and 1905 so that no ( or negligible ) capping layer material is present over the dielectric region . this reduces or eliminates the possibility of current leakage between the electrically conductive regions when an electrically conductive material is used to form the capping layer . removal of the capping layer includes removing 1905 just the capping layer material from the masking layer , or removing 1904 a portion ( e . g ., a top part on which the capping layer material is formed ) or all of the masking layer together with the capping layer material formed thereon . fig2 a shows a cross - section of a structure 2100 including a dielectric region 2101 on which a masking layer 2102 and a capping layer 2103 are formed , using the molecular self - assembly of an embodiment . the masking layer 2102 is a self - assembled monolayer ( sam ) but is not so limited . the sam includes one or more of the following , but is not so limited : a head group 2102 a formed on the dielectric region 2101 ; a linking group 2102 b connected to the head group 2102 a ; a terminal group 2102 c connected to the linking group 2102 b , on which one or more other materials can be formed . fig2 b through 21e show additional cross - sections of the structure 2100 during further processing to remove the capping layer 2103 , under an embodiment . each of fig2 b through 21e illustrates a different approach to effect removal of a capping layer from a dielectric region . in fig2 b , the entire masking layer 2102 is removed from the dielectric region 2101 ; as a consequence of removing the masking layer 2102 , the capping layer 2103 is also removed from over the dielectric region 2101 . in fig2 c , the head group 2102 a of the masking layer 2102 is cleaved , removing part of the head group 2102 a , all of the linking group 2102 b and all of the terminal group 2102 c of the masking layer 2102 , together with the capping layer 2103 formed on the masking layer 2102 . the part of the head group 2102 a remaining on the dielectric region 2101 is designated as “ h ′” ( h prime ) to indicate difference from the unmodified head group 2102 a of fig2 a . in fig2 d the linking group 2102 b of the masking layer 2102 is cleaved , removing part of the linking group 2102 b and all of the terminal group 2102 c of the masking layer 2102 , together with the capping layer 2103 formed on the masking layer 2102 . the part of the linking group 2102 b remaining on the dielectric region 2101 is designated as “ l ′” ( l prime ) to indicate difference from the unmodified linking group 2102 b of fig2 a . in fig2 e , the terminal group 2102 c of the masking layer 2102 is cleaved , removing part of the terminal group 2102 c of the masking layer 2102 , together with the capping layer 2103 formed on the masking layer 2102 . the part of the terminal group 2102 c remaining on the dielectric region 2101 is designated as “ t ′” ( t prime ) to indicate difference from the unmodified terminal group 2102 c of fig2 a . other processes ( not shown ) can be used to effect removal of a capping layer from over a dielectric region , and the molecular self - assembly of alternative embodiments include these alternative processes . for example , in the structure 2100 , the bond between the head group 2102 a and the linking group 2102 b can be broken , resulting in the removal of the linking group 2102 b and the terminal group 2102 c of the masking layer 2102 , together with the capping layer 2103 formed on the masking layer 2102 . alternatively , the bond between the linking group 2102 b and the terminal group 2102 c can be broken , resulting in the removal of the terminal group 2102 c of the masking layer 2102 , together with the capping layer 2103 formed on the masking layer 2102 . in yet another alternative process , the capping layer 2103 may be removed from the masking layer 2102 without affecting the structure of the masking layer 2102 , i . e ., so that the terminal group 2102 c , the linking group 2102 b and the head group 2102 a are not cleaved and the bonds there between are not broken . additionally , two or more of the above - described processes can be combined ; this may for example increase the likelihood that the capping layer 2102 is adequately removed from over the dielectric region 2101 . furthermore , in any of the processes described above in which at least part of the masking layer 2102 remains on the dielectric region 2101 after removal of the capping layer 2103 , the exposed part of the masking layer 2102 can be functionalized to produce desired characteristic ( s ) ( this is true for any type of masking layer in accordance with the molecular self - assembly , not only the masking layer 2102 ). referring again to fig1 , when capping layer material is removed 1904 and 1905 from the masking layer , the removal 1904 and 1905 under the molecular self - assembly of an embodiment includes subsequent removal 1906 of all of the masking layer or modification of the masking layer ( i . e ., removing some and / or functionalizing ). removing 1906 all of , or modifying , the masking layer may be used to produce a surface ( i . e ., an exposed surface of the masking layer or the dielectric region ) having particular characteristics ( e . g ., good propensity for adhesion to a dielectric barrier layer subsequently to be formed on the masking layer ). when first removing the capping layer , then removing or modifying the masking layer , the process of an embodiment removes some or all of the masking layer ( and / or to functionalize the masking layer ) after removing the capping layer ( rather than together with removal of the capping layer ) for one or more of a variety of reasons . any of a variety of processes can be used to remove masking layer material from the dielectric region . similarly , any of a variety of processes can be used to functionalize a masking layer . the particular process or processes used in an embodiment to remove masking layer material from the dielectric region and / or to functionalize the masking layer can depend , in particular , on the characteristics of the masking layer material , and may also depend on the material used to form the dielectric region . a dielectric barrier layer can also be formed 1907 on the electronic device or not , depending on the properties of the capping layer . fig2 e shows formation of a dielectric barrier layer 2030 on the electronic device 2000 . if a dielectric barrier layer is formed on the electronic device , such formation can be accomplished using any type , number , and / or combination of materials and / or processes . when the capping layer is formed of a material that provides good inhibition of diffusion of the electrically conductive material into adjacent material of the electronic device while still providing other required properties of the capping layer , it is possible to eliminate the dielectric barrier layer from the electronic device or , at least , reduce the thickness of the dielectric barrier layer . the molecular self - assembly of an embodiment forms a capping layer so that diffusion of material from the electrically conductive regions into adjacent regions is inhibited with sufficient effectiveness that the dielectric barrier layer can be formed with a smaller thickness than would be the case if the capping layer was not present . the molecular self - assembly of other embodiments forms a capping layer so that diffusion of material from the electrically conductive regions into adjacent regions is inhibited with sufficient effectiveness that a dielectric barrier layer need not be formed . eliminating the dielectric barrier layer or reducing the thickness of the dielectric barrier layer reduces capacitance , which can decrease the power consumption and / or increase speed of operation of the electronic device . by using a masking layer on the dielectric region to minimize or eliminate selectivity as an important consideration in choosing materials and / or processes for forming the capping layer , the molecular self - assembly enables formation of a capping layer that provides adequate inhibition of electromigration and a good barrier to diffusion of electrically conductive material . this enables elimination or reduction in thickness of a conventional dielectric barrier layer . the capping layer can also be optimized to resist against any deleterious effects associated with subsequent exposure to moisture containing environments , oxygen containing environments , oxidizing environments , and the like . the molecular self - assembly described above can be used in the processing of a substrate comprising any type of material . for example , the molecularly self - assembled material can be formed on material previously formed on a substrate and can be formed on material ( substrate or other material ) that has been functionalized to have desired properties , such as desired adhesion characteristics . in particular , the molecular self - assembly can be used in processing semiconductor substrates as in the manufacture of components for use in the electronics industry . the molecular self - assembly can also be used in processing substrates like glass , silicon , and / or plastic for use in the production of flat panel displays , for example . the molecular self - assembly can be used in the processing of any type of semiconductor substrate , including but not limited to silicon substrates , silicon - on - insulator substrates , silicon carbide substrates , strained silicon substrates , silicon germanium substrates , and gallium arsenide substrates . the molecular self - assembly can include a substrate of any size . for example , the molecular self - assembly can be used in the processing of small semiconductor substrates having areas of less than one square inch up to twelve ( 12 ) inch ( 300 millimeter ( mm )) or larger semiconductor substrates used in the production of many electronic components . in general , there is no limit to the size of substrates that can be processed . for example , the molecular self - assembly can be used to process each succeeding larger generation of semiconductor substrates used to produce electronic components . the molecular self - assembly can also be used to process the relatively large substrates that are used in the production of flat panel displays . such substrates include rectangular substrates on the order of approximately one square meter , but larger substrates can be used . the molecular self - assembly can also be scaled for use in roll - to - roll processing applications for flexible substrates having a fixed width , but ( theoretically ) unlimited length ( a manner of substrate processing that can be particularly useful in the production of flat panel displays ); for example , such substrate rolls can be hundreds of feet long . the molecular self - assembly can be used in processing substrates of any shape , e . g ., circular , rectangular ( including square ), etc . for example , and as described above , the molecular self - assembly can be used in the processing of semiconductor substrates used in the production of electronic components ( e . g ., circular substrates ), as well as in the processing of substrates used in the production of flat panel displays ( e . g ., rectangular substrates ). the molecular self - assembly can be used in the processing of a single substrate or multiple substrates ( e . g ., batch processing ). for example , in wet semiconductor processing , a single substrate can be processed or a batch of , for example , 13 , 25 or 50 substrates can be processed at a single time . in dry semiconductor processing and flat panel display production , typically , a single substrate is processed at one time . the molecular self - assembly described herein can include wet processing and / or dry processing . in wet processing , a substrate is processed using a fluid . for example , the substrate can be immersed , in whole or in part , in a fluid having specified characteristics ( e . g ., a specified chemical composition ). also , for example , a fluid can be sprayed on to the substrate in a specified manner . wet processing for use with the molecular self - assembly of an embodiment can make use of any of a variety of chemical constituents , as appropriate for the desired processing . in dry processing ( e . g ., physical vapor deposition , chemical vapor deposition , plasma - enhanced chemical vapor deposition , and atomic layer deposition ), a plasma or gas is used to produce a desired interaction with a substrate that processes a substrate surface in a specified way . dry processing for use with the molecular self - assembly can make use of inert or reactive gases , as appropriate for the desired processing . any of a variety of chemical constituents or other reactants ( collectively referred to herein as constituents or chemical constituents ) can be used by a molecular self - assembly system of an embodiment to effect molecular self - assembly and related processes . the constituents can be in the liquid phase , gaseous phase , and / or some combination of the liquid and gaseous phases ( including , for example , the super - critical fluid phase ). the constituents used and their concentrations , as well as the mixture of constituents , will depend on the particular process step ( s ) to be performed . the chemical delivery system can enable precise control of the molar concentrations , temperature , flow rate and pressure of chemical constituents as appropriate to the process . the chemical delivery system can also provide appropriate filtration and control of contamination . the molecular self assembly of an embodiment includes a method comprising receiving a substrate . the substrate includes at least one dielectric material . a molecularly self - assembled layer is formed on an exposed surface of the dielectric material , the molecularly self - assembled layer comprising at least one material having at least one of a molecular characteristic and a molecular type that includes one or more of a molecular type of a head group of molecules of the material , a molecular characteristic of a head group of molecules of the material , a molecular type of a terminal group of molecules of the material , a molecular characteristic of a terminal group of molecules of the material , a molecular type of a linking group of molecules of the material , and a molecular characteristic of a linking group of molecules of the material , wherein the at least one of the molecular characteristic and molecular type are selected according to at least one pre - specified property of the molecularly self - assembled layer . the method of an embodiment comprises preparing the exposed surface of the dielectric material , wherein preparing includes one or more of functionalization , cleaning , etching , rinsing , drying , vaporization , annealing , curing , thermal treatment , uv treatment , ir treatment , electron treatment , ion treatment , and x - ray treatment . the method of an embodiment comprises post - processing the molecularly self - assembled layer , wherein the post - processing includes one or more of functionalization , cleaning , etching , rinsing , drying , vaporization , annealing , curing , thermal treatment , uv treatment , ir treatment , electron treatment , ion treatment , and x - ray treatment . the at least one pre - specified property of the molecularly self - assembled layer of an embodiment includes one or more of pore sealing properties , adhesion properties , diffusion barrier properties , passivation properties , and selectivity . the at least one pre - specified property of an embodiment is specified according to at least one of an application of the molecularly self - assembled layer , a type of the dielectric material , and a type of the material to be subsequently formed on the molecularly self - assembled layer . the at least one pre - specified property of an embodiment includes a plurality of properties , further comprising assigning degrees of importance to each of the plurality of properties . the method of an embodiment comprises one or more of cross - linking , polymerizing , and oligomerizing molecules of the molecularly self - assembled layer . forming the molecularly self - assembled layer of an embodiment comprises joining complementary materials in nano - molecular action using coordinated action of independent molecules under distributed control . the dielectric material of an embodiment is a porous dielectric material , wherein the at least one of a molecular characteristic and a molecular type causes the molecularly self - assembled layer to seal a majority of pores of the exposed surface of the dielectric material . the molecular type of an embodiment is an organic molecule and the molecular characteristic includes at least one of a size and a length of one or more of a terminal group and a linking group . the at least one of the molecular characteristic and the molecular type of an embodiment comprise a carbon chain including at least one of a linking group and a terminal group , wherein a length of at least one of the linking group and the terminal group is long enough relative to a size of the pores of the exposed surface so as to seal the pores . sealing of the majority of pores of an embodiment prevents diffusion of at least one of reactants , reagents , precursors , and carrier gases from subsequent depositions into the porous dielectric material . the method of an embodiment comprises etching at least one structure in the dielectric material . the at least one structure of an embodiment includes one or more of at least one via and at least one trench . the method of an embodiment comprises forming at least one deposited barrier layer on the molecularly self - assembled layer , wherein the deposited barrier layer prevents diffusion of other materials into the dielectric material . the method of an embodiment comprises forming at least one conductive layer on the at least one deposited barrier layer , wherein the at least one conductive layer comprises at least one electrically conductive material . the at least one conductive layer of an embodiment includes a seed layer . the method of an embodiment comprises filling the at least one structure with the at least one electrically conductive material . the at least one electrically conductive material of an embodiment includes one or more of copper , ruthenium , tungsten , and aluminum . the molecularly self - assembled layer of an embodiment forms a masking layer on the dielectric material . the method of an embodiment comprises cleaning the substrate , wherein the cleaning includes removing contamination from an electrically conductive material at a bottom portion of the at least one structure , wherein a portion of the contamination is captured in the masking layer . the masking layer of an embodiment protects the dielectric material during the cleaning . the cleaning of an embodiment generates an anchor area at the bottom portion of the at least one structure by removing a portion of the electrically conductive material at the bottom portion of the at least one structure . the method of an embodiment comprises forming a structural anchor in the anchor area by filling the anchor area with material of at least one of barrier layer deposition , seed layer deposition , and bulk copper fill during at least one of the barrier layer deposition , the seed layer deposition , and the bulk copper fill . the electrically conductive material of an embodiment is a metal , wherein the contamination includes at least one of organic contamination , metallic contamination , and metal oxide contamination . the method of an embodiment comprises removing the masking layer from at least a portion of the dielectric material , wherein removing the masking layer includes removing the contamination . the method of an embodiment comprises forming a capping layer over an exposed surface of the electrically conductive material at the bottom portion of the at least one structure . forming of the metal alloy capping layer of an embodiment includes delivering and effecting a plating chemistry for electroless plating of the capping layer , wherein the capping layer is a metal alloy capping layer . the method of an embodiment comprises removing excess material of the capping layer . the method of an embodiment comprises removing the masking layer from at least a portion of the dielectric material , wherein removing the masking layer includes removing at least one of the contamination , material of the capping layer , and the excess material of the capping layer . the method of an embodiment comprises preparing the exposed surface , wherein the preparing further includes preparing an exposed surface of an electrically conductive material at a bottom portion of at least one structure of the dielectric material . the method of an embodiment comprises functionalizing at least one terminal group of the molecularly self - assembled layer by modifying at least one characteristic of the terminal group so as to generate a pre - specified interaction with at least one other material formed on the molecularly self - assembled layer . the method of an embodiment comprises selecting the at least one of the molecular characteristic and the molecular type to provide a pre - specified force of adhesion between the molecularly self - assembled layer and the dielectric material . the adhesion of an embodiment is produced by covalent bonding between molecules of at least one material , wherein the at least one material includes material of the molecularly self - assembled layer and the dielectric material . the adhesion of an embodiment includes covalent bonding between silicon and one or more of oxygen , carbon , and nitrogen . the at least one of the molecular characteristic and the molecular type of an embodiment includes a pre - specified head group for molecules of the material . the method of an embodiment comprises selecting the at least one of the molecular characteristic and the molecular type to provide a pre - specified force of adhesion between the molecularly self - assembled layer and at least one material formed on the molecularly self - assembled layer . the at least one of the molecular characteristic and the molecular type of an embodiment includes a pre - specified terminal group for molecules of the material . the molecularly self assembled layer of an embodiment comprises at least one of a cluster of atoms , a cluster of functionalized atoms , nanoparticles , and functionalized nanoparticles . the molecularly self - assembled layer of an embodiment comprises molecules including organosilanes . the molecularly self - assembled layer of an embodiment comprises one or more of dendrimers , hyper - branched polymers , polymer brushes , and block co - polymers . the dielectric constant of the dielectric material of an embodiment is less than or equal to approximately 2 . 5 . the size of the pores of the dielectric material of an embodiment is approximately in a range of ten ( 10 ) angstroms to fifty ( 50 ) angstroms . the porosity of the dielectric material of an embodiment is equal to or less than approximately fifty percent ( 50 %). the methods , processes , and systems described above for molecular self - assembly can be used to produce or manufacture semiconductor devices . aspects of the molecular self - assembly systems and methods described herein may be implemented as functionality programmed into any of a variety of circuitry , including programmable logic devices ( plds ), such as field programmable gate arrays ( fpgas ), programmable array logic ( pal ) devices , electrically programmable logic and memory devices and standard cell - based devices , as well as application specific integrated circuits ( asics ). some other possibilities for implementing aspects of the molecular self - assembly systems and methods include : microcontrollers with memory ( such as electronically erasable programmable read only memory ( eeprom )), embedded microprocessors , firmware , software , etc . furthermore , aspects of the molecular self - assembly systems and methods may be embodied in microprocessors having software - based circuit emulation , discrete logic ( sequential and combinatorial ), custom devices , fuzzy ( neural ) logic , quantum devices , and hybrids of any of the above device types . of course the underlying device technologies may be provided in a variety of component types , e . g ., metal - oxide semiconductor field - effect transistor ( mosfet ) technologies like complementary metal - oxide semiconductor ( cmos ), bipolar technologies like emitter - coupled logic ( ecl ), polymer technologies ( e . g ., silicon - conjugated polymer and metal - conjugated polymer - metal structures ), mixed analog and digital , etc . it should be noted that the various components disclosed herein may be described and expressed ( or represented ) as data and / or instructions embodied in various computer - readable media . computer - readable media in which such data and / or instructions may be embodied include , but are not limited to , non - volatile storage media in various forms ( e . g ., optical , magnetic or semiconductor storage media ) and carrier waves that may be used to transfer such formatted data and / or instructions through wireless , optical , or wired signaling media or any combination thereof . examples of transfers of such data and / or instructions by carrier waves include , but are not limited to , transfers ( uploads , downloads , e - mail , etc .) over the internet and / or other computer networks via one or more data transfer protocols ( e . g ., http , ftp , smtp , etc .). when received within a computer system via one or more computer - readable media , such data and / or instruction - based expressions of the above - described components may be processed by a processing entity ( e . g ., one or more processors ) within the computer system in conjunction with execution of one or more other computer programs . unless the context clearly requires otherwise , throughout the description and the claims , the words “ comprise ,” “ comprising ,” and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense ; that is to say , in a sense of “ including , but not limited to .” words using the singular or plural number also include the plural or singular number respectively . additionally , the words “ herein ,” “ hereunder ,” “ above ,” “ below ,” and words of similar import refer to this application as a whole and not to any particular portions of this application . when the word “ or ” is used in reference to a list of two or more items , that word covers all of the following interpretations of the word : any of the items in the list , all of the items in the list and any combination of the items in the list . the above description of illustrated embodiments of the molecular self - assembly systems and methods is not intended to be exhaustive or to limit the molecular self - assembly systems and methods to the precise form disclosed . while specific embodiments of , and examples for , the molecular self - assembly systems and methods are described herein for illustrative purposes , various equivalent modifications are possible within the scope of the molecular self - assembly systems and methods , as those skilled in the relevant art will recognize . the teachings of the molecular self - assembly systems and methods provided herein can be applied to other processing systems and methods , not only for the systems and methods described above . the elements and acts of the various embodiments described above can be combined to provide further embodiments . these and other changes can be made to the molecular self - assembly systems and methods in light of the above detailed description . in general , in the following claims , the terms used should not be construed to limit the molecular self - assembly systems and methods to the specific embodiments disclosed in the specification and the claims , but should be construed to include all processing systems that operate under the claims . accordingly , the molecular self - assembly systems and methods are not limited by the disclosure , but instead the scope of the molecular self - assembly systems and methods is to be determined entirely by the claims . while certain aspects of the molecular self - assembly systems and methods are presented below in certain claim forms , the inventors contemplate the various aspects of the molecular self - assembly systems and methods in any number of claim forms . accordingly , the inventors reserve the right to add additional claims after filing the application to pursue such additional claim forms for other aspects of the molecular self - assembly systems and methods .

7Electricity

referring now on occasion to all of the figure drawings , the present invention provides an apparatus and a method of accomplishing an improved corticotomy facilitated orthodontic procedures . according to a preferred embodiment , a surgical template 20 ( fig1 ) is securely positioned over a patient &# 39 ; s teeth and gums ( also referred to herein as gingivae and identified by reference numeral 83 , fig3 ) and is constructed so as to indicate the regions of the gums 83 which may be safely penetrated , in numerous locations , passing then through a cortical plate and into an underlying medullary bone within a jawbone ( 66 , fig2 ), by a small drill or needle ( 102 , fig9 ) thereby effecting the corticotomy . the use of the small drill 102 or needle 102 is referred to as a needle corticotomy . after the corticotomy is completed , the patient &# 39 ; s cortical plate softens , as known to those familiar with the art , within typically 1 to 7 days an amount sufficient to begin moving the teeth in an accelerated manner by means of the application of light forces using any of the currently available conventional orthodontic techniques . future devices to assist the movement of teeth may also be developed and used in conjunction with the instant invention . the cortical bone remains soft for a period of time , thereby permitting faster movement of the teeth in response to light forces that are applied to them to urge them in the desired direction . continuing now to refer in greater detail to the various figures wherein like reference characters refer to like parts , there is shown at 20 in fig1 , the surgical template constructed in accordance with the subject invention . an accelerated orthodontic procedure is facilitated by performing a corticotomy involving the perforation of a patient &# 39 ; s cortical plate . a detailed description of a corticotomy , in general , is not included herein other than to describe the differences thereto that arise from use of the instant invention as it relates to a needle corticotomy because corticotomies are generally well known to those having ordinary skill in the dental arts . referring momentarily to fig2 , the jawbone 66 includes at the surface the cortical plate which includes a thickness that varies patient to patient , as described in greater detail hereinafter . covering the cortical plate are the gingivae 83 or gums . protruding from the cortical plate are the various teeth ( 62 , 64 fig2 ). underneath the cortical plate is the medullary bone where each tooth &# 39 ; s 62 , 64 root 68 , 70 , fig2 , are disposed . the medullary bone contains any of a variety of landmarks ( one landmark is shown in fig3 , reference numeral 90 ) that are to be avoided . the various landmarks to avoid are well known to those having ordinary skill in the dental arts . serious harm to the patient can occur if certain of these landmarks are contacted during the corticotomy . a primary advantage , as is described in greater detail hereinafter , is that the instant invention permits the desired corticotomy to occur without the removal of the mucogingival tissue 83 . the improved needle corticotomy is accomplished by penetrating the mucosal tissue ( gums 83 ) and the underlying cortical plate at very specific locations and in very specific directions as indicated by the surgical template 20 . the template 20 is custom made ( molded ) to precisely fit each patient and is positioned over the teeth 62 , 64 and gums 83 after the landmarks ( to avoid ) have first been identified , as described in greater detail hereinafter , and factored into design of the template 20 . fig1 provides an overall perspective view of the surgical template 20 , showing its major features and their spatial relationships . further referring to fig1 , the surgical template 20 is so engineered to present targeted areas through which penetrations using the needle 102 or drill 102 or by other means , as described in greater detail hereinafter , may be made with assurance that the key anatomical landmarks will be avoided . these preferred areas are used to guide the dentist as he or she drills through the patient &# 39 ; s gingivae 83 and also through the patient &# 39 ; s cortical plate beneath the gingivae 83 . these areas are exemplified by a plurality of regions 22 , 24 , 26 , 28 , 30 , 32 , 34 , 36 , 38 , 40 , 42 , 44 , and 46 . these regions 22 - 46 are of any preferred or desired size and shape and they will vary from patient to patient , depending on the general or unique location of the landmarks . often , the regions 22 - 46 will have a common shape that resembles either a triangle or a “ tall ” type of a trapezoid . however , depending on the unique landmarks that a particular patient may have , the shape of any of the regions 22 - 46 will vary , as desired . some of the regions 22 - 46 may resemble a square or a rectangular , whereas some may be more oval or circular , or include any conceivable type of a polygonal shape . the shape of any one region 22 - 46 may vary significantly from the shape of any adjoining region . the regions 22 - 46 are included on the surgical template 20 in two basic ways . there is a third way to indicate the regions , discussed in greater detail hereinafter , which does not utilize the template 20 or any variation thereto . each patient differs anatomically and therefore the surgical template 20 is constructed specifically to correspond to the unique anatomical features of each patient . the surgical template 20 is generally comprised of a molded element that closely follows the contours of the patient &# 39 ; s teeth 62 , 64 ( and other teeth ) and gingival 83 regions proximal to the teeth 62 , 64 that are to be repositioned . the surgical template 20 is made to “ form - fit ” to the patient &# 39 ; s specific anatomy . as shown throughout the drawings , the template 20 extends the length of either the upper or lower jawbone 66 . this is generally preferred to ensure that a firmer or better fit occurs . however , if preferred , a smaller , shorter , or other specific section of the template 20 can be used when only one or two teeth are to be repositioned and a more localized corticotomy is required . it is also important to note that the template 20 is preferably saved even after the corticotomy is performed . the needle corticotomy is intended to soften the cortical plate proximate areas of injury to the plate by producing regional acceleratory phenomena or rap , as is discussed further hereinafter . if , however , it is determined that after having performed a needle corticotomy , as described herein , there is insufficient rap occurring , the template 20 may be reused and a repeat needle corticotomy accomplished at any site ( i . e ., at any particular region 22 - 44 ) where rap has slowed down after 90 - 120 days . therefore , the template 20 is saved for possible future use . the preferred method of constructing the surgical template 20 is the use of cad / cam technology which consists of a ctscan to create an image file . the image file is used to create a virtual 3d model of each ( upper and lower ) jawbone 66 depicting also all of the teeth 62 , 64 , roots 68 , 70 , critical landmarks 90 and cortical regions 22 - 46 over an interproximal bone 60 ( fig2 ). computer software is used for this purpose and is known . the surgical template 20 is then virtually created to fit a virtual model of the jawbone 60 . this information is stored on a cd - rom and is then used to create an actual physical model of each jaw and then an actual physical surgical template ( i . e ., a variation in construction that is still used as the template 20 ) is created to fit each jaw , which includes each physical model made from the image file as well as each of the patient &# 39 ; s actual jawbones 66 . the actual physical model of each jaw is preferably created using a clear plastic type of outer material with landmarks shown in color within the model . that makes it easy , when constructing the template 20 , to create the regions 22 - 46 that avoid the landmarks . as is described in greater detail hereinafter , an effective way to produce the physical models is by the use of stereo - lithography . one possible way to create the surgical template 20 is for the dentist to take an impression ( well known ) of the patient &# 39 ; s teeth 62 , 64 and gums 83 and then construct a plaster model ( not shown ) from the impression . the plaster model is then used to form the surgical template 20 over the plaster model using a thermo - suction technique ( well known ). it is also known how to construct a virtual model of a jaw and then a physical model using the ctscan image file . this practice has been used when an implant , used to replace a missing tooth , is implanted into a jaw and the dentist must drill down from the top of the jaw . the software to generate the preferred view of the jawbone used for the invention as described herein is obtained by modification to the software . there are other well known techniques and methods that can readily be adapted to create the desired template 20 . for example , vacuum thermoforming techniques using an essix brand vacuum machine ( at the worldwide web at essix . com ) can also be used to form the template 20 over a model of the jawbone 66 . a plastic sheet is thermoformed onto a plaster model of the patient &# 39 ; s gums and teeth , thereby providing a base to be used to create the actual finished template 20 . landmarks are located by x - ray or ctscan and are then superimposed on the template base . it is not necessary to indicate the location of the landmarks on the template 20 , however , they can be included , if desired . it is , however , necessary to assist the dentist in providing areas that are safe to drill into which will avoid these landmarks . while including all of the landmarks on the template 20 and allowing the dentist to drill around them is possible , it is not preferred . rather , it is preferred that the regions 22 - 46 be included on the template 20 that reveal areas that are “ safe ” to penetrate through the gingivae 83 , through the cortical plate , and into the vascular regions of medullary bone underneath . in other words , it is preferred to show the dentist areas where it is safe to drill rather than to show areas to avoid drilling . it also improves safety by showing the safe regions 22 - 46 because those areas that are shown as safe to drill into on the template 20 , that is the regions 22 - 46 , include a safety margin that helps ensure that the dentist will stay sufficiently far away from key landmark areas , for example , from roots , nerves , vessels , sinus areas , etc . the template 20 is preferably constructed of a sheet of transparent plastic to allow viewing of the teeth 62 , 64 and gums 83 over which it is applied ; however , other moldable materials may also be suitable . the material used to form the template 20 is preferably of sufficient thickness and rigidity so as to maintain its form when it is applied over the teeth 62 , 64 and gums 83 . according to a modification , described further hereinafter , the thickness becomes a variable . continuing to refer now in particular to fig2 is shown , amongst other elements , the typical anatomical features of a patient . regions of the cortical plate determined to be safe to penetrate are determined and are projected to the surgical template as the regions 22 - 46 in the template 20 . it is to be understood that not every tooth is necessarily repositioned during any orthodontic procedure and that therefore , not all of the regions 22 - 46 will always be utilized during corticotomy . in general , if a tooth is to be urged in any given direction as part of the orthodontic procedure , the needle corticotomy is performed minimally on the side of the tooth in the interproximal bone 60 where migration of the tooth is desired . however , the needle corticotomy is preferably performed on both sides of the tooth that is to be repositioned . additionally as mentioned earlier , the regions 22 - 46 are presented in either of three ways . two of those ways are used with the template 20 ; a third way is described as a modification hereinafter . a preferred way is to provide a cut - out of the region where corticotomy is to occur . the dentist performing the orthodontic procedure determines this . needle corticotomy may occur between many , most , all or only a few of the teeth . only select regions 22 - 46 , where the corticotomy is to occur , will appear on the template 20 . this is to avoid confusion and the possibility that excess corticotomy could occur between teeth that do not require rap . in some cases the same dentist performing the orthodontic procedure will also perform the corticotomy , as described herein . this , of itself , is an improvement over the prior art wherein when practicing corticotomy with the prior art a more skilled practitioner , one who was able to perform the mucoperiosteal flap procedure , was required to perform the corticotomy . this procedure was more daunting and complex than many dentists would care to engage in . the instant invention allows those dentists who would not feel sufficiently skilled to perform a mucoperiosteal flap procedure to accomplish the type of needle corticotomy disclosed herein . according to a preferred way of indicating the regions 22 - 46 on the template 20 , each region 22 - 46 where corticotomy is to occur is cut out or removed to provide an opening or plurality of openings through the template 20 , exposing the gingivae 83 directly underneath . as described in greater detail hereinafter , the dentist would simply use each cut - out region 22 - 46 to drill a plurality of holes through the gingivae 83 , cortical plate , and down into the medullary bone . according to a preferred way of indicating the regions 22 - 46 on the template 20 , each region 22 - 46 where corticotomy is to occur is outlined on the template . the dentist would similarly use each region 22 - 46 to drill a plurality of holes that first pass through the template 20 itself ensuring that each of those holes occurs within one of the outlined regions 22 - 46 . after puncturing the template 20 , the dentist would continue drilling through the gingivae 83 , cortical plate , and down into the medullary bone . fig2 shows a safe area 50 between the roots of two teeth 62 , 64 that includes a generally trapezoidal overall shape . it also tends to resemble a triangular in shape as well . the safe area 50 as determined to exist between any two of the adjacent teeth 62 , 64 is used to define each of the regions 22 - 46 that appear on the template 20 . the safe area 50 , once determined , is projected onto the surgical template 20 . the safe area 50 is generally defined by outlining the interproximal bone 60 between the adjacent teeth 62 and 64 as viewed from the buccal or labial view of the jaw bone 66 . the safe area 50 is further defined by the surfaces of the roots 68 and 70 of adjacent teeth 62 and 64 on the sides , an upper apex 72 of the cortical triangle being defined by the gingival crest of the bone and a lower delineation 74 being preferably defined by a line drawn from a point approximately ¾ the distance of the root length of one tooth to a similar point on the adjacent tooth as measured from the base of a crown 74 and 76 where the root begins towards the apical end of the root 78 and 80 . if anatomical features to be avoided are determined to lie within the safe area 50 , the boundaries of the safe area 50 are adjusted to exclude those features and the adjusted safe area 50 is then projected onto the template 20 where it is either outlined ( to drill through the template 20 and through the gingivae 83 , cortical plate , and to the medullary bone ) or the projected safe area 50 is cut out and removed from the template thereby allowing the dentist to drill directly into the gingivae 83 and continue through the cortical plate and into the medullary bone . experiments have shown that limiting corticotomies to the safe areas 50 ( i . e ., the regions 22 - 46 ) is sufficient to produce adequate softening of the cortical plate to permit accelerated tooth repositioning ( rap ). the total number of guide regions 22 - 46 in the template 20 will be determined on a case by case basis as required to soften the appropriate interproximal cortical plate bone regions . as in fig2 , the lower delineation 74 may alternatively be defined by a line 82 drawn from the apex of the root of one tooth 78 to the apex of the adjacent root 80 ; however , landmark features , which tend to be more prevalent closer to the root apex , such as nerves maybe located in this region and care must be taken to avoid these structures . other potential complications of placement of the lower delineation 74 as defined from adjacent root apexes have been observed such as an increased difficulty in penetrating the more delicate mucogingival tissues 83 residing over the apical end of the root as the tissue itself tends to wrap around the drill 102 during penetration . the use of the well fitting surgical template 20 with a closed border approximately ⅛ ″ beyond the safe area 50 helps to prevent wrapping of the delicate mucogingival tissue in the apical area . further , a thicker , harder plastic material , if used to create the template 20 provides an added benefit . the template 20 also holds the mucogingival tissue even firmer , which further protects the tissue from wrapping around the drill 102 . another solution to minimize the wrapping of the delicate mucoperiosteal tissue , aside from drilling through the template 20 , is to limit the size of the regions 22 - 46 that have been cut out to a minimal amount . this is done by creating holes within the borders of the safe areas 50 instead of a complete cut out of the plastic surface of the surgical template 20 over the safe area 50 , which is also the border of the underlying interproximal bone . this design approach provides a preferred method for providing access to the dentist when penetrating the gingivae 83 and cortical plate of bone , first , because it holds the mucoperiosteal tissue 83 more firmly which limits the wrapping effect , and secondly , because the holes that are to be drilled through the template can be color coded which provides the operating dentist with a depth guide . the depth guide referred to here is particularly useful when a transparent virtual or physical model of the jaw is provided to the dentist , along with the surgical template or guide , since the 3d imaging software allows the software technician ( who creates the virtual and actual physical models of the patient &# 39 ; s jaw ) to measure the depth of the mucosal tissue as well as the depth of the cortical plate of bone the dentist is penetrating to reach the vascular medullary bone beneath the cortical plate of bone . referring to fig3 , showing a right buccal view of the regions 22 - 46 ( 46 being identified ) are projected onto the surface of the working model . the landmark anatomical features such as a mandibular canal 90 are thereby avoided . the projected safe areas 50 form the regions 22 - 46 and those regions where corticotomy is to occur are then cut out ( or , alternately , outlined on ) from the surgical template 20 , thus forming the openings ( or , alternately , the outlined areas ) through which penetrations can safely be made without the need for mucoperiosteal flap procedure . fig4 shows a frontal view , fig5 , a right buccal view , and fig6 , an occlusal view of the surgical template 20 illustrate the close form fitting construction of the template to the patient &# 39 ; s anatomy and provide alternate views of the cut out regions . forming the plastic template 20 tightly around the teeth and gingivae 83 allows the template 20 to be held in place and in the correct position on the patient . the exact dimensions of the template 20 and the cut out regions will , of course vary , depending upon the specific anatomy of the patient . also , and as mentioned earlier , for certain situations where the needle corticotomy is to be performed at only a few locations , a smaller section of the template 20 ( i . e ., not including all of the teeth ) may be provided , if preferred . if a smaller section of the template 20 is used , it must nevertheless include a sufficient number of teeth or other anatomical features of the patient so as to ensure that the smaller section is properly aligned in the patient &# 39 ; s mouth . the smaller section , as well as the full template 20 cannot be allowed to excessively move or shift in its position while it is affixed over the patient &# 39 ; s teeth 62 , 64 and gums 83 . this is because it is important to maintain the few regions 22 - 46 ( i . e ., those few that are included in the smaller section of the template 20 ) in their proper position over the interproximal bone 60 and away from all of the landmarks 90 it is desirable to avoid . it is also noted that more than one template 20 can be used . for example , a first version of the template 20 ( or a first section of the template 20 ) may be used to assist in performing a needle corticotomy with the upper jawbone ( i . e ., maxillary ). the first version of the template 20 would then provide a maxillary version of the surgical template 20 . a second , different version of the template 20 ( or a second section of the template 20 ) may be used to assist in performing a needle corticotomy with the lower jawbone ( i . e ., mandibular ). the different version of the template 20 would then provide a mandibular version of the surgical template 20 . this is useful when teeth are to be repositioned in both the upper and lower jaws . it is also possible to use a first section of the template 20 on one side of either the upper or lower jawbone and to simultaneously use a second section of the template 20 on another side or location of the either the same upper or lower jawbone . this is when one or two teeth are to be repositioned on the same jawbone but when these teeth are sufficiently separated from each other . the use of two sections of the template 20 , as described , may be used in this situation although it is still preferred to use one continuous version of the template 20 , as shown . these options are discussed herein to illustrate a few of the variations in the apparatus and method that are possible for those skilled in the art . when the teeth of any particular patient are deemed to be especially crowded , the dentist may elect to cut the template 20 ( either the mandibular or the maxillary versions thereof ) into two or three sections to permit easier placement of the sections of the template 20 over the crowded teeth . referring now to fig7 , a left buccal view of the surgical template 20 , a gingival portion of the template is indicated by bracket 129 . the gingival portion 129 is that section of the template 20 that rises above the gum line or gingival crest on the maxillary or upper version of the template 20 and which covers the gingivae 83 that are disposed over the cortical plate in the area of interest , namely where the needle corticotomy is to be performed . the gum line is indicated by marker 131 . the gingival portion 129 , of course , extends down from the marker 131 on the mandibular or lower version of the template 20 . the gingival portion 129 may also be generally referred to as a mucogingival or as a mucoperiosteal portion of the template 20 . a mucosal extension 132 optionally protrudes from one or both ends of the gingival portion 129 of the template 20 . referring now to fig8 , an internal view of a surgical template 20 , shows the plurality of indentations around the teeth . these indentations are the spaces into which each respective tooth fits . such a space is exemplified by reference numeral 92 . it is important to understand that the template 20 is thermoformed ( or otherwise produced ) so as to provide a plurality of the spaces 92 that conform well to the shape , location , and volume of each tooth . accordingly , the template 20 fits over the teeth and gums with precision and it is retained in place by the precision of its fit . the surgical guide ( i . e ., the template 20 ) thereby indicates the areas into which penetrations of the gingivae may be made without injuring sensitive , predetermined landmark features . fig9 shows a frontal view of a maxillary version of the template 20 in position disposed precisely over a patient &# 39 ; s teeth and gums . assuming that needle corticotomy is to be performed at region 36 ( as shown in fig9 ; the region numbers may change with each version of the template 20 ), it is preferred that a plurality of penetrations ( i . e ., holes that are drilled ) occur at region 36 and also at each remaining region wherever corticotomy is to occur . this may include only one or two of the total number of regions 22 - 46 or it may extend up to and including all of the regions 22 - 46 . again , this is determined on a case by case basis . the reason a plurality of penetrations is preferred to just one penetration at any given region ( i . e ., region 36 ) is because it is highly desirable to enter into a vascular region of the medullary bone and cause it to bleed . when bleeding of the medullary bone occurs , conditions for generating rap are optimized . in particular , the cortical plate of bone is avascular . by penetrating into the medullary bone , a blood supply is provided to the cortical plate . osteoblasts are then sent to the cortical plate in sufficiently larger numbers which results in rap or “ regional acceleratory phenomenom ” and allows the teeth to move ( reposition ) faster when orthodontic forces are subsequently applied . therefore , a plurality of penetrations , spaced 3 - 4 mm apart , are accomplished through the gingivae 83 , through the cortical plate , and into the medullary bone underneath the region 36 to adequately soften the interproximal bone . also , it is possible to observe bleeding and conclude , with a high degree of accuracy , that it is originating in the medullary bone . a number of penetrations are next made into and through the gingivae 83 that is exposed in the region 36 . in general , each penetration is made as close to perpendicular with respect to the surface of the gingivae 83 as is possible . according to a preferred embodiment , the gingivae 83 that is to be punctured is exposed by the cut out area ( i . e ., the region 36 ) in the surgical template 20 . while variation is possible , a preferred way to make the punctures is by using a small diameter needle - like instrument , for example a product marketed as an x - tip ® 104 and as shown in fig9 , or # 2 small round bur , or similar drill . the x - tip ® 104 is shown mounted in a slow dental handpiece 100 and in the preferred position ( i . e ., perpendicular to surface ) to perform a penetration though the gingivae and through the underlying cortical plate , passing beyond the cortical plate and in to the underlying inner or medullary bone . the cortical plate usually is from 1 mm to 2 mm thick and typically requires a 4 mm long needle or drill shaft 102 to penetrate through the gingivae 83 , cortical plate , and sufficiently far into the medullary bone . when portions of the cortical plate are determined to be harder or thicker than that suitable for penetration by an x - tip ®, experiments have shown that a small round burr or other type drill is indicated and may , of course , be substituted therefore . the needle or drill , as mentioned above , is generally inserted perpendicular through the gingivae 83 into the underlying cortical plate and subsequently into the underlying medullary bone . experiments have shown best results when penetrations are made at approximately 3 - 4 mm spaced - apart distances within the region 36 and when the penetrations occur in sufficient number within the surgical template 20 cut out region 36 to maximize the occurrence of pap and the associated softening of the cortical plate . softening of the cortical plate shortly after the needle corticotomy is performed requires about one week to reach the level of regional acceleratory phenomena or rap , which as mentioned hereinbefore results in the rapid softening of the cortical plate thereby allowing accelerated repositioning of the teeth using orthodontic appliances such as braces or the aligners sold under the tradename , invisalign ®. experiments have further shown that after a needle corticotomy , softening of the cortical plate is sustained for approximately 90 to 120 days before re - hardening begins to secure the teeth in their new positions . it is noted that a slight pressure is maintained on the cortical plate during at least a portion of this period of time by the orthodontic appliances that are used . it is , of course , possible that re - hardening might occur sooner in the absence of these sustained slight forces by the teeth themselves . it is possible , also , for re - hardening to occur sooner than desired , even when slight pressure is applied to the cortical plate by the teeth . if the cortical plate re - hardens before the orthodontic procedure is completed , the surgical template 20 or a section of the template 20 can be positioned again over the affected teeth that require additional movement and for the needle corticotomy to again be performed in the areas ( i . e ., regions 22 - 46 ) that require it . an advantage provided by the instant apparatus and method is that the need for post - operative dressing or treatment is either greatly lessened or entirely eliminated after the minor surgical procedure ( i . e ., puncturing of the gingivae 83 ) has been completed . the usual pain and antibiotic medications used for other common types of dental procedures is usually sufficient to give the patient comfort and protection from infection . by way of contrast , the prior art method using a mucoperiosteal full flap surgery , however , is much more invasive and the potential for infection far greater . there are two ways to determine the depth of drilling that is required and they are either by approximation or by some form of measurement . as described above , the template 20 shows where to drill but it does not show how deep . neither does it show how many holes to drill in any given region 22 - 46 . the practitioner uses his skill to make such determination and this is generally a very acceptable approach . it is important to note that the regions 22 - 46 have already excluded the landmarks that are to be avoided so a slight variation in angle ( away from perpendicular ) or depth is of little concern . it is possible to use the image file ( described hereinabove ) to more precisely define both the number of penetrations that are to occur in any given region as well as the depth of each penetration , separate and distinct from the next penetration . before a discussion of this occurs , the following description is useful in explaining how the detailed image files , useful in creating the template 20 or any variation thereto , are obtained . the interproximal bone 60 regions that are safe to penetrate are identified by various means , for example by x - rays , mri , ultra - sound , ct ( or cat ) scans or other currently recognized diagnostic techniques as well as by future diagnostic techniques for visualizing or locating anatomical landmark features to be avoided during penetration of the cortical plate . the preferred method of creating and manufacturing a surgical guide for use in the present invention is as follows : a ct scan is taken of the patient &# 39 ; s upper and lower jawbones and teeth . the scan is formatted and using 3d cad / cam software , a virtual model of each of the jawbones is created virtually showing the jawbone in transparent plastic with a gingival layer , teeth , roots and critical landmarks visible to the end user . the gingival layer , teeth , roots and critical landmarks are preferably delineated within the transparent plastic sufficient to be readily observed . the interproximal bone 60 between all of the roots is also visible . a safe area 50 is then drawn on the virtual model over each interproximal bony 60 area between any two adjacent teeth 62 , 64 where corticotomy is to occur . using 3d software to create a virtual model of each jawbone allows for the creation of different views to optimally display the density and depth of the cortical plate , thereby allowing “ virtual holes ” ( penetrations ) of varying circumference and depth to be placed through the gingivae and cortical plate in all of the intended interproximal bone 60 areas of the jawbones . the location of the virtual holes is in conjunction with those interproximal bony 60 areas adjacent to teeth 62 , 64 that are misaligned and are in need of orthodontic movement . it is also possible to determine an ideal “ virtual depth ” for each penetration . based on the depth necessary for the end user to penetrate the cortical plate , each virtual hole is color coded to indicate the preferred depth that the drill must penetrate to optimally penetrate the cortical plate into the medullary bone . the selection of color codes is determined by number of millimeters the x - tip ® or # 2 round bur or other drill must be driven to penetrate the cortical plate . for instance , 2 mm length holes could be green , 4 mm holes could be yellow and 6 mm holes could be red . a file of this information is then saved and stored on a cd - rom for use in the physical construction of the models and surgical guides ( i . e ., template 20 ). the most accurate and cost effective method for creating a large volume of surgical template 20 guides for end users is by the process of stereo - lithography . using the cd - rom file ( of course the cd - rom file could be stored otherwise and emailed , for example ), an actual physical model of each jawbone is manufactured , which includes all of the before mentioned features and qualities of the virtual models . the full scale model is constructed of transparent material allowing a 3d visualization of the patients &# 39 ; anatomy . a surgical template 20 is then constructed to fit each physical model of each jawbone . each of the safe areas 50 are then projected onto the surgical template 20 and included as one of the regions 22 - 46 . as mentioned earlier , any one of the regions 22 - 46 may include any particular shape although a generally triangular shape ( or trapezoidal ) is most common . depending on the preference of the end user practitioner , holes of varying depths and colors are made through the surgical template . in other words , each of the plurality of individual holes that are to be drilled in any or every particular region 22 - 46 is pre - drilled through the template 20 . after the practitioner places the template 20 over the patient , he or she simply holds the drill 102 perpendicular and drills through each of the pre - drilled holes in the template 20 that have been provided in each region 22 - 46 . an advantage of pre - drilling the holes in the template during its manufacture ( as opposed to providing the larger cut - out region ) is that the gingival portion 129 provides greater support for the gingivae 83 virtually elimination the possibility that the gingivae 83 will wrap around the drill 102 . however , as previously described , if the end user prefers , a complete cut - out of each particular region 22 - 46 is alternately made in the template 20 thereby allowing the end user to choose the locations for penetrating the cortical plate . another alternate method to produce the template 20 is to take digital x - rays of the patients &# 39 ; teeth and jawbones in the regions where the teeth are to be repositioned . the x - rays are scaled to full size in a computer graphics program such as microsoft photodraw ®. the anatomical landmarks are identified on the x - rays and the safe areas 50 , used to define the regions 22 - 46 , are defined and included . a template element ( the basic template sheet that conforms to the patient &# 39 ; s anatomy , prior to its completion ) is constructed using a simple vacuum thermoforming machine to suction a moldable plastic sheet ( readily moldable at temperature ) over a plaster model of the jawbone which the dentist makes from simple impressions of the patients &# 39 ; teeth and gums that he or she has taken . another example of a prior art type of device that can be modified for use to create the template are bleach trays , currently used to house a solution of bleach used to whiten teeth . of course additional modifications to the trays , consistent with the disclosure herein , must be first accomplished . the safe areas 50 where corticotomy is required are then projected onto the template element by placing the x - ray images over the template element . the regions 22 - 46 are then mapped and marked on the template element to indicate the cut - out regions . the regions 2 - 46 are then cut - out ( i . e ., removed ) from the template element to produce the actual template 20 . the cut - out regions 22 - 46 thus reveal the safe areas 50 for needle or drill penetration to occur . holes , as mentioned hereinbefore , can alternately be drilled through the surgical template 20 during its manufacture if the end user prefers this method over a full cut out . although not preferred it is possible , as also mentioned hereinbefore , to simply outline the regions 22 - 46 on the template 20 and to allow the dental practitioner to drill , at the time of corticotomy , first through the template 20 and then through the gingivae 83 , cortical plate , and into the medullary bone . the template 20 is complete when it has been created to fit at least a portion of the jawbone of the patient and when it also includes some indication as to where the safe areas 50 are located for performing a needle corticotomy directly through the gingivae 50 . that indication , as described herein , may include providing an outline of each region 22 - 46 , a cut - out ( i . e ., removed portion from the template 20 ) of each region 22 - 46 , or predrilled holes in the template 20 within each region 22 - 46 . as indicated , identification of the cortical safe areas 50 , which are the delineated areas of interproximal bone between each tooth 62 and the adjacent tooth 64 , and then the accurate projection of these safe areas 50 as each region 22 - 46 to the surgical template 20 are critical to the invention . after the needle corticotomy has been performed , preferably , an aligner ( a device intended to apply orthodontic forces to reposition at least one of the teeth ) or braces are applied , the patient is released , and the gingivae 83 are allowed to heal . the patient preferably returns in a few days to confirm that healing is properly occurring . it is possible to delay the application of orthodontic forces until a later time . however , it is preferred to apply the orthodontic forces sooner rather than later . any preferred orthodontic device is used ( i . e ., applied ) to begin to apply a force to the teeth that require repositioning . rap occurs in response to the needle corticotomy in the affected regions 22 - 46 and rapid movement of those teeth also occur in response to the force that is applied to the softened cortical plate by the teeth . the orthodontic device and movement of the teeth are periodically monitored and the orthodontic device is adjusted or replaced with a modified orthodontic device to ensure that constant pressure is maintained and applied to the teeth to reposition them as quickly as possible . once the teeth have reached their desired position , no additional force attempting to move them a further amount is applied to them . orthodontic devices may then be utilized , as desired , to retain the now quickly and properly repositioned teeth in their desired position until the cortical plate re - hardens and secures the teeth in position from that time forward . prior to the instant invention , it has not been possible to perform a needle corticotomy safely through the gingivae 83 , absent first performing a mucoperiosteal flap procedure to expose the cortical plate . the time required to perform the mucoperiosteal flap procedure , the expense associated with it , the discomfort it causes to the patient , the added risks or infection , and the fear associated with these elements are all eliminated by the instant invention . the gingivae 83 are able heal readily from the punctures associated with the needle corticotomy that occur in the regions 22 - 46 . no suturing is typically required . it is expected that future scientific advancement will include even further modification to the instant invention , thereby allowing the dentist to perform the needle corticotomy without the use of a surgical template and / or drills as previously described . the use of a monitor viewing screen at the site of the operation displaying an internal view of the patients jawbones making it possible to place the drill , x - tip or even to use a laser as a boring instrument or other type of cutting device and to do so without the use of the surgical template 20 , while still penetrating through the gingivae 83 and cortical plate to the inner medullary bone to provide the necessary blood supply to the cortical plate to induce rap , or the regional acceleratory phenomenon , to occur while avoiding all landmarks . likewise , new and better methods of correcting orthodontic malocclusions ( i . e ., orthodontic devices ) will be used by dentists ( i . e ., to reposition the teeth ) and when available for use , are of course suitable for use with the instant invention after the needle corticotomy has been performed . therefore , any method that induces rap combined with new orthodontic methods is included in this invention which does not require either a mucoperiosteal flap or insertion or bone grafting materials . referring now to fig1 is shown a cross - sectional view of a modified template , identified in general by the reference numeral 200 . to illustrate a first method of regulating depth and direction refer to a portion of the drawing identified by bracket 202 . it is preferred , though not required , that the thickness of the modified template 200 be fairly constant if the first method is employed . it is required , however , that the thickness of the modified template 20 not exceed a minimum amount required to permit drilling of the deepest required hole . the reason for this is made apparent in the following discussion . according to the first method , a short conduit 204 is included in the modified template 200 as and where needed within any given one or more of the regions 22 - 46 . as and where needed , a long conduit 206 is similarly provided . the short and long conduits 204 , 206 are formed of any preferred material including metal or plastic or any other preferred type of material . the short conduit 204 cannot be shorter than the thickness of the modified template 200 . this is to ensure that the deepest hole that is required to be drilled into any of the regions 22 - 46 will penetrate into the medullary bone the desired amount when a particular length of drill or needle is used . conversely , the long conduit 206 cannot be any longer than would permit the chosen needle or drill to penetrate the minimum required amount into the medullary bone . when the first method for regulating depth is used , a particular length drill or needle is specified . the length of each conduit 204 , 206 is selected at each particular drill site after analysis of the image files ( i . e ., the cd rom file ) or other detection means to determine the location of the landmarks to avoid . analysis of the thickness of the cortical plate and of the medullary bone are factored in to determine the optimum depth of drilling . the speed advantage thus obtained is apparent . the practitioner performing the needle corticotomy merely selects one length of drill or needle , inserts it into the instrument , and then proceeds in rapid succession to create all of the punctures by inserting the drill or needle into each conduit 204 , 206 until drilling has penetrated the full depth allowed by each particular conduit 204 , 206 . not only is the drilling depth automatically regulated and varied for each and every puncture location , but the direction of drilling is also ensured , thereby preventing any possibility that inadvertence could cause the drill or needle to wander in an unwanted direction and possibly contact a landmark . if it is deemed especially important to avoid a particular landmark and , nevertheless accomplish a required puncturing , an angled conduit 208 is provided in the modified template 200 . the angled conduit 208 includes the desired length and is other than normal with respect to a surface of the gingivae 83 . the second method of regulating depth and direction of drilling ( i . e ., puncturing the gingivae 83 , cortical plate , and entering into the medullary bone ) is accomplished as shown by referring to a portion of the drawing identified by bracket 210 . the thickness of the modified template 200 is accordingly varied to produce a similar regulation to the depth of drilling as described above . at a first thinner location of the modified template 200 , a first shorter embedded conduit 212 is included that is flush with the two opposite surfaces of the modified template 200 . similarly , at a second thicker location of the modified template 200 , a second longer embedded conduit 214 is included that is also flush with the two opposite surfaces of the modified template 200 . the dentist similarly is instructed to use a drill or needle of a particular length and to drill , in succession , through all of the embedded conduits 212 , 214 in the modified template 200 . any of the embedded conduits 212 , 214 may of course be angled away from normal , if desired . with either method , it is of course possible to require a change in either the length or diameter ( another variable that is regulated by the conduits 202 , 204 or by the embedded conduits 212 , 214 ) of the drill or needle , should that be necessary to accommodate anomalies in the anatomic features of the patient . not specifically shown , but apparent after the instant disclosure , a modification of the second method of regulating depth and direction ( i . e ., varying the thickness of the modified template 200 ) includes the omission of the embedded conduits 212 , 214 from the modified template 200 . it is not generally preferred that both methods for controlling depth and direction be employed on the same region of the modified template 200 , although it is possible . it is generally preferred to construct any version of the modified template 200 so that it utilizes only one , but not both , of the methods for controlling depth and direction . it is possible , however , to construct the modified template 200 using both methods , one at certain regions 22 - 46 and the other at a remainder of the regions 22 - 46 . for example , the conduits 202 , 204 may irritate the tissues of the cheek farther back in the mouth and may therefore not be used toward the rear but instead proximate the front teeth , while the actual depth of the modified template 200 may be varied in these more rearward portions to lessen discomfort to the cheek . it is important to note that the number of penetrations that are required at any one of the regions 22 - 46 include a sufficient number of penetrations through the cortical plate and into the medullary bone and at preferred spaced apart intervals to cause a sufficient softening of the cortical plate . while generalizations may be made , this can also vary from patient to patient . also shown in fig9 , are a few of the plurality of bore holes ( i . e ., punctures ) 350 that have been accomplished in the region 36 where needle corticotomy is occurring . referring also to the side is shown a first color code 352 and below it a second color code 354 that are provided on the template 20 , as desired . the first color code 352 includes a different color than the second color code 354 . each color code 352 , 354 instructs the dentist to make the punctures that are proximate any given one of the color codes 352 , 354 at a particular depth . the preferred depth for each hole or group of holes is determined by analysis of the anatomical features and landmarks and is optionally provided as a guide for the dentist to follow . another expected , common method of utilizing the instant invention is to provide the template 20 as the first template covering a full arch to allow for a full corticotomy when desired . this is to assist for general types of tooth movement , such as expansion or retraction . a second and , as desired , a plurality of successive templates ( not shown ) are created at various stages of the aligners or braces where certain desired tooth movements need additional corticotomy treatment to facilitate optimally rapid tooth movement . the second and successive templates are typically created at the beginning of difficult tooth movements , such as rotations , closing large spaces , applying a torque for angulation of roots , eruption , and distalizing or mesializing of teeth . the second and successive templates can also include a full arch , anterior arch , quadrant ( i . e ., half arch ), or any portion of arch , as desired , depending primarily on the amount of corticotomy that is required to keep tooth movement progressing as rapidly as possible . the invention has been shown , described , and illustrated in substantial detail with reference to the presently preferred embodiment . it will be understood by those skilled in this art that other and further changes and modifications may be made without departing from the spirit and scope of the invention which is defined by the claims appended hereto .

0Human Necessities

a pipe 1 of a pipeline consists of high - alloyed steel and may have a weak point 2 on the inside of the pipe as a result of corrosion or cavitation . a weak point 2 of this kind may be found on a pipeline 1 by an inspection . in order to avoid a leak developing in the case of this weak point 2 becoming larger , the pipe 1 , which may be a straight - line pipe or an elbow , is provided with a shell 3 , which covers over the weak point 2 . in principle , one shell 3 suffices , which can be secured by means of a suitable holding device that engages around the pipe in the manner of a belt . the holding device may at the same time be a tensioning device in order to apply a radial force . an adhesive layer 4 provided on the shell 3 on its inner side is pressed against the outer wall of the pipe by this radial force . a plurality of shells is preferably provided , half - shells in the case of the embodiment according to fig1 and one - third shells in the case of the embodiment according to fig2 . the shells 3 consist of steel and are coated with an adhesive layer 4 on their inner side , i . e . their concave side . the adhesive is an epoxy adhesive , which is dry , i . e . non - sticky . the epoxy adhesive is activatable at 80 ° c .- 120 ° c . and then develops its full adhesive capacity . application of the adhesive 4 to the concave side of the shell 3 is effected in liquid form , by spraying , extrusion or the like . the half shells have previously been manufactured to have an internal wall contour that corresponds to the external wall contour of the pipe to be repaired . the individual shells 3 are placed around the pipe in such a way that their edges run parallel to the elongate contour of the pipe . flange portions 5 extend outward in the radial direction at the edges . these flange portions are flange strips that are spaced apart from one another , so that a gap 6 is formed between the individual shells 3 . the shells with their adhesive layer 4 are in surface engagement against the previously prepared external wall of the pipe 1 to be repaired . the pipes are pretreated , for example by sandblasting , acid treatment , or the like , in such a way that as soon as the adhesive is activated , it establishes an adhesive bond with the external wall of the pipe . for this , coatings which are possibly present on the external wall of the pipe are fully removed , so that the adhesive may enter into an effective bond with the bare metal . in fig3 , the force action of a clamping force to be applied is represented by k . the force k is applied in the circumferential direction so that the two flange edges 5 that run parallel to one another are pressed against each other . as a result of this , a radially inwardly directed force component is developed in the region of the adhesive layer 4 , this force pressing the adhesive layer 4 onto the surface of the pipe 1 to be repaired . a heating action is designated by w , this being developed by means of a heating device . the heating device warms up the shells 3 mounted on the pipe 1 to be repaired , so that the thermally activatable adhesive 4 is softened . as a result of the force k applied during the application of heat , the softened adhesive 4 penetrates to some extent into the gap interspaces 6 . the application of the heat is terminated when a sufficient quantity of adhesive is present in the gap interspaces 6 . after the adhesive 4 has cooled down and hardened out , the continuing force action k may be terminated . for permanent securing of the shells 3 to one another , the shells may be bolted to one another in the region of the flanges 5 . the clamping force may be applied by a clamp , hydraulically , by way of a tensioned spring , or otherwise . it is necessary for the clamping force to have sufficient resilience for the shells 3 to be able to shift slightly in the course of the activation of the adhesive layer 4 . enlargement of the weak point 2 and its final development into a hole in the pipe 1 is not in fact prevented by the apparatus described above or by the method described above . discharge of fluid from the pipe 1 is however prevented in an effect manner , since the shell 3 functions as a new pipe wall . in order to ensure this , the shells 3 are arranged around the pipe 1 in such a way that the weak point 2 is located approximately midway between two edges 5 of a shell 3 , thus the shell 3 overlies the weak point in an optimal manner . fig5 shows a modification in which only one shell 3 is to be adhered to a weak point 2 that is not to be seen in this figure . here also , the external wall of the pipe has been pretreated . a coating has been removed by sand blasting or by a suitable acid treatment , so that the adhesive of the shell enters into direct contact with the steel of the pipe . clamping means engaging around the pipe are designated by the reference numeral 7 and may be clamping belts . reference numeral 8 designates schematically illustrated clamping members , by means of which tension can be exerted on the clamping belts 7 . the shells may be precoated with adhesive . they may however also be coated with adhesive only on site . this is especially advantageous if the adhesive is a liquid or pasty medium . an adhesive which can be pre - applied is especially suitable , so that the repair can be effected without having to bother with liquid adhesives on site . the adhesives are preferably applied to the inner side of the shell 3 during its manufacture . the adhesives have a dry or self - adhering surface at ambient temperature . after the shell 3 or the plurality of shells 3 is / are secured on the pipe , the adhesive is thermally activated , the bond to the pipe being first of all effected and a chemical cross - linking reaction bringing about a duromer adhesive , i . e . an adhesive that is non - soluble and non - meltable . the main constituent of the organic portion of the adhesive which can be pre - applied consists of acrylate , methacrylate , polyurethane , phenol resin or epoxy resin in monomeric , oligomeric or polymeric form . preferred embodiments of adhesives which can be pre - applied are described in more detail below : reactive adhesives which can be pre - applied and are stickily adhesive are preferably covered by a protective film or protective paper after being applied to the inner side of the shell 3 , as is generally customary according to the state of the art , e . g . for self - adhesive labels . the purpose of the protective film or protective paper is to protect the sticky adhesive from contamination . the advantage of this embodiment of the invention is that the repairing shell 3 adheres on the pipe immediately after it has been applied and does not have to be held further for the remaining process steps . the strength and durability of conventional sticky adhesives is however in no way sufficient under the typical conditions of use for a pipeline , so that a cross - linking to form a duromer adhesive with permanent bonding must be effected . the sticky adhesives — preferably based on acrylates , polychloroprene or polyisoprene — must as a result contain chemical groups , which are subsequently amenable to a cross - linking reaction under site conditions . examples of these are : acrylate groups ( bonded to the base polymers or in the form of low - molecular acrylates ), which are cross - linked by micro - encapsulated peroxides , the peroxides being released from the microcapsules by thermal action or by mechanical pressure ; copolyacrylates containing stickily adhesive acrylates ( e . g . isooctylacrylate ) and acrylates containing hydroxyl groups ( e . g . 2 - hydroxyethylacrylate or 2 - hydroxymethacrylate ), which are cross - linked by thermally activatable blocked isocyanates ( e . g . desmodur tt , rheinchemie ). for the embodiments of the invention which are based on adhesives that can be pre - applied and have a dry surface , covering - over of the adhesive is normally not necessary , but may be used to used to protect the adhesive layer from contamination . adhesives of this kind may have a different base . examples are mentioned below : solid polyesterpolyols ( e . g . polycaprolactone ( e . g . capa from solvay ) or polyhexanedioladipates ( e . g . dynacoll from degussa )), which are formulated with thermally activatable blocked isocyanates ( e . g . desmodur tt , rheinchemie ). application to the substrate to be precoated is effected in the form of a melt . solid epoxidated phenol resins ( e . g . novolak epoxy resin , epr 600 from hexion ), which are formulated with dicyanodiamide ( e . g . dyhard 100 from degussa ) and optionally urones ( e . g . ur 300 from degussa ) as hardening accelerator . application to the substrate to be precoated is effected in the form of a melt . aqueous dispersions of a solid bisphenol a or epoxy resin based on epoxidated novolak ( e . g . epi - rez resin 3522 - w - 60 from hexion ), which is formulated with dicyanodiamide ( e . g . dyhard 100 from degussa ) and optionally a urone as hardening accelerator ( e . g . ur 500 from degussa ). application to the substrate to be precoated is effected e . g . by spraying - on of the aqueous dispersion . after evaporation of the water , a dry adhesive layer is achieved , which becomes sticky under heat and hardens out as an adhesive of high strength . the cross - linking reaction is induced thermally after the components have been joined together . preferred embodiments for introducing heat into the adhesive layer on site are hot air , electrically heated heating strips or heating cushions , and inductive heating of the metallic substrate material ( e . g . the steel of which the pipe and / or the pipeline consists ). these methods of heating are known in principle in the prior art and require merely to be adapted to the present invention . an adhesive which can be pre - applied as a dry reactive layer is prepared from 900 g polycaprolactonediol with a molecular weight of 2000 ( pcl 2000 e diol , solvay ) and 100 g polycaprolactonetriol with a molecular weight of 2000 ( pcl 2000 e triol , solvay ) and 91 . 5 g isoqurc tt ( isochem kautschuk gmbh ), the powders being mixed closely into one another . at 70 ° c ., a melt of the adhesive with an average thickness of 300 μm is applied to a half shell of steel st 37 having an internal diameter of 30 mm , a length of 50 mm and a material thickness of 1 . 2 mm . after cooling , the coating is non - sticky . a hole of 3 mm diameter is drilled in a pipe of st 37 , the pipe having a length of 200 mm , an outer diameter of 30 mm and a wall thickness of 2 mm , and the hole is then to be repaired with the half shell precoated with the adhesive . for this , the half shell is placed on the pipe so that the hole is in the middle of the region covered by the half shell . the half shell and the pipe are firmly connected to one another by wire and the adhesive is then hardened for 60 min at 160 ° c . in an oven . after a storage time of 2 days under ambient conditions , the repaired pipe was subjected to a pressure test at 10 bar . there was no failure of the repaired location , either at 22 ° c . ambient temperature or at 50 ° c . all features disclosed are ( in themselves ) pertinent to the invention . the disclosure content of the associated / attached priority documents ( copy of the prior application ) is hereby also included in full in the disclosure of the application , also for the purpose of incorporating features of these documents in claims of the present application .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

referring to fig2 a , 2 b and 2 c , some oligo ( phenylenevinylene ) s ( opvs ) for use in accordance with one aspect of the invention are illustrated , and are examples of opvs of the invention . the opvs of the invention are represented by the formula ( i ): x is h , nhr , nr 2 , ( o ( ch 2 ) 2 ) 2 or , or , no 2 , or so 2 r ; y is h , nhr , nr 2 , ( o ( ch 2 ) 2 ) 2 or , or , no 2 , or so 2 r ; a , b , c , and d are each independently selected from the group consisting of h , r , or , nhr , and nr 2 ; e and f are each independently selected from the group consisting of h , sir 3 , alkyl , and aryl groups ; and each r is independently selected from the group consisting of a substituted and unsubstituted alkyl and aryl groups ; and wherein if both x and y are or , at least one of a , b , c , d , e , and f is other than h ; if both x and y are one of ( o ( ch 2 ) 2 ) 2 och 3 and so 2 c 6 h 13 , at least one of a , b , c , d , e , and f is other than h ; if x , y , e , and f are all h , at least one of a , b , c , and d is other than h , and a , b , c , and d are not all tert - butyl ; and if x , y , a , b , c , and d are all h , e and f are not both c 6 h 13 or both c 8 h 17 . the oligo ( phenylenevinylene ) ( opv ) of formula ( i ) may be selected such that : x is h , nhr , nr 2 , ( o ( ch 2 ) 2 ) 2 och 3 , oc 3 h 7 , oc 4 h 9 , oc 5 h 11 , oc 6 h 13 , no 2 , or so 2 c 6 h 13 ; y is h , nhr , nr 2 , ( o ( ch 2 ) 2 ) 2 och 3 , oc 3 h 7 , oc 4 h 9 , oc 5 h 11 , oc 6 h 13 , no 2 , or so 2 c 6 h 13 ; a , b , c , and d are each independently selected from the group consisting of h , ch 3 , och 3 , nh ( c 3 - 8 - alkyl ), and n ( c 3 - 8 - alkyl ) 2 ; e and f are each independently selected from the group consisting of h , si ( c 3 - 8 - alkyl ) 3 , and c 6 - 14 - aryl groups ; and each r is independently selected from the group consisting of c 3 - 8 - alkyl and c 6 - 14 - aryl groups ; wherein if both x and y are or , at least one of a , b , c , d , e , and f is other than h ; if both x and y are one of ( o ( ch 2 ) 2 ) 2 och 3 and so 2 c 6 h 13 , at least one of a , b , c , d , e , and f is other than h ; if x , y , e , and f are all h , at least one of a , b , c , and d is other than h , and a , b , c , and d are not all tert - butyl ; and if x , y , a , b , c , and d are all h , e and f are not both c 6 h 13 or both c 8 h 17 . examples of r groups include substituted or unsubstituted methyl , propyl , butyl , hexyl , phenyl , and methylphenyl groups . in one aspect , both or one of the terminal ends of the opv are dialkylamino , diarylamino , alkylamino , and / or arylamino groups with a chain length of 2 to 5 phenyl rings . thus , the opv of formula ( i ) may be selected such that : each r is independently selected from the group consisting of c 3 - 8 - alkyl and c 6 - 14 - aryl groups . specifically mentioned as an example of an opv is 1 , 4 - bis - 4 -( dibutylamine ) styrylbenzene ( opv ( 1 )- nbu ), illustrated in fig2 a . opv ( 1 )- nbu is a very efficient and bright green - blue emitter , with an efficiency of about 5 cd / a . this is because the oxidation potential of the opv ( 1 )- nbu is relatively low compared with other materials . since it has a relatively low oxidation potential , it can also be used as hole injection or transport material in the htl . the luminance of opv ( 1 )- nbu at 20 v is about 5000 cd / m 2 . by changing the chain length and adding different functional groups as side - or end - group , the emission colour of the opv can be tuned from yellow to blue . selection of particular side - or end - groups based on their electronic property , such as by using strong electron donating or accepting groups , influences the emission colour . furthermore , such a selection can be used to select opvs which are particularly useful as hole injection / transporting or electron injection / transporting materials . for example , use of electron accepting groups in the opv favours its electron injection / transporting capabilities , whereas use of strong electron donating groups favours its hole injection / transporting capabilities ( see for example , tao et al ., nonlinear optics ( 2000 ) vol . 25 , 491 ; tao et al ., synthetic metals 111 - 112 ( 2000 ) 417 ; and tao et al ., thin solid films 363 ( 2000 ) 298 , all of which are incorporated by reference herein ). the opvs of the invention may be synthesized using techniques generally known in the art . examples of synthetic routes using the stereoselective wadsworth - emmons reaction as a key step ( see for example m . s . wong , et al , j . mater . chem . 8 ( 1998 ) 2005 , incorporated by reference herein ). referring to fig3 there is illustrated the structure of an organic light - emitting device in accordance with one aspect of the invention . a substrate layer of glass 31 is partially coated with a transparent conductive oxide , in this case indium - tin - oxide ( ito ) to form the anode 33 . on the ito anode 33 is a layer of n , n ′- diphenyl - n , n ′- bis ( 3 - methylphenyl )- 1 , 1 - biphenyl - 4 , 4 ′- diamine ( tpd ) as hole transport layer ( htl ) 35 , followed by a layer of an opv as emissive layer 38 , and a layer of 2 -( 4 - biphenylyl )- 5 -( 4 - tert - butylphenyl )- 1 , 3 , 4 - oxadiazole ( pbd ) as electron transporting layer ( etl ) 37 . the cathode is an aluminum cathode 39 . the device may also include an ito pad 43 to connect the cathode with the environment . the substrate may be opaque or transparent , rigid , or flexible , and / or plastic , metal , or glass . the substrate may be as thin as 10 microns , if present as a flexible plastic or metal foil substrate , such as aluminum foil , or substantially thicker if present as a rigid , transparent or opaque , substrate , or if the substrate is comprised of a silicon - based display driver . materials that may be used as the hole transport anode layer , aside from ito , include zn — in — sno 2 , sbo 2 , and other materials known in the art . the hole transport anode layer may be from about 50 nm to greater than 400 nm thick . the htl layer shown in fig3 is 50 nm thick ; however other thicknesses can be used , usually in the range of 5 or 10 to 100 nm . other materials may be incorporated into or used instead of tpd as the hole transport layer . examples of other hole transport layer materials include 4 , 4 ′- bis [ n -( 1 - naphthyl )- n - phenylamino ] biphenyl ( npb ), opvs , and molecules disclosed in the art ( see for example u . s . pat . no . 6 , 150 , 043 issued nov . 21 , 2000 , and u . s . pat . no . 6 , 023 , 073 issued feb . 8 , 2001 , both of which are incorporated herein by reference ). in one embodiment , the oligo ( phenylenevinylene ) of the formula ( i ) may be used as the htl . the eml layer may have a variety of thicknesses , such as 5 to 100 nm . as shown in fig3 the eml layer has a thickness of 50 nm . in some devices , the emissive layer may be purely made by opv of formula ( i ). more than one opv may be used in the eml . further , the opvs may be mixed with other emitters such as anthracene , atp , bnvp , coumarin , or other known emitters . in some devices , the emissive layer may be made by co - deposition of a hole transporting material , such as tpd or npd , and opv . co - deposition can achieve high quality thin films and may reduce red - shifts in emission color . in some cases , the eml may be tpd , npd , or other hole transport layer material , doped with opv . the effect of co - deposition on emission color in the case of opv ( 1 )- nbu is shown in fig4 . a comparison of 2 : 1 tpd : opv ( 1 )- nbu to 1 : 2 tpd : opv ( 1 )- nbu to pure opv ( 1 )- nbu , shows that the devices using co - deposited tpd : opv ( 1 )- nbu as emitter have shorter emission wavelengths . in some devices of the invention , the opv will not be present in the eml layer , but will be present solely in the etl or htl layer . the etl layer shown in fig3 is 20 nm thick . other thicknesses may be used such as 5 or 10 to 100 nm . materials other than pbd may be used and are known in the art , such as alq 3 , a carbazole , an oxadiazole , a triazole , a thiopene , or oligothiophene group ( see also u . s . pat . no . 6 , 023 , 073 , issued feb . 8 , 2001 , incorporated by reference herein ). an opv of formula ( i ) may also be used in the etl layer . an electron transport cathode layer may also be included . materials that maybe used as the electron transport cathode layer include mg — ag , li — al or ca , or a non - metallic material such as ito , and other materials known in the art . it typically has a thickness of about 5 to 30 nm . generally , any material that meets the necessary requirements ( such as oxidation potential , charge mobility , homo , and lumo positions ) may be used as htl and etl layers , as well as for the anode and / or cathode . lif can be added between the cathode and the etl in order to enhance the electron injection efficiency , in a thickness of , for example , 0 . 1 to 2 . 0 nm . a capping layer 41 may optionally be used for encapsulation to prevent oxygen and moisture from contaminating the device . the capping layer may be glass , metal , polymer / metal multilayers , or any other suitable material . a patterned insulating layer 47 is used to define the emissive area or pixel size of an oled ; such materials are known in the art and include sio 2 , sin x , and al 2 o 3 , or substantially any other material that may be used as the insulating material of an oled , which may be deposited by a variety of processes such as plasma enhanced chemical vapour deposition ( pecvd ), electron beam , or the like . the electroluminescent ( opv ) materials of this invention may be present alone in an eml which also functions as an htl and etl layer , sandwiched between an anode and a cathode . alternatively , they may be present as part of a heterostructure comprising htl and etl layer , in which the electroluminscent material is incorporated into one of the htl and etl layers , or as part of a structure having an htl , eml , and etl layer . fig5 shows the current density - voltage characteristics of an oled having a structure as shown in fig3 and using the opv , opv ( 1 )- nbu , as the eml . it shows typical rectifying behavior with a rectifying ratio of 10 5 at ± 15 v . the luminance - voltage and luminance - current density characteristics of the test device of fig3 comprising opv ( 1 )- nbu as the opv are shown in fig6 and 7 , respectively . the luminance - current density relationship is not exactly linear , but may be improved , however , by adjusting the layer thickness to realize balanced charge injection . the dependence of the device &# 39 ; s external efficiency on bias voltage is also shown in fig6 . in the luminance range of 20 to 1600 cd / m 2 , the efficiency varies between 5 . 4 to 4 . 0 cd / a . in the luminance range typically used for display 100 to 200 cd / m 2 , the efficiency varies between 5 . 3 and 5 . 0 cd / a . the external efficiency may be further improved by optimizing the layer thickness and co - deposition ratio . the oleds of the present invention have the advantage that they can be fabricated entirely from vacuum - deposited molecular organic materials as distinct , for example , from oleds in which some of the layers are comprised of polymeric materials , which cannot be readily deposited using vacuum deposition techniques . a vacuum - deposited material is one which can be deposited in a vacuum typically having a background pressure less than one atmosphere , preferably about 10 − 5 to about 10 − 11 torr for vacuum deposition , or about 50 torr to about 10 − 5 torr for vapour deposition . the oled of the present invention may be used in substantially any type of device which is comprised of an oled , for example , in oleds that are incorporated into a larger display , a vehicle , a computer , a television , a printer , a large area wall , theater or stadium screen , a billboard or a sign numerous modifications may be made without departing from the spirit and scope of the invention as defined in the appended claims .

8General tagging of new or cross-sectional technology

referring to fig1 a cartilage treatment probe 10 includes a proximal section 12 for attachment to a radiofrequency power supply , a shaft 14 , and a distal , active tip 16 . shaft 14 is formed from a stainless steel tube 17 ( see fig3 ) covered with insulation , e . g ., heat shrink tubing , which is surrounded by a sheath 18 . referring to fig2 and 3 , tip 16 extends from a distal end 20 of shaft 14 . tip 16 includes a bumper , or head , 22 formed from one or more electrically insulating materials , e . g ., an electrically insulating ceramic or tetrafluorethylene ( tfe ) material , that has a generally planar tissue contacting surface 22 a . bumper 22 defines a transverse slot 24 for pivotably coupling bumper 22 to a flexible portion , i . e ., a nitinol wire form 26 . as shown in fig4 nitinol wire form 26 loosely resides in transverse slot 24 . wire form 26 is in a super - elastic state , as explained below . wire form 26 is held in place by a retainer disk 28 that is glued to bumper 22 or snaps into bumper 22 , allowing bumper 22 to pivot freely about nitinol wire form 26 . the proximal ends 30 , 32 of wire form 26 are attached to distal end 20 of shaft 14 , such as by being inserted into distal end 20 of shaft 14 and crimped to stainless steel tube 17 . bumper 22 pivots about an axis defined by wire form 26 that is substantially perpendicular to the longitudinal axis of shaft 14 , although this orientation can be varied . nitinol wire form 26 is arranged so that , in a relaxed state , bumper 22 is offset from a longitudinal axis of shaft 14 by a distance d and by an angle α , as shown in fig2 to facilitate accessing tissue with bumper 22 . referring again to fig2 bumper 22 has a height h in the range of about 0 . 05 to 0 . 15 inches , preferably about 0 . 09 inches , a width w in the range of about 0 . 10 to 0 . 19 inches , preferably about 0 . 14 inches , and a length l in the range of about 0 . 10 to 0 . 30 inches , preferably about 0 . 20 inches . bumper 22 is offset from the longitudinal axis of shaft 14 distance d in the range of about 0 . 01 to 0 . 40 inches , preferably about 0 . 15 inches . the distance d is measured from the longitudinal axis of shaft 14 to a line parallel to the longitudinal axis that intersects transverse slot 24 , as shown in fig2 . the angle α is approximately 30 degrees . angle α can range from about 0 to 45 at least about degrees on either side of the longitudinal axis . referring again to fig3 and 4 , tip 16 includes a “ t ” shaped electrode 34 having a stem 38 and a top 44 . electrode 34 is made from an electrically conductive material , e . g ., stainless steel flat stock or a wire form . bumper 22 defines a hole 36 and stem 38 of the “ t ” is located in hole 36 . soldered , or otherwise attached , to the end of stem 38 is a power lead 40 . power lead 40 is a thin flexible conductor strip chosen for its flexibility and low profile . proximal of tip 16 , power lead 40 is positioned between tube 17 and the heat shrink tubing surrounding tube 17 , and extends to the proximal end of probe 10 for connection to a cable running to the power supply . bumper 22 also defines a cut - out 42 in tissue contacting surface 22 a , in which top 44 of the “ t ” resides to form an electrically conductive , active portion 46 of the electrode , for applying energy to tissue . top 44 , which forms an electrically conductive surface of portion 46 , is substantially planar but other surface geometries can be used . referring to fig5 top 44 of the “ t ” is positioned in bumper 22 such that electrically conductive portion 46 is flush with tissue contacting surface 22 a or extends out from tissue contacting surface 22 a by about 0 . 0003 to 0 . 004 inches . portion 46 also can be recessed in tissue contacting surface 22 a by about 0 . 0003 to 0 . 004 inches . the active , electrically conductive portion 46 of the electrode preferably has a small surface area in the range of about 0 . 0002 to 0 . 0065 square inches , preferably about 0 . 0009 to 0 . 0036 square inches , more preferably in the range of about 0 . 0016 to 0 . 0021 square inches , and most preferably about 0 . 0018 square inches . the surface area of portion 46 is substantially smaller than the surface area of tissue contacting surface 22 a , which can be , for example , in the range of about 0 . 01 to 0 . 057 square inches , preferably about 0 . 028 square inches . bumper 22 acts as a physical barrier to limit the depth of penetration of electrode 34 into the tissue . bumper 22 also masks portions of electrode 34 , except for portion 46 , to limit the direction of current flow from electrode 34 . power lead 40 and stem 38 of electrode 34 are surrounded by an insulating material ( not shown ) such that portion 46 is exposed only on tissue contacting surface 22 a of bumper 22 . referring to fig6 and 7 , in use , probe 10 can be positioned adjacent to a tissue surface 50 to be treated , so that the electrically conductive surface of portion 46 is substantially parallel to tissue surface 50 . radio frequency power is delivered to portion 46 from a radio frequency generator ( not shown ), such as , for example , the vulcan ® generator sold by smith & amp ; nephew , inc , andover , mass . as probe 10 is moved across tissue surface 50 , bumper 22 pivots freely about nitinol wire form 26 to facilitate tissue contacting surface 22 a sliding across tissue surface 50 and the surface of electrically conductive portion 46 remaining substantially parallel to tissue surface 50 . nitinol wire form 26 , which is extremely flexible in multiple directions , provides tip 16 with a range of flexibility relative to shaft 14 such that bumper 22 and the active , electrically conductive portion 46 of electrode 34 remains substantially in contact with articular tissue surface 50 while traveling over complex geometries . the resistance to deformation of the nitinol in its superelastic state is constant , providing a spring action that helps bumper 22 and the electrically conductive surface of portion 46 follow the curvature of tissue surface 50 while maintaining a controlled , approximately uniform contact pressure of the bumper 22 and electrode 34 against articular cartilage surface 50 over complex geometries as nitinol wire 26 is deflected . the spring action of nitinol wire 26 also biases bumper 22 towards tissue surface 50 when probe 10 is pressed towards tissue surface 50 . nitinol wire 26 can be referred to as a spring , and other springs or spring materials , such as , for example , stainless steel spring wire , can be used . referring to fig8 sheath 18 can be slid forward relative to stainless steel tube 17 to cover tip 16 to provide temporary rigidity to flexible tip 16 for insertion into and removal from the joint capsule . sheath 18 includes ribs 52 ( fig1 ) that facilitate grasping of sheath 18 to extend and retract sheath 18 . when covering tip 16 , sheath 18 also protects tip 16 and limits catching of tip 16 on tissue . power is preferably delivered to probe 10 under the control of an impedance feedback loop to maintain the probe in an ablative mode . in addition , since the impedance rises when the probe is not being moved across tissue , impedance feedback can be used to recognize when the probe is not being moved and controls can be used to turn off the power and / or sound an alarm . probe 10 also can include one or more temperature sensors , such as a thermistor mounted in tip 16 , to monitor the temperature at or near tip 16 . the temperature sensors and the power generator can be coupled by a feedback control system that regulates the amount of energy delivered to the probe based on the temperature at or near tip 16 , in order to control the temperature of tissue surface 50 . these control systems can be implemented , for example , in software . the use of a small surface area electrode allows the probe to function in an ablative mode at low power and provides for low thermal penetration into the tissue such that the extent of cell death can be maintained at preferably less than about 200 microns . this results in surface smoothing of the cartilage of the articular surface with minimal tissue removal and cell death . the use of probe 10 is indicated , e . g ., for chondromalacia lesions outerbridge system grades ii and iii , as well as for stabilizing the rim of grade iv lesions . it is believed that an additional benefit of the use of probe 10 is the sealing of articular surfaces to stop or slow down the degradation process of the cartilage . probe 10 has been shown as a monopolar device . a monopolar device has certain advantages over a bipolar device , such as the smaller size of the monopolar device facilitating access to small joint spaces , and the presence of only one electrode in the joint space so the user does not have to be concerned with inadvertent contact of a return electrode with tissue . however , the probe can be bipolar by incorporating a return electrode on the shaft or elsewhere on the probe , as discussed with respect to fig9 below . stainless steel tube 17 need not define a lumen along its entire length , but need only be able to receive ends 30 and 32 of the nitinol wire 26 to attach ends 30 and 32 to the distal end 20 of tube 17 . for example , tube 17 can be solid along the majority of its length , providing additional rigidity to the probe , and include one or two openings at distal end 20 of tube 17 into which ends 30 and 32 of nitinol wire 26 are inserted . referring to fig9 an alternate embodiment of a cartilage treatment probe 900 includes an active tip 916 that attaches to distal end 20 of shaft 14 , as discussed above . active tip 916 includes a bumper , or head , 922 , having a tissue contacting surface 922 a . tissue contacting surface 922 a includes an electrically conductive surface 935 of an active electrode 930 for applying energy to tissue . electrically conductive surface 935 is rounded and extends out from tissue contacting surface 922 a a small amount , such as approximately 0 . 0003 to 0 . 004 inches . alternatively , electrically conductive surface 935 can be flush with or recessed in tissue contacting surface 922 a . electrically conductive surface 935 has a surface area substantially smaller than tissue contacting surface 922 a , as discussed above . bumper 922 defines a transverse slot 924 that receives a nitinol wire 940 , or more generally a flexible member , for pivotably coupling bumper 922 to shaft 14 , as discussed above . a portion 942 of nitinol wire 940 is located in slot 924 and is surrounded by a sleeve 944 to facilitate pivoting of bumper 922 about nitinol wire 940 . slot 924 is closed off with a non - conductive filler material 928 , which can be the same as or different from the material of bumper 922 , in order to hold nitinol wire 940 in slot 924 , while allowing bumper 922 to pivot about nitinol wire 940 . active electrode 930 is l - shaped and bumper 922 defines a corresponding l - shaped aperture 925 for receiving active electrode 930 . also within l - shaped aperture 925 , a distal portion 952 of an active power lead 950 is soldered , or otherwise attached , to a top surface 934 of active electrode 930 . distal portion 952 of active power lead 950 and top surface 934 of active electrode 930 are closed off by an electrically insulating filler 954 , which is the same or a different material than bumper 922 . accordingly , active electrode 930 is exposed only at electrically conductive surface 935 , and bumper 922 includes an electrically conductive portion for treating tissue positioned at only one side ( tissue contacting surface 922 a ) of bumper 922 . it should be understood that electrode 930 and aperture 925 can have any other suitable geometry that allows electrode 930 to be mounted to bumper 922 . shaft 14 also includes an electrically conductive surface of a return electrode 960 coupled to a return power lead 962 . return electrode 960 is shown flush with the outer surface of shaft 14 , but return electrode 960 can project from or be recessed in shaft 14 . for example , shaft 14 can be formed by a stainless steel tube covered with insulation , and return electrode 960 can be disposed over the insulation . another layer of insulation can be disposed over a portion of return electrode 960 and / or return power lead 962 . return electrode 960 and / or return power lead 962 also can be formed from the stainless steel tube . active power lead 950 and return power lead 962 are coupled to opposite poles of a bipolar electrosurgical generator ( not shown ), such as the aforementioned vulcan ® generator . thus , probe 900 operates in a bipolar mode with current mainly flowing from electrically conductive surface 935 , through or around the tissue surface , to return electrode 960 . it should be understood that return electrode can be located on another part of probe 10 , such as , for example , on bumper 22 or on nitinol wire 940 . referring to fig1 , an alternative embodiment of a cartilage treatment probe 1000 includes an active tip 1016 that attaches to distal end 20 of shaft 14 , as discussed above . active tip 1016 includes a bumper , or head , 1022 having a tissue contacting surface 1022 a . tissue contacting surface 1022 a of bumper 1022 includes an electrically conductive surface 1035 of an electrode 1030 for applying energy to tissue . electrically conductive surface 1035 is rounded and is recessed within tissue contacting surface 1022 a a small amount , such as approximately 0 . 0003 to 0 . 004 inches . alternatively , electrically conductive surface 1035 can be flush with or extend from tissue contacting surface 1022 a , as discussed above . electrically conductive surface 1035 also has a surface area substantially smaller than a surface area of tissue contacting surface 1022 a , as discussed above . bumper 1022 defines a transverse slot 1024 that receives a flexible portion 1040 , which is a nitinol wire , for pivotably coupling bumper 1022 to shaft 14 , as discussed above . bumper 1022 includes an upper bumper portion 1060 ( fig1 - 13 ) and a lower bumper portion 1070 ( fig1 - 16 ). upper bumper portion 1060 and lower bumper portion 1070 are made of the same or different non - conductive materials , such as ceramic or tfe . referring to fig1 - 13 , upper bumper portion 1060 includes transverse slot 1024 , an upper mating surface 1062 , and a cylindrical projection 1064 projecting down from upper mating surface 1062 . upper bumper portion 1060 also includes an upper electrode receiving aperture 1066 configured to receive a top portion 1034 of l - shaped electrode 1030 and an end portion 1052 of a power lead 1050 . as shown in fig1 and 12 , upper electrode receiving aperture 1066 includes a rectangular portion 1067 intersecting upper mating surface 1062 and a tapered portion 1068 intersecting an upper surface 1022 b of bumper 1022 . referring to fig1 and 14 - 16 , lower bumper portion 1070 includes tissue contacting surface 1022 a and a lower mating surface 1072 . lower bumper portion 1070 also includes a substantially round projection receiving hole 1074 for receiving projection 1064 of upper bumper portion 1060 . hole 1074 includes a tapered section 1075 that tapers from a larger diameter at a point near tissue contacting surface 1022 a to a smaller diameter approximately halfway through hole 1074 . hole 1074 also includes a constant diameter section 1076 that extends from the point halfway through the hole 1076 to lower mating surface 1072 as discussed below . lower bumper portion 1070 also includes a lower electrode receiving aperture 1078 for receiving a lower portion 1032 of l - shaped electrode 1030 . bumper 1022 is assembled by passing nitinol wire 1040 through slot 1024 , seating electrode 1030 as explained below , and aligning upper mating surface 1062 of upper portion 1060 and lower mating surface 1072 of lower portion 1070 such that projection 1064 passes through projection receiving hole 1074 . l - shaped electrode 1030 is seated in electrode receiving apertures 1066 and 1078 such that bottom portion 1032 is seated in lower aperture 1078 and top portion 1034 is seated in rectangular portion 1067 of upper aperture 1066 . bottom portion 1032 of electrode 1030 is exposed at tissue contacting surface 1022 a to form electrically conductive surface 1035 . projection 1064 is heated to deform projection 1064 so that projection 1064 fills tapered section 1075 of projection receiving hole 1074 and locks upper bumper portion 1060 to lower bumper portion 1070 . in doing so , projection 1064 is made to be flush with tissue contacting surface 1022 a . end portion 1052 of power lead 1050 passes through tapered portion 1068 and into rectangular portion 1067 of upper aperture 1066 and is electrically connected to electrode 1030 to transmit electrical energy to electrode 1030 . the portion of power lead 1050 outside of bumper 1022 is covered with an electrically insulating material . when assembled , only electrically conductive surface 1035 of electrode 1030 is exposed , on tissue contacting surface 1022 a of bumper 1022 . power lead 1050 is coupled to an electrosurgical generator ( not shown ) for delivering monopolar energy to electrically conductive surface 1035 . referring to fig1 , an alternative embodiment of a cartilage treatment probe 1700 includes an active tip 1716 . active tip 1716 includes a flexible portion 1740 , a bumper , or head , 1722 and a living hinge 1745 . flexible portion 1740 is coupled to distal end 20 of shaft 14 ( e . g ., as shown in fig1 ), such as by ultrasonic welding . flexible portion 1740 is resiliently flexible , has a rectangular cross section , and is made of an elastic or superelastic material , such as plastic . flexible portion 1740 biases bumper 1722 , as discussed above . bumper 1722 has a tissue contacting surface 1722 a , which includes an electrically conductive surface 1735 of an l - shaped electrode 1730 for applying energy to tissue . electrically conductive surface 1735 is rounded , extends out from tissue contacting surface 1722 a a small amount and has a surface area substantially smaller than a surface area of tissue contacting surface 1722 a , as discussed above . alternatively , electrically conductive surface 1735 can be flush with or recessed in tissue contacting surface 1722 a , as discussed above . electrode 1730 is exposed only at electrically conductive surface 1735 on tissue contacting surface 1722 a . referring to fig1 and 18 , bumper 1722 includes a lower bumper portion 1770 and an upper bumper portion 1760 . lower bumper portion 1770 and upper bumper portion 1760 are made of the same or different non - conductive materials , such as ceramic or tfe . lower bumper portion 1770 includes a portion of tissue contacting surface 1722 a . lower bumper portion 1770 is substantially t - shaped , including a distal portion 1772 and a proximal portion 1773 . projecting laterally from proximal portion 1773 are lateral ridges 1774 ( only one of which is shown ). distal portion 1772 includes an electrode receiving aperture 1776 for receiving a bottom portion 1732 of l - shaped electrode 1730 . upper bumper portion 1760 includes a top wall 1762 and lateral depending walls 1764 arranged in a u - shaped configuration when viewed from a distal end of bumper 1722 . each of lateral depending walls 1764 terminate has a terminal end 1765 that forms a portion of tissue contacting surface 1722 a . an interior surface 1761 of each lateral depending wall 1764 defines a groove 1766 for receiving lateral ridges 1774 of lower bumper portion 1770 . an interior surface 1763 of top wall 1762 and interior surfaces 1761 define a space 1767 for receiving a top portion 1734 of l - shaped electrode 1730 . bumper 1722 is assembled by inserting bottom portion 1732 of l - shaped electrode 1730 into aperture 1776 in lower bumper portion 1770 . proximal portion 1773 of lower bumper portion 1770 is inserted into upper bumper portion 1760 so that lateral ridges 1774 are aligned with or fit into grooves 1766 , and top portion 1734 of electrode 1730 is received in space 1767 defined by interior surfaces 1761 and 1763 . upper bumper portion 1760 and lower bumper portion 1770 are locked together by friction fit or by other means such as , for example , an adhesive . assembled bumper 1722 defines a rear opening 1768 configured to receive a power lead ( not shown ) for attachment to electrode 1730 . the remaining space between electrode 1734 and interior surfaces 1731 , 1733 is filled with a non - conductive material , such as , for example , a ceramic or plastic epoxy . bumper 1722 is pivotably coupled to flexible portion 1740 by a living hinge 1745 disposed between flexible portion 1740 and bumper 1722 . living hinge 1745 includes a thin section 1747 of material integral with flexible portion 1740 and bumper 1722 . thin section 1747 has a thickness of approximately 0 . 006 inches , although other dimensions can be used . flexible portion 1740 , upper bumper portion 1760 , and living hinge 1745 are , for example , molded from a single piece of material . living hinge 1745 is composed of a flexible material , such as , for example , polypropylene or polyethylene , that can flex a large number of times without failure . living hinge 1745 allows bumper 1722 to pivot relative to flexible portion 1740 , about thin section 1747 as shown by arrow 1780 . referring to fig1 and 20 , an alternate embodiment of a cartilage treatment probe 1900 includes a shaft 1914 , a wire 1980 , and a bumper , or head , 1922 . bumper 1922 is indirectly pivotably coupled to a flexible distal portion 1940 of shaft 1914 by wire 1980 . rather than wire 1980 being resiliently flexible , wire 1980 is made from a rigid material , such as stainless steel or plastic , and flexibility is provided by flexible distal portion 1940 of shaft 1914 . flexible distal portion 1940 includes a plurality of cutouts 1942 to form a resiliently flexible , corrugated structure . at points between adjacent cutouts 1942 , flexible distal portion 1940 , has a radial ( or transverse ) cross - section that is circular and that is substantially similar to the radial cross - section of the remainder of shaft 1914 proximal of flexible portion 1940 . bumper 1922 can be , for example , any of bumpers 22 , 922 , 1022 , or 1722 and includes an electrode ( not shown ). bumper 1922 is pivotably coupled to wire 1980 , as discussed above . wire 1980 is bent so that bumper 1922 is offset from a longitudinal axis of shaft 1914 a distance , as discussed above , to facilitate accessing a tissue surface with a tissue contacting surface 1922 a of bumper 1922 . bumper 1922 is generally parallel to the longitudinal axis , but could be offset by an angle , as discussed above , such as by making flexible portion 1940 curved . referring to fig2 , an alternative embodiment of a cartilage treatment probe 2100 includes an active tip 2116 having a bumper , or head , 2122 , pivotably coupled to a resiliently flexible portion 2140 . bumper 2122 includes an upper bumper portion 2160 and a lower bumper portion 2170 , each made of a non - conductive material , such as ceramic or plastic . upper bumper portion 2160 and lower bumper portion 2170 are joined to one another , for example , by applying an adhesive , brazing , or ultrasonic welding , or by one of the other mechanisms discussed above . flexible portion 2140 is coupled to shaft 14 , as discussed above . lower bumper portion 2170 includes a tissue contacting surface 2122 a and an l - shaped recess 2172 for receiving an l - shaped electrode 2130 , as discussed above . l - shaped electrode 2130 includes an electrically conductive surface 2135 that is flush with tissue contacting surface 2122 a . alternatively , electrically conductive surface 2135 can extend from or be recessed in tissue contacting surface 2122 a . electrically conductive surface 2135 has a surface area substantially smaller than tissue contacting surface 2122 a . upper bumper portion 2160 defines a recess 2162 and a cavity 2164 that receives , in mating relationship , a substantially dome - shaped member 2166 . member 2166 is fixedly attached to a distal end of flexible member 2140 , which is , for example , a nitinol tube . member 2166 and cavity 2164 function like a ball - and - socket joint , allowing bumper 2122 to pivot in three dimensions about dome shaped member 2166 and flexible member 2140 . the three - dimensional pivoting facilitates the sliding of tissue contacting surface 2122 a across a tissue surface having a complex geometry while the surface of electrically conductive portion 2135 remains substantially parallel to the tissue surface . it should be understood that member 2166 and / or cavity 2164 can include stops or can be shaped differently so as to allow for more or less freedom of movement . further , recess 2162 and cavity 2164 can be positioned in upper bumper portion 2160 , for example , more proximally or distally than shown . extending through flexible member 2140 and through an aperture 2155 in member 2166 is a power lead 2150 . a distal end portion 2152 of power lead 2150 is electrically coupled to l - shaped electrode 2130 to deliver energy to electrically conductive surface 2135 . distal end portion 2152 has sufficient slack to avoid breaking or disconnecting from electrode 2130 while bumper 2122 pivots relative to flexible portion 2140 . a proximal end of power lead 2150 is coupled to an electrical energy source ( not shown ), as discussed above . it should be understood that power lead 2150 can be coupled to electrode 2130 without passing through flexible member 2140 . a number of embodiments have been described . nevertheless , it will be understood that various modifications can be made . for example , the bumper can be directly or indirectly pivotably coupled to the shaft . in addition , the bumpers can have any suitable number of sides arranged in any suitable shape , such as a parallelepiped , a triangular prism or a half dome with a planar tissue contacting surface . also , in bumper 1022 , projection 1064 can be deformed by a method other than heating , such as , for example , by mechanical deformation . moreover , upper bumper portion 1060 and lower bumper portion 1070 can be joined by another mechanism such as friction fit , press fit , or adhesive , or can be made as a single piece . flexible portions 26 , 940 , and 1040 can be a nitinol wire not in a superelastic state , or can be another elastic or superelastic component , such as a stainless steel or plastic spring . both the shaft and the nitinol wire can be resiliently flexible to provide additional flexibility . in addition , the flexing action of the flexible portion can be in a direction other than that shown . likewise , the bumper can pivot about an axis in a different direction than the direction shown . also , the proximal ends of flexible portions 26 , 940 , 1040 , and 1740 can be attached to the shaft by any suitable means , such as , for example , by crimping , welding , or press - fitting . the electrodes can be made of any biocompatible electrically conductive material , such as , for example , stainless steel , tungsten , gold , silver , or platinum . the electrically conductive surface of an embodiment can , for example , be flush from the tissue contacting surface , project from the tissue contacting surface , or be recessed in the tissue contacting surface . in addition , the electrically conductive surfaces can be , for example , planar or curved . moreover , the probe can include more than one electrically conductive surface and / or return electrode , such as , for example an array of electrically conductive surfaces on the bumper . the features described for the various embodiments are non - limiting . further these features can be combined or interchanged with one another , as well as deleted and supplemented . accordingly , these and other embodiments are within the scope of the following claims .

0Human Necessities

hereinafter , embodiments of the present invention will be described with reference to the accompanying drawings . a configuration of a test apparatus of a semiconductor device of the present embodiment is shown in fig1 . as shown in fig1 , the test apparatus is configured of a defect detection unit 1 , an arithmetic processing unit 2 , and an electrical characteristics test unit 3 . first , according to a general process of manufacturing a semiconductor device shown in fig2 , five defective detections are carried out by using the defect detection unit 1 . here , the defects are classified in accordance with the contents thereof , and the presence of defects and the number of defects are detected for each classified defect . those are , for example , the presence of defects and the total number of the defects , the presence of critical defects ( considerable defects in a shape and a size ) and the number of the defects , the presence of singular defects ( a defect in a predetermined appearance and size ) and the number of the defects , the presence of combined defects and the number of the defects , and the like , and those are automatically detected as the data ( information ) for each chip . the data of the respective defect detections for each chip of a semiconductor wafer are fed back to a manufacturing apparatus ( not shown ). also , the data of the defect detections are transmitted to the arithmetic processing unit 2 and arithmetically processed by the arithmetic processing unit 2 , and transmitted to the electrical characteristics test unit 3 . then , on the basis of the transmitted data of the chips , a first electrical characteristics test is carried out by the electrical characteristics test unit 3 . in this case , as shown in a flowchart of fig3 , with respect to the chips in which defects arose in any of the first to fifth defect detections , the electrical characteristics test is carried out with respect to all of the semiconductor devices in the chips as high - risk chips . on the other hand , with respect to the chips in which no defect has been recognized in any defect detection , the electrical characteristics test is carried out with respect to 95 % of the semiconductor devices . for example , examples of the first , second , third , fourth and fifth defect detections are shown in fig4 to fig8 . chip 5 of a wafer 4 has a defect , and a chip 6 has no defect , and the results of the defect and non - defect are processed by arithmetic processing unit 2 , which result is as shown in fig9 . on the basis of the result , the electrical characteristics tests are carried out to the chips under condition a ( normal test ) or condition b ( highly accurate test ), as shown in fig1 . further , a determination on a non - defective product or a defective product is carried out for each chip , circles are marked on the defective products in ink , the wafer is diced to separate the products , and only the non - defective products which have not been marked are packaged . the packaged semiconductor devices are managed by number ( no .) information . next , a second electrical characteristics test which is more than detailed than the first electrical characteristics test is carried out with respect to the packaged semiconductor devices , and thereafter , only the non - defective products are shipped . the number of the defect detections is not limited to five times , and is different in accordance with the manufacturing process , there are cases in which the number of defect detections may be less than five , or more than five defect detections may be required . like the first embodiment , the data of the five defect detections for each chip are fed back to a manufacturing apparatus . also , the data of the defect detections are transmitted to the arithmetic processing unit 2 and arithmetically processed by the arithmetic processing unit 2 , and transmitted to the electrical characteristics test unit 3 . then , on the basis of the transmitted data of the chips , the first electrical characteristics test is carried out by the electrical characteristics test unit 3 . in this case , as shown in a flowchart of fig1 , with respect to the chips in which critical defects arose in any of the first to fifth defect detections , the electrical characteristics test is carried out with respect to all of the semiconductor devices in the chips as high - risk chips . on the other hand , with respect to the chips in which no defect has been recognized in any defect detection , the electrical characteristics test is carried out with respect to 95 % of the semiconductor devices . after that , like the first embodiment , a determination on a non - defective product or a defective product is carried out for each chip , circles are marked on the defective products in ink , the semiconductor wafer is diced to separate the products , and only the non - defective products which have not been marked are packaged . then , the second electrical characteristics test is carried out with respect to the packaged semiconductor devices , and thereafter , only the non - defective products are shipped . as in the first embodiment , the number of the defect detections is not limited to five times , and is changed in accordance with the manufacturing process , there are cases in which the number of defect detections may be less than five , or more than five defect detections may be required . like the first and second embodiments , the data of the five defect detections for each chip are fed back to a manufacturing apparatus . also , the data of the defect detections are transmitted to the arithmetic processing unit 2 and arithmetically processed by the arithmetic processing unit 2 , and transmitted to the electrical characteristics test unit 3 . then , on the basis of the transmitted data of the chips , the first electrical characteristics test is carried out by the electrical characteristics test unit 3 . in this case , as shown in a flowchart of fig1 , with respect to the chips in which five or more defects or one or more critical defects arose in any of the first to fifth defect detections , a highly accurate electrical characteristics test is carried out as the high - risk chips , with the patterns in the test parameters ( input voltage , electric current , frequency , temperature , and the like ) being increased ( for example , in the case of a temperature , with two patterns of an ordinary temperature and a high temperature ). on the other hand , with respect to the other chips , the electrical characteristics test is carried out with the normal patterns ( for example , in a case of a temperature , only an ordinary temperature ). after that , like the first and second embodiments , a determination on a non - defective product or a defective product is carried out for each chip , circles are marked on the defective products in ink , the semiconductor wafer is diced to separate the products , and only the non - defective products which have not been marked are packaged . then , the second electrical characteristics test is carried out with respect to the packaged semiconductor devices , and thereafter , only the non - defective products are shipped . as in the first and second embodiments , the number of the defect detections is not limited to five times , and is changed in accordance with the manufacturing process , there are cases in which the number of defect detections may be less than five , or more than five defect detections may be required . a configuration of a test apparatus of a semiconductor device according to a fourth embodiment of the present embodiment is shown in fig1 . as shown in fig1 , the test apparatus is configured of the defect detection unit 1 , the arithmetic processing unit 2 , the electrical characteristics test unit 3 , and a reliability test unit 7 . in the same manner as in the first , second and third embodiments , five defect detections and two electrical characteristics tests are carried out . a reliability test is carried out with respect to the chips determined to be non - defective products in the two electrical characteristics tests . the information of the chips from the arithmetic processing unit 2 are transmitted to the reliability test unit 7 as well . on the basis of the information , as shown in fig1 showing the flow after the electrical characteristics test , the reliability test is carried out in a sampling manner with respect to the chips on which the normal test of the electrical characteristics test is carried out . on the other hand , also as shown in fig1 , the reliability test is carried out with respect to all of the high - risk chips on which a highly accurate test ( total test / all item test ) of the electrical characteristics test is carried out . in the present embodiment as well , the number of times of the defect detections is not limited to five , and is changed in accordance with the manufacturing process . there are cases in which the number of defect detections may be less than five , or more than five defect detections may be required . as described above , in the above - described respective embodiments , chips which are determined that there is the problem on the items , which are previously set , for the defect detection are sampled as high - risk chips , and the highly accurate electrical characteristics test and reliability test are carried out with respect to only the high - risk chips . in accordance therewith , highly accurate tests can be efficiently carried out with respect to a large number of chips , and it is possible to suppress an occurrence of a market defect accident after shipping the products . in this way , in accordance with the respective embodiments , an inspecting method and an test apparatus for a semiconductor device in which it is possible to more efficiently and even highly accurately suppress the outflow of defective products can be obtained . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general invention concept as defined by the appended claims and their equivalents .

6Physics

the invention will be described in detail with reference to the drawings . referring now to fig1 , feed air 1 is passed into higher pressure column 20 which is operating at a pressure generally within the range of from 60 to 220 pounds per square inch absolute ( psia ). in the embodiment of the invention illustrated in fig1 , feed air 1 is a gaseous stream , and liquid feed air in stream 11 is also provided into the system . stream 11 is divided into stream 12 which is passed through valve 13 and into higher pressure column 20 as stream 14 , and into stream 6 which is passed through valve 15 and into lower pressure column 21 as stream 16 . within higher pressure column 20 the feed air is separated by cryogenic rectification into oxygen - enriched liquid and nitrogen - enriched vapor . oxygen - enriched liquid is withdrawn from the lower portion of column 20 in stream 3 , cooled by passage through heat exchanger 17 to form stream 18 , and passed through valve 19 and into lower pressure column 21 as stream 22 . nitrogen - enriched vapor or shelf vapor , containing from 30 to 70 ppm neon , is withdrawn from the upper portion of higher pressure column 20 in stream 23 and passed into reboiler / condenser 24 wherein it is condensed by indirect heat exchange with lower pressure column bottom liquid . this neon - containing liquid is withdrawn from reboiler / condenser 24 in stream 25 . a portion 26 of stream 25 is passed back into the upper portion of higher pressure column 20 as reflux . another portion of the neon - containing fluid from reboiler / condenser 24 is passed in stream 27 to subcooler 28 . within subcooler 28 the neon - containing liquid is subcooled by indirect heat exchange with nitrogen streams from the lower pressure column , and the resulting fluid is withdrawn from subcooler 28 as subcooled neon - containing liquid in stream 2 . stream 2 is passed through valve 29 and then into separator 30 in stream 31 . in the embodiment of the invention illustrated in fig1 , separator 30 contains at least one tray 32 . that is , in the embodiment of the invention illustrated in fig1 separator 30 is a small rectification column . separator 30 also contains reboiler 33 which is driven by a portion of the shelf vapor passed to reboiler 33 in stream 4 . within separator 30 the neon - containing liquid is separated into neon - containing vapor and remaining liquid . the remaining liquid is passed from separator 30 in stream 34 into the upper portion of lower pressure column 21 . this liquid yields high purity nitrogen product containing very low concentrations of light components owing to the removal of much of the light components with the crude neon . the neon - containing vapor is recovered from separator 30 in stream 5 as product crude neon . typically the crude neon is provided to a neon refinery for the production of high purity or refined neon . the neon - containing shelf vapor in stream 4 , which is condensed in reboiler 33 , is passed out of reboiler 33 in stream 35 . preferably , as illustrated in fig1 , stream 35 is passed into stream 27 and then passed to subcooler 28 and ultimately into separator 30 for subsequent recovery of the neon in this fluid as part of the crude neon in stream 5 . lower pressure column 21 is operating at a pressure less than that of higher pressure column 20 and generally within the range of from 16 to 75 psia . within lower pressure column 21 the various fluids passed into that column are separated by cryogenic rectification into oxygen - rich liquid and nitrogen - rich vapor . oxygen - rich liquid is withdrawn from the lower portion of column 21 in stream 36 for recovery as product oxygen having an oxygen concentration of at least 90 mole percent . if desired , as shown in fig1 , the oxygen - rich liquid may be increased in pressure by pump 37 prior to recovery as high pressure liquid and / or gaseous oxygen . nitrogen - rich vapor is withdrawn from the upper portion of column 21 in stream 9 , warmed by passage through subcooler 28 and heat exchanger 17 , and recovered as product nitrogen 38 having a nitrogen concentration of at least 99 . 9 mole percent . for product purity control purposes a nitrogen - containing waste stream 39 is withdrawn from column 21 below the withdrawal level of stream 9 , warmed by passage through subcooler 28 and heat exchanger 17 , and removed from the system in stream 40 . fig2 illustrates another embodiment of the invention wherein the separator is a phase separator . the numerals in fig2 are the same as the numerals in fig1 for the common elements and these common elements will not be described again in detail . in the embodiment of the invention illustrated in fig2 , the phase separator 50 does not contain a reboiler so that the phase separation is essentially totally as a result of flashing through valve 29 and gravitational separation within the phase separator . however , phase separator 50 could contain a reboiler in which case the fluid flow employing streams 4 and 35 illustrated in fig1 would also be employed with the embodiment of the invention illustrated in fig2 . the numerals in the embodiment of the invention illustrated in fig3 are the same as those of fig2 for the common elements , and these common elements will not be described again in detail . referring now to fig3 , a portion 60 of stream 27 is not subcooled but rather is passed through valve 61 and as stream 62 is combined with flashed stream 31 . this increases the amount of vapor produced in phase separator 50 thus increasing the recovery of the more volatile neon which preferentially concentrates in the vapor rather than in the remaining liquid which is passed from the separator into the lower pressure column . the numerals in the embodiment of the invention illustrated in fig4 are the same as those of fig2 for the common elements , and these common elements will not be described again in detail . referring now to fig4 , liquid air stream 6 which is flashed through valve 15 is passed in stream 16 to feed air phase separator 45 . vapor from feed air phase separator 45 is passed in stream 46 to crude neon stream 5 to form part of the crude neon product . liquid from feed air phase separator 45 is passed in stream 47 into lower pressure volume 21 . this embodiment of the invention serves not only to increase the recovery of neon but also enhances the purity of the nitrogen product because light impurities , which would otherwise be in the nitrogen product , are removed from the system in stream 46 . a computer simulation of the embodiment of the invention illustrated in fig1 was carried out and the results are presented in table 1 . these results are presented for illustrative purposes and are not intended to be limiting . the stream numbers correspond to those of fig1 . although the invention has been described in detail with reference to certain preferred embodiments , those skilled in the art will recognize that there are other embodiments of the invention within the spirit and the scope of the claims .

8General tagging of new or cross-sectional technology

fig1 shows a compound chemically sensitive element according to an embodiment of the invention . specifically , a compound chemically sensitive element 51 comprises an outer highly insulating sleeve 52 , an ion sensitive film 53 applied to the lower end face of the sleeve 52 with an insulating resin 57 so as to close the bottom opening , a ph sensor 5 fixedly connected to the inside of the sleeve 52 with an insulating resin 54 so that its insulated gate 5a is located downside , a conductive resin 56 which fills the space within the sleeve 52 between the ion sensitive film 53 and the resin 54 so as to contact the insulated gate 5a , and a pair of lead wires 8a , 8b connected to the ph sensor 5 . the ion sensitive film 53 is not directly mounted on the insulated gate 5a of the ph sensor 5 , and is hence subject to no restriction during its manufacture . consequently , any known ion sensitive film may be directly used as the film 53 . by way of example , the soda aluminosilicate glass having the composition mentioned previously may be used as na + sensitive film , and the soda aluminosilicate glass having the described composition may be used as k + sensitive film . a solid film comprising a mixture of silver chloride ( agcl ) and silver sulfide ( ag 2 s ) may be used as cl - sensitive film . alternatively , a solid film comprising lanthanum fluoride laf 3 may be used as f - sensitive film . it is also to be understood that a fine powder of the materials described above may be dispersed in a carrier which may comprise silicone rubber , polyvinyl chloride ( pvc ) or the like to form the ion sensitive film 53 . in addition to the ion sensitive films referred to above , a porous film of synthetic fibre may be used as a carrier , which may be impregnated with the solution of a variety of ion exchange materials in a suitable solvent , with pvc mixed , and subsequently desicated to form an ion sensitive film which may also be effectively used in the present invention . by way of example , a solution of tetrahydrofuran ( thf ) and a small quantity of dioctyl adipate ( doa ) as a plasticizer may be combined with a powder of pvc to provide a liquid material in which valinomycin as k + exchange material may be dissolved . the resulting solution may be used to impregnate a porous film of synthetic fibre having a pore size of 0 . 1 to 3 . 0 μm and having its one surface coated with a conductive resin . upon drying , a k + sensitive film may be obtained . referring to fig2 the ph sensor 5 is shown in cross section . it comprises a silicon substrate 11 of p - type in which source and drain diffusion regions 13 , 14 of n - type are formed with a gate 12 defined therebetween , thus providing an mos transistor . an insulating layer 15 comprising silicon dioxide ( sio 2 ) is formed on at least the gate 12 of the transistor , and a h + sensitive layer 16 which comprises sin or al 2 o 3 is applied on top of the insulating layer 15 as by cvd process . when forming the insulating layer 15 and the h + sensitive layer 16 on the gate 12 , protective layers 17 , 18 of the same material as these layers 15 , 16 are simultaneously formed so as to cover the entire substrate 11 . the well known vacuum evaporation and photoetching process may be used to provide electrode layers 19 , 20 for contact with the source and the drain diffusion region 13 , 14 . the purpose of the conductive resin 56 is to provide an electrochemical and physical connection between the ion sensitive film 53 and the insulated gate 5a of the ph sensor 5 , and preferably comprises a material containing very fine silver particles . the insulating resin 57 used should be one which effectively maintains a high insulation when immersed in a solution to be examined over an increased length of time . for example , silicone rtv rubber available from shinetsu chemical co ., or picene ( c 22 h 14 ) may be used . in operation , when the ion sensitive film 53 is brought into contact with a solution to be examined , a potential difference is developed across the solution and the ion sensitive film 53 in accordance with the concentration of a specific ion contained in the solution . a contact potential is also developed across the film 53 and the conductive resin 56 as well as across the conductive resin 56 and the insulated gate 5a of the ph sensor 5 , but remains constant . hence , the potential difference which is developed across the interface between the solution to be examined and the ion sensitive film 53 according to the ion concentration is applied to the insulated gate 5a of ph sensor 5 through the conductive resin 56 . by immersing a reference electrode in the solution to be examined and applying a suitable bias voltage thereto , a measurement of the source - drain current of the ph sensor 5 provides an indication of the concentration of the specific ion in the solution to be examined . in the compound element 51 , the material which provides an electrochemical connection between the ion sensitive film 53 and the insulated gate 5a of the ph sensor 5 comprises non - volatile and non - fluid conductive resin 56 , which facilitates maintenance and control , and also allows a free choice of the orientation in which the element 51 is disposed , affording a great advantage that it can be easily handled . fig3 shows another embodiment for a compound chemically sensitive element 61 which is constructed so that a solution to be examined flows through the element in order to determine the concentration of a specific ion therein . the compound element 61 shown comprises a highly insulating casing 62 , a tubular ion sensitive film 63 disposed within the casing 62 , a ph sensor 5 fixedly connected to the casing 62 with its insulated gate 5a located in opposing relationship with the outer periphery of the ion sensitive film 63 , a conductive resin 56 disposed between the casing 62 and the ion sensitive film 63 so as to contact the insulated gate 5a , and a pair of lead wires 8a , 8b connected to the ph sensor 5 . the operation of the element 61 takes place in a manner such that a solution to be examined is introduced through an inlet 63a defined by one end of the ion sensitive film 63 and discharged through an outlet 63b defined by the other end thereof , thus allowing a determination of the concentration of a specific ion in the solution while the solution flows through the element . in the embodiments described in connection with fig1 and 3 , the compound chemically sensitive element is designed as an ion sensor which determines the concentration of a specific ion in a solution to be examined . however , it is to be understood that the compound element of the invention is not limited to an ion sensor , but is equally applicable to a chemical detecting element which detects a particular substance contained in a material to be examined . fig4 shows a compound chemically sensitive element according to a further embodiment of the invention which is adapted to determine the concentration of glucose contained in a solution to be examined . the element 71 shown comprises a highly insulating outer sleeve 72 , a chemically sensitive film 73 applied to the lower end of the sleeve 72 so as to close the bottom opening thereof , a ph sensor 5 secured to the inside of the sleeve 72 with an insulating resin 74 , with its insulated gate 5a located downside , an annular silver electrode 77 disposed in contact with the surface of the chemically sensitive film 73 which is located inside the sleeve 72 , a plate - shaped platinum electrode 78 fixedly mounted within the sleeve 72 in spaced and opposed relationship with the silver electrode 77 to divide the interior of the sleeve 72 into a pair of upper and lower compartments , a conductive solid or gel - like electrolyte 79 such as lanthanum fluoride which fills the space between the platinum electrode 78 and the chemically sensitive film 73 and disposed in contact with the silver electrode 77 , conductive resin 56 which fills the space between the platinum electrode 78 and the insulating resin 74 and disposed in contact with the insulated gate 5a of the ph sensor 5 , and a pair of lead wires 8a , 8b connected to the ph sensor 5 . the chemically sensitive film 73 is formed by a gelled film comprising a porous support which is impregnated with polyacryl amide and glucose oxydase which is a glucose oxidizing enzyme . in the compound element 71 , the chemically sensitive film 73 , the silver electrode 77 , the platinum electrode 78 and the conductive solid or gel - like electrolyte 79 form together a chemically sensitive assembly 80 , which has its platinum electrode 78 physically and electrochemically connected to the insulated gate 5a of the ph sensor 5 through the conductive resin 56 . in operation , when the chemically sensitive film 73 is brought into contact with a solution to be examined which contains glucose , the glucose oxydase contained in the film 73 acts to decompose the glucose into gluconic acid ( c 6 h 10 o 7 ) and hydrogen peroxide ( h 2 o 2 ), and the amount of oxygen consumed depends on the concentration of the glucose . consequently , by connecting the positive terminal of a constant current source 81 to the silver electrode 77 and the negative terminal to the platinum electrode 78 to form an oxygen electrode which is known in itself , the potential at the platinum electrode 78 varies in accordance with the change in the oxygen concentration of the chemically sensitive film 73 . the change in the potential is applied to be the insulated gate 5a of the ph sensor 5 through the conductive resin 56 , causing a change in the source - drain current thereof . consequently , the resulting change in the current may be detected to determine the concentration of the glucose contained in a solution to be examined . fig5 shows an additional embodiment of the invention in which the compound chemically sensitive element 71 of fig4 is modified into a flow - through type . specifically , the element 91 shown comprises a highly insulating casing 92 , a tubular chemically sensitive film 93 disposed within the casing 92 , a coil - shaped silver electrode 97 so as to be disposed around the film 93 , a platinum electrode 98 disposed in spaced and surrounding relationship with the silver electrode 97 and having its opposite end openings secured to the sidewalls of the casing 92 so as to divide the interior thereof into a pair of compartments , a ph sensor 5 secured to the casing 92 with its insulated gate 5a disposed in opposing relationship with the outer peripheral surface of the platinum electrode 98 , a conductive solid or gel - like electrolyte 79 disposed in contact with the silver electrode 97 between the chemically sensitive film 93 and the platinum electrode 98 , conductive resin 56 which fills the space between the platinum electrode 98 and the casing 92 and disposed in contact with the insulated gate 5a , and a pair of lead wires 8a , 8b connected to the ph sensor 5 . it should be understood that the chemically sensitive film 93 is constructed in an identical manner as the chemically sensitive film 73 shown in fig4 . in the present embodiment , the chemically sensitive film 93 , the silver electrode 97 , the platinum electrode 98 and the conductive solid or gel - like electrolyte 79 form together a chemically sensitive assembly , generally in the same manner as in fig4 . in operation , the positive terminal of a constant current source 81 is connected to the silver electrode 97 and the negative terminal to the platinum electrode 98 to form an oxygen electrode . a solution to be examined is introduced at an inlet 93a formed by one end of the chemically sensitive film 93 and discharged through an outlet 93b formed by the other end thereof , thereby permitting a determination of the concentration of glucose in the solution . it should be understood that the invention is not limited to the specific embodiments described above , but that a number of changes , modifications and variations are possible therein . by way of example , in addition to constructing the compound element of the invention as an ion sensor or glucose sensor , it may be constructed as a gas sensor or a detecting element which determines the concentration of antigen or antibody .

6Physics

in fig1 a sheet of thin thermoplastic material passes between two heating devices 2 and 3 of the type normally used for thermoforming thermoplastic material . the heating may be performed , for instance , by means of infrared heating . downstream of the heating devices 2 , 3 in the direction of movement a of the sheet 1 , there is located a work station comprising a vacuum - forming tool 5 with negative forms 6 for producing cup - shaped articles . the tool 5 is provided in conventional manner with vacuum channels 7 connected to a vacuum source ( not shown ). the tool 5 is movable horizontally and vertically by means of suitable mechanisms ( not shown ). above the forming tool 5 and on the other side of the sheet of material 1 is a stamping tool 4 consisting of a plate 8 with stamping strips 9 attached thereto and directed towards the sheet material . the strips 9 are kept hot with the help of heating elements in the plate 8 . the stamping tool 4 is movable vertically by means of suitable mechanisms ( not shown ). after leaving the work station the sheet of material 1 is wound onto a reel 10 . fig2 shows the apparatus of fig1 as seen from above . for the sake of clarity the stamping tool 4 has been omitted . as can be seen from fig2 the forming tool 5 comprises two identical vacuum - forming dies 5a and 5b which are attached to each other . in the position shown in fig2 the sheet material 1 is in position over the die 5a . the two interconnected dies 5a and 5b are movable by means of a suitable mechanism in a horizontal direction perpendicular to the direction a of movement of the sheet material 1 . the manufacture of cup - shaped , thin - walled articles takes place in the apparatus shown in fig1 and 2 in the following manner , starting from the position of fig2 where the die 5a is in an operative position beneath the sheet 1 . the pre - heated sheet 1 is fed intermittently by feeding means ( not shown ), for instance in the form of feeding chains which preferably cooperate with means arranged along the edge of the sheet material , so as to present preheated sheet portions in the work station . when a predetermined length of pre - heated material has been fed forward into position between the forming tool 5 and the stamping tool 4 , there is a brief pause in the feeding . at this moment the die 5a is moved vertically upwards towards the sheet 1 . when an upper position of the die 5a has been reached , a vacuum is applied and forming of the sheet 1 in the forms 6 takes place . next , the stamping tool 4 is lowered at a suitable moment towards the die 5a which is provided with a resilient counter surface for engagement by the strips 9 of the tool 4 . the actual stamping process effected between the strips and the counter - surfaces will be described in detail hereinafter . as will be shown later , the stamping can be performed with very low stamping force and , furthermore , occurs instantaneously . immediately after the stamping operation the stamping tool is returned to its original position by an upward vertical movement . the stamping strips 9 sever the formed articles completely from the sheet 1 so that the freed articles are retained in the die 5a due to the vacuum . the articles therefore accompany the die 5a on a subsequent downward movement and in a following horizontal movement of the die 5a which carries the die 5a to one side of the sheet material 1 . on completion of the horizontal movement of die 5a the die 5b has at the same time assumed the operating position beneath the sheet in place of the die 5a . the separated articles in the die 5a are now easily accessible and can be simply removed from the die 5a by suitable lifting means provided at the one side of the sheet 1 . such a lifting means may be designed in many ways . for instance , the articles may be removed from the die 5a by means of vacuum and placed on a suitable stacking means . in order to facilitate removal compressed air may be forced between the forming die and the articles therein . this can easily be effected by introducing the compressed air via the vacuum channels of the die . when the die 5b has reached the operating position under the sheet 1 it is moved towards the sheet , whereupon a new cycle of operation is started for the die 5b and the stamping steel 4 in exactly the same manner as described earlier in connection with the die 5a . the only difference is of course that after forming and stamping of the articles the die 5b is moved to the other side of the sheet of material from that to which the die 5a is moved after its forming and stamping operation . the forming dies 5a and 5b may be so mechanically connected that all vertical and horizontal movements are performed by both simultaneously . it is however , possible for the dies 5a and 5b to perform their vertical movements separately . optimal use of the production capacity of the arrangement can be obtained by suitable timing of the heating , forming , stamping , cooling and transportation operations with respect to each other . thus the stamping operation can be fitted into the operating cycle at the most appropriate moment since this is performed during or after the forming . if stamping is performed while the forming die is still under vacuum , the articles are firmly held in position which contributes to extremely high precision in the stamping process . in the same way cooling may be effected not only during the forming process with the forming die in its uppermost position , but may also occur after stamping and even while the die is being moved sideways since in the apparatus embodying the invention the formed objects may remain in their die during the subsequent operations of feeding forward more material and forming in the other die . fig3 shows a detail of the apparatus embodying the invention . here a part of a forming die 5a , 5b is designated 11 and a part of the sheet of material to be stamped is designated 12 . a stamping strip of the stamping tool is designated 13 . the strip 13 is embedded in the heated bottom plate , only shown in part at 14 . a groove 15 in the upper surface of the forming die 11 is filled with resilient material such as silicon rubber , so that , when the strip 13 is lowered towards the sheet of material 12 , the heated strip will cut through the material . it has been found that with such a resilient counter - surface for the stamping strip this will cut through the material without requring any substantially stamping force . moreover , it has been found that the required accuracy in the flatness of the stamping strip is very low if the counter - surface is yielding . the stamping strip can therefore be easily and quickly fitted without having to be carefully aligned . it has been found that extremely clean cuts can be obtained with the arrangement shown in fig3 while at the same time the stamping force , as mentioned above , is very slight . it has been found that the apparatus for manufacturing vacuum - formed products from a thin thermoplastic film in accordance with the invention enables manufacture with extremely high production capacity . by way of example it may be mentioned that when manufacturing deep , bowl - shaped , disposable inserts for cooking vessels in accordance with u . s . pat . no . 4 , 164 , 174 it is possible to achieve an extremely high production rate which is unmatched by any known method . for example , it may be mentioned that such bowl - shaped inserts with a diameter of about 200 mm and a depth of about 90 mm can be formed from an hd hm polythene film with a thickness of 0 . 1 m and using a forming tool having 9 forms in each die , the forms being arranged in each tool in 3 rows each of 3 forms . such inserts have a wall - thickness at the top edge of about 0 . 10 mm , which is desirable in this case in order to give the edges a certain rigidity . at the thinnest parts near the bottom a thickness of about 0 . 02 mm has been measured . this is also desirable since the walls and bottom of the inserts should be as thin as possible so that they can easily be screwed up after use and also so that the inserts have a high thermal conductivity . in the example mentioned optimal use of the capacity of the apparatus can be achieved by a suitable choice of the various cycles . a double - operating forming tool results in substantially doubled production capacity . if with a forming tool consisting of a single die it is possible to achieve a total of 20 forming and stamping cycles a minute , it has been found that with the double - operating forming tool it is possible to achieve 40 cycles a minute . this is because part of the operating cycle of the die occurs at the side of the sheet of material at the same time as the forming and stamping operations of the other die are being performed . fig4 illustrates a possible operating cycle for apparatus embodying the invention . at the bottom of fig4 there is illustrated the sequence of operations for hot - forming in accordance with a known method in which the individual distances indicated substantially correspond to the times required for transport , heating , forming and cooling . at the top of fig4 there is illustrated the sequence of corresponding operations in a method embodying the invention , referred to hereinafter as the shuttle method and employing two forming dies a and b . it is clear from the operating diagram of the shuttle method that , for instance , the cooling of die a takes place partly during the sideways movement of dies a and b . at the same time the plastic sheeting is fed along . while the sheeting is being heated , finished products are being removed from die a and vacuum - forming is simultaneously being performed in die b . during the latter part of this stage , die b is stamped while at the same time cooling is initiated . during the next feed stage of the plastic film the dies a and b move sideways . during the susbsequent heating stage of the plastic film the finished products are removed from die b at the same time as forming , stamping and cooling take place in die a . it is thus clear from the skeleton diagram in fig4 that practically double production can be achieved by this shuttle method embodying the invention . fig5 illustrates schematically another embodiment of the invention in which two interconnected forming dies are arranged to pivot about a central point 17 . the dies designated 5a and 5b in fig2 are designated 16a and 16b in fig5 . in the position shown in fig5 the material 1 is over the die 16a for forming and stamping . when this operation has been completed the die swings about its pivot 17 so that the die 16b comes into position below the material 1 . both dies are arranged to be moved vertically during the forming process , in the same manner as the dies 5a and 5b in fig2 . the embodiment according to fig5 has the advantage that the finished articles need only be removed from the dies 16a and 16b on one side of the sheet of material . of course , there are other conceivable of embodiments of the invention operating on the same principle as that illustrated in fig5 the dies being arranged like a carousel . for instance , it is possible to imagine three or more interconnected dies pivotably arranged . a capacity of about 20 , 000 bowl - shaped disposable inserts per hour has been achieved using the embodiment of the method just described . it has also been possible to stack the articles directly in a simple stacking means placed at the side of the machine . as mentioned previously , the present invention enables vacuum - forming and stamping to be performed using very little force . this is a great advantage since the whole forming machine can then be very simple , having relatively slight dimensions in comparison with the extremely clumsily dimensioned arrangements required for traditional vacuum - forming . this also results in low tool costs , which further justifies the use of double tools -- a prerequisite for performance of the invention . as an example it may be mentioned that when manufacturing disposable articles of the type described in die tools with 9 articles by means of traditional vacuum forming with a combination of compression and vacuum , the calculated force is approximately 6 tons on the form at an over - pressure of 2 atmospheres and 8 . 5 tons at an over - pressure of 3 atm . with the use of vacuum alone , there is no pressure at all on the tool . the apparatus thus requires extremely little stamping force . stamping in traditional manner with steel strips against a non - yielding counter - surface requires about 15 kgf per centimeter of length of the stamping strip in the example above . this would give a total stamping force of about 9000 kgf . with the use of heated stamping strips with yielding counter - surfaces in the form of rubber , for instance , in accordance with the invention , it has been found in said example that the corresponding stamping force required is about 300 kgf , i . e . 0 . 5 kgf / cm along the length of the stamping strip . the stamping force is required has in this case been reduced to about 1 / 30 . it was also found that stamping was performed right through the material even though the stamping strips had not been aligned with any great precision on the bottom plate . in apparatus embodying the invention a stamping force of not more than 2 . 0 kgf / cm length of the stamping strip is preferably used . the stamping strips are heated to a temperature suitable for the thermoplastic material concerned , preferably 150 °- 275 ° c . it has been found advisable to use resilient material having an elasticity of not less than 30 p & amp ; j and preferably more than 100 p & amp ; j , particularly when using stamping strips which are not very accurately aligned . if silicon rubber is used , for instance , with a sheet of thin polyethylene and a stamping tool temperature of about 200 ° c ., a silicon rubber with a hardness of about 160 p & amp ; j has been used with extremely satisfactory results . thus an extremely high capacity can be achieved by means embodying the present invention , partly due to the fact that each die can be made quite large at relatively low cost and may contain forms for a large number of articles while using extremely little force for the forming and stamping operations , and partly due to optimal use being made of the work cycle by the use of several forming dies . it may be mentioned that , when using traditional equipment for the production of bowl - shaped products in accordance with the example described above , it is hardly possible to produce more than four bowls power stroke which , with 20 strokes a minute , corresponds to a production rate of 4800 units an hour . in this example , therefore , apparatus embodying the invention gives four times the production rate in spite of the fact that the required apparatus is compact in design , requires little space and is relatively cheap to manufacture . vacuum - forming technique has been used in the embodiments shown and described above but the invention is of course not limited to this but can be used for all types of thermoforming .

1Performing Operations; Transporting

for the purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiment illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications in the illustrated device , and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates . referring to fig1 there is illustrated an enema tip retention apparatus 20 including clamp member 21 , adjustable belt arrangement 22 , enema tube 23 and enema tip 24 . clamp member 21 includes a mounting plate portion 27 adjustable , releasable clamp 28 and collar buttons 29 and 30 which provide retaining means for securing clamp member 21 to adjustable belt arrangement 22 . belt arrangement 22 includes a first strap portion 31 which is variable in circumferential encompassing size by means of belt buckle 32 and adjustment holes 33 . looped around first strap portion 31 are retaining straps 36 and 37 whose length extension from first strap portions 31 in a downwardly direction is controlled by adjustment means 38 and 39 . adjustment means 38 and 39 ( see fig7 ) include a collar stickpin - type arrangement wherein the outermost enlarged end portions of pin 40 are inserted through strap holes and thereby disposed on opposite outwardly facing surfaces of their corresponding retaining straps . this arrangement securely forms an enclosing loop for each strap which surrounds first strap portion 31 . the free ends of retaining straps 36 and 37 each include a keyhole - shaped slot 41 and 42 , respectively , which are suitably sized and arranged for engagement with and receipt of collar buttons 29 and 30 . collar buttons 29 and 30 ( see fig1 a and 2 ) each include a base portion 45 , an enlarged head portion 46 and a reduced diameter portion 47 therebetween . the size and shape of collar buttons 29 and 30 is such that enlarged head portion 46 is able to pass through larger opening 48 of keyhole - shaped slots 41 and 42 but not the smaller oblong opening portion 49 . thus , the means of attachment of clamp member 21 to adjustable belt arrangement 22 is to insert collar buttons 29 and 30 into keyhole - shaped slots 41 and 42 and then pull outwardly on retaining straps 36 and 37 such that reduced diameter portions 47 are snugly anchored within smaller oblong openings 49 , and retained there due to the larger sizes of head portion 46 and base portion 45 . referring to fig2 clamp member 21 is illustrated in greater detail and includes a deformable tab portion 52 , a cooperating locking portion 53 , which has a series of ratchet teeth 54 , and a clearance aperture 55 located adjacent the common end of portions 52 and 53 . clearance aperture 55 extends through clamp member 21 , including mounting plate portion 27 . enema tube 23 is partially shown in both fig1 a and fig2 illustrations and is disposed within clearance aperture 55 . as deformable tab portion 52 and cooperating locking portion 53 are drawn together , by squeezing , the dimensional size of clearance aperture 55 is reduced , and a clamping action occurs around enema tube 23 thereby holding this tube in position . inasmuch as the longitudinal axis of clearance aperture 55 is substantially perpendicular to mounting plate portion 27 , it should be apparent that when clamp member 21 is oriented near the rectal opening of a patient and first strap portion is secured around the patient &# 39 ; s waist , that retaining straps 36 and 37 may be adjusted in length until clamp member 21 is drawn snugly up against the patient &# 39 ; s rectal opening so that the enema tube 23 and its joined enema tip 24 are retained in position within the patient . by securing the enema tube and tip in such a manner , the enema tip is unable to slip out of the patient as the patient turns from one side to the other and orients his body in various positions which the radiologist or physician may request as part of the fluoroscopy x - ray examination procedure . referring to fig3 and 5 , alternative arrangements of clamp member 21 are illustrated . while it should be understood that the preferred arrangement of clamp member 21 with respect to the remainder of apparatus 20 is to have the smooth surface of mounting plate portion 27 closest to the patient , it is possible to use an orientation wherein the collar button side of mounting plate portion 27 is closest to the patient . it is also possible to arrange adjustable , releasable clamp 28 such that the longitudinal axis of its clearance aperture is parallel with the surface of mounting plate portion 27 rather than being perpendicular to it . fig3 illustrates such an arrangement where clamp 28 is disposed on mounting plate portion 27 so that the longitudinal axis of clearance aperture 55 is substantially parallel with the surface of mounting plate portion 27 . also included is a tube 56 which is shown in section only and secured by clamp 28 . this tube may be a drainage tube or similar device and thus , the arrangement of fig3 is suitable for retaining such tubes in a fixed position so that drainage of the patient cavities can be achieved , such as the sinuses . while this particular arrangement may not be best suited for enema administering , the clamping concept is virtually the same as clamp member 21 and collar buttons 29 and 30 are provided for retention of this alternative clamp member when such drainage of cavities is desired to be achieved . referring to fig4 there is illustrated a clamp , enema tube and enema tip combination 59 which is a one - piece , integral , molded assembly . combination 59 includes an enema tube 60 , an enema tip 61 , a mounting plate 62 , a clearance hole grommet 63 , collar button 64 and collar button 65 . although fabricated as a molded , one - piece combination , it is possible that these various component parts could be individually molded and then fitted together in a press - fit manner such that grommet 63 would be anchored within mounting plate 62 and would provide a snug fit around the outside diameter of enema tube 60 such that the tube and tip 61 would be held securely in position within the patient . in this manner , collar buttons 64 and 65 would be utilized as has been previously explained for collar buttons 29 and 30 of fig1 . referring to fig5 the alternative clamp member of fig3 is illustrated and includes a tubular insert 69 which has a lateral cross section of a &# 34 ; c &# 34 ; shape . this insert is generally concentric with clearance aperture 55 and is suitable to adapt the inside diameter size of clearance aperture 55 to the outside diameter of tube 70 such that various - sized tubes can be held by the clamp member . all that is required for adaptation is to select the appropriately sized c - shaped insert with the desired thickness . the use of such inserts is also envisioned with clamp member 21 inasmuch as the orientation of the clamp 28 with respect to the mounting plate portion 27 , whether parallel or perpendicular , is equally well suited for the addition of such inserts . referring to fig6 an alternative arrangement of the fig1 apparatus is illustrated and although belt arrangement 71 is similar to belt arrangement 22 , the noted difference involves the design of retaining straps 72 and 73 which are joined together at the general location of the enema tube 74 and enema tip 75 by means of retaining portion 76 . retaining portion 76 serves virtually the same purpose as did the free ends of retaining straps 36 and 37 which were provided with keyhole - shaped slots 41 and 42 , respectively . in the fig6 illustration , keyhole - shaped slots 77 and 78 ( see fig8 ) are provided and the only difference between the retaining portion arrangement of fig1 and that of fig6 is that the two retaining straps 72 and 73 are joined together wherein their y - shaped configuration and union at two locations creates a clearance opening 79 . enema tube 74 and enema tip 75 are joined together and extend through a retaining flange 82 which includes two oppositely disposed collar buttons 83 and 84 which are suitably positioned and sized to fit within keyhole - shaped slots 77 and 78 . in order to insert retaining flange 82 into retaining portion 76 , the outer ends of flange 82 must be drawn together by bending flange 82 and then insert collar buttons 83 and 84 into the enlarged opening portions of slots 77 and 78 . by fabricating retaining flange 82 out of a resilient , flexible material , release from this bent position will cause the collar buttons to flip outwardly thereby locking them in position in the smaller oblong opening portions of slots 77 and 78 . this locking engagement securely retains the enema tube and enema tip as part of belt arrangement 71 . the free end of enema tube 74 is provided with a series of angularly arranged layers or serrations 85 and these provide a snug fit arrangement with flexible tube 86 which may be forced over the free end of enema tube 74 . tube 86 may then be connected to a source of barium for introduction into the patient . referring to fig9 an alternative arrangement to the retaining portion designs of fig1 and 6 is illustrated . retaining flange 89 is a separate component and includes keyhole - shaped slots 90 and 91 and a clearance opening 92 . retaining straps 93 and 94 are provided with collar buttons 95 and 96 , respectively , disposed at their free ends . as has been previously described , collar buttons 95 and 96 are arranged to be received by slots 90 and 91 for fixed retention of retaining flange 89 . the clearance opening 92 of retaining flange 89 is suitably sized to receive in a snugly - fit arrangement an enema tip and tube combination or similar tubular member . referring to fig1 and 11 , still further alternative arrangements are illustrated . in fig1 , mounting plate 99 is provided with a serrated tubular member 100 secured therethrough as well as collar buttons 101 and 102 . serrated tubular member 100 extends beyond each surface of mounting plate 99 a distance sufficient for the connection of enema tip 103 and enema tube 104 . by fabricating the enema tip and enema tube members out of a flexible resilient material , they may be easily axially forced over the extending portions of serrated tubular member 100 and firmly lock onto the serrated surfaces , thereby providing a fixed and integrally appearing arrangement . in fig1 , the enema tip 107 is secured to mounting plate 108 and has a free end 109 of a serrated tube design . in this arrangement , enema tube 110 will fit over the extending serrations of free end 109 and although the enema tip and mounting plate are an integral design , various enema tubes may be used in this particular combination . although a conventional enema tip and enema tube combination have been illustrated throughout this specification , it is to be understood that the retaining and clamping arrangements disclosed herein are equally suitable for use with various types and styles of enema tips and tubes , including , but not limited to , those disclosed in my copending patent application , ser . no . 39 , 502 , filed on may 16 , 1979 now abandoned . thus the arrangements disclosed herein are suitable for double - contrast studies in which air is introduced after the barium is evacuated . in fact , the arrangements disclosed in the specification are particularly well suited to such double - contrast studies in that the enema tube and tip can be retained within the patient throughout the study in a well - secured and comfortable manner and is not subject to slipping out or otherwise separating from its inserted position within the patient . thus , in combination with any of one the various barium and air combination tubes of my copending patent application , barium is first introduced and then evacuated and then air is subsequently introduced into the patient and all of these operations may be performed without the necessity to remove the enema tip from the patient . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected .

0Human Necessities

now , preferred embodiments of this invention will be described below with reference to the accompanying drawings . in the diagram of fig1 numeral 1 stands for a vehicular body of an excavator possessing a track type undercarriage 2 and rotatably mounted on the undercarriage . the apparatus for operating a bucket 3 as the working element comprises a boom 4 attached to the vehicular body 1 in a manner enabling the boom 4 to generate a vertical rotary movement and an arm 5 attached swingably at one end thereof to the aforementioned boom 4 and attached at the other end thereof to the bucket 3 in such a manner that the bucket 3 will be allowed to rotate in the vertical direction about the point of attachment . with reference to fig2 the boom 4 has a main body consisting of a linear rear boom member 6 , a linear front boom member 7 , and an elbow - shaped intermediate boom member 8 interconnecting the first two boom members fast to each other in such a manner that the three boom members will jointly assume the shape of diverged legs of the letter l . the front , rear , and intermediate boom members 7 , 6 , and 8 are each fabricated in the shape of a hollow tube of a circular or elliptic cross section . the rear boom member 6 is attached fast at the rear end thereof to a connecting member 9 possessing a two - prong forked bracket 11 . the forked bracket 11 is so shaped that the lower end thereof will protrude outwardly from the rear boom member 6 roughly in the shape of diverged legs of the letter l . to the leading end of the front boom member 7 is attached fast a connecting member 10 possessing a similar two - prong forked bracket 12 . the forked bracket 12 is so shaped that the upper end thereof will protrude inwardly from the aforementioned front boom member 7 roughly in the shape of diverged legs of the letter l . the aforementioned connecting members 9 and 10 may be formed by casting or fabricated with sheet metal pieces . they avoid blocking the rear end of the rear boom member 6 and the leading end of the front boom member 7 . the boom 4 fabricated as described above is vertically rotatably attached to the vehicular body 1 by causing the forked bracket 11 of the connecting member 9 to be connected with a shaft pin to the upper part of a support bracket 13 of the vehicular body 1 . the arm 5 mentioned above possesses a linear arm member 16 fabricated in the shape of a hollow tube of a circular or elliptic section . a connecting member 17 possessing an inwardly extended two - prong fork bracket 19 is attached fast to the front end and a connecting member 18 possessing a two - prong forked bracket 20 is attached fast to the rear end respectively of the arm member 16 . the connecting members 17 and 18 avoid blocking the front end and the rear end of the arm member 16 . the forked bracket 12 of the front connecting member 10 of the boom 4 is connected with a shaft pin 21 to the rear connecting member 18 rear the arm member 16 . the upper end of the bucket 3 is connected with a shaft pin 22 to the forked bracket 19 of the front connecting member 17 . to the lower part of the support bracket 13 of the vehicular body 1 , the basal end of a boom cylinder 23 is connected with a shaft pin 24 . the end of a piston rod 25 of the boom cylinder 23 is connected with a shaft pin 26 to a fulcrum 15 formed at the central bent part of the intermediate boom member 8 . the boom cylinder 23 is enclosed in the boom 4 . to the shaft pin 26 of the fulcrum 15 is connected the basal end of an arm cylinder 27 . the point of connection of the boom cylinder 23 to the boom 4 and the point of connection of the arm cylinder 27 to the boom 4 constitute a joint fulcrum . the end of the piston rod 28 of the arm cylinder 27 is connected with a shaft pin 29 to the forked bracket 20 of the rear connecting member 18 of the arm 5 . the arm cylinder 27 is enclosed with the boom 4 . the basal end of a working element cylinder 31 is connected to the shaft pin 21 of a connection part 30 between the boom 4 and the arm 5 . the point of connection of the boom 4 to the arm 5 and the point of connection of the working element cylinder 31 to the arm also constitute a joint fulcrum . to the end of a piston rod 32 of the working element cylinder 31 , one side ends of links 33 and 34 are connected with a pin 35 . the other end of the link 33 is connected with a pin 36 to the rear upper end of the bucket 3 and the other end of the link 34 is connected with a pin 37 to the forked bracket 19 . owing to the arrangement described above , the boom 4 is raised by extending the boom cylinder 23 and it is lowered by contracting the boom cylinder . the arm 5 is swung by actuating the arm cylinder 27 and the bucket 3 is operated by actuating the working element cylinder 31 . the desire to enhance the strength of the boom 4 and that of the arm 5 can be attained by fabricating the boom and the arm each in the shape of a hollow tube of a circular or elliptic section very stable to withstand torsional load and the desire to improve the appearance of the apparatus as a whole is accomplished by causing hydraulic cylinders to be enclosed with the boom and / or the arm in the shape of the hollow tube . the face that the point of connection of the boom 4 to the arm 5 and the point of connection of the working element cylinder 31 to the arm constitute a joint fulcrum and the fact that the point of connection of the boom cylinder 23 to the boom 4 and the point of connection of the arm cylinder 27 to the boom 4 also constitute a joint fulcrum serve to lower the number of points of connection used in the apparatus as compared with the conventional countertype and simplify the process of fabrication of the apparatus . the coincidence of the positions of the fulcrums serves to lower the maximum moment and also lower the torsional and bending moments . the fact that this apparatus has no use for the additional connecting members indispensable to the conventional coutertype serves to lower the weight of the apparatus as a whole . fig3 and fig4 illustrate other embodiments of this invention . they differ from the embodiment of fig2 in the manner of attachment of the boom cylinder . a forked bracket 38 is welded to the opposite lateral parts of the intermediate boom member 8 and extended inwardly therein . the end of the piston rod 25 of the boom cylinder 23 is connected with a shaft pin 39 to the leading end of the end of the bracket 38 as illustrated in fig4 . in this embodiment , the arm cylinder 27 and the working element cylinder 31 are enclosed respectively within the hollow tubes of the boom 4 and the arm 5 and the boom cylinder 23 is not enclosed in the boom 4 . the apparatus , therefore , has a neat appearance as compared with the conventional countertype . as already apparent to those akilled in the art , at least one cylinder selected from the group consisting of the boom cylinder 23 , the arm cylinder 27 , and the working element cylinder 31 can be enclosed within the boom 4 or the arm 5 , enabling the apparatus to assume a neat appearance . obviously , many modifications and variations of the present invention are possible in light of the foregoing teachings . it is , therefore , to be understood that within the scope of the appended claims , the present invention may be practiced otherwise than as specifically described herein .

4Fixed Constructions

it will now be described how one can improve the integration of digital baseband systems and circuits with one or more rf subsystem . clearly , the method and system being described hereinafter are particularly suitable for the purpose of designing an new mobile phone fitted with multimedia and enhanced functionalities , such as global positioning system ( gps ), bluetooth , wireless ian , 2g and 3g , a high resolution camera and display ( s ) a tv out capability etc . . . clearly , the clocking architecture which will be described is suitable for allowing the combination of a wide number of features and functions such as mentioned above , but can also be used for a limited subset of functionalities . furthermore , it should be clear that the embodiments which will be described hereinafter should not be restricted to the telecommunication standards , nor to the frequency bands nor to the combination of bands which are shown in the illustrative example of fig1 . the technique described below can be used in a wide range of applications , and is particularly applicable to both 2g ( egprs ) systems and 3g systems ( fdd - wcdma all releases including long term evolution ), and can be advantageously incorporated in any recent architecture , such as typical architecture of fig1 . conventionally , each individual component , identified as an aggressor in a mobile phone , has its own clock signal which is generated by one phase locked loops so that , in the whole phone , no less than 10 plls can be simultaneously ( and asynchronously ) operated , each one corresponding to its particular functional entity . the clocking of all those individual components — or aggressors — results , as mentioned in the first section of the present description , in wideband noise which might contribute to desensitize the rf receiver . the present invention brings a partial solution to the problem of wideband noise falling in the first category , which is generated by high speed data transfers between the single chip and its peripherals , such as camera , displays but also , usb and external memory interface ( blocks 150 , 160 , 170 , 180 ). for such wideband noise , the aggressor &# 39 ; s frequency lobes result from the several high order harmonics of either the bit rate grid used to exchange data between the single chip i / o ( input / output ) pads and the external memory , or the external display ( s ), or the external camera ( s ), or even from the usb bus . fig2 shows the first power spectral density ( psd ) properties of the first category of aggressor : wideband noise of a high speed data transfer on a serial or on a parallel interface , in the case of a high speed nrz or rz serial data link . the victim &# 39 ; s carrier frequency denoted f w is located in between the n th harmonic null ( or zero ) and the n th + 1 null of the aggressors psd , thereby suffering from being jammed by the maximum psd of the n th psd lobe . it should be noticed that the data interface exhibits the spectrum of a pulsed clock spur leakage located at the frequency nulls of the data psd . as shown in the figure , the digital high speed serial interfaces generate wideband spectral lobes which span over several hundred of mhz , which can couple directly into the lna input pin ( s ) via electromagnetic coupling of the long bonding wires which can be modeled as radiating transmissions lines , acting in a fashion very similar to antennae . with respect to fig3 a , there is illustrated the severity of the problem for the case of a single chip gsm 900 rf / bb / pmu receiver which tends to be desensitized by the presence of the external memory interface wideband noise being clocked at 65 mhz ( crosses ). the victim &# 39 ; s carrier frequency is set to 937 mhz ( channel 10 ). it can be seen that the victim is located within a maximum of the aggressor &# 39 ; s 14 th lobe psd . in order to reduce desensitization of the rf receiver by the different possible aggressors , it is proposed to implement a fine and adaptive control of the clocking of each individual component or functional block which is identified as a possible aggressor for the considered victim , generally the rf receiver . this fine adaptive control is performed by a general control unit — a so - called use case manager ( ucm )— which has the function of adjusting , at a very fine level , the clock rate of the considered component so as to precisely position the aggressor wideband noise psd with respect to the considered victim &# 39 ; s carrier . in one embodiment , the control is performed so as to set the aggressor wideband noise psd null just to the left or to the right , in the frequency domain , of the victim &# 39 ; s wanted carrier frequency denoted “ f w ”. it has been noticed that the fine adjustment of the null should not be exactly centered onto f w , because of the presence of interface clock leakage , but very close near that value . in any case , the skilled man will particularly define the best relative position of the victim &# 39 ; s wanted carrier frequency “ f w ” with respect to the aggressor wideband noise psd null in one particular embodiment , the clocking rate of the individual aggressor ( s ) is / are defined by means of a central clocking system with a frequency plan being arranged so as to allow a dynamic , reprogrammable scheme under control by the usm , in order to move the grid based upon the a - priori knowledge of the downlink wanted carrier frequency . this permits the victim to always take advantage of the lowest possible aggressor noise psd and yet avoids the eventual strong pulsed clock leakage located at the exact frequency nulls of the the aggressor psd . in one embodiment , the adjustment of the particular clock rate of the one individual component — or aggressor — is achieved by means of at least one programmable frequency divider providing high resolution dividing ratio , based on the combination of integer divide ratios and fractional divide ratios for achieving fine adjustment of the clocking frequency by precisely adjusting the frequency clocking of the considered aggressor — such as the ddr storage for instance — one can ensure that the impact of wide band noise generated by external high speed data interface of the previously identified aggressors is being minimized within the rf receiver . in one particular embodiment , the use case manager ucm is arranged to have high - level vision of the contextual operations of the mobile telephone , and particularly any frequency switching of the rf transmitter controlled by the base station , so as to precisely generate the appropriate control parameters for controlling the different clocks required by the different elements the latter more particularly uses the following information for controlling the fine tuning of the clock rate : victim &# 39 ; s wanted carrier frequency ( location of the victim in the frequency domain ) victim &# 39 ; s operating frequency band , and therefore a priori knowledge of duplex gap and duplex distance victim &# 39 ; s operating mode ( egprs , wcdma etc . . . ) victims &# 39 ; s wanted carrier received power aggressor activity : a priori knowledge of min and max values of prf 1 and prf 2 , and fburst aggressor min / max clock frequency capabilities ( for eg . certain memories have tight tolerances on changing their operating clock frequencies ) indeed , considering for instance the case of the carrier received power , it has been noticed when the received power is very low — which is the case when the mobile phone is far away from its base station — a fine control of the clock rate shows to be very critical so as to avoid any desensitization of the rf receiver and , therefore , the use case manager ( cm ) is aware of such information so as to perform very fine and effective control of the clock rate of the memory storage . to achieve the fine tuning of the clock rate of the aggressor , the usm continuously performs a contextual analysis of the mode of operation of the mobile phone , taking into account a number of input parameters above , so as to precisely determine the control parameters used by the programmable dividers and , thus , fix the clock rate of the considered aggressor . for the sake of clarity , there will now be considered one illustrative example of a gsm900 channel 10 receiver victim and a new memory interface which is now clocked onto a 78 mhz grid instead of the previously shown 65 mhz grid . it can be seen that not only does the victim benefit from the lowest aggressor noise psd , but it is also protected from the strong clock leakage . the skilled man will straightforwardly adapt the teaching of the invention to not only other victim &# 39 ; s carrier frequencies within this frequency band , but also to other frequency bands of the etsi gsm standard . note also that the technique also applies to other telecommunication standards than egprs . for example , but not limited to , this invention can be applied to any of the frequency bands of a wcdma 3gpp standard modulated carrier . the fine control of the clock rate of the memory is achieved by means of a central system clock generator pll associated with a set of integer frequency dividers to derive multiple grids from a unique master clock source on which the external peripherals can be clocked to ensure evasion of the aggressor noise psd . to minimize cost and complexity , it is preferable , but not compulsory , that the unique system clock frequency is a multiple integer number of : the various crystal running frequencies , namely a multiple of 26 mhz and 19 . 2 mhz , of the various interface data rates : for example 480 mhz for usb , 1248 mhz for m - phy camera interfaces , etc . clock candidates that fullfil these requirements are 1248 mhz , 2496 mhz as shown in fig4 illustrating a master clock pll source being the multiple integer of world &# 39 ; s most used crystal frequencies : 26 and 19 . 2 mhz . it should be noticed that from 1248 , the umts chip rate can be easily derived , as well as gsm , as well as lte system clocks . usb 2 . 0 which uses 480 mbit / s can also be derived since 1248 and 2496 are multiple integers of 24 mhz , and 480 mhz = 24 * 20 mhz . fig5 illustrates one possible — and non limiting — embodiment of a clock architecture which can be used for providing accurate control of the frequency values for different aggressors . the architecture is based on at least one master clock reference , operating at f vco , for instance between 4 and 5 ghz , and which can be used for generating all or most of the clocks used by the different constituents of the mobile phone , including the possible aggressors . one sees a phase locked loop ( pll ) which is formed by means of oscillator 102 operating at f vco the output of which being connected to the input of a programmable divide by n circuit 103 and which output is connected to a first input of a phase comparator circuit 104 , a second input of which receives the output of a 26 mhz reference crystal oscillator 105 . note that this conventional pll architecture may rely upon integer n or fractional n division ratios . the pll comprising blocks 101 , 102 , 103 , and 104 is used for generating all frequency clock references , particularly required by the baseband ( or also entitled “ cpu ”), the memory ( or also known as “ ddr ”) and display etc . for instance , the f vco frequency is divided by a programmable divider 106 which allows any division between n to n 1 so as to provide a so called variable digital clock which can be further divided by a dedicated programmable divider 108 used for clocking the digital signal processor ( dsp ) or also called “ central processing unit ” ( cpu ), as well as the divider 107 to feed the external ddr memory , the divider 109 to feed the camera interfaces etc . note that programmable division ratios n 1 , n 2 of divider 106 , p 1 of divider 107 , p 2 of divider 108 and p 3 of divider 109 can be either implemented in integer n or as fractional division ratios depending on the mobile phone application ( number of bands , number of telecommunication standards being supported , etc ). it should be noticed that the architecture which is illustrated in fig5 is only one illustrative example of how achieving one complete set of clocking signals which are derived from one single centralized master clock . in particular , the architecture can be adapted for the purpose of introducing some clock spreading techniques s which are out of the scope of the present invention , but which may be advantageously used by the skilled man . it can be seen in fig5 that all the different clocks are under control of the use case manager . this is represented by the control leads of programmable dividers 103 and 106 . accordingly , the use case manager is thus able to precisely define and control the clocking of each “ aggressor ”, in accordance with the particular context of use of the mobile phone , including the tx modulated carrier frequency , the tx modulated carrier power , the dl received carrier power , the operating frequency band ( dd & amp ; dg ), the mode of operation ( 2g , 3g ), the clocking of the aggressor being considered . basically , the pll is arranged so as to provide all clocks — high speed and low speed — which are required for embodying a recent mobile phone including a wide range of multimedia functionalities . fig6 illustrates , in the case of the memory , the determination of the position of the victim or rf carrier with respect to different possible situations : a . in the case of simple pulsed clock aggressors , the victim wanted carrier location in the frequency domain relative to the position of the data aggressor noise power spectral density null must be equal to the pulse repetition frequency ( prf = 1 / t ). f burst is equal to 1 / t the spur location is generally defined by : p * f burst +/− q * prf with q being an integer number b . in the case of aggressors using packet of pulsed clock , the minimum frequency gap between the aggressor data psd null and the location of the victim &# 39 ; s carrier must be at least equal to p * f burst + prf 1 + prf 2 . the spur location is generally defined by : p * f burst +/− q * prf 1 +/− r * prf 2 , where p , q & amp ; r are integer numbers , and “ p ” referring to the harmonic number of the clock frequency . fig6 also illustrates an example of numerical values for 2 different categories of memories or aggressors , with the indication of the particular values for parameter prf 1 and prf 2 . as a conclusion , the invention which was described above achieves a very effective mitigation technique which prevents wideband data spectral lobes from falling within the downlink carrier frequency to which the ue is attached to in either cell dch state for 3g , or in connected mode for 2g systems . it has been shown that the invention achieves a very precise clock control so as to precisely set the wideband noise psd null just to the left or to the right , in the frequency domain , of the rf transceiver wanted carrier frequency ( fw ). indeed , instead of simply specifying that the wanted carrier frequency ( fw ) should be located between two consecutive harmonics , it has been discovered by the inventor that a very advantageous effect derives from the location of the wanted carrier frequency ( fw ) sufficiently close to the harmonics ( but without being equal to it ) so as to take advantage of a lower level of psd .

7Electricity

the figures are provided for illustrative purposes only to assist in understanding the invention herein and are not intended nor should they be construed as limiting the scope of this invention in any manner . fig1 is a schematic representation of a smoke detector tester of this invention . it is understood that , with regard to this description and the appended claims , any reference to any aspect of this invention made in the singular includes the plural and vice versa unless it is expressly stated or unambiguously clear from the context that such is not intended . as used herein , any term of approximation such as , without limitation , near , about , approximately , substantially , essentially and the like , means that the word or phrase modified by the term of approximation need not be exactly that which is written but may vary from that written description to some extent . the extent to which the description may vary will depend on how great a change can be instituted and have one of ordinary skill in the art recognize the modified version as still having the properties , characteristics and capabilities of the word or phrase unmodified by the term of approximation . in general , but with the preceding discussion in mind , a numerical value herein that is modified by a word of approximation may vary from the stated value by ± 10 %, unless expressly stated otherwise . as used herein a “ seal ” refers to a device that helps to form a relatively tight interface between two contiguous surfaces in order to minimize leakage of a smoke - simulating aerosol during testing of a smoke detector using a device of this invention . by “ relatively tight interface ” is meant that the contiguous surfaces need not necessary form a fully gas - tight interface but the interface should prevent escape of the aerosol for a sufficient period of time for the smoke detector to react to the aerosol if the smoke detector is in working order . the interface will comprise the lip or edge of an end piece of this invention , as described below , and the surface of the smoke detector around the smoke sensor region or the surface to which the smoke detector is mounted if the end piece encompasses the entire body of the smoke detector . for the purposes of this invention , a seal can comprise , without limitation , an o - ring seal , a cup seal or a face seal . the terms “ proximal ” and “ distal ” simply refer to the opposite ends of a construct and are used as a method of orienting an object with relation to another object such as the orientation of the end of a canister herein in relation to a hollow tube to which it is coupled . in general , which end is designated as proximal and which as distal is purely arbitrary unless the context unambiguously expresses otherwise . as used herein , the use of “ preferred ,” “ presently preferred ,” “ preferably ,” or “ more preferred ,” and the like refers to preferences as they exist at the time of filing of this application . as used herein , “ fluidly coupled ” means that a smoke - simulating aerosol can pass substantially unimpeded between components of a test device of this invention when the components are permanently or reversibly coupled together and the tester is in use . as used herein , a “ barrel ” refers to a hollow tube as exemplified by , without limitation , a plumbing pipe , electrical conduit , laboratory tubing and the like . for the purpose of this invention , a barrel may be circular in cross - section , that is it may be cylindrical , or it may be oval in cross - section or it may have a cross - sectional shape of any other desired configuration . fig1 illustrates a smoke detector test device of this invention . each of the elements of the test device shown may be made of the same material or of different materials . the materials can be , without limitation , metals , alloys , polymers or composites . it is presently preferred , however , to fabricate all elements of the test device from the same material , preferably at present a polymer , which polymer can be , without limitation , pvc ( polyvinyl chloride ), cpvc ( chlorinated polyvinyl chloride ) or pex ( high density polyethylene ). a consideration to be made when selecting a barrel polymer is that , when smoke - detector engaging end piece 15 is placed over a smoke detector and pressure is applied at the handle end of the device , the barrel will be rigid enough to relay that pressure to the end piece and hold it firmly in place during testing . this can be achieved by the selection of the polymer itself or by adjusting the thickness of the wall of the polymer barrel or both . smoke detector engaging end - piece 15 is presently preferred to be cup - shaped as shown in fig1 . the cup will have a diameter 16 that permits it to be placed over at least the sensing portion , preferably at present then entire exposed body , of a smoke detector ( not shown ). optional gasket 17 will form a seal either with the body of the smoke detector or with surface to which the smoke detector is attached to assure that the sensing element of the smoke detector is exposed to the smoke - simulating aerosol for a sufficient period of time to properly determine the status of the smoke detector using smoke detector test device 10 . while a cup - shape as shown in fig1 is presently preferred , it is understood that end piece 15 may have any shape so long as it completely covers at least the sensing element of the smoke detector , preferably at present , the entire body of the smoke detector . a presently preferred diameter 16 for end piece 15 is approximately 6 inches since this will permit testing of the majority of commercial smoke detectors in use at the time of filing of this application . end - piece 15 can be of any depth 23 that will permit proper coverage of a smoke detector . it is presently preferred that the depth be approximately 3 inches since , as above , this will accommodate the vast majority of commercial smoke detectors in use at the time of the filing of this application . if barrel 20 , discussed below , is straight , the angle that centerline 23 of end - piece 15 makes with centerline 12 of the straight barrel can be modified to improve application of the end piece to a smoke detector . with a straight barrel , an angle of about 30 ° to about 45 ° is presently preferred . if barrel 20 is curved , which is the presently preferred configuration , the angle of end - piece 15 to the distal end of barrel 20 may be any angle that provides good coverage of a smoke detector . in fact , it is an embodiment of this invention that the coupling of end - piece 15 to barrel 20 may comprise a ball - joint such that the angle of end - piece 15 can be continuously changed to any desired configuration . end - piece 15 is coupled to distal end 30 of barrel 20 of device 10 . the coupling may be permanent , that is , end piece 15 and barrel 20 may be one piece either glued together or initially formed as one construct . it is presently preferred , however , that end - piece 15 be coupled to barrel 20 by a reversible coupling such as , without limitation , a threaded coupling , a compression fitting or a swagelok ®. this will allow changing out end - piece 15 to accommodate various size and shape smoke detectors . barrel 20 can be any length from about 12 inches to about 48 inches . as mentioned previously , a presently preferred configuration for barrel 20 is a curve that describes an arc with a degree of bending of about 20 ° to about 40 °. barrel 20 can be rigid or it can be fabricated of a flexible material such as , without limitation , electrical conduit . if electrical conduit is used , a tube having an outside diameter smaller that the inside diameter of the conduit may be run through the conduit and may be fluidly coupled to the end piece and to the hollow chamber so as to minimize escape of the smoke - simulating aerosol from the conduit . while any diameter barrel may be used , it is presently preferred that it be relatively small to assure unimpeded insertion of the device into close spaces . it is presently preferred that the barrel have an inside diameter of about ¼ inch to about ¾ inch . the outside diameter will vary according to the thickness of the wall of the barrel and this thickness will depend on the nature of the material of which the barrel is fabricated so as to achieve a rigid barrel or a flexible barrel with sufficient rigidity to allow sufficient pressure to be transmitted to the end piece when it is placed over a smoke detector . the above proviso pertains to conduit used to fabricate a flexible barrel : the conduit must be stiff enough to hold the shape into which it has been bent sufficiently to permit pressure applied at the handle end of device 10 to be transmitted to the end - piece and hold it in place over a smoke detector . in another embodiment , barrel 20 may comprise a telescoping construct that allows adjustment of the length of the barrel to fit various space requirements in the vicinity of a smoke detector being tested . a telescoping barrel may be able to span the entire range of barrel lengths discussed above or it may be fabricated to extend to a lesser or greater distance than a single length rigid barrel . at the other end , i . e ., proximal end 31 of barrel 20 , barrel 20 is coupled to device body 25 . again , the coupling of barrel 20 to device body 25 may be permanent or reversible . as above , a reversible coupling is preferred such that the length and curvature of barrel 20 may be changed by replacing one barrel with another . it is , in fact , an aspect of this invention that device 10 can be provided as a kit that includes different length barrels , different curvature barrels , different diameter cup - shaped constructs and any combination of these . device body 25 comprises canister 30 . canister 30 is coupled to device body either permanently or , as above , in a reversible manner to accommodate different size and shape aerosol generators 38 . at distal end 32 of canister 30 is end - cap 35 . end - cap 35 will retain aerosol generator 38 within canister 30 . as shown in fig1 , end - cap 35 can be a hinged snap - lock construct but virtually any type of end - cap such as a threaded closure and threaded canister may be used . any other manner of end - cap that will keep the aerosol generator in place may be used . either end - cap 35 or distal end 32 of canister 30 may comprise a gasket ( not shown ) to ensure a tight seal when the aerosol generator is in place . at present the use of commercial smoke detector testing aerosols sold in pressurized cans by entities such as crc industries , inc . ( warminster , pa .) and sdi ( wall township , n . j .) are contemplated . device body 25 also comprises grip 36 . grip 36 in fig1 is shown as a pistol grip as such is commonly known . any manner of grip can be used , however , so long as it permits a secure hold on device body 25 when device 10 is in use . to this end , grip 36 may include a sleeve or coating of a slip resistant material to improve the user &# 39 ; s hold on the device . such slip resistant materials include , without limitation , rubber , a polymer or a polymer impregnated with a particulate material . any of the foregoing may additionally be embossed with a cross - hatched surface . device body 25 is coupled to trigger 40 . trigger 40 is designed so as to remotely depress activator button 44 of aerosol generator 38 in canister 30 . that is , pulling back on trigger 40 causes end 48 of lever 49 to depress activator button 44 . when activator button 44 is depressed , it opens a valve ( not shown ) to release a smoke - simulating aerosol from nozzle 45 of generator 38 . the smoke - simulating aerosol is discharged from nozzle 45 into hollow chamber 47 of device body 25 . trigger 40 may be of any design that can affect the depression of activator button 44 including that shown in fig1 where trigger 40 and lever 49 are shown as one - piece hinged by hinge 50 so as to permit rotation of lever 49 onto activator button 44 . the operation of a smoke detector test device of this invention is straight forward . a pressurized can of a commercial smoke - simulating substance is placed in the canister and the canister is closed to hold the can in place . the trigger is then pulled to test that the activator button is depressed and a smoke - simulating aerosol is expelled from the pressurized can . then the barrel of the device is inserted into a space containing a smoke detector and the end - piece of the device is made to cover the smoke detector or at least the smoke sensing element of the smoke detector . the trigger is depressed and the smoke - simulating aerosol exits the nozzle and travels through the hollow chamber into the barrel and then into the end piece . if the smoke detector is in working order , it will sound the alarm . the device can then be withdrawn from the region of the smoke detector .

6Physics

one embodiment of the remover of the present invention is shown in fig1 and 2 , in which a take - up drum 5 is arranged above the section of a weft w extending between a main nozzle 1 and the selvage of a woven cloth ( not shown ). the take - up drum 5 is securely mounted on a main shaft 10 extending in parallel to the running direction of the weft w . the main shaft 10 is rotatably mounted via a bearing 17 and a bearing 18 to a causing 9 which is secured to a proper framework not shown of a fluid jet loom . spaced rearwards apart from the take - up drum 5 , a slide gear 13 is mounted to the main shaft 10 in an axially slidable arrangement . as later described in more detail , the slide gear 13 is normally pushed rearwards by means of a compression spring 15 . an intermediate shaft 20 is rotatably mounted to the casing 9 in parallel to the main shaft 10 whilst extending in the running direction of the weft w . a drive motor 24 is mounted atop the casing 9 and has an output shaft 25 on which a drive bevel gear 27 is secured . this drive bevel gear 27 is in a meshing engagement with a driven bevel gear 23 secured on the intermediate shaft 20 . a drive gear 21 is secured on the boss of the driven bevel gear 23 in a meshing engagement with the slide gear 10 . the drive motor 24 is reversible in rotation depending on control signals accepted . for removal of a faulty weft , the drive motor 24 transmits its rotation to the main shaft 10 via the gears 27 , 23 , 21 , 13 , the pin 51 and the cam 60 , thereby rotating the take - up drum 5 in a direction to separate the faulty weft from the woven fabric . in fig2 for example , the take - up drum 5 rotates in the counterclockwise direction . a circumferential groove 5a is formed in the take - up drum 5 and a catcher pin 7 is secured at its proximal end to the bottom of the circumferential groove 5a . as best seen in fig2 the catcher pin 7 is bent somewhat in the rotating direction of the take - up drum 6 for removal of a faulty weft . the size of the catcher pin 7 is selected so that , as the take - up drum rotates , the catcher pin 7 should scoop the weft w at the section extending between the main nozzle 1 and the selvage of the woven cloth . a longitudinal groove 5b is also formed in the take - up drum 5 extending normal to the circumferential groove 5a . as shown in fig2 and 3 , a stationary cutter 31 is fixed to one side wall of the longitudinal groove 5b astride the intersection of the both grooves 5a and 5b . as shown in fig4 a movable cutter 41 is also slidably accommodated in the longitudinal groove 5b whilst being pressed side by side against the stationary cutter 31 by a reaf spring 49 . more specifically as shown in fig7 a and 7b , the stationary cutter 31 is provided with fore and rear gullets 31b and 31c intervened by a center point 31a . similarly , the movable cutter 41 is provided with fore and rear gullets 41b and 41c intervened by a center point 41a . in this case , however , the fore edge of the center point 41a and the rear edge of the rear gullet 41c are provided with blades . the movable cutter 41 is coupled via a bracket 43 to a cutter shaft 45 which is axially slidably inserted over the main shaft 10 . the above - described compression spring 15 is interposed between a spring seat 42 secured on the cutter shaft 45 and the casing 9 . due to the repulsion of the compression spring 15 , the rear end of the cutter shaft 45 is normally kept , via a slip ring , in pressure contact with the fore face of the slide gear 13 . on the rear side of the slide gear 13 , is a cam 60 secured to the main shaft 10 and provided with a cam face 61 in contact with a pin 51 projecting from the rear face of the slide gear 13 . the relationship between the pin 51 and the cam face 61 of the cam 60 is shown in fig6 . on the rear side , the cam 60 is accompanied in one body with a ratchet wheel 63 . as shown in fig5 this ratchet wheel 63 is controlled by a ratchet 62 so that the main shaft 10 should be allowed to rotate in one direction only . that is , the main shaft 10 is allowed to rotate only when the drive motor 24 rotates in the normal direction . when the drive motor motor 24 rotates in the reverse direction , the main shaft 10 is locked against rotation by the ratchet 62 . at the rear end , the intermediate shaft 20 is provided with a radial dog 71 which is faced by a proximity switch 73 . by an output signal from this proximity switch 73 , is fixed the stop position of the take - up drum 5 , i . e . the position at which a faulty weft wound on the take - up drum 5 should be severed . the operation of the faulty weft remover of the above - described construction will now be explained . during normal weaving operation of the loom , the weft is delivered to the main nozzle 1 for weft insertion from a weft reservoir ( not shown ) via a clamper 3 in the open state . when a faulty weft is produced by faulty weft insertion , a stop signal is issued by a weft detector ( not shown ) on the loom . this stop signal makes a weft cutter ( not shown ) inactive and closes the clamper 3 in order to provisionally prohibit further delivery of weft from the weft reservoir . thus , the faulty weft is not cut , the next weft insertion is canceled , and the loom performs one more cycle of inertia rotation to stop . as a consequence , the faulty weft under this condition extends between the main nozzle 1 and the selvage of the woven cloth . next , the loom is rotated reversely to a crank angle of about 180 degrees for free release of the faulty weft . during this procedure , the weft reservoir is provisionally kept inactive and the clamper 3 open . after this procedure , the drive motor 24 is driven for rotation in the normal direction . this rotation of the drive motor 24 is transmitted to the slide gear 13 via the gears 27 , 23 and 21 . then the pin 51 on the slide gear 13 abuts against the cam face 67 of the cam 60 whic is thereupon driven for rotation . then the main shaft 10 is also driven for rotation so that the faulty weft should be caught by the catcher pin 7 to be wound on the take - up drum 5 . concurrent rotation of the dog 71 on the intermediate shaft 20 is constantly watched by the proximity switch 73 which is electrically connected to the drive motor 24 . full removal of the faulty weft is thus detected through the extent of rotation of the intermediate shaft 20 by the proximity switch 73 facing the dog 71 and , on receipt of a corresponding signal from the proximity switch 73 , the drive motor 24 is driven for rotation in the reverse direction and the slide gear 13 rotates in the reverse direction too . as a substitute of the dog - switch combination for detection of the full removal , degree of rotation of the drive motor 24 in the normal direction may be detected for issue of a corresponding signal . as a further substitute , presence of the faulty weft may be detected between the main nozzle 1 and the selvage of the woven cloth . despite rotation of the slide gear 13 in the reverse direction , the cam 60 is locked against accompanying rotation by the ratchet 62 shown in fig5 . as a consequence , the pin 51 on the slide gear 13 moves from the position shown with solid lines to a position shown with dot lines in fig6 . as a result , the slide gear 13 is urged to move towards the take - up drum 5 against the repulsion by the compression spring 15 . then , the cutter shaft 45 also moves towards the take - up drum 5 in order to move the movable cutter 41 forwards across the circumferential groove 5a via the bracket 43 . following this linear movement of the movable cutter 41 , the blade on the fore edge of the center point 41a severs the section of the faulty weft in the fore gullet 31b of the stationary cutter 31 ( see fig7 a and 7b ) whereas the blade on the rear edge of the rear gullet 41c severs the section of the faulty weft in the rear gullet 31c of the stationary cutter 31 . full severance of the faulty weft is again detected through rotation of the intermediate shaft 20 by the proximity switch 73 facing the dog 71 and on receipt of a corresponding signal from the proximity switch 73 , the drive motor 24 ceases its rotation in the reverse direction . as the moment , the pin 51 returns to the position shown with the solid lines in fig6 . since the take - up drum 5 on the main shaft 10 is locked against rotation in the reverse direction during this procedure by the rachet 62 ( see fig5 ), the faulty weft on the take - up drum 5 can be reliably severed by the cutter assembly without slack . so that a remainder of weft connected to the main nozzle 1 after the severance should be of an optimum length , the angular position of the take - up drum 5 can be duly adjusted by changing the relative position between the proximity switch 73 and the dog 71 on the intermediate shaft 20 . in the case of the embodiment shown in fig1 the ratchet 62 is used for locking the cam 60 against rotation in the reverse direction . this operation can be done by use of a proper one - way clutch . further , an electromagnetic brake may be used for locking the main shaft 10 , i . e . the cam 60 , against rotation in the reverse direction . in a modification , the pin 51 may be secured to the fore face of the ratchet wheel 63 and the cam 60 may be arranged on the rear side of the slide gear 13 . more broadly , the pin - cam combination may be replaced by a known proper mechanism for converting a rotary movement into a linear movement . in accordance with the present invention , driving of the take - up drum and the cutter assembly by a single , common drive source removes the need for phase adjustment in operation . further , since the faulty weft wound on the take - up drum is distributed into separate groups by the specified configuration of the stationary cutter and different groups are severed by different blades on the movable cutter , severance of the faulty weft can be reliably carried out regardless of the amount and / or type of the faulty weft . it will be well understood that the stationary cutter 31 shares distribution of a faulty weft and the movable cutter 41 shares severance of the faulty weft in the case of the above - described embodiment . in general , the cutter assembly used for the present invention is classified into two major types . in the case of the first type , the stationary cutter shares distribution of a faulty weft and the movable cutter shares severance of the faulty weft . in the case of the second type , the stationary cutter shares severance of a faulty weft and the movable cutter shares distribution and severance of the faulty weft . apparently , the cutter assembly shown in fig7 a and 7b belongs to the first type . a cutter assembly shown in fig8 a and 8b is a slight modification . a stationary cutter 131 is provided with a center point 131a , and fore and rear gullets 131d and 131e . a movable cutter 141 is provided with a fore point 141a having a fore edge blade and a rear gullet 141d having a rear edge blade . during forward movement of the movable cutter 141 , the section of the faulty weft in the fore gullet 131d is severed by the blade on the fore point 141a and the section of the faulty weft in the rear gullet 131e is severed by the blade on the rear edge of the rear gullet 141d . except for the shape of the gullets , the cutter assembly in fig9 a and 9b is substantially similar to that shown in fig8 a and 8b . the faulty weft may be severed during rearward movement of a movable cutter by properly adjusting the relative position between stationary and movable cutters . one example is shown in fig1 a and 10b . in this case , a stationary cutter 231 is provided with center point 231a , and fore and rear gullets 231d and 231e . a movable cutter 241 is provided with a fore point 241a with a blade on its rear edge , a rear point 241b with a blade on its rear edge , and a center gullet 241d intervening the fore and rear points . during rearward movement of the movable cutter 241 , the section of the faulty weft in the fore gullet 231d is severed by the blade on the rear edge of the fore point 241a whereas the section of the faulty weft in the rear gullet 231e is severed by the blade on the rear edge of the rear point 241b . except for the shapes of the point and gullets , the cutter assembly in fig1 a and 11b is substantially similar to that shown in fig9 a and 9b . the other cutter assemblies are shown in fig1 a to 12e . in this case , a common stationary cutter 331 in fig1 a is used in combination with various movable cutters . that is , the stationary cutter 331 is provided with a center point 331a and fore and rear gullets 331d and 331e . a movable cutter 341 in fig1 b is provided with a blade on its fore edge only . a movable cutter 341 is fig1 c is provided with a fore point 341a with blades on its fore and rear edges . in this case , severance of faulty weft is carried out twice during one cycle reciprocation of the movable cutter 341 in order to further enhance reliability in operation . further improvement in operation is found in use of a movable cutter 341 shown in fig1 d and 12e . for example in fig1 d , the movable cutter 341 is provided with fore and rear points 341a and 341b intervened by a center gullet 341d . each point is provided with blades on its fore and rear edges . when compared with the one shown in fig1 c , the stroke of the movable cutter 341 shown in fig1 d or 12e for one reciprocation is half as shown with chain lines . cutter assemblies of the second type are shown in fig1 a through 14b . in this case , the stationary cutter shares severance and the movable cutter shares distribution and severance . a stationary cutter 431 in fig1 a is substantially similar to that in fig1 a except for the shape of the gullet . that is , the stationary cutter 431 is provided with a relatively broad center gullet 431d having blades on its fore and rear edges . in fig1 b , a movable cutter 441 includes fore and rear gullets 441d and 441e intervened by a center point 441a which is provided with blades on its fore and rear edges . during forward movement of the movable cutter 441 , the section of the faulty weft in the fore gullet 441d is severed by cooperation of the blade on the fore edge of the center point 441a of the movable cutter 441 with the blade on the fore edge of the center gullet 431d of the stationary cutter 431 . whereas , during rearward movement of the movable cutter 441 , the section of the faulty weft in the rear gullet 441e is severed by cooperation of the blade one the rear edge of the center point 441a of the movable cutter 441 with the blade on the rear edge of the center gullet 431d of the stationary cutter 431 . in this case , cooperation between different blades on different cutters provides a sort of shearing effect at severance , thereby greatly enhancing operational reliability of the cutter assembly . in the case of the movable cutter 441 shown in fig1 c , blades are formed on the fore edge of the center point 441a and on the rear edge of the rear gullet 441e . during forward movement of the movable cutter 441 , the section of the faulty weft in the fore gullet 441d is first severed by cooperation of the blade on the fore edge of the center point 441a of the movable cutter 441 with the blade on the fore edge of the center gullet 431d of the stationary cutter 431 . next , the section of the faulty weft in the rear gullet 441e is severed by cooperation of the blade on the rear edge of the rear gullet 441e of the movable cutter 441 with the blade on the fore edge of the center gullet 431d of the stationary cutter 431 . here again , a sort of shearing effect can be expected at severance . for reduction in stroke for one reciprocation , a movable cutter 441 in fig1 b includes fore , center and rear points 441a - 441c and fore and rear gullets 441d and 441e . the fore point 441a has a blade on its fore edge , the center point 441b has blades on its fore and rear edges and the rear point 441c has a blade on its rear edge .

3Textiles; Paper

referring now in more detail and by reference characters to the drawings , the hair and scalp treatment composition of the present invention is described primarily in one preferred embodiment with numerous equivalents thereof and the various possible embodiments of the invention which can be derived by using the equivalents for the ingredients in the preferred composition and the differing ranges thereof . it is desired to produce a composition which is essentially an all natural composition and even one more preferably made entirely of herbs and natural ingredients . however , it is recognized that in some cases , other ingredients which are not necessarily herbal ingredients and which are even more so not natural ingredients , may also be used . however , in accordance with the present invention , it is preferable to keep the number of synthetic ingredients to a minimum , such that the composition is largely or primarily herbal or natural . the composition of the present invention primarily starts with oils which are used as an initial liquid carrier . the oils are preferably natural oils , such as natural vegetable oils , although there could be mixtures of oils employed and which may contain some synthetic oils , as well . the preferred oils are soybean oil and olive oil . both of these oils can be used in combination . the soybean oil predominates in amount of oil present constituting over 80 % of the oil present by weight and the olive oil constitutes the significantly lesser percentage of oil , although these respective ranges can vary somewhat . when only one oil is used , it is preferred to use the soybean oil . moreover , when both oils are used , it is preferable to use at very least 70 % by weight of the soybean oil . the preferred soybean oil is one which is extracted from the seeds of the soybean plant . soybean oils of this type are normally used in the manufacturer of soaps , shampoos , and bath oils and thus have been proven to be highly effective for use in stimulating hair growth in the scalp . soybean is used also in cosmetics and other hair preparations . the olive oil has been found to be effective for fever induced illnesses , nervous tension and hypertension . moreover , it is effective for treatment of the nervous tension and hypertension and fevers . olive oil can also be used externally for abrasions . it is effective for treatment of dry skin and , even more so , for hair dandruff . olive oil is frequently in skin and hair preparations . its combination in the present invention has proven to be highly effective . the citronella oil , sometimes referred to as cymbopogen oil , contains large amounts of citral and geraniol and which are naturally lemon - scented and rose - scented , respectively . the citronella is an aromatic herb which actually has cooling properties , in that it increases perspiration and relieves spasms . to this extent , it is effective for use as a scalp treatment ingredient . moreover , the citronella oil is also known to be an effective bacterial agent in combating bacterial infections . citronella oil is also known for internal use in reducing digestive problems , particularly in children . it is also known for external use for treatment of ringworm , lice , athlete &# 39 ; s foot and scabies . the oil has actually found use in herbal bath preparations and cosmetics . however , the citronella does find very effective use as a scalp and hair treatment . the soybean oil has been known to be effective for reducing the incidents of clogged pores for many years . it is believed that the active ingredient in the soybean oil which is effective for this purpose is the lecithin . the olive oil has similarly been known to be useful for this purpose . however , it is possible to use other natural oils and , particularly , other natural vegetable oils as , for example , corn oil , almond oil , as well as oils of various other nuts . it is also possible to use other oils , such as safflower oil , of the type which is used in creams and lotions for softening the skin and in hair preparations . although , not expected , various vegetable oils and even edible vegetable oils may be used . a salad oil has been found to be beneficial when rubbed on the skin of babies and older individuals . they have also been used in cleaners , in emollient creams and hair grooming preparations . although it is possible to use animal fat oils , they are not preferred due to their high fat content . nevertheless , they are natural to the extent that they are generated in animal bodies and are usually not as disadvantageous as many of the lower alkene aromatic oils and synthetic oils . as indicated previously , the major ingredients are added to the one or more oils in a mixture some of these other ingredients are normally in a dry state and still others are in liquid state . these ingredients are preferably , although not necessarily , all natural ingredients as , for example , herbal ingredients . one of the main important ingredients added to the oil carrier is a microbicide for eliminating fungus or other microbial growth on the scalp of an individual . any efficacious microbicide which exhibits substantial antimicrobial action can be used for this purpose , and include those microbicides hereinafter described . it is understood that microbial growth which can infest the scalp is often contributory to a large number of poor hair conditions and poor scalp conditions . therefore , it is an important aspect of the present invention to eliminate these microbes which may have infested the scalp region . one of the important microbicides which can be used is that of citronella . this ingredient is a natural insect repellant and is also highly effective in destroying fungus and precluding the growth of fungus on the scalp . as indicated previously , a eucalyptus oil can be used in place of the citronella oil or in addition to the citronella oil . there are several other antibacterial agents which can be used . to some extent , some of the microbicides can function as an antibacterial agent . as indicated , citronella oil , which is an effective microbicide , is also effective as an antibacterial agent . to the same extent , quassi chips ( picrasma ) is effective for this purpose , as well as lavender and golden rt . as pointed out above , goldenseal rt is effective in various skin infections . to this extent , the goldenseal actually operates as an antibacterial agent . the same holds true of basil oil . where a combination of the citronella oil and the eucalyptus oil is employed , the citronella oil would be used in as a substantial major portion of any such mixture . thus , the citronella oil would be used in an amount of about at least 75 % by weight and , even more preferably , an amount of about 85 % by weight with respect to any other oil . some of the other microbicidal agents which can be used include that composition known as melissa , which is an herbal oil . the melissa oil contains a lemon scent but has effective antiviral activity . it is frequently used for treatment of herpes sores , gout , insect bites , and also as an insect repellant . another microbicidal agent which can be used are quassi chips , also known as “ picrasma ”, and which are derived from an ash - like tree . this tree frequently is used externally in lotions and removes parasites , such as lice . it is also used internally for convalescent debility , poor appetite and even malaria and nematodes . another microbicide which may be used is that of lavender . lavender has been used externally for burns , sunburns , skin irritations , and insect head lice . it is known to be effective in its treatment for insect head lice . it has further uses , such as in treatment of muscular pain and neuralgia . another microbicide which can be used is golden seal rt . this type of herbicidal composition has been used formerly for external treatment of eczema and various skin infections . consequently , it has been found that for use in the hair and scalp treatment it is an effective microbicide . in addition , it has been used internally for digestive disorders , peptic ulcers and excess mucus . a further microbicide which can be used both as a microbicide and as an insect repellant is basil oil . in addition , hops can be used as a microbicide . hops were initially medicinally used for insomnia any agent which is capable of operating as a microbicide can be used for this purpose . thus , for example , iodine is also effective as a microbicide . however , iodine is not preferred inasmuch as it is not necessarily one of the natural herbal ingredients . it is further desirable to use an anti - bacterial agent along with the microbicide . to some extent , the microbicides are effective antibacterial agents , and vice versa . one highly effective anti - bacterial agent which is herbal in nature is alkanet , sometimes known as alkanna tinctoria . several species of the alkanets can be used . the alkanets are effective in that they actually function as a dye but more importantly operate as anti - bacterial herbs which promotes the healing and relieves itching of the scalp , particularly when the scalp may be injured by brushes or combs . the alkanets are also an effective astringent . typically , alkanets have been used externally in the past for varicose and indolent ulcers , bed sores and itching rashes . nevertheless , it has been found to be effective in the composition of the present invention . the scalp conditioner , willow , is actually preferably used in the form of a willow - bark . it functions as an astringent cooling herb , and effectively relieves pain and has been found to reduce any inflammation . however , other scalp conditioners which are herbal in nature can also be used . rosemary is a scalp conditioner which is rich in volatile oils , various flavonoids and phenolic acids . rosemary is known to be both highly antiseptic and anti - inflammatory . it is also used effectively for dandruff control . another scalp conditioner which can be effectively used is that herb , horsetail , which is also an astringent healing herb . horsetail has been found to control both internal and external bleeding . moreover , it has been used widely in hair preparations . other scalp conditioners which can be used include yarrow , which is an aromatic astringent herb for reducing inflammation , as well as aloe vera . the aloe vera herb is used for eczema , burns , scalds and various skin problems . moreover , it has been used in cosmetics and hair preparations . in addition , birch bark , which is also an astringent tonic herb , known for reducing inflammation , is also an effective scalp conditioner . to some extent , citronella oil actually operates as a scalp conditioner , although the other herbal components mentioned above are more effective for this particular purpose . another ingredient which is important for use in the composition of the invention is a scalp conditioner , such as willow . the scalp conditioner preferably should act as a dandruff and flake control agent . any efficacious scalp conditioner which exhibits substantial scalp conditioning action , that is , improving the condition of the scalp , and including those hereinafter described , can be used in the present composition and method . it is known that the epidermal skin of the scalp will flake as a result of dryness and result in the condition known as dandruff . although several selenium compounds are known as an effective scalp conditioning agent to control dandruff , they are not necessarily benign with respect to the condition of the scalp . it is therefore preferable to employ a herbal type ingredient . the composition of the invention also includes a hair growth stimulant and , again , preferably a natural or herbal type hair growth stimulant . one of the most effective stimulants is that of bergamot , which contains a volatile oil comprising compounds relating to thymol and tannic acid . the bergamot is actually an antioxidant , but is effective as a hair growth stimulant . it has been used externally for eczema , psoriasis , and itching of the skin . it has also been found , in connection with the present invention , that it serves as an excellent hair growth stimulant . the use of bergamot has also been found to be particularly good for depression as well as aiding the body in fighting of infections . presently , it is used as a perfumery in cosmetics . bergamot has also been known to be used for internal application to treat colic in babies and is externally used in douches and baths and for treatment of vaginal infections . another hair growth stimulant which can be used is jaborandi . this herb has been effective in that it stimulates the sebaceous glands and scalp , and is responsible for an increase in hair growth . southernwood has been used in the past for frostbite , extracting splinters , sciatica pain , swelling and hair loss . in the environment of the present invention , it has been found to be an effective hair growth stimulant . nettle has been known for use in scalp and hair problems . in the present invention it encourages hair growth . the nettle herbs have a longstanding reputation for preventing hair loss , and making the hair soft and shiny . as indicated , in the environment of the present invention , it is an effective hair growth stimulant . another herbal hair growth stimulant which can be used is minoxidil . minoxidil is an unnatural medicine which is used to treat high blood pressure . actually , minoxidil is found commercially under the name “ rogaine ” for use as an anti - baldness treatment . in the present invention , it has been found to be an excellent hair growth stimulant . willow , and preferably the bark of the willow tree , is highly effective for this purpose . the willow not only conditions the scalp , but provides a natural oil to the scalp and reduces dandruff and scalp dryness . the composition of the invention preferably includes a hair manageability agent which provides some luster or shine to the hair and also improves the texture and fullness of the hair . any hair manageability agent which is efficacious in providing for the manageability of hair , including those hereinafter described , can be used in the composition and method of the present invention . one of the preferred natural ingredients which can be used for this purpose is the herb , rosemary . this herb has been found to improve the sheen and texture of the hair . it is not fully understood if the rosemary or equivalent herbs , as hereinafter described , actually penetrate the hair or merely coat the hair . nevertheless , rosemary and equivalent herbs have been found to be effective in operating as a hair manageability agent . the rosemary is particularly effective as a hair manageability agent , since it also provides a sheen to the hair after use . in addition , the rosemary is known to literally penetrate the hair or otherwise coat the hair in order to provide more body to the hair , that is , to make it fuller in at least feel . the use of rosemary after rinsing of the hair also improves the texture and fullness of the hair . some of the other natural herbal ingredients which can be used for this purpose include that herb known as irish moss . although the odor from irish moss is not as pleasant as that of rosemary , it is nevertheless an effective hair manageability agent . other equivalent hair manageability agents which can also be used include , for example , rosemary , which is also used as a scalp conditioner . to some extent , aloe vera is operative as a hair manageability agent . nettle , which is also a hair growth stimulant , is also effective as a hair manageability agent , inasmuch as it has been found to not only prevent hair loss , but also makes hair relatively soft and provides a sheen to the hair . actually , this aids in the manageability of the hair . another main ingredient in the composition of the present invention , is a hair straightening agent . actually , the hair straightening agent may or may not be effective for certain individuals . for individuals who have naturally straight hair , a straightener may not may not be required , although if that is the desired appearance , it does not hurt . for those individuals with curly hair , the hair straightening agent is effective in providing a natural means to reduce some of the straight hair appearance and provide some curl to the hair . one of the most effective hair straightening agents which can be used in the composition of the present invention , is alkanet , which is both an astringent and an antibacterial agent . alkanet is known largely as a colorant for cosmetics and has been used externally to relieve itching . however , it has shown in the present invention that it has some straightening ability , when used in hair preparations of the type taught in the instant application . another hair straightening agent which can be used is stearic acid , which is a naturally occurring substance in butter acids , tallow , cascarilla bark , and other animal fats . it is used in deodorants and antiperspirants . it is also found in liquid powders and hand creams . however , stearic acid has been found to be an effective hair straightening agent . another hair straightener which can be used is cetyl alcohol , which is an emollient and an emulsion stabilizer . it has been used in the past in many cosmetic preparations , including baby lotions and brilliantine . an additional hair straightening agent which can be used , although not necessarily an herbal component , is sodium hydroxide . actually , sodium hydroxide is an effective emulsifier in liquid face powders , soaps , shampoos , and cuticle removers . however , it does serve as an excellent hair straightening agent . finally , propylene glycol , which is used as a well known cosmetic ingredient , can also be used as a hair straightening agent . propylene glycol has also been used in liquid make - ups , creams , mascaras , and other cosmetic components . it is further used as a spray deodorant . nevertheless , it does serve as an effective hair straightener in accordance with the present invention . it is preferred to avoid the use of sodium hydroxide and propylene glycol , if possible . it would be desirable to remain with the herbal hair straightening agents . however , these others can be used in some environments . the composition of the invention also includes a mild hair coloring agent . any of a well known number of hair coloring agents can be used for providing for the color of the hair . one of the preferred natural hair coloring agents is that herb known as alkanet . in this case , alkanet also operates as a straightening agent to overcome curly hair . the alkanets mentioned above are also highly effective in that they have already been used previously to make hair dyes with natural ingredients . the alkanets provide a slightly red to red - brown color to the hair , although other coloring agents could be used for this purpose . some of the other natural hair coloring agent which may be used include , for example , some of the red dyes , such as the red dyes hereinafter described . it is also possible to use hair coloring agents as , for example , several of the red dyes , such as red dye # 2 , red dye # 5 , possibly red dye # 3 , and the like . however , as indicated previously , it is preferable to use the natural ingredients , although some minor amounts of synthetic ingredients can be tolerated in the present invention . it should also be recognized that in order to obtain colors other than red , other ingredients could be used . it is , however , preferable in selecting a coloring agent to avoid the synthetic coloring agents and , particularly , the rather harsh acting oxidizing and reducing agents normally used for bleaching and dying hair . another one of the important ingredients used in the composition of the present invention is a vitamin , such as , and even preferably , vitamin e . vitamin a also may be used in place of or in addition to the vitamin e , although the vitamin e has been found to provide the most beneficial results of all of the vitamins . vitamin e operates in a manner similar to lecithin , in that it tends to eliminate clogged pores and actually operates to open clogged pores . thus , vitamin e actually improves scalp condition . vitamin a can also be used in combination with vitamin e . vitamin a has been found to have some benefit in healing qualities . it is recognized that when brushing hair and even combing hair with implements , such as the conventional brushes and combs , that some injury , even though slight , does result to the scalp . in this case , it has been found that the combination of vitamins e and a is beneficial in reducing the effects of those injuries and in healing those injuries . beta carotene has also been found to be effective as a substitute for vitamin a or vitamin e . moreover , it can also be used in combination with vitamin a or vitamin e . when used in combination , however , it is preferable to include at least 50 % of the vitamin e . the composition of the invention may also use an anti - graying compound and which may be , for example , the herb paba . paba , for example , is frequently used as an ingredient in suntan lotions . any efficacious anti - graying compound , which presents substantial anti - graying effects , including but not limited to those hereinafter described , can be used in the composition and method of the present invention . it is , however , possible to use other anti - graying compounds , such as , for example , known equivalent compounds . it is also possible use other agents , such as panacinic acid . some of the other anti - graying agents which may be used include the natural herb nettle and sage . the herbs nettle or sage are both equally effective in the composition of the invention for serving as an anti - graying compound . the sage is an excellent ingredient inasmuch as it also helps to maintain the hair in a natural color . the use of sage has been well known at least by native americans , even prior to settling by caucasians , in order to prevent graying . if desired , one can also add a fragrance to the composition and again , preferably , a natural fragrance ingredient , such as lavender . however , other fragrances can be used , including banana , strawberry , root beer , etc . actually , each of these fragrances are naturally derived . however , other fragrances could be added if desired . inasmuch as some of the ingredients in the composition can be labile , particularly in the presence of water , it is frequently desirable to add a preservative . one of the highly effective preservatives is benzoic acid . actually , benzoin gum in herbal form is also effective for this purpose and does not present the acidity as is presented by the benzoic acid . benzoin , sometimes referred to as “ gum benjamin ”, is also known to provide astringent and expectorant properties . moreover , it is an effective herbal antiseptic . in chinese medicine , the use of benzoin is regarded as a circulatory stimulant . to this extent , it is believed that the benzoin not only acts as a preservative , but it also is effective to improve circulation on the scalp of the user . benzoin has been actually used as an anti - oxidant in cosmetics and a fixative in perfumes , creams and ointments . however , its ability to act as a circulatory stimulant is particularly effective as a hair and scalp treatment component in the present invention . nevertheless , this use provides a preservative action . some of the other preservatives which may be used include malaic acid , in the form of colorless crystals . this component has been used in the past as a preservative for fats and oils . menadrone k3 is another effective preservative agent , and has been used as a preservative in emollients . methyl paraben is a widely used preservative in cosmetics . however , it is effective in the present invention , in that it does not reduce the efficacy of the other components . it is also nonirritating , non - sensitizing , and certainly nonpoisonous . it is possible to use propylparaben . again , this component is widely used in cosmetics as a preservative . it is also an effective bactericide and fungicide . another preservative which can be used is moringa , also known as “ oleifera ”. the moringa is also a potent antibiotic . the oil has no taste , smell or color , and is exceptionally resistant to oxidation . thus , it serves as an effective preservative in the environment of the present invention . other well known herbal preservatives may also be used . the main ingredients which are generally employed in the dry state and added to the aforesaid oils include the microbicide , such as citronella , the scalp conditioner , such as willow , the hair growth stimulant , such as bergamot , the coloring agent , such as alkanet and the vitamin , such as vitamin e . the most important of the aforesaid ingredients are possibly the hair straightener , such as alkanet , the microbicide , such as citronella , the hair growth stimulant , such as bergamot , and the preservative , such as benzoin , and the latter of which actually functions more than a mere preservative , as aforesaid . one or more of these ingredients can be eliminated , however , they are all preferred in the composition of the invention . in addition , it is also desirable to use the other ingredients mentioned above . the ingredients which are added to the carrier oils , such as soybean and olive oil , are partially liquid , as described above , and include , for example , a vitamin e oil , bergamot in the form of an oil of bergamot , citronella in the form of an oil of citronella . the willow , such as white willow , the alkanet and benzoin gum are generally in a solid state . the benzoin gum is hereafter described , but for purposes of the invention , is usually introduced in this solid state . in preparing the composition of the present invention , the aforesaid dry ingredients are added to the initial carrier oil or carrier oil mixture . this mixture is allow to sit for at least several days at room temperature in order to allow the active ingredients of the dry components to be absorbed into the oil or oil mixture . it is possible to heat the oil with the solid components therein slightly to a temperature of , e . g ., 150 ° f . to some extent , this will reduce the sitting time in which the dry components are allowed to remain in the oil or oil mixture . thereafter , the oil or oil mixture with the active ingredients of the dry components which have been dissolved by the oil or oil mixture is decanted from the remaining dry components . the oils could be filtered or strained from the dry components , if necessary . the dry components are thereafter discarded and the oil is preserved for use . at this point in time , a preservative , such as a known preservative , benzoin , is then added to the oil . the oils can be heated to a temperature of about 150 ° f ., as aforesaid . moreover , heating is only necessary for a relatively short time as , for example , a period not normally exceeding about ten minutes . this heat allows the active components of the dry ingredients to be absorbed by the oil and to enable these other ingredients to also be absorbed by the oils . thereafter , the oil is stirred for several minutes . at this point , the oil is introduced into a wax or gel base which serves as the final carrier . the wax or gel base and the oils are then heated to enable the oils to be dissolved in the wax or gel base . again , heating preferably should occur below a temperature of about 200 ° f ., and then only for periods not exceeding five minutes . after the heat is removed , the product is allow to sit at room temperature to cool and thereby allow the wax or gel to harden . it is also possible to add to the product , in the wax or gel base , a hardener in order to achieve more rapid hardening , and in addition , a product which has a more hardened form . some of the hardeners which may be used include beeswax , paraffin , and palm oil . the beeswax is used in many cosmetics , such as baby creams . it is also used in hair dressings and cold creams , foundation creams , and makeup , to provide some body to the composition . paraffin is used in essentially the same manner as the beeswax . palm oil has been used in the past in baby soaps , liniments and ointments . nevertheless , the beeswax , paraffin and palm oil have operated as effective hardeners in the composition of the present invention . it should be recognized that the entire percentage of the added dry ingredients are not dissolved in the oils and , hence , it is only the active ingredients which are removed by the oils . the precise exact ingredients and the percentages that are retained by the oils are not fully understood at this point in time . however , they have been found to be effective in the final composition . when only the basic components , such as the willow , bergamot , alkanet , citronella oil and white willow are used , these components preferably exist by weight in ratios as set forth below . to the right of each component in the following table i is set forth the allowed percentage range of each individual component . this is followed by the preferred percentage range by weight and , finally , this is followed by a specific percentage based on a most preferred embodiment of the invention . table ii sets forth those same ingredients and the percentages along with the vitamins therein , but not the carrier oils . table i available preferred most preferred percentage percentage embodiment ingredient by weight by weight percentage growth stimulant 6 - 17 % 8 - 14 % 11 % ( bergamot ) microbicide 6 - 17 % 8 - 14 % 11 % ( citronella ) scalp conditioner 9 - 36 % 15 - 30 % 22 % ( white willow bark ) hair straightener 22 - 65 % 35 - 55 % 44 % ( alkanet ) preservative 6 - 17 % 8 - 14 % 11 % ( benzoin ) [ 0088 ] table ii available preferred most preferred percentage percentage embodiment ingredient by weight by weight percentage growth stimulant 5 - 16 % 7 - 13 % 10 % ( bergamot ) microbicide 5 - 15 % 7 - 13 % 10 % ( citronella ) scalp conditioner 8 - 35 % 15 - 25 % 20 % ( white willow bark ) hair straightener 20 - 60 % 30 - 50 % 40 % ( alkanet ) preservative 15 - 16 % 7 - 13 % 10 % ( benzoin ) vitamin 5 - 16 % 7 - 13 % 10 % ( vitamin e ) when each of the aforesaid active components along with the two carrier oils and the wax or gel are used , they are also present in the weight range , as hereinafter described : the important components of the composition preferably exist by weight in ratios as set forth below in table iii . to the right of each component in this following table iii is set forth the allowed percentage range of each individual component . again , followed by the preferred percentage range by weight and , finally , by a specific percentage based on a most preferred embodiment of the invention : table iii available preferred most preferred percentage percentage embodiment ingredient by weight by weight percentage growth stimulant 0 . 05 - 0 . 24 % 0 . 08 - 0 . 17 % . 128 % ( bergamot ) microbicide 0 . 05 - 0 . 24 % 0 . 08 - 0 . 17 % . 128 % ( citronella ) scalp conditioner 0 . 12 - 0 . 5 % 0 . 2 - 0 . 41 % . 256 % ( white willow bark ) hair straightener . 2 - 1 . 5 % 0 . 37 - 0 . 71 % . 512 % ( alkanet ) preservative 0 . 05 - 0 . 24 % 0 . 06 - 0 . 71 % . 128 % ( benzoin ) vitamin 0 . 05 - 0 . 24 % 0 . 08 - 0 . 17 % . 128 % ( vitamin e ) carrier oil 60 - 95 % 71 - 89 % 82 . 72 % ( soybean oil ) carrier oil 5 - 14 % 6 - 29 % 8 % ( virgin olive oil ) hardener 5 - 14 % 6 - 29 % 8 % ( beeswax ) the oils which are used as the initial carrier are preferably soybean oil and olive oil . when used as a mixture , the soybean oil should be present in a predominant amount as , for example , about 90 % by weight . however , the soybean oil can vary from about 60 % to 100 % by weight of the two oils . it is also possible to add other natural oils to the combination of soybean and olive oil , if desired , to act as a liquid carrier . the waxes which are used as the final carrier or base for the composition are again preferably insect wax , such as beeswax , or a vegetable wax . it is also possible to use non - natural waxes or otherwise synthetic waxes , such as paraffin wax . in order to form a gel composition , the gelling agent may be irish moss or seaweed which are both natural gels . however , it is possible to use a synthetic gelling agent , such as carboxymethyl cellose or hydroxy methyl cellose . one of the important aspects of the present invention , which is not necessarily apparent from a consideration of the various components , is the fact that they are generally compatible with one another . in this respect , there does not appear to be any deleterious interaction which would cause a reduction in the efficacy of any one component . in other words , one of the preferred hair straightening agents is cooperative with a scalp conditioner , for example , without reducing the effectiveness of either . although it is not known at present , if there is any synergism between the components in the composition , it is believed that some synergism does exist , in that the composition has actually been tested and has been found to perform very beneficial results , and even results superior to those which might have been anticipated . in addition , and probably one of the more important aspects , is that this hair treatment composition is made essentially with all natural ingredients , and preferably , all herbal ingredients . heretofore , no such composition of this type has existed . the invention is further illustrated by , but not limited to , the following example : approximately 83 ounces of soybean oil was mixed with approximately 8 ounces of olive oil to create an initial liquid carrier . the two oils were completely miscible with one another . separately from the preparation of the oils , approximately 0 . 13 ounces of citronella was mixed with approximately 2 . 56 ounces of white willow and approximately . 13 ounces of bergamot , as well as 13 ounces of vitamin e . in addition , approximately 0 . 512 ounces of alkanet was mixed with the other ingredients . the mixture of active ingredients was then introduced into the mixture of soybean oil and olive oil and allowed to sit for approximately seventy - two hours at room temperature . thereafter , the mixture of oils was decanted and preserved and the remaining dry ingredients were then discarded . the oil mixture was then introduced into a vessel containing beeswax which was then heated causing a melting of the beeswax . the oils within a few minutes dissolved within the beeswax after heating to a temperature of about 200 ° f . the wax was then allowed to cool with the oils completely entrained therein . in the preparation of the final composition with the wax base , approximately 8 ounces of wax was used to hold the oils and the other active ingredients . testing of the composition found that the composition did tend to stimulate hair growth and did remove incidents of dandruff . it was also found that the composition freed the scalp from any microbial growth , such as fungal growth , for a substantial period of time . thus , there has been illustrated and described a unique and novel hair and scalp treatment composition and which thereby fulfills all of the objects and advantages which have been sought . it should be understood that many changes , modifications , variations and other uses and applications which will become apparent to those skilled in the art after considering the specification and the accompanying drawings . therefore , any and all such changes , modifications , variations and other uses and applications which do not depart from the spirit and scope of the invention are deemed to be covered by the invention .

0Human Necessities

studies were carried out to investigate whether the pt content of conventional wetproofed isotope exchange catalyst could be reduced or eliminated by promoting the catalytic properties of pt with other additive metals or replacing the pt with other less costly metals . a number of pt - based bimetallic formulations were tested . the percentage loading of each metal was varied in the test samples to investigate the effects of the actual amount and the ratio of the different metals on the substrate . the catalyst samples were subjected to different tests to determine the activities of the catalysts . the conditions of testing ranged in temperature and pressure under vapour - phase or trickle - bed mode . unless otherwise stated , carbon black was used as the substrate for all catalysts . teflon ® 30 suspension from e . i . du pont de nemours was used for wetproofing the catalyst . with a number of exceptions , all catalyst powders comprising pt were prepared using a standard method of precipitation of pt using sodium platinum sulfite as generally described in u . s . pat . no . 4 , 082 , 699 petrow et al . ( the contents of which are incorporated herein by reference ). platinum oxide was precipitated onto the powder support by reacting na 6 pt ( so 3 ) 4 prepared from chloroplatinic acid as described in u . s . pat . no . 4 , 082 , 699 , with hydrogen peroxide and then the platinum oxide was reduced to platinum metal . most of the bimetallic catalyst powders were prepared using variations of the standard precipitation procedure . the standard precipitation procedure was used to make catalyst powders with pt as the sole metal component . the bimetallic precipitation procedure is similar to the standard precipitation procedure with the only difference being the addition and dissolution of an additional metal salt ( s ) to the platinum solution and the use of extra hydrogen peroxide . pt — cr catalysts were prepared in the same manner as the standard method for pt with co - precipitation of sodium platinum sulfite ( na 6 pt ( so 3 ) 4 ) and chromium ( iii ) nitrate ( cr ( no 3 ) 3 . for pt — ti catalysts , ticl 4 was substituted for cr ( no 3 ) 3 . the catalysts for testing were prepared by loading onto a carrier such as a stainless screen with teflon ® 30 suspension from e . i . du pont de nemours in the manner as described in u . s . pat . no . 4 , 143 , 123 , the contents of which are incorporated herein by reference . all of the catalyst powders were sprayed with teflon ® in a 1 : 1 ratio onto stainless steel screens . for vapour - phase testing , catalyst powders were sprayed onto a single 100 - mm wide by 320 - mm long piece of screen . all of the catalysts for trickle bed k y a tests were sprayed onto 250 - mm wide by 900 - mm long pieces . process for making a 5 % pt + 2 % ti on carbon xc - 72r catalyst a small batch of the bimetallic catalyst was prepared from 25 g of xc - 72r carbon . about 4 . 6 g of na 6 pt ( so 3 ) 4 and 2 . 1 g of ticl 4 using the procedure outlined in u . s . pat . no . 4 , 082 , 699 . this catalyst powder was then mixed with teflon ® 30 in a 1 : 1 ratio and coated onto a 28 mesh stainless steel screen with 0 . 0075 - inch wire diameter in the manner described in u . s . pat . no . 4 , 143 , 123 . process for making a 5 % pt + 2 % cr on carbon xc - 72r catalyst a small batch of catalyst powder was prepared from 25 g of xc - 72r carbon , about 4 . 7 g of na 6 pt ( so 3 ) 4 , and about 10 . 7 g of chromium nitrate nanohydrate , cr ( no 3 ) 3 . 9h 2 o , using the procedure outlined in u . s . pat . no . 4 , 082 , 699 . this catalyst powder was mixed with teflon ® 30 in a 1 : 1 ratio and coated onto a 28 mesh stainless steel screen with 0 . 0075 - inch wire diameter in the manner described in u . s . pat . no . 4 , 143 , 123 . a number of the catalyst test samples [ 5 % pt + 2 % au , 7 % pt + 3 % pd and 5 % ni + 5 % pt on xc - 72r ] used for comparison purposes were prepared by conventional co - impregnation methods rather than co - precipitation . most of the ni catalysts with or without cr were prepared using nicl 2 or ni ( no 3 ) 2 and cr ( no 3 ) 3 by precipitating with sodium carbonate on different supports such as carbon or silicalite . exceptions were 5 % ni on carbon ( by impregnation ), 15 % ni + 0 . 1 % pd on xc - 72r ( by chemical deposition ), 8 % ni + 2 % cr + 0 . 1 % pd on xc - 72r ( by sequential precipitation in the order : co - precipitation of ni + cr then precipitation of pd ). a number of different test facilities were used to determine the activities of the catalysts prepared in this work . the conditions of testing ranged in temperature and pressure under vapour - phase ( h 2 / h 2 o vapour ) or trickle - bed mode ( h 2 / h 2 o vapour / h 2 o liquid ). this is a vapour phase reactor system with internal gas circulation to reduce external mass - transfer resistance . catalysts were tested at a constant pressure of 2000 kpa ( abs ) and at temperatures ranging from 68 to 155 ° c . the relative humidity was raised to a maximum value of 84 % while the vapour content was increased to a maximum of 9 . 0 %. the actual weight of the catalyst screen was maintained at about 0 . 65 g . table 1 reports the catalytic activities for pt catalysts promoted by either cr or ti . in table 1 ( and table 2 below ) the results for a base catalyst comprising 10 % pt on vulcan xc - 72 ™ carbon black are presented for comparison purposes . the catalytic rate constants in table 1 are given in the units of mol d · s − 1 · m − 3 , where the volume corresponds to the catalyst module structural volume . hence , comparison of the performance of the different catalysts can be carried out in a straightforward way by comparing these activities and the metal loadings . for example , if a catalyst made with 5 % pt and a certain loading of another metal shows similar activity to the base catalyst , then 50 % savings in the pt cost is achieved with the new catalyst , assuming that the cost of the other metal is negligible ( which is generally the case ). as seen from table 1 , compared with the base 10 % pt on xc - 72r catalyst , the bimetallic catalysts ( pt in combination with ti or cr on xc - 72r ) had similar or higher activities at most conditions . since , all the bimetallic catalysts in table 1 had lower than 10 % pt , their pt content in a unit volume of bed will be correspondingly lower . for example , the 2 % pt + 5 % ti catalyst has only approximately 0 . 24 kg · m − 3 of pt compared to the 10 % pt catalyst with say 1 . 2 kg · m − 3 of pt — a considerable saving in the cost of pt . for a given loading of pt , generally , the pt — ti catalysts appear to be more active than pt — cr catalysts as seen with 8 % pt + 2 % ti versus 8 % pt + 2 % cr and 5 % pt + 5 % ti versus 5 % pt + 5 % cr . apart from the cost - savings , the improved wetproofed catalysts experienced a significant increase to their activities as compared with the base 10 % pt catalyst at high temperatures . for example , the catalyst with 8 % pt + 2 % ti on xc - 72r is as active as the base catalyst at 68 ° c . and 62 ° c . for reactor and condenser outlet temperatures , respectively . however , at 105 ° c . and 100 ° c . for reactor and condenser outlet temperatures , respectively , the pt — ti catalyst had an activity significantly greater than that of the base catalyst . the catalyst containing 2 % pt - 5 % ti on xc - 72 also had a similar effect . though the results at 105 ° c . reactor temperature show that the bimetallic catalysts may be somewhat more strongly dependent on relative humidity or vapour content compared to the base catalyst , the results at 155 ° c . reactor temperature do not confirm this observation . during the testing of these catalysts , it was noticed that the bimetallic catalysts took considerably longer period to steady out , during which time the activity of the catalyst continued to increase . the base catalyst , on the other hand , showed an increase first followed by a somewhat steady activity and then a slow decrease . in these tests it was also noticed that the bimetallic catalysts appeared to show a prolonged activity increase with time - on - stream at higher relative humidities . this was assumed to be indicative of a strong dependence of activity on the relative humidity . such dependence is considered to be advantageous in the trickle - bed environment of isotope exchange application . table 2 contains the results for catalytic activities of pt catalysts promoted by zr or v for purposes of comparison . as can be seen from table 2 , neither zr nor v showed any obvious promoting effects at the conditions of the tests in the reactor . a significant reduction in activity occurred when these metals were present with pt in the catalyst compared to the base catalyst . a comparison of the results for catalysts in table 2 with those in table 1 containing similar loadings of pt shows that zr and v were inferior to cr or ti as catalyst promoters . the test results for various compositions are reported in table 3 . as can be seen from the results in table 3 , none of the ni containing catalysts showed any significant activity in the high pressure / high temperature vapour - phase reactor tests . even the tests at a relatively high temperature of 200 ° c . did not activate the ni to yield a desirable activity . this is a nominally 50 - mm diameter trickle - bed reactor test facility operated at ambient pressure and temperatures up to 80 ° c . typical long term test results are shown in fig1 for 5 % pt and 5 % pt + 2 % ti catalysts at 80 ° c . and 118 kpa ( abs ). the tests were done at a water flux of 100 mol · m − 2 · s − 1 and hydrogen flux of 50 mol · m − 2 s − 1 . a few sets of σk y a values are given in table 4 for discussion in conjunction with the results presented in fig1 . as can be seen from table 4 , on increasing the test temperature from 25 to 80 ° c ., the activity increased more steeply for the bimetallic pt — cr and pt — ti catalysts compared to the base pt catalyst . though more data is required for a complete understanding of the temperature effect on activity for these catalysts , it may be generalized from the results shown in table 4 that the bimetallic catalysts show a somewhat stronger dependence on temperature compared to the base pt catalyst . the test results shown in fig1 provide some indications that there may be some differences in the deactivation profiles of ti catalysts compared with the base pt catalyst over the test period . while the base catalyst continued to deactivate gradually over the one month period , the bimetallic catalyst steadied out within this period . at the end of the tests , the bimetallic catalyst had an activity of about 830 mol · m − 3 · s − 1 while the base catalyst had a lower activity of 630 mol · m − 3 · s − 1 , revealing superior performance achieved by adding the secondary metal . nominally 100 - mm diameter by 250 - mm long catalyst modules were tested at temperatures up to 150 ° c . and pressures up to 2500 kpa ( g ) in this facility . the results obtained on the 8 % pt + 2 % cr and 5 % pt + 5 % cr catalysts were compared with the base catalyst . each catalyst module tested was 100 - mm diameter by 250 - mm long , consisting of a catalyst layer thickness approximately equivalent to the base catalyst loading of 1 . 2 g · l − 1 . this , for example , would translate into a pt loading of 0 . 6 g · l − 1 ; for the 5 % pt + 5 % cr catalyst . the tests results showed that the pt — cr catalysts performed well . in general , at temperatures in the range of about 50 to 150 ° c ., the activity of the catalysts matched the performance of the base catalyst . this is surprising since the bimetallic catalysts contained less pt in the module than the base catalyst . this is especially surprising of the 5 % pt + 5 % cr catalyst which contained only half the pt loading normally present in the base catalyst . the 8 % pt + 2 % cr containing bimetallic catalyst had about 1 . 0 g · l − 1 of pt . the 8 % pt + 2 % cr and 5 % pt + 5 % cr catalysts also did not show any appreciable deactivation over a 30 day period of testing and in fact showed some modest increase in activity over the test period . moreover , these bimetallic catalysts appeared to show more stable activity than the base catalyst . as is evident from the above test results , given the cost reduction realized through the substitution of platinum with an inexpensive alternative , the bimetallic catalysts , pt — cr and pt — ti , are an improvement over the base 10 % pt catalyst at temperatures greater than 60 ° c . and at ambient and higher pressures . the amount of platinum can be varied depending on the activity / cost / stability considerations . catalysts having less than 10 % pt by weight based on the total weight of the support and the deposited metals will show cost improvements over base 10 % pt catalyst . catalysts can also be prepared in accordance with the present invention having a base 10 % pt loading with a cr or ti promoter to improve performance or stability as compared to the monometallic catalyst . catalysts in accordance with the present invention can advantageously have platinum in an amount of from about 2 % to about 8 % and the amount of cr or ti from about 1 % to 5 % by weight based on the total weight of the support and the deposited metals and can advantageously have a weight ratio of platinum to cr or ti in the range of 5 : 1 to 2 : 5 . the combined amount of platinum and cr or ti can advantageously be about 10 % by weight based on the total weight of the support and deposited metals . although the above tests used carbon black as the catalyst support , the invention is not so limited and suitable supports other than carbon black may be used . while the catalysts in accordance with the present invention are particularly suitable for use in heavy water production , they can also be used in other hydrogen isotope exchange processes including heavy water upgrading and detritiation applications . thus , the catalysts in accordance with the present invention can be used for the separation of tritium from hydrogen or deuterium . other modifications can also be made without departing from the scope of the invention .

1Performing Operations; Transporting

embodiments of the disclosure relate generally to the field of disease recognition in the heart . for example , embodiments of the disclosure relate to systems and methods for exploiting spatio - temporal information for view recognition and disease recognition in cardiac echo videos . the inventors of the present invention have published an article entitled “ exploiting spatio - temporal information for view recognition in cardiac echo videos ,” and published by the ieee computer society , 2001 l street , nw . suite 700 , washington , d . c . 20036 - 4910 usa , on jun . 27 , 2008 , which is incorporated by reference into this application as if set forth fully herein . two of the inventors also published an article entitled “ cardiac disease recognition in echocardiograms using spatio - temporal statistical models ,” published by ieee engineering in medicine and biology society , 445 hoes lane , piscataway , n . j . 08854 - 4141 usa , on aug . 23 , 2008 , which is incorporated by reference into this application as if fully set forth herein . throughout the description , for the purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the present disclosure . it will be apparent , however , to one skilled in the art that the present disclosure may be practiced without some of these specific details . fig1 is illustrates different cardiac echo view points used in an echo cardiographic examination . an echographic exam involves scanning a heart from four standard transducer positions , namely , parasternal , apical , subcostal and suprasternal . for each transducer position , the transducer is rotated and oriented to obtain multiple tomographic images of the heart along its long and short axes . of the viewpoints generated by standard transducer positions , the most common are the apical 4 - chamber 110 , the parasternal long axis 120 , the parasternal short axis 130 and the apical 2 - chamber 140 . tomographic imaging from the four standard transducer positions shows different combinations of anatomical regions of the heart , as illustrated in fig1 . because different regions of the heart may be diseased without potentially affecting other regions , it is desirable to image the different regions of the heart . for example , apical 4 - chamber view 110 illustrates the left ventricle , left atrium , right ventricle , right atrium , septal wall , the mitral and tricuspid valves and can also be used to study left ventricle hypertrophy . as seen in fig2 a and 2b , there can be significant variation in the appearance of the heart for a given transducer position . this may be caused by anatomical differences between diseased and normal hearts as well as possibly due to a variety of other factors such as the variability between patients , instruments , operator experience or imaging modalities . images 210 and 220 show a four - chambered view of two different hearts . image 210 illustrates a patient with hypertrophy , while image 220 illustrates excessive enlargement of the left ventricle . images 230 , 240 and 250 show three different echocardiograph frames where 230 and 240 are 2 - chamber viewpoints and the 250 is a short - axis viewpoint of the same heart . thus , the echocardiograph of the same heart can generate very different images depending on the transducer position and image . the effect of zoom and pan can also make the determination of viewpoint difficult . images 260 and 270 illustrate this , where 270 is a zoomed in version of the region depicted in 260 . the determination of viewpoint becomes even more challenging for real - time recordings , as it must distinguish standard viewpoints from transitional ones when the transducer is being moved before settling in a new position . image 290 shows a transitional view that is from a continuous recording with before and after views shown in 280 and 295 , repsectively . image 290 must be classified as a spurious view . fig2 c shows a preferred embodiment of how visual appearance is represented by our modeling approach . each image of a heart is represented by a shape vector s obtained by concatenating the ( x , y ) locations of n feature points f 1 , f 2 , . . . f n as seen in 210 c and in equation ( 1 ). the shape vectors s are geometrically normalized by a similarity transform γ sim that factors out variation in rotation , scale , and position . the final shape vectors are represented in a normalized space 220 c . for instance , procrustes analysis using two anchor points can be used for this normalization step . thus , the full description of shape includes the vector s as well as a similarity transform fs that positions the shape in the image through a rotation , scale , and a translation . s =[ x 1 , y 1 , . . . , x n , y n ] t [ equation 1 ] given an image with n features , the texture vector t concatenates the pixels from a set of patches centered on the feature points into a long vector , where patch size is matched to the pixel spacing between features . just as the shape vectors are normalized for geometry , the texture vector t raw is similarly normalized for echo gain and offset by subtracting the mean and dividing by standard deviation as seen in equation ( 2 ). since cardiac motion is a useful feature for cardiac analysis , we would also like to create a canonical representation of motion . considering a cardiac cycle with m frames will produce m sets of feature points { s 1 , s 2 , . . . , s m }, where each s is a column vector of stacked shape ( x , y ) feature coordinates , as shown in 230 c . to create a canonical representation , the motion of the cardiac cycle is vectorized by normalizing for image plane geometry and standardizing the time axis to a target length n . align the first frame s 1 to a canonical position using a similarity transform γ 1 sim . to standardize the remaining frames i , 2 ≦ i ≦ m , apply the same similarity transform to standardize the frames , as shown in equation 3 to standardize the sequence length from input length m to a target length n , interpolate the s i &# 39 ; s in time using piecewise linear interpolation . next , to decouple shape from our motion representation , we factor out shape by subtracting out frame 1 , creating our final motion vector m shown in equation 4 . in what follows , the shape , texture , and motion vectors are used to represent images both in model training and model fitting steps . in the model training step , a user trains the model representation by hand annotating the shape in all the training images . in contrast , the model fitting stage automatically fits a model of shape and texture to an input sequence to analyze . fig3 a is a block diagram illustrating an example method for training a spatiotemporal model of a heart 300 . this may also be referred to as training stage block diagram 300 . in one embodiment beginning at 310 , a user first prepares a set of training data by annotating the ( x , y ) positions of feature points in the images , usually taken to sample along the contours of the heart walls and valves . in 320 , the user builds an active shape model ( asm ), a spatial and textural model of heart appearance , for a known transducer viewpoint from the annotated training data . to construct the asm model , the dimensional of the spatial and textural vector is reduced using pca to find a small set of eignshapes and eigentextures . the shape s and the texture t can be linearly modeled to form the active shape model as seen in equation ( 5 ). the p - dimensional vector a and the q - dimensional vector b are the low dimensional vector representations of shape and texture . proceeding to 330 - 350 , a motion model is generated for a transducer viewpoint class by tracking the viewpoint &# 39 ; s asm within the training set of annotated echo sequences and modeling the resulting tracks with a linear generative motion model . in block 330 , the asm model built in block 320 is used to densely track the asm feature points throughout the entire training data , which is necessary since the manual annotation step in block 310 only requires a fraction of the training set to be hand - annotated . in block 340 the asm tracks are vectorized into motion vectors by normalizing for heart rate period and the positioning of the heart in the image . block 350 applies a dimensionality reduction procedure to the training motion vectors , modeling them with a low - dimensional linear model , as shown in equation 6 . the r - dimensional vector c is the low dimensional vector representations of motion , and the columns of matrix m are a set of r “ eigenmotions ” that form a low - dimensional basis for the cardiac motions seen in the training set . the final output of the training procedure 300 is a viewpoint - specific asm model and motion model . fig3 b shows an algorithm for the method for training spatio - temporal models of the heart from training sequences seen in the block diagram shown in fig3 a . fig4 a shows how the asm and motion models from block diagram 300 can be fit to a new image sequence to extract heart shape and motion . this may be referred to as the fitting stage block diagram 400 in block 410 , the asm model is fit to the first frame in the image sequence , image i 1 . since there is no prior information of the overall heart location in the image , this step is preceded by a segmentation step that locates the heart chambers . given the initial asm fit from i 1 , block 420 tracks the feature locations frame by frame through the remainder of the sequence using the asm model . fitting an asm to a new sequence involves finding a similarity transform γ sim to position the model appropriately and recovering the shape and text vectors a and b . this is iteratively estimated by alternating between shape and texture update steps . to evaluate an asm fit at a given position , error of fit is measured in shape and texture space using mahalanobis distance and the normalized reconstruction error . for image i , this can be seen in equation ( 7 ). fit ( a , b , γphu sim )= a t σ shp − 1 a + b t σ tex − 1 b + 2 r 2 / λ tex q + 1 [ equation 7 ] where r =∥ t − tt t t ∥, t = l ( γ sim ( x , y )). λ tex q + 1 is the ( q + 1 ) th texture eigenvalue , and σ shp and σ tex are diagonal matrices with pca eigenvalues . the overall motion of the asm tracks from block 420 is analyzed in blocks 430 - 440 . in block 430 , the asm feature tracks are vectorized into a motion vector m , as in stage 340 , normalizing for heart rate period and a global positioning transform . proceeding to 440 , the motion vector is projected into an eigen - motion feature space of a transducer viewpoint class , as shown in equation ( 8 ). proceeding to 450 , the matching algorithm estimates a measure of a sequence fit for each cardiac view , wherein the sequence fit is an average appearance fit over the cardiac cycle plus a mahalanobis distance and reconstruction error , as shown in equation ( 9 ). where the function “ fit ” is defined in equation ( 7 ), r mot =∥ m − mm t m ∥, λ mot r + 1 is the ( r + 1 ) th texture eigenvalue , and σ mpt is a diagonal ( r × r ) matrix of eigenvalues corresponding to e 1 m , e 2 m ,. . . . , e r m . the mahalanobis term is a weighted distance from the pca projection of m to the mean motion m ( but within the pca model space ). the reconstruction term measures the distance from m to the pca projection of m , and it tells how well the model explains the data . fig4 b shows an algorithm for fitting steps of the spatio - temporal models to a new echo sequence seen in the block diagram shown in fig4 a . fig5 a is a block diagram 500 of a method for recognizing cardiac viewpoint in echo sequences , divided into a model building stage 500 a and a runtime recognition stage 500 b . the model building stage 500 a iterates over all the viewpoints and builds a viewpoint - specific asm and motion model for each viewpoint . the inputs for a 500 a are a set of viewpoints v , l ≦ v ≦ v , and a set of training sequences . in block 510 , the iteration variable v is initialized to 1 since this is the initial viewpoint . proceeding to block 520 , asm and motion models are built for viewpoint v from the training data specific for that viewpoint . this is implemented as a procedure call to the training block 300 in fig3 . after the asm and motion models for view v = l are completed , we move to the next viewpoint in block 530 by increasing v by 1 . in decision block 540 , the algorithm determines if the all available views v have been considered . if v is less than or equal to v , blocks 520 - 530 are repeated . if v is greater than v , model building stage 500 a is completed . view recognition stage 500 b recognizes cardiac viewpoint v in input sequence i using the viewpoint - specific asm and motion models generated by stage 500 a . as in stage 500 a , the view recognition algorithm iterates over the viewpoints v , and it returns the viewpoint with the best model fit . in block 550 , the iteration variable v is initialized to 1 since this is the initial viewpoint . proceeding to block 560 , the viewpoint fit , fit ( v ) ( see equation 9 ), is computed by fitting the asm and motion models for viewpoint v to input sequence i . block 560 is implemented as a procedure call to the fitting block 400 in fig4 . after the model fitting is completed , we move to the next viewpoint in block 570 by increasing v by 1 . in decision block 580 , the algorithm determines if the all available views v have been considered . if v is less than or equal to v , blocks 560 - 570 are repeated . if v is greater than v , we proceed to block 590 , where the view v that minimizes fit ( v ) is returned as the recognized view . fig5 b shows the algorithm for recognizing cardiac viewpoint shown in the block diagram of fig5 a . fig6 a and 6b show a block diagram of disease recognition 600 , which includes a model building portion 600 a in fig6 a and a disease recognition portion 600 b in fig6 b . the model building portion 600 a in fig6 a builds models for a set of diseases , where the disease models are , in turn , broken down into a collection of viewpoint - specific asm and motion models . the inputs for 600 a include a set of training sequences , viewpoints v , l ≦ v ≦ v , and diseases d , l ≦ d ≦ d . block diagram 600 a mostly consists of flow control over two nested loops , the outer loop over diseases d and an inner loop over viewpoints v . block 605 begins with the first disease , d = l , and block 610 begins with the first viewpoint , v = l . block 615 creates an asm and motion model for disease d and viewpoint v , using the training data for d and v . after model building and proceeding to block 620 , v is increased by 1 . in decision block 625 , the algorithm determines if the all available views v have been modeled . if v is less than or equal to v , blocks 615 - 620 are repeated to model an additional viewpoint . when v is greater than v , the disease model for a particular disease , d , is the union of asm ( d , v ) and motionmodel ( d , v ) over all the viewpoints v , as shown in block 630 . for example , a disease model for an enlarged heart would contain appearance - based asm models that all generate enlarged chambers in all the viewpoints . it should be noted that the disease model also creates a “ normal ” model such that a healthy heart is part of the models included in this process . thus , the process can recognize a healthy heart , rather than attempting to associate a heart disease with a healthy heart . block 635 shows the algorithm proceeding to the next disease and block 640 shows a decision block that tests for additional diseases to model by comparing d with d . if d is less than or equal to d , the process repeats blocks 610 - 635 to model an additional disease . if d is greater than d , the model building stage 600 a completes . fig6 b is the disease recognition portion 600 b of block diagram 600 and shows blocks 645 , 650 , 655 , 660 , 665 , 670 , 675 , 680 and 685 . the input to disease recognition is an input sequence ito classify , the disease models generated in 600 a , viewpoints v , l ≦ v ≦ v , and diseases d , l ≦ d ≦ d . similar to the model building portion 600 a , disease recognition 600 b consists of two nested loops , the outer loop over diseases d and an inner loop over viewpoints v . block 645 begins with the first disease , d = l , and block 650 begins with the first viewpoint , v = l . block 655 fits the input sequence i to asm and motion models for disease d and viewpoint v , which may be described by the algorithm in fig4 and equation 9 , described above . block 660 increments v by 1 , moving to the next viewpoint . decision block 665 shows that if v is less than or equal to v , the process is returned to block 655 . if v is greater than v , the algorithm proceeds to block 670 , where the overall disease fit , fit ( d ), is taken as the average fit ( d , v ) over all views v . block 675 moves to analyze the input i with the next disease , incrementing d by one . decision block 680 processes the next disease by returning to block 650 if d is less than or equal to d . if d is greater than d , then we proceed to block 685 . block 685 shows that the disease recognized by the algorithm is the disease that minimizes fit ( d ). fig6 c shows the model building and disease recognition algorithms that correspond to block diagrams 600 a and 600 b . thus , at block 685 , the algorithm has recognized the heart disease most present in the patient in input sequence i . as discussed above , the null hypothesis is that the patient does not have a disease , wherein a normal class is also modeled . the diagnostic viewpoints of the normal class are taken as the union of viewpoints from all of the disease classes . fig7 illustrates an example computer architecture for implementing the methods and flows as described in fig3 - 6 . the exemplary computing system of fig7 includes : 1 ) one or more processors 701 ; 2 ) a memory control hub ( mch ) 702 ; 3 ) a system memory 703 ( of which different types exist such as ddr ram , edo ram , etc ,); 4 ) a cache 704 ; 5 ) an i / o control hub ( ich ) 705 ; 6 ) a graphics processor 706 ; 7 ) a display / screen 707 ( of which different types exist such as cathode ray tube ( crt ), thin film transistor ( tft ), liquid crystal display ( lcd ), dpl , etc . ); and / or 8 ) one or more i / o devices 708 . the one or more processors 701 execute instructions in order to perform whatever software routines the computing system implements . the instructions frequently involve some sort of operation performed upon data . both data and instructions are stored in system memory 703 and cache 704 . cache 704 is typically designed to have shorter latency times than system memory 703 . for example , cache 704 might be integrated onto the same silicon chip ( s ) as the processor ( s ) and / or constructed with faster sram cells whilst system memory 703 might be constructed with slower dram cells . by tending to store more frequently used instructions and data in the cache 704 as opposed to the system memory 703 , the overall performance efficiency of the computing system improves . system memory 703 is deliberately made available to other components within the computing system . for example , the data received from various interfaces to the computing system ( e . g ., keyboard and mouse , printer port , lan port , modem port , etc .) or retrieved from an internal storage element of the computing system ( e . g ., hard disk drive ) are often temporarily queued into system memory 703 prior to their being operated upon by the one or more processor ( s ) 701 in the implementation of a software program . similarly , data that a software program determines should be sent from the computing system to an outside entity through one of the computing system interfaces , or stored into an internal storage element , is often temporarily queued in system memory 703 prior to its being transmitted or stored . the ich 705 is responsible for ensuring that such data is properly passed between the system memory 703 and its appropriate corresponding computing system interface ( and internal storage device if the computing system is so designed ). the mch 702 is responsible for managing the various contending requests for system memory 703 access amongst the processor ( s ) 701 , interfaces and internal storage elements that may proximately arise in time with respect to one another . one or more i / o devices 708 are also implemented in a typical computing system . i / o devices generally are responsible for transferring data to and / or from the computing system ( e . g ., a networking adapter ); or , for large - scale non - volatile storage within the computing system ( e . g ., hard disk drive ). ich 705 has bi - directional point - to - point links between itself and the observed i / o devices 708 . referring back to fig3 - 6 , portions of the different embodiments of the described methods and flows may be embodied in software , hardware , firmware , or any combination thereof . any software may be software programs available to the public or special or general - purpose processors running proprietary or public software . the software may also be a specialized program written specifically for signature creation and organization and recompilation management . for the exemplary methods illustrated in fig3 - 6 , embodiments of the invention may include the various processes as set forth above . the processes may be embodied in machine - executable instructions that cause a general - purpose or special - purpose processor to perform certain steps . alternatively , these processes may be performed by specific hardware components that contain hardwired logic for performing the processes , or by any combination of programmed computer components and custom hardware components . embodiments of the invention do not require all of the various processes presented , and it may be conceived by one skilled in the art as to how to practice the embodiments of the invention without specific processes presented or with extra processes not presented . for example , while it is described that a user may perform portions of the methods , those portions alternatively or in conjunction may be performed by an automated or computer process . in another embodiment , the models may be provided as previously generated . the foregoing description of the embodiments of the invention has been presented only for the purpose of illustration and description and is not intended to be exhaustive or to limit the invention to the precise forms disclosed . numerous modifications and adaptations are apparent to those skilled in the art without departing from the spirit and scope of the invention .

0Human Necessities

embodiments are described with reference to the figures in which like reference numbers indicate identical or functionally similar elements . also in the figures , the left most digits of each reference number corresponds to the figure in which the reference number is first used . as illustrated in fig1 - 2 , the embodiments described herein are directed to a second row seat system 112 for a motor vehicle 100 . in the embodiments illustrated in the fig1 - 2 , the motor vehicle 100 is a minivan , although any other type of vehicle with removable seats 114 may include embodiments of the second row seat system 112 . as illustrated in fig1 - 2 , the motor vehicle 100 has a floor 116 that is supported by a body 118 . as also shown , there is a front row of seats 120 . shown in fig1 are two individual seats 122 , 124 , with a folding tray 126 that may lower to the side of the passenger seat 124 to create a walkway to the rear of the motor vehicle 100 . the bases 200 of the two front seats 122 , 124 are fixedly secured the floor 116 of the motor vehicle 100 . the seat bases 200 and cushions 202 of each of each of the front seats 122 , 124 may be raised and lowered in a vertical direction between a maximum and minimum height , moved forward and rearward longitudinally between a maximum forward and maximum rearward position , and the seatback 204 may be reclined between an upright position to a fully reclined position in manners known to those skilled in the art . for example , these movements may be accomplished mechanically by the seat operator as known in the art , or through actuation of a power switch 206 known in the art . located behind the front row of seats 120 is the second row seat system 112 . in the embodiment illustrated in fig1 , the second row seat system 112 includes a left seat 130 , a middle seat 132 , and a right seat 134 . each of the three seats 130 , 132 , 134 is removable from the motor vehicle 100 , as will be discussed . when the middle seat is removed 132 , the left seat 130 and right seat 134 are additionally slidable laterally as discussed herein . the left and right seats 130 , 134 are supported on a front rail system 300 and a rear rail system 302 that extend laterally across the floor 116 between the left side 136 of motor vehicle 100 and the right side 138 of the motor vehicle 100 that are illustrated in fig3 . the front rail system 300 includes a front lower rail 304 mounted laterally across the motor vehicle 100 within and spanning the entire width of the floor 116 . the front lower rail 304 is generally u - shaped , with the ends 400 , 402 folded inwardly and then downwardly , creating a u - shaped cross sectional profile with a generally open center portion 404 and two substantially , but not completely closed upper portions 406 , 408 . the front rail system 300 further includes two front upper rails 306 , 308 that are nested within the portions of the front lower rail 304 . each of the front upper rails 306 , 308 have a lower portion 410 that has a cross section that is generally uu - shaped , with the inner ends 412 , 414 of the uu - cross section being connected , and the outer ends 416 , 418 of the uu - cross section being nested through the openings 420 , 422 and in the upper portions 406 , 408 of the front lower rail 304 . rollers 424 , 426 are connected to the outer ends 416 , 418 of each of the front upper rails 306 , 308 . the rollers 424 , 426 are positioned to engage the closed upper portions 406 , 408 of the front lower rail 304 . the rollers 424 , 426 are oriented in a lateral direction to enable each of the front upper rails 306 , 308 to slide laterally within the front lower rail 304 . the inner ends 412 , 414 of the uu - cross section of each front upper rail 306 , 308 extend upwardly beyond the height of the outer ends 416 , 418 of the uu - cross section . the inner ends 412 , 414 are either connected to or formed integrally with each other . further , the inner ends 412 , 414 are either connected to or formed integrally with an upper portion 310 , 312 of each of the front upper rails 306 , 308 . connections may be made by known methods , including , but not limited to , welding , mechanical connections such as rivets , or any other method known to one skilled in the art . the rear rail system 302 includes a rear lower rail 314 mounted laterally across the motor vehicle 100 , spanning the entire width of the floor 116 . the rear lower rail 314 is generally u - shaped , with the ends 430 , 432 folded inwardly and then downwardly , creating a u - shaped cross sectional profile with a generally open center portion 434 and two substantially , but not completely closed upper portions 436 , 438 . the rear rail system 302 further includes two rear upper rails 316 , 318 that are nested within the portions 436 , 438 of the rear lower rail 314 . each of the rear upper rails 316 , 318 are have a generally uu - shaped cross section , with the inner ends 442 , 444 of the uu - cross section being connected , and the outer ends 446 , 448 of the uu - cross section being nested through the openings 450 , 452 and in the upper portions 436 , 438 of the rear lower rail 314 . rollers 454 , 456 are connected to the outer ends 446 , 448 of each of the rear upper rails 316 , 318 . the rollers 454 , 456 are positioned to engage the closed upper portions 436 , 438 of the rear lower rail 314 . the rollers 454 , 456 are oriented in a lateral direction to enable each of the rear upper rails 316 , 318 to slide laterally within the rear lower rail 314 . the inner ends 442 , 444 of the uu - cross section of each rear upper rail 316 , 318 extend upwardly beyond the height of the outer ends 446 , 448 of the uu - cross section . the inner ends 442 , 444 are either connected to or formed integrally with each other . further , the inner ends 442 , 444 are either connected to or formed integrally with an upper portion 320 , 322 of each of the rear upper rails 316 , 318 . connections may be made by known methods , including , but not limited to , welding , mechanical connections such as rivets , or any other method known to one skilled in the art . the upper portions 310 , 312 , 320 , 322 of each of the front and rear upper rails 306 , 308 , 316 , 318 extend the lateral length of each of the front and rear upper rails 306 , 308 , 316 , 318 . rail covers 460 , 462 extend from a left lateral end 340 , 344 of the front and rear lower rails 304 , 314 to the right end 342 , 346 of the front and rear lower rails 304 , 314 . the rail covers 460 , 462 are made of a flexible plastic polymer with a slit 464 down the middle that extends from the left lateral end 340 , 344 to the right lateral end 342 , 346 of the front and rear lower rails 304 , 314 . the inner ends 412 , 414 , 442 , 444 of the uu - cross section of the upper rails 306 , 308 , 316 , 318 extend through up through the slit 464 . the upper rails 306 , 308 , 316 , 318 are free to move laterally , with the flexible material of the rail covers 460 , 462 flexing around the inner ends 412 , 414 , 442 , 444 of the uu - cross section of the upper rails 306 , 308 , 316 , 318 move laterally through the slit 464 in the rail cover 460 , 462 . the rail covers 460 , 462 act to prevent large debris from being introduced into the lower rails 304 , 314 that may interfere with the lateral movement of the upper rails 306 , 308 , 316 , 318 . the front and rear upper rails 306 , 308 , 316 , 318 on the same side of the motor vehicle 100 are connected by cross brackets 350 , 352 , 354 , 356 . in the embodiment illustrated in fig3 , two cross brackets 350 , 352 , 354 , 356 extend from the opposite ends of each of the upper portions 310 , 312 , of the front upper rails 306 , 308 to the corresponding opposite ends of the each of the upper portions 320 , 322 of the rear upper rails 316 , 318 . the cross brackets 350 , 352 , 354 , 356 may be connected to the upper portions 310 , 312 , 320 , 322 of the upper rails 306 , 308 , 316 , 318 may any known means such as nut and bolt fasteners , rivets , welds , and the like . each of the cross brackets 350 , 352 , 354 , 356 , front upper rail 306 , 308 and rear upper rail 316 , 318 that are connected in a square - like manner when viewed from above form a left sliding carrier 360 and a right sliding carrier 362 . each of the cross brackets 350 , 352 , 354 , 356 include a front striker 470 and a rear striker 472 . each front striker 470 is positioned above the upper portion 310 , 312 of the front upper rail 306 , 308 . each rear striker 472 is positioned above the upper portion 320 , 322 of the rear upper rail 316 , 318 . the strikers 470 , 472 allow for the removable seats 114 to be attached to the front rail system 300 and rear rail system 302 . as illustrated in fig5 , the left sliding carrier 360 further includes a left cover 500 . the left cover 500 covers the entire left sliding carrier 360 with the exception of four openings 510 that leave the four strikers 470 , 472 of the left sliding carrier 360 exposed . the right sliding 362 carrier further includes a right cover 502 . the right cover 502 covers the entire right sliding carrier 502 with the exception of four openings 510 that leave the four strikers 470 , 472 of the right sliding carrier 502 exposed . the left cover 500 and right cover 502 are horizontally flat . as illustrated in fig6 - 9 , at a longitudinally rearward position 600 generally above the rear upper rail 316 , 318 of each sliding carrier 360 , 362 , the covers 500 , 502 each gradually slope downward in a vertical and rearward direction to a height generally equal to that of the floor 116 . the sloped angle of the cover 500 , 502 allows cargo to be loaded into the motor vehicle 100 from the rear of the motor vehicle 100 without damaging the cover 500 , 502 . additional , the sloped angle of the rearward portion 602 of the cover 500 , 502 provides additional leg room for a passenger sitting in a third row of seats 140 in the motor vehicle 100 behind the removable seat 114 by providing extra room for shoes 800 , as illustrated in fig8 - 9 . the left sliding carrier 360 further includes a handle 370 that is attached to the laterally outward left cross bracket 350 as shown in fig1 . the right sliding carrier 362 also includes a handle 372 that is attached to the laterally outward right cross bracket 356 in a manner the same as the left handle 370 shown in fig1 . the handles 370 , 372 are not covered by the covers 500 , 502 of the sliding carriers 360 , 362 . the following embodiments are going to be described with respect to the right sliding carrier 362 . in each situation , the left sliding carrier 360 features the same described embodiment . the sliding carrier 362 includes a lock mechanism 1100 for locking the sliding carrier 362 into place . in the embodiment illustrated in fig1 - 14 , the front lower rail 304 includes five ( 5 ) sets of three ( 3 ) holes 1300 , 1302 , 1304 , 1306 , 1308 located in an inner wall 1200 of the front lower rail 304 that are spaced to the right laterally from a longitudinal centerline cl of the motor vehicle 100 for use with the right sliding carrier 362 , and an additional five ( 5 ) sets of three ( 3 ) holes ( not shown ) located in the inner wall 1200 of the front lower rail 304 that are spaced to the left laterally from the longitudinal centerline cl of the motor vehicle 100 for use with the left sliding carrier 360 . each set of three ( 3 ) holes 1300 , 1302 , 1304 , 1306 , 1308 is spaced laterally apart from each other and correspond to a locking position of the sliding carrier 362 . within each set of three ( 3 ) holes 1300 , 1302 , 1304 , 1306 , 1308 , as illustrated in fig1 with respect to the first set of the three ( 3 ) holes 1300 , the distance d 1 between the first hole 1400 and second hole 1402 is the same as the distance d 2 between the second hole 1402 and the third hole 1404 . each set of three ( 3 ) holes 1300 , 1302 , 1304 , 1306 , 1308 that make up each set of five ( 5 ) holes on each side of the front lower rail 304 are similarly constructed . located in the upper portion 310 , 312 of the front upper rail 306 , 308 of each of the sliding carriers 360 , 362 is a lock 1102 . the lock 1102 , when viewed from the side in fig1 , has a generally c - shaped cross section . the lower portion 1202 of the lock 1102 includes three locking member extensions 1104 . the three locking member extensions 1104 correspond with and fit into the three ( 3 ) sets of holes 1300 , 1302 , 1304 , 1306 , 1308 in the lower rail 304 and lock the sliding carrier 362 into place . a spring ( not shown ) biases the lock 1102 and locking member extensions 1104 against the inner wall 1200 of the upper front rail 304 . as the sliding carrier 362 slides along the upper front rail 304 , the locking member extensions 1104 are forced into a set of three ( 3 ) holes 1300 , 1302 , 1304 , 1306 , 1308 when the three locking member extensions 1104 come into alignment with one of the sets of three ( 3 ) holes 1300 , 1302 , 1304 , 1306 , 1308 . as illustrated in fig1 - 19 , beneath the handle 372 is located a towel bar 1500 used to unlock the lock mechanism 1100 of the sliding carrier 362 , which allows the sliding carrier 362 to slide back and forth along the lower rails 304 , 314 . the grip 1502 of the towel bar 1500 is located underneath the handle 372 that extends from the sliding carrier 362 . the towel bar 1500 is ergonomically positioned such that it is equally accessible from above , illustrated by arrow a , through the opening 1700 in the handle 372 or from below , illustrated by arrow b , underneath the handle 372 . the towel bar 1500 , from either direction , as illustrated by arrow a and arrow b , may be actuated with the normal grip movement of an adult . additionally , the towel bar 1500 location is designed to not be operable by a small child to prevent accidental actuation of the towel bar 1500 and release of the locking mechanism 1100 by a small child . the span d 3 of the grip in the embodiment illustrated in fig1 is 65 . 5 mm , which exceeds the maximum grip of a 97 th percentile 5 - year old child . as illustrated in fig2 - 26 , the towel bar mechanism 2000 includes the towel bar 1500 that is gripped by the user . the ends 2002 , 2004 of the towel bar 1500 are each connected to a perpendicular bar 2006 , 2008 that extends beneath the cover 502 . the perpendicular bars 2006 , 2008 are in turn connected to the lock mechanism 1100 . when actuated , the towel bar 1500 releases the lock 1102 from one of sets of three ( 3 ) holes 1300 , 1302 , 1304 , 1306 , 1308 , thereby allowing the sliding carrier 362 and the seat 134 on top thereof to slide back and forth laterally along the front and rear lower rails 304 , 314 . the perpendicular bars 2006 , 2008 each have a first pin 2400 and a second pin 2402 that fit within a bracket 2100 that limit their motion . the bracket 2100 has a first opening 2200 and second opening 2202 that receive the first pin 2400 and second pin 2402 respectively . the second opening 2402 is an angled oval opening . the angle of the second opening 2402 is upward in the laterally outward direction in the direction of arrow c . the second pin 2402 in the second opening 2202 also acts as the rotation point for the perpendicular bars 2006 , 2008 as the towel bar 1500 is lifted outward and upward . fig2 is an expanded view of the first opening 2200 , which is the shape of a relatively obtuse triangle with rounded rather than sharp corners 2500 , 2502 , 2504 . one side is an obtuse rounded corner 2500 . a tangent t drawn at the apex 2506 of the obtuse rounded corner 2500 is an angle α . in the embodiment illustrated in fig2 , the angle α is 45 °. the side 2520 opposite the obtuse rounded corner 2500 may have a very slight arcuate shape . the first pin 2400 in the first opening 2200 operates to force the towel bar 1500 to move outward and upwardly when actuated . the shape of the opening 2200 is tuned to insure the motion path of the pin 2400 towel bar 1500 is fluid , as illustrated by arrow d . the upward and outward motion of the towel bar 1500 causes the laterally inward ends 2404 of the perpendicular bars 2006 , 2008 to move outward and upward . locking bars 2406 are rotationally connected by the second pin 2402 to the inward ends 2404 of the perpendicular bars 2006 , 2008 . the outward and upward motion causes the locking bars 2406 to move outward and downward . the downward motion acts to pull the spring - biased locking mechanism 1100 , which is connected to the locking bars 2406 , out of one of the sets of three ( 3 ) holes 1300 , 1302 , 1304 , 1306 , 1308 . by limiting the motion of the towel bar 1500 , the towel bar 1500 can be controlled to move in an ergonomically advantageous motion by requiring the towel bar 1500 to move outward and upward consistent with the closing grip motion of the user . the limited movement of the towel bar 1500 , particularly the inability of the towel bar 1500 to move laterally inward , helps to prevent the lock mechanism 1100 from being unlocked in a side impact , as illustrated in fig2 , because the locking bar 2406 is prevented from lowering unless the towel bar 1500 moves outward and upward , which is opposite of motion caused by a side impact . as illustrated in fig2 - 29 , the front and rear lower rails 304 , 314 include a rail end bracket 2700 at each end 340 , 342 , 344 , 346 of the rails 304 , 314 . the bracket has a generally u - shaped end 2704 that matches the u - shaped cross sectional profile of the ends 400 , 402 , 430 , 432 of the lower rails 304 , 314 , with a center portion 2706 and two upper portions 2708 , 2710 . an l - shaped extension 2712 extends from the bottom 2714 of the center portion 2706 . a first section 2716 of the l - shaped extension 2712 is attached to the bottom surface 2718 of the lower rail 304 , 314 . the attachment may be by any method known to one skilled in the art , including , but not limited to , a rivet 2900 as shown in fig2 , nut and bolt fastener , weld , and the like . the second section 2720 of the l - shaped extension 2712 extends upward from the first section 2716 of the l - shaped extension 2712 . the second section 2720 may extend up to , but not higher than , the top 2722 of the lower rails 304 , 314 . the second section 2720 acts to block the sliding carriers 360 , 362 at the lateral ends 340 , 342 , 344 , 346 of the lower rails 304 , 314 . the u - shaped end 2704 of each rail end bracket 2700 acts as a cap at the end of the lower rails 304 , 314 to prevent the introduction of dirt or debris into the substantially closed upper portions 406 , 408 , 436 , 438 of the lower rails 304 , 314 that would interfere with the free movement of the upper rails 306 , 308 , 316 , 318 within the lower rails 304 , 314 . as illustrated in fig3 - 33 , at the ends 340 , 342 , 344 , 346 of the lower rails 304 , 314 on either side 136 , 138 of the motor vehicle 100 is located a step garnish 3000 that covers the ends 340 , 342 , 344 , 346 of the lower rails 304 , 314 and rail end brackets 2700 . the step garnish 3000 is typically installed after the removable seats 114 are installed . in the past , the step garnish 3000 was installed by lowering the step garnish 3000 downwardly into place . however , the handles 370 , 372 on the sliding carriers 360 , 362 interfere with a downward installation . in order to solve this interference problem , the step garnish 3000 includes an inner step garnish 3002 , which is installed from the side so that it fits underneath the handle 370 , 372 of the sliding carriers 360 , 362 , as illustrated in fig3 . a second , outer step garnish 3004 , which includes a cut out clearance shape 3006 for the handles 370 , 372 , is installed in the traditional manner . the exposed portion 3008 of the inner step garnish 3002 is designed to match the clearance shape 3006 of the outer step garnish 3004 . when the outer step garnish 3004 is installed over the inner step garnish 3002 , the exposed portion 3008 of the inner step garnish 3002 and the outer step garnish 3004 create a complete finished surface 3010 that is indistinguishable from a single piece step garnish . the finished surface 3010 may include ridges 3012 to create a greater friction surface to aid a user to enter or exit the motor vehicle 100 . the step garnishes 3000 may be connected to the motor vehicle 100 using tappet screws , rivets , nuts and bolts , interference fit fasteners , or by any other method known to one skilled in the art . further movement of the two sliding carriers 360 , 362 may be controlled by inclusion of a spacer 3400 with one or both of the front or rear lower rails 304 , 314 . the spacer 3400 includes first and second plastic shoes 3500 , 3502 that are located with the closed upper portions 406 , 408 , 436 , 438 of the front and rear lower rails 304 , 314 . the plastic shoes 3500 , 3502 are connected by a metal bracket 3504 . the spacers 3400 are free to slide between the left and right sliding carriers 360 , 362 . the spacers 3400 prevent the two sliding carriers 360 , 362 from coming into contact at a position along the sliding carriers 360 , 362 overlapping slide range 3402 . the spacers 3400 help maintain a safe distance between the removable seats 114 on the sliding carriers 360 , 362 . in the embodiment illustrated in fig3 - 35 , the spacer 3400 maintains a safe 15 mm gap between the sliding carriers 360 , 362 to prevent pinching between the seats 114 . the plastic may be any formulation known to those skilled in the art to be durable and relatively low friction . the left seat 130 on top of the left sliding carrier 360 and the right seat 134 on top of the right sliding carrier 362 may each slide between five ( 5 ) possible positions as illustrated by the table in fig3 . the five ( 5 ) possible positions correspond with the five ( 5 ) sets of three ( 3 ) holes 1300 , 1302 , 1304 , 1306 , 1308 located in the inner wall 1200 of the front lower rail 304 that are spaced to the right laterally from a longitudinal centerline cl of the motor vehicle 100 for use with the right sliding carrier 362 , and the five ( 5 ) sets of three ( 3 ) holes ( not shown ) located in the inner wall 1200 of the front lower rail 304 that are spaced to the left laterally from the longitudinal centerline cl of the motor vehicle 100 for use with the left sliding carrier 360 . on the table in fig3 , the position 445 b corresponds to the first set of three ( 3 ) holes 1300 . the position 363 b corresponds to the second set of three ( 3 ) holes 1302 . the position 281 b corresponds to the third set of three ( 3 ) holes 1304 . the position 199 b corresponds to the fourth set of three ( 3 ) holes 1306 . the position 117 b corresponds to the fifth set of three ( 3 ) holes 1308 . the positions − 445 b , − 363 b , − 281 b , − 199 b , and − 117 b correspond to the mirror image five ( 5 ) sets of three ( 3 ) holes on the left side 136 of the motor vehicle 100 . the table in fig3 represents the possible locations of the left seat 130 and right seat 134 for each of the positions . for example , if the left seat 130 is in position − 117 b , the only position for the right seat 134 is 445 b , as shown in fig3 . fig3 - 42 show some possible seating positions for the embodiment of the motor vehicle 100 as described herein . fig3 shows the left seat 130 in position − 445 b , while the right seat 134 is in position 445 b . in this positioning , the center seat 132 is also installed . fig3 shows the left seat 130 in position − 445 b , while the right seat 134 is in position 445 b and the center seat 132 is removed . fig4 shows the left seat 130 in position − 363 b , while the right seat 134 is in position 363 b . this arrangement brings the two seats 130 , 134 nearer together toward the centerline cl of the motor vehicle 100 and away for the left 136 and right 138 sides . fig4 shows the left seat 130 in position − 199 b , while the right seat 134 is in position 363 b . in this example , the two seats 130 , 134 are still side - by - side , but the two seats are shifted laterally leftward compared to the example shown in fig3 away from the right side 138 of the motor vehicle 100 . fig4 shows the left seat 130 in position − 281 b , while the right seat 134 is in position 281 b . in this example , the two seats 130 , 134 are side - by - side along the cl of the motor vehicle 100 . the only restriction on how far the left sliding carriers 360 can slide across the lower rails 304 , 314 is the position of the right carrier 362 and the spacers 3400 that separate the two . additionally , the only restriction on how far the right sliding carriers 362 can slide across the lower rails 304 , 314 is the position of the left carrier 360 and the spacers 3400 that separate the two . as illustrated in fig3 and 41 , the left sliding carrier 360 or the right sliding carrier ( not illustrated ) may cross the longitudinal centerline cl of the motor vehicle 100 if space is available . two removable seats 114 , a left seat 130 and right seat 134 , are designed to be secured to the sliding carriers 360 , 362 , the left seat 130 on left sliding carrier 360 , and the right seat 134 on the right sliding carrier 362 . as illustrated in fig4 , the seats 130 , 134 are connected to the sliding carriers 360 , 362 via hook fasteners 474 around the front strikers 470 and hook and lock fasteners 476 that hook around the rear strikers 472 located on the cross brackets 350 , 352 , 354 , 356 and exposed through the openings 510 in the covers 500 , 502 of the sliding carriers 360 , 362 . the hook fasteners 474 and the hook and lock fasteners 476 are of a type known to those skilled in the art . as illustrated in fig4 - 47 , during typical operation of the removable seats 114 , the removable seat 114 is moved from an upright position , illustrated in fig4 - 45 , to a folded position , illustrated in fig4 - 47 , by actuation of a first lever 4400 on the seat 114 . located at the back 4402 of the seat cushion 202 below the seat back 204 is a latch striker 4404 used for the latch car seat system that is standard in automobiles . when the seat back 204 is folded down upon actuation of the first lever 4400 , a seat handle 4406 is exposed that is on the bottom 4408 of the seat back 204 when the seat back 204 is upright . by hiding the seat handle 4406 when the seat 114 is in the upright position , improper attachment of a latch enable car seat may be avoided by only having the latch striker 4404 visible . as illustrated in fig4 - 50 , in order to remove the seat 114 , a lock 478 is released on the rear hook and lock fasters 476 by actuating a second lever 4900 in the seat 114 . when the lock 478 is released , the user may grasp the seat handle 4406 and lift the rear 4402 of the seat 114 . lifting the rear 4402 of the seat 114 from the rear strikers 472 allows the seat 114 to be rotated about and axis a 1 that runs through the front strikers 470 . when the seat 114 reaches an appropriate angle α 1 , the front hooks 474 may be removed from the front strikers 470 , and the seat 114 is removed . a bar 4800 extends from the left front hook fastener 474 to the right front hook fastener 474 ′ parallel to and around the axis a 1 through the strikers 470 . as the user rotates the seat 114 forward to remove the front hook fasteners 474 , 474 ′, the bar 4800 rotates forward and down as it rotates about axis a 1 until it contacts the cover 500 . the shape of the forward portion 5000 of the cover 500 is designed so that the bar 4800 contacts the front portion 5000 of the cover 500 when the seat 114 has been rotated an angle α 1 about the axis a 1 . in the embodiment illustrated , angle α 1 is approximately 45 °, although the angle α 1 may be tuned based upon the geometry and available space of the motor vehicle 100 . once the bar 4800 contacts the cover 500 , the user is prevented from rotating the seat 114 any further . this operation controls the location of the seat when the user is removing the seat to be in an optimum position . this also prevents the seat 114 from contacting any other interior components by rotating too far forward . as illustrated in fig5 - 54 , when the center seat 132 is in the upright position , the center seat 132 includes a left isofix bar ( not shown ), which is located beneath a cap 5100 and a right isofix bar ( not illustrated ) for use with a latch - enabled child seat . the seat 132 includes a cap 5100 that covers each bar when the latch system is not in use to prevent users from accidentally getting straps or the like hooked on the isofix bars . when the left removable seat 130 or the right removable seat 134 is positioned up against the center seat 132 , removing the cap 5100 to expose the isofix bar can be problematic . in order to make removal of the cap 5100 easier for a user , the cap 5100 includes a scoop portion 5200 on the grip portion 5202 of the cap 5100 . the grip portion 5202 not only includes a scoop portion 5200 in the side 5204 of the cap 5100 , but also an indented portion 5206 longitudinally forward of the scoop out shape 5200 to further increase access by a user &# 39 ; s hand . as illustrated in fig5 , the indented portion 5206 longitudinally forward of the scoop portion 5200 has a lateral width w 1 less than a lateral width w 2 of the cap body 5300 and greater than a lateral width w 3 of the scoop portion 5200 . in addition to the cap 5100 on the isofix bar on the center seat 132 , the laterally l - shaped inner cover 5208 of the seat frame 5500 of the left and right seats 130 , 134 has a smooth lower external surface 5600 and a smooth and recessed external upper surface 5602 that is laterally opposite the isofix cap 5100 of the center seat 132 that provides additional clearance for a user to access the grip portion 5202 of the cap 5100 . as illustrated in the embodiment shown in fig5 - 56 , the minimum gap d 3 between the center seat 132 and left seat 130 or right seat 134 is 16 mm , but the recessed external upper surface 5602 of the inner cover 5208 of the seat frame 5500 of the left seat 130 or right seat 134 , and the scoop portion 5200 of the cap 5100 over the isofix bar , at the location of the indention portion 5206 longitudinally forward of the scoop portion 5200 provides a clearance d 4 of 30 mm for the user to grip and remove the isofix cap 5100 . another feature of the removable seats 114 is the necessity of providing a seatbelt 4300 for the user as illustrated in fig4 and 57 - 61 . because the removable seats 114 are slidable between five separate positions as previously described , the seatbelt 4300 is integrally provided within the removable 114 by methods known to those skilled in the art . however , at the top of the seat back 204 , a seatbelt mechanism 4302 is provided for protecting the seatbelt 4300 and to transition the seatbelt 4300 from within the seat 114 to the outside of the seat 114 , as illustrated in fig6 . the seatbelt mechanism 4302 includes an arcuate slot 4304 through which the seatbelt 4300 extends and is presented to the user for use . the arcuate slot 4304 includes an extended base 5800 that sits on top of and is connected to a bracket 5802 . the extended base 5800 also includes a raised and curved section 5804 over which the seatbelt 4300 moves and transitions from a vertical orientation to a horizontal orientation . the seatbelt mechanism 4302 also includes a garnish 5700 that protects the seatbelt 4300 during use and when the seat 114 is removed . the arcuate slot 4304 is designed to prevent the seatbelt 4300 from reversing the side presented to the user and becoming twisted or tangled . due to position of the garnish 5700 , there is a need for a method and apparatus to attach the garnish 5700 to the seatbelt mechanism 4302 that is both easy to install and durable during use of the seat 114 in the intended manner . as shown in fig5 - 61 , the garnish 5700 primarily is constructed of a solid molded plastic piece that includes an arcuate opening 5806 , a cap opening 5808 , and an interference fit fastener 6000 that extends from the bottom of the garnish 5700 . the interference fit fastener 6000 is inserted into a slot ( not shown ) in the seatbelt mechanism 4302 . the arcuate slot 4304 fits into the arcuate opening 5806 of the garnish 5700 . a cap 5702 is provided for completing attachment of the garnish 5700 to the seatbelt mechanism 4302 . the cap 5702 is constructed of a single piece that includes a base portion 6100 , a living hinge 6102 , and an outer cover 6104 . the base portion includes , in the embodiment shown in the fig5 - 61 , includes two holes 5810 that correspond to two holes 5812 in the cap opening 5808 of the garnish 5700 and two holes 5814 in the bracket 5802 . tapping screws 5816 are used to connect the base portion 6100 of the cap 5702 and garnish 5700 to the bracket 5802 . the outer cover 6104 of the cap 5702 is then folded over downwardly at the living hinge 6102 , as shown by arrow b in fig6 , and the outer cover 6104 , now folded over and parallel with the base portion 6100 , covers the base portion 6100 . the outer cover 6104 has a tapered end 6106 that snaps into a hook surface 6108 of the lower edge 5818 of the cap opening 5808 of the garnish 5700 . the tapered end 6106 creates an interference fit with the hook surface 6108 to hold the cover 5702 in place . reference in the specification to “ one embodiment ” or to “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiments is included in at least one embodiment . the appearances of the phrase “ in one embodiment ” or “ an embodiment ” in various places in the specification are not necessarily all referring to the same embodiment . in addition , the language used in the specification has been principally selected for readability and instructional purposes , and may not have been selected to delineate or circumscribe the inventive subject matter . accordingly , the disclosure of the embodiments is intended to be illustrative , but not limiting , of the scope of the embodiments , which is set forth in the claims . while particular embodiments and applications have been illustrated and described herein , it is to be understood that the embodiments are not limited to the precise construction and components disclosed herein and that various modifications , changes , and variations may be made in the arrangement , operation , and details of the methods and apparatuses of the embodiments without departing from the spirit and scope of the embodiments as defined in the appended claims .

1Performing Operations; Transporting

hereinafter , a first embodiment of the invention will be described in detail with reference to fig3 to 10 . fig3 shows a bag binder 11 . in an outer case 12 , a binding device 14 and a crimping device 15 are opposed to each other across a guiding groove 13 which is downward formed from the upper face of the front portion of the outer case 12 . the binding device 14 and the crimping device 15 are driven by a motor 16 and a reduction gear mechanism 17 , and the crimping device 15 is driven by the reduction gear mechanism 17 via a cam 18 , a slider 19 , and a lever 20 . when an opening portion of a resin bag is puckered and inserted into the guiding groove 13 , a trigger arm 21 is pushed by the bag to downward swing , whereby a trigger switch 22 is turned on to activate the motor 16 . the motor 16 rotates a main gear 23 via the reduction gear mechanism 17 . an eccentric pin 24 disposed on a side face of the main gear 23 is engaged with a long hole 25a of a carrier 25 of the binding device 14 . when the main gear 23 makes one rotation , the carrier 25 is driven to make a round trip in a longitudinal direction along a carrier guide 26 . after the binding operation is ended , the carrier 25 returns to the initial position and the rear end of the carrier 25 pushes a stop switch 27 , thereby ending one cycle of the operation . as shown in fig4 a binding piece 31 is formed by a resin flat plate having a substantially portal shape . a locking pawl portion 33 in the form of internal teeth is disposed in an internal basal portion between right and left legs 32 . holes 34 with which pins ( described later ) of the binding device 14 are to be engaged are formed in the right and left legs 32 , respectively . a groove is formed in the outer side of the tip end portion of each of the legs , thereby constituting a hooking portion 35 . a number of binding pieces 31 are molded into a belt - like shape with being aligned in a row and directing the respective legs 32 to the front . the belt of binding pieces is wound into a roll , and then loaded into a magazine ( not shown ) of the bag binder 11 . fig5 is a partially schematic illustration of the shape of the binding device 14 . as shown in the figure , the binding device 14 comprises : a slide guide 41 which is to be fixed to a base ( not shown ) of the bag binder 11 ; a binding piece guide slider 42 attached to the slide guide 41 ; a cover slider 43 attached to the upper face of the binding piece guide slider 42 ; a binding slider 44 attached onto the cover slider 43 ; and the carrier 25 . lateral pairs of swing arms 45 , 46 , and 47 are pivotally mounted to the three sliders 42 , 43 , and 44 of the upper , middle , and lower stages so as to be horizontally swingable , respectively . the arms are directed to the front . a pawl which laterally protrudes is formed in a front end portion of each of the swing arms 45 , 46 , and 47 . in each of the pawls , a rear edge portion has an inclined face where the outer side is in a more advanced position . the carrier 25 is provided with pawls 25b , 25c , and 25d which are respectively engageable with the pawls of the swing arms 45 , 46 , and 47 . in the initial position shown in fig5 the swing arms 45 which are on the both sides of the binding piece guide slider 42 are contacted with the inner side faces of the slide guide 41 so that the outward swing of the arms is restricted , and the inner pawls are engaged with the pawls 25b of the carrier 25 . in the slide guide 41 , holes 41a are formed in positions which are more forward than the swing arms 45 of the binding piece guide slider 42 that is in the initial position . when the binding piece guide slider 42 is advanced integrally with the carrier 25 under the state where the swing arms 45 are engaged with the pawls 25b of the carrier 25 , and the outer pawls of the swing arms 45 reach the positions of the holes 41a of the slide guide 41 , the swing arms 45 which are engaged with the pawls 25b of the carrier 25 are outward rotated by the function of the inclined faces of the pawls of the swing arms 45 , and the outer pawls enter the holes 41a , with the result that the engagement between the binding piece guide slider 42 and the swing arms 45 is canceled . for the swing arms 46 which are on the both sides of the cover slider 43 , the inner pawls are contacted with the outer side faces of the binding piece guide slider 42 so that the outward swing of the arm is restricted , and the outer pawls are engaged with the pawls 25c of the carrier 25 . in the binding piece guide slider 42 , holes 42a are formed in positions which are more forward than the swing arms 46 of the cover slider 43 . when the cover slider 43 is advanced by a predetermined distance with respect to the binding piece guide slider 42 , the inner pawls of the swing arms 46 are engaged with the holes 42a of the binding piece guide slider 42 , with the result that the engagement between the cover slider 43 and the carrier 25 is canceled . for the binding slider 44 , similarly , the swing arms 47 on the both sides are contacted with the outer side faces of the cover slider 43 , and the outer pawls are engaged with the pawls 25d of the carrier . when the binding slider 44 is advanced by a predetermined distance with respect to the cover slider 43 , the inner pawls of the swing arms 47 are engaged with the holes 43a of the outer side faces of the cover slider 43 , with the result that the engagement between the binding slider 44 and the carrier 25 is canceled . a binding piece table 43b which is similar in shape to the binding piece 31 is formed in a front portion of the cover slider 43 and in the same plane as the binding piece guide slider 42 . basal portions of a pair of right and left binding arms 48 are pivotally mounted to the rear portion of the table . the binding arms 48 are coupled to the binding slider 44 via links 49 . when the binding slider 44 is relatively advanced with respect to the cover slider 43 , tip end portions of the right and left binding arms 48 are swung in the closing direction . a vertical pin 50 protrudes from the tip end portion of each of the binding arms 48 . the pins 50 are engaged with the holes 34 on the both sides of the binding piece 31 shown in fig4 . a binding piece cutter 51 is attached to the upper face of the cover slider 43 by means of a shaft , so as to be vertically swingable . the upper face of the front portion of the binding piece cutter 51 is formed as an inclined face 51a which is downward inclined as moving toward the front . a downward cutter blade 51b is formed in each of the right and left front end portions of the cutter . the front end of the binding piece guide slider 42 is positioned so as to be below the binding piece cutter 51 and opposed to the cutter blades 51b , and serves as a receiving table which receives share stress of the cutter blades 51b when a binding piece is to be cut off . hereinafter , the operation of the binding device 14 will be described . when the motor 16 is activated as a result of the above - described operation of inserting a bag into the bag binder 11 , the binding piece guide slider 42 , the cover slider 43 and the binding slider 44 are forward pushed from the initial positions shown in fig5 by the pawls 25b , 25c , and 25d of the carrier 25 , so as to be integrally advanced . at this time , the pins 50 of the binding arms 48 are engaged with the holes 34 of the leading binding piece ( not shown ), and the binding pieces in the form of a belt are advanced together with the binding piece guide slider 42 , so that the leading binding piece on the binding piece table 43b of the cover slider 43 is fitted onto a puckered portion of a bag which is in the guiding groove . at the same time , the upper inclined face 51a of the binding piece cutter 51 abuts against a stationary bar 52 which elongates above the binding piece cutter 51 ( in this side of the sheet in fig5 ), thereby causing the front portion of the binding piece cutter 51 to be downward swung . as a result , the portion where the leading binding piece 31a and the next binding piece 31b are linked to each other is pushingly cut by the cutter blades 51b and the front end portion of the upper face of the binding piece guide slider 42 . the swing arms 45 of the binding piece guide slider 42 enter the holes 41a of the slide guide 41 , and the engagement between the binding piece guide slider 42 and the carrier 25 is canceled , so that the binding piece guide slider 42 stops after performing a predetermined forward stroke . thereafter , the cover slider 43 and the binding slider 44 are pushed by the carrier 25 to be further advanced , and the swing arms 46 of the cover slider 43 enter the holes 42a of the binding piece guide slider 42 , thereby canceling the engagement between the cover slider 43 and the carrier 25 . as a result , the cover slider 43 stops . in this case , since the cover slider 43 is advanced after the binding piece guide slider 42 stops , a gap is formed between the binding piece table 43b of the cover slider 43 and the front end of the binding piece guide slider 42 , so that the rear portion of the binding piece 31a fitted onto the puckered portion of the bag is not supported by the binding piece guide slider 42 . thereafter , the binding slider 44 only is further advanced by the carrier 25 , so that , as shown in fig6 the binding arms 48 are swung in the closing direction via the links 49 . since the pins 50 at the tip ends of the binding arms 48 are engaged with the holes 34 of the binding piece 31 , the legs of the binding piece 31 are twisted in the closing direction , and the legs 32 are overlapped each other , so that the binding piece 31 is elastically deformed into a funnel - like shape . as described above , the rear portion of the binding piece 31 is not supported . therefore , the deformation of the binding piece 31 is not impeded , and the rear portion of the binding piece 31 which is elastically deformed into a funnel - like shape is downward projected . as shown in fig6 the swing arms 47 of the binding slider 44 then enter the holes 43a of the cover slider 43 , so that the engagement between the carrier 25 and the binding slider 44 is canceled . as a result , the binding slider 44 stops under a state where the legs of the binding piece 31 are overlapped each other . at the same time when the binding slider 44 stops , the rotation of the cam 18 shown in fig3 causes the crimping device 15 to operate , so that the legs 32 of the binding piece 31 are vertically crimped . fig7 a shows the crimping device 15 . the crimping device comprises : a crimp plate 62 having a crimp pin 61 which is downward directed ; two upper and lower presser plates 65 and 66 respectively having dowel forming holes 63 and 64 ; a lock plate 67 ; a press plate 69 having a press pin 68 which is upward directed ; and a shifter 70 . a cam groove is formed in a side face of each of the four plates 62 , 65 , 66 , and 69 , and the shifter 70 . the rear end portions of the four plates 62 , 65 , 66 , and 69 are coaxially coupled to each other by a pin 71 . the pin 71 is engaged with a long hole 70a of the shifter 70 . two front and rear drive pins 72 and 73 which elongate from the shifter 70 pass through the cam grooves of the plates 62 , 65 , 66 , and 69 . when the shifter 70 is longitudinally moved , the plates 62 , 65 , 66 , and 69 are vertically swung in accordance with the shapes of their respective cam grooves . in an initial state shown in fig7 a , first , the binding piece in the state where the legs are overlapped each other is inserted between the two presser plates 65 and 66 . when the shifter 70 is forward moved , the lower presser plate 66 is raised , so that the legs of the binding piece is pressingly fixed by the upper and lower presser plates 65 and 66 as shown in fig7 b . then , the press plate 69 is raised as shown in fig7 c , so that a dowel is press - formed in each of the legs , by the press pin 68 . as shown in fig8 a , the lock plate 67 is then forward pushed so that the locking state of the upper presser plate 65 is canceled . as shown in fig8 b , therefore , the pressing due to the upper and lower presser plates 65 and 66 is canceled , and the upper presser plate 65 is raised . as shown in fig8 c , the crimp pin 61 of the crimp plate 62 then crushes the dowel formed by the press pin 68 through the hole 63 of the upper presser plate 65 . fig9 a shows the shape of a dowel d which is formed by the press pin 68 , and fig9 b shows the final shape of the dowel d which has undergone the crimping process c by the crimp pin 61 . fig1 shows a state where the binding piece 31 is fastened to the bag b . thereafter , the shifter 70 is retracted to go back to the initial state shown in fig7 a , the carrier 25 of the binding device 14 is retracted to return the binding piece guide slider 42 , the cover slider 43 , and the binding slider 44 to the initial positions shown in fig5 . the rear end of the carrier 25 pushes the stop switch 27 , thereby ending one cycle of the operation . in this way , the legs of the binding piece 31 are overlapped each other by laterally pressing the binding piece by the binding arms 48 , and the legs are then crimped . as shown in fig1 , therefore , the binding piece 31 can be attached to the bag b in close proximity to the contents of the bag , so that the bag b is bound in a tension state . the bag which has been bound can be opened in the following manner . the legs 32 of the binding piece 31 are pulled so as to be separated from each other by fingers . then , the crimped dowel d is deformed , and the legs are separated from each other . the binding piece is detached from the bag , so that the bag can be opened . when the binding piece which is detached from the bag is to be reused , the legs 32 of the binding piece 31 are crossed with each other so as to attain the crosswise engaging state of the hooking portion 35 . after the bags is once opened , the bag cannot be again bound by using the dowel in such a manner that the state before the opening is again attained , because the crimped portion c of the dowel d of the binding piece 31 is deformed . therefore , the opening history of the bag can be easily checked in a visual manner . this is effective also in safety management and sanitary management during distribution of commodities . hereinafter , a second embodiment of the invention will be described with reference to fig1 to 15b . fig1 shows a bag binder 101 . the portion on the right side is a binding piece magazine 102 which houses a roll of binding pieces that are linked to one another into a belt - like shape . a guide groove 104 is formed in a table 103 , which leftward protrudes from the binding piece magazine 102 . the guide groove has an l - like shape in a plan view , or elongates from a lateral center portion of the front face toward the inner side and is then bent leftward . in the table 103 , a binding piece feeding device 105 is incorporated on the right side of the guide groove 104 , and a binding device 106 on the left side of the guide groove . a cutter device 107 is disposed behind the binding device 106 . when an arm 107a which is pivotally mounted to the upper face of the table 103 is swung toward the front side so as to make a guide groove 107b in the front portion coincident with the guide groove 104 of the table 103 , an upper extra portion of a bound bag is cut away by a cutter blade ( not shown ) which can longitudinally slide in the arm 107a with being interlocked with the binding operation . the feeding device 105 , the binding device 106 , and the cutter device 107 are driven by a motor ( not shown ) via a reduction gear mechanism , and a cam and link mechanism . a trigger lever 108 is pivotally mounted to the left side of the guide groove 104 . a tip end portion of the trigger lever 108 rightward elongates to cross the guide groove 104 . when an opening portion of a bag is puckered and inserted into the guiding groove 104 , the trigger lever 108 is pushed by the bag to swing , whereby a trigger switch ( not shown ) in the table 103 is turned on to activate the motor . as shown in fig1 , a binding piece 109 is formed by a resin flat plate having a substantially portal shape . a locking pawl portion 111 in the form of internal teeth is disposed in an internal basal portion between right and left legs 110 . holes 112 with which pins ( described later ) of the feeding device 105 are to be engaged are formed in the legs 110 , respectively . a groove 113 which elongates from the outer side face to the front inner side is formed in the tip end portion of each of the legs , thereby constituting a hooking portion 114 . a number of binding pieces 109 are integrally molded into a belt - like shape with being aligned in a row . the belt of binding pieces is wound into a roll , and then loaded into the binding piece magazine 102 of the bag binder 101 . fig1 shows the arrangement of the feeding device 105 and the binding device 106 . as shown in the figure , a carrier 116 is engaged with a carrier guide 115 disposed on the base of the bag binder 101 , so as to be longitudinally slidable . when the carrier 116 is advanced toward the binding device 106 , the binding piece 109 is fitted onto the bag , and the binding piece 109 attached to the bag is fastened by the binding device 106 . a binding piece guide 117 is attached onto the carrier 116 of the feeding device 105 so as to be longitudinally slidable and has upper and lower cases . a gap between the upper and lower cases functions as a binding piece passageway in which the center portion is higher ( which has an l - like section shape ). a binding piece table 118 which is similar in shape to the binding piece 109 is formed in a front portion ( in the figure , the left portion ) of the binding piece guide 117 . the binding piece 109 which is forward fed through the binding piece passageway is exposed on the binding piece table 118 . a pair of right and left c - shape binding arms 119 are coaxially and pivotally mounted to a rear portion of the binding piece table 118 . the binding arms 119 are coupled via links 121 to an arm shifter 120 which is behind the binding arms 119 and longitudinally slidable . a vertical pin 122 protrudes from the tip end portion of each of the binding arms 119 . the pins 122 are engaged with the holes 112 on the both sides of the binding piece 109 shown in fig1 . a pin 116a fixed to the carrier 116 is engaged with a groove 120a formed in the arm shifter 120 . a larger - diameter main gear 123 is disposed below the carrier 116 . a crank roller 124 disposed in the vicinity of the outer edge of the main gear 123 is engaged with a cam groove 116b formed in the rear portion of the carrier 116 . the main gear 123 is coupled with the motor via plural reduction gears ( not shown ). although illustration is omitted , a feeding pawl mechanism ( not shown ) which uses swinging pawls is interposed between the carrier 116 and the binding piece guide 117 . feeding pawls which are pivotally mounted to the binding piece guide 117 are engaged with the carrier 116 . the binding piece guide 117 is pushed by the carrier 116 so as to be advanced together with the carrier 116 . when the binding piece guide 117 is advanced by a predetermined distance , the guide abuts against a stopper and stops , and the feeding pawls are disengaged from the carrier 116 . the carrier 116 and the arm shifter 120 are further advanced , so that the pair of right and left binding arms 119 are pushed by the arm shifter 120 and are swung in the closing direction . a disk 125 in which a notch 125a is formed is fitted onto the shaft of the main gear 123 . a light emitting portion and a light receiving portion of a photo - interrupter 126 fixed to a frame ( not shown ) are vertically opposed to each other across the outer edge portion of the disk 125 . the photo - interrupter 126 is connected to a motor control unit ( not shown ). the motor control unit controls the stop position of the carrier 116 in accordance with an output of the photo - interrupter 126 . next , the operation of the bag binder 101 will be described . when the upper end opening portion of a resin bag into which vegetables or fruits are disposed is inserted into the guiding groove 104 while puckering the opening portion by a hand , the trigger lever 108 is pushed by the bag to swing , and the trigger lever turns on the trigger switch in the table 103 to activate the motor . when the main gear 123 is rotated by the motor , the carrier 116 and the binding piece guide 117 are pushed by the crank roller 124 shown in fig1 so as to be advanced . since the leading one of the binding pieces 109 is engaged with the pins 122 of the binding arms 119 , the leading binding piece is advanced together with the binding piece guide 117 and then fitted onto the puckered portion of the bag . although illustration is omitted , a cutter which is attached to the upper face of the binding piece guide 117 cuts the portion where the leading binding piece and the next binding piece are linked to each other . in the position where the binding piece on the binding piece table 118 of the binding piece guide 117 enters the front portion of the binding device 106 , the feeding pawls of the binding piece guide 117 are disengaged from the carrier 116 and the binding piece guide 117 stops . the carrier 116 and the arm shifter 120 are further advanced . as a result , the pair of right and left binding arms 119 which are pivotally mounted to the binding piece guide 117 are swung in the closing direction , so that the legs of the leading binding piece 109 cross each other . as a result , the binding piece 109 is elastically deformed into a funnel - like shape as shown in fig1 a and 14b . at this time , a press pin of the binding device 106 is positioned directly below the legs 110 of the binding piece 109 . the binding device 106 is configured in the same manner as that of the first embodiment , and hence its detailed description is omitted . a plate from which a punch protrudes , and an upper die plate having a pin hole which serves as a die cooperate to vertically press the legs 110 of the binding piece 109 , thereby forming a dowel in the crosswise portions of the legs . the dowel is crimped from the upper side by a crimp plate having a crimp pin . fig1 a shows the shape of a dowel d which is formed by the punch and the die , and fig1 b shows the final shape of the dowel d which has undergone the crimping process c by the crimp pin . a state where the binding piece 109 is fastened to the bag b is shown in fig1 . the upper and lower plates of the binding device 106 are then opened to return to their waiting positions , and the carrier 116 is retracted by a predetermined distance . thereafter , the feeding pawls of the binding piece guide 117 are engaged with the carrier 115 , and the binding piece guide 117 is retracted integrally with the carrier 116 . when the notch 125a of the disk 125 which is coaxial with the main gear 123 reaches a space between the light emitting portion and the light receiving portion of the photo - interrupter 126 for detecting a waiting position , an on signal of the photo - interrupter 126 causes a motor control unit to start the braking of the motor or enter the deceleration step . at the timing when the notch 125a goes out from the space between the light emitting portion and the light receiving portion of the photo - interrupter 126 and the on signal of the photo - interrupter 126 is turned off , an electromagnetic brake is applied to the motor and the guide stops at a waiting position shown in fig1 . the bag which has been bound can be opened in the following manner . the legs 110 of the binding piece 109 are pulled so as to be separated from each other by fingers . then , the crimped dowel d is deformed , and the legs are separated from each other . the binding piece is detached from the bag , so that the bag can be opened . when the binding piece which is detached from the bag is to be reused , the legs 110 of the binding piece 109 are crossed with each other so as to attain the crosswise engaging state of the locking pawl portion 111 at the tip end . after the bags is once opened , the bag cannot be again bound by using the dowel in such a manner that the state before the opening is again attained , because the crimped portion c of the dowel d of the binding piece 109 is deformed . therefore , the opening history of the bag can be easily checked in a visual manner . this is effective also in safety management and sanitary management during distribution of commodities . hereinafter , a third embodiment of the invention will be described with reference to fig1 to 12 , and 16 to 19b . in the description of the embodiment , the components which are identical with or have the same function as those of the first or second embodiment are denoted by the same reference numerals , and their description is omitted . in the third embodiment , as shown in fig1 , a flap 127 is pivotally mounted to a front portion of a binding device 106 . the flap 127 closes the lower open face of the guide groove 104 . as shown in fig1 in an enlarged manner , at the left end ( in the figure , the upper side ) of the flap 127 as seen from the feeding device , a stopper 127a for restricting the swing of the trigger lever 108 and a sub trigger lever 128 is raised . the center portion of the front edge is recessed so as not to impede the insertion of a bag into the guide groove 104 . the flap 127 is pressingly contacted with the lower face of the table 103 of the bag binder 101 by a tension spring ( not shown ) elongating between a lug 127b which is raised from the right rear end portion and a frame of the binder . a shaft 129 for the trigger lever 108 exposed over a case of the bag binder 101 and the sub trigger lever 128 disposed below the case is positioned in front of the left end portion of the flap 127 . the trigger lever 108 in the upper side and the sub trigger lever 128 in the case are coupled to each other by a pin 130 . a pawl 128a is formed in the sub trigger lever 128 . in the initial position , the pawl protrudes toward the left edge portion of the flap 127 . the stopper 127a in the left end of the flap 127 and the pawl 128a of the sub trigger lever 128 constitute a safety device . when a bag is inserted , the trigger lever 108 and the sub trigger lever 128 are swung from the initial positions shown in fig1 in a counterclockwise direction , the pin 130 pushes a lever of a trigger switch 131 to activate the bag binder 101 . the sub trigger lever 128 is displaced with respect to the trigger lever 108 by about 90 degree in a clockwise direction in the figure . when the bag pushes the trigger lever 108 , the bag is inserted into the guide groove 104 with being sandwiched between the trigger lever 108 and the sub trigger lever 128 , and then pushed by the sub trigger lever 128 so as to be surely inserted into the binding piece feeding passageway . when the bag is removed away , the trigger lever 108 and the sub trigger lever 128 are returned to the initial positions by a spring ( not shown ). as shown in fig1 , the lower end of the front portion of the semicircular stopper 127a of the flap 127 is removed away so as not to interfere with the pawl 128a of the sub trigger lever 128 . as shown in the figure , when the flap 127 is in the initial position , the trigger lever 108 and the sub trigger lever 128 can be freely swung . as shown in fig1 a and 19b , when the flap 127 is downward swung , the stopper 127a advances into the radius of rotation of the pawl 128a of the sub trigger lever 128 . when the trigger lever 108 and the sub trigger lever 128 are disposed to be swung from the initial positions , the pawl 128a bumps against the stopper 127a to block the swinging operations of the trigger lever 108 and the sub trigger lever 128 . when the flap 127 is opened , therefore , the trigger lever cannot be swung , thereby attaining the safety in the case such as that where the flap 127 is opened and a binding piece jammed in the binding device 106 is to be removed away . the binding device 106 is configured in the same manner as that of the first embodiment , and hence its detailed description is omitted . a base plate 132 is fixed to the lower portion of a frame 106a of the binding device . a lower release plate 133 , a center die plate 134 , and an upper press plate 135 are pivotally mounted to a stationary shaft 106b which is disposed above the base plate . the three plates 133 , 134 , and 135 are lowered or raised by a shifter 136 which is longitudinally moved . the base plate 132 from which a punch is raised , and the die plate 134 which is above the base plate and in which a pin hole serving as a die is formed cooperate to vertically press the crosswise portions of the legs of the binding piece 109 , thereby forming a dowel . the dowel is crimped from the side above the pin hole by a crimp pin of the press plate 135 which is above the die plate 134 . the binding piece 109 is pulled out from the punch of the base plate 132 by the release plate 133 . next , one cycle of the operation of the bag binder 101 will be described . when the upper end opening portion of a resin bag into which vegetables , fruits , or the like are disposed is inserted into the guiding groove 104 while puckering the opening portion by a hand , the trigger lever 108 is pushed by the bag to swing . as shown in fig1 , the pin 130 coupling the trigger lever 108 and the sub trigger lever 128 turns on the trigger switch 131 , thereby activating the motor . when the main gear 123 is rotated by the motor , the carrier 116 and the binding piece guide 117 are pushed by the crank roller 124 shown in fig1 so as to be advanced . since the leading one of the coupled binding pieces 109 is engaged with the pins 122 of the binding arms 119 , the leading binding piece is advanced together with the binding piece guide 117 and then fitted onto the puckered portion of the bag . although illustration is omitted , a cutter which is attached to the upper face of the binding piece guide 117 cuts the portion where the leading binding piece and the next binding piece are linked to each other . in the position where the binding piece 109 enters the front portion of the binding device 106 , the feeding pawls of the binding piece guide 117 are disengaged from the carrier 116 and the binding piece guide 117 stops . the carrier 116 and the arm shifter 120 are further advanced . as a result , the pair of right and left binding arms 119 which are pivotally mounted to the binding piece guide 117 are swung in the closing direction , so that the legs of the leading binding piece 109 cross each other . as a result , the binding piece 109 is elastically deformed into a dome - like shape . at this time , the legs of the binding piece 109 enter the space between the die plate 134 and the release plate 133 of the binding device 106 . thereafter , the binding device 106 crimps the binding piece 109 to fasten it . after the crimping step , the feeding device 105 performs the returning step . when the carrier 116 is retracted by a predetermined distance , the feeding pawls of the binding piece guide 117 are engaged with the carrier 115 , and the binding piece guide 117 is retracted integrally with the carrier 116 . the combination of the disk 125 and the photo - interrupter 126 detects that the guide reaches the waiting position , and the guide stops at the waiting position shown in fig1 . after the crimping , the worker pulls down the bag . then , the bag is pulled out to a space below the table 103 of the bag binder 101 . fig1 shows a state where the binding piece 109 is fastened to the bag b . when the binding piece 109 is jammed in the binding device 106 by any reason , the flap 127 in the lower face of the table 103 is downward opened , and the binding piece 109 remaining in the binding device 106 is removed away . at this time , as shown in fig1 a and 19b , the stopper 127a of the flap 127 blocks the swinging operations of the trigger levers 108 and 128 . even if the worker erroneously touches the trigger lever 108 , therefore , the lever is not swung to the activating position , and hence the binding piece can be safely removed away . in other words , when an accident such as that a binding piece cannot be removed from the punch of the binding device or that a binding piece is jammed in the press - bonding device by any reason occurs , the binding piece must be removed away while opening the flap disposed in a portion where the binding device is incorporated . when the worker touches the trigger lever in the vicinity of the press - bonding device during the work of removing the binding piece , the motor is activated , thereby producing a fear that a finger is squeezed by the feeding device and the binding device or that a finger is damaged by the cutter device for cutting an upper extra portion of the bag . according to the third embodiment , such a fear can be eliminated . the invention is not restricted to the embodiments described above , and may be variously modified without departing from the technical scope of the invention . it is a matter of course that such modifications are within the scope of the invention . as described above , according to the first aspect of the invention , the bag binder attaches a binding piece to a puckered portion of a bag by pressing the outer side of the legs of the binding piece . unlike a bag binder of the prior art which attaches a binding piece to a bag by twisting legs of the binding piece , therefore , a binding piece can be attached to a bag in close proximity to contents of the bag , so that the bag is bound in a tension state . consequently , damages due to abrasion between contents of a bag can be prevented from occurring , and a bag containing commodities can be easily handled . the invention is preferably applied to packing of commodities which are readily damaged , such as vegetables , or fruits . according to the second aspect of the invention , the rotation position of the main gear for driving the binding mechanism is detected by the photo - sensor , and the stop position is controlled in accordance with a signal of the photo - sensor . therefore , the accuracy of the control of the waiting position is improved , and the invention can attain an effect in stabilization of the binding operation . according to the third aspect of the invention , in the case such as that where a binding piece jammed in the bag binder is to be removed away , when the flap covering the binding mechanism is opened , the trigger lever cannot be swung . therefore , an accident caused by an erroneous operation of the trigger lever can be prevented from occurring , and hence the safety is improved .

1Performing Operations; Transporting

referring more particularly to the figures , shown in fig1 is a carburetor outer vent control device in accordance with the teachings of the present invention . in fig1 an outer vent 3 is formed in the outer sidewall of the float chamber 2 of the carburetor 1 . the outer vent 3 is coupled to the charcoal canister 6 by a fuel vapor line 5 which has a solenoid valve 4 installed at an intermediate point of the line . the solenoid valve 4 is normally closed and opens when a control system 7 causes current to flow from the battery 8 to the solenoid 9 so that the solenoid 9 is magnetized . control system 7 consists of a relay 10 connected in series with the battery 8 and the solenoid 9 . an ignition switch 12 is connected in series with the coil of relay 10 and a heat sensitive switch 13 is coupled in parallel with the ignition switch 12 . the relay 10 is normally closed and the relay contact 15 is opened when current flows from the battery 8 through the relay coil 11 so that the later is energized . furthermore , the heat senstive switch 13 is off whenever the temperature of the engine coolant inside the coolant jacket 14 exceeds a given value . the charcoal canister 6 is coupled with a purge port 18 provided in the air intake 17 by a purge line 16 and is designed such that the adsorbed fuel inside the charcoal canister 6 is sucked into the air intake 17 when the engine is running . the charcoal canister 6 is further provided with an air inlet 21 . furthermore , an inner vent tube 22 which opens into the air intake 17 is connected to the float chamber 2 so that the float chamber 2 is connected with the interior of the air intake 17 . a venturi 23 and throttle valve 24 are provided in the air intake 17 . in operation , when the engine is running , the engine ignition switch 12 is on . accordingly , current flows from the battery 8 to the relay coil 11 and the magnetization of the relay coil 11 causes the relay contact 15 to be opened . when the relay contact 15 is opened , the solenoid 9 of the solenoid valve 4 is demagnetized . this causes the solenoid valve 4 to close the fuel vapor line 5 . accordingly , the fuel vapor generated in the float chamber 2 is no longer adsorbed by the charcoal canister 6 . in this case , fuel vapor is delivered to the engine via the inner vent tube 22 and the air intake 17 and is burned . when the engine is shut off , the engine ignition switch 12 is off . if the temperature of the engine coolant exceeds a given value at this time , the heat sensitive switch 13 is also off so that the coil 11 of relay 10 is demagnetized . this causes the relay contact 15 to be closed so that current flows to the solenoid 9 of the solenoid valve 4 thereby causing the solenoid valve 4 to open the fuel vapor line 5 . when the fuel vapor line 5 is opened , fuel vapor generated inside the float chamber 2 is adsorbed by the charcoal canister 6 . after a certain amount of time has elapsed since the shutting off of the engine , the temperature of the engine and the engine coolant drop . when the engine coolant temperature drops below a given value , the heat sensitive switch 13 is switched on . the switching on of this heat sensitive switch 13 causes the coil 11 of the relay 10 to be magnetized so that the relay contact 15 is opened . this causes the solenoid 9 of the solenoid valve 4 to be demagnetized . when the solenoid 9 is demagnetized , the solenoid valve 4 is closed so that the adsorption of fuel vapor from the float chamber 2 into the charcoal canister 6 is interrupted . by this time , the temperature of the fuel inside the float chamber 2 has also dropped so that the fuel evaporation is greatly curtailed . accordingly , even though the adsorption by the charcoal canister 6 is interrupted , no emission problems are created . from this point on , the fuel vapor resulting from slow evaporation remains inside the float chamber 2 , the air intake 17 and the intake manifold ( not shown on the figures ) thereby improving the starting performance of the engine when it is started . since the purge port 18 leading from the canister to the carburetor is provided upstream of the throttle valve , gasified fuel vapor adsorbed in the canister is not sucked into the manifold during idling , thus not affecting the air - fuel ratio during idling . referring to fig2 shown therein is a second embodiment in accordance with the teachings of the present invention . in this second embodiment , the control system 7 of the embodiment shown in fig1 is modified . since the remaining parts are identical to those in fig1 their description of interconnection will be omitted and they are not shown in the fig2 . the control system of fig2 includes a signal inverter 25 which utilizes a metal oxide semiconductor field - effect transistor ( mosfet ) to invert the on - off signal 100 of the engine ignition switch 12 , a differentiating circuit 26 which differentiates the output signal 102 of the signal inverter 25 and puts out a trigger signal 104 , a timer circuit 27 containing a monostable circuit or counter which puts out an on signal 106 for a fixed period of time ( 5 to 15 minutes ) when actuated by the trigger signal 104 and a relay circuit 28 whose contact is closed by the on signal 106 from the timer circuit 27 . furthermore , in this second embodiment as well as in the first embodiment , the solenoid valve 4 is normally closed and is opened when current flows through the solenoid 9 . accordingly , it opens the fuel vapor line 5 only when current flows from the relay circuit 28 to the solenoid 9 . in operation , when a running engine is shut down , the ignition switch 12 is switched off so that the signal sent to the signal inverter 25 changes from an on to an off as indicated by the signal 100 in fig3 . as shown in fig3 the signal inverter 25 inverts this signal 100 so that it becomes signal 102 . this signal 102 is differentiated by the differentiating circuit 26 and is changed into the trigger signal 104 which is sent to the timer circuit 27 . when triggered by this trigger signal 104 , the timer circuit 27 sends a relay actuating signal to the relay circuit 28 for a fixed period of time t , as shown by signal 106 in fig3 . the relay circuit 28 is actuated by signal 106 and is switched on as indicated by signal 108 in fig3 as long as signal 106 is on on and the solenoid 9 is thereby magnetized and the solenoid valve 4 is opened . accordingly , the fuel vapor line 5 is opened for a period of time t determined by the timer circuit 27 and the fuel vapor generated inside the float chamber 2 is adsorbed in the charcoal canister 6 via the fuel vapor line 5 . a time period which corresponds to the period during which intense evaporation occurs after the shut down of the engine is desirable for the actuation time of the timer circuit 27 . since the amount of fuel vapor generated after solenoid valve 4 is closed is not very large , there is very little emission into the atmosphere via the air intake 17 and the air filter . the vapor remains inside the air intake 17 and the intake manifold ( not shown ) thereby improving the starting performance of the engine when it is started . referring to fig4 shown therein is a third embodiment in accordance with the teachings of the present invention . in this third embodiment the fuel vapor line 5 is opened and closed by a solenoid valve 4 and a heat sensitive valve 29 . the solenoid valve 4 is a normally closed valve and opens only when the ignition switch 12 is off so that no current flows to the solenoid 9 from the battery 8 . furthermore , the heat sensitive valve 28 contains thermowax , etc . which responds to the temperature of the engine coolant and the valve 29 is designed such that the vapor line 5 is opened only when the engine coolant temperature exceeds a given value . in operation , when a running engine is shut down , the engine ignition switch 12 is switched off . this causes the solenoid valve 9 to be demagnetized so that the solenoid valve 4 is opened . meanwhile since the heat sensitive valve 29 remains open only so long as the temperature of the engine coolant exceeds a given value the fuel vapor line 5 is connected between the float chamber 2 and the charcoal canister 6 . accordingly , the large amounts of fuel vapor generated inside the float chamber 2 while the temperature exceeds a given value after the engine is shut down are adsorbed by the charcoal canister 6 so that emission into the outside air is prevented . when the engine is running , the ignition switch 12 is on and the solenoid 9 is magnetized . this causes the solenoid valve 4 to be closed so that the charcoal canister cannot adsorb the fuel vapor generated inside the float chamber 2 while the engine is running . furthermore , even when the engine is shut down , the fuel vapor inside the float chamber 2 is not adsorbed by the charcoal canister 6 so long as the temperature is below a given value since the fuel vapor line 5 is closed by the heat sensitive valve 29 . since in this case the temperature is low , little fuel vapor is generated inside the float chamber 2 and adsorption by the charcoal canister is unnecessary . furthermore , it should be apparent that even though in the above described embodiments the temperature of the engine coolant was one of the factors which determined whether the fuel vapor line 5 was open or closed , any other means of establishing an effective relationship between the opening and closing of the fuel vapor line 5 and the amount of fuel vapor present or generated inside the float chamber 2 would also be appropriate , for example , it would also be appropriate to establish a relationship between the opening and closing of the fuel vapor line 5 in the engine temperature or the temperature of the fuel inside the float chamber 2 . in all cases it is understood that the above described embodiments are merely illustrative of but a few of the many possible specific embodiments which represent the applications of the principles of the present invention . numerous and vary other arrangements can be readily devised by those skilled in the art without departing from the spirit and scope of the invention .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

as previously described , the present invention discloses an improved and generally cylindrical overall shaped dynamometer constructed from a plurality of individual and modified triangular handle meters which is designed to measure an individuals grip strength . as previously described , the hand dynamometer is useful in helping to diagnose the musculoskeletal disorders of the hand and to monitor the recover progress after a hand surgery or injury . referring again to fig1 , a cylindrical shaped dynamometer is generally shown at 10 and includes a base ( see as generally shown at 12 ), such as which is fastened or connected to an appropriate device or assembly ( not shown ) for receiving and subsequently modifying a signal representative of a generated input force . additionally not shown but understood to exist is the provision of appropriate mechanical to electrical signal technology for sensing the exertion of a mechanical force , converting the same to a digital or other electronic related scale , and transmitting a signal representative of the reading to an appropriate output . the dynamometer further exhibits a plurality of six individual elongate portions , ( also termed arms ) and which are shown at 14 , 16 , 18 , 20 , 22 and 24 . as is shown in fig2 and 3 , the configuration of each of the individual elongate portions 14 - 24 ( further represented in fig2 as selected portion 14 ) is such that they each exhibit a modified triangular shape with a slightly convex ( or outwardly projecting ) side , such that the elongate portions collectively define a generally cylindrical shape . as shown , the outer surface associated with each arm exhibits an angle of 60 °, with the six in total establishing the 360 ° circumferential rounded outer profile and a corresponding three dimensional elongated cylindrical shape . that said , it is also envisioned and understood that any plurality of individual arms or elongate portions , ranging from two , three , four , five , seven or more can be incorporated into alternate variants and within the scope of the invention . the base 12 exhibits a generally circular profile and in a preferred embodiment represents a common assembled base . without limitation , this can be further defined by the side - by - side aligning arrangement of outwardly annular projecting ends 26 , 28 , 30 , 32 , 34 and 36 corresponding to the elongate portions 14 , 16 , 18 , 20 , 22 and 24 . as further shown , a plurality of apertures 38 extend in a linear direction through the annular projecting ends , around its collective circumference , and so that a plurality of mounting fasteners ( not shown ) can be used to mount the dynamometer assembly to a desired input location such as corresponding to a housing associated with the testing device . as further shown in fig1 , a gap or spacing ( see at 40 , 42 , 44 , 46 , 48 and 50 ) is defined in linear extending fashion along a boundary associated with each mating pair of modified triangular elongate and gripping portions , e . g . as illustrated by boundary gap 40 between portions 14 and 16 , gap 42 between portions 16 and 18 , gap 44 between portions 18 and 20 , gap 46 between portions 22 and 20 , gap 48 between portions 24 and 22 and , finally , gap 50 between portions 24 and 14 . as further shown , the linear extending gaps terminate at locations a predetermined distance ( see for example at 52 associated with gap 48 ) short of the boundary location defined with the annular projecting base portions ( see also corresponding indicated distance 54 between the inner end of the gap 48 and the annular projecting end ). the degree of spacing or gapping , is determined according to the material properties of the elongate arm portions , as well as the desired testing parameters of the dynamometer assembly however , and as illustrated , can vary from some fraction less than 1 mm up to several mm . in this fashion , the generally circular outer profile exhibited by the assembled and gap spaced elongated and modified triangular shaped portions 14 - 24 is capable of being more ergonomically and comfortably grasped by a user . further , and upon being compressed , the dynamometer handle design more accurately records and converts a readout signal associated with the handle . the data collection occurs by virtue of the collective inward ( compressing ) deflection of the individual of the handle portions ( see arrows 54 ), the inner tapered edges of each of the arms deflecting towards one another in the fashion shown . the interior architecture associated with the handle design 10 includes an accessible recessed and lowermost location 56 , this defined within the handle 14 as shown in fig2 . strain gauge wires ( not shown ) extend from the recessed location 56 through an aperture 58 defined in the assembled base portion 28 and into the associated design machine . in this fashion , the assembled triangular shaped portions operate to convert a degree of mechanical compressive force applied to a signal which is transmitted via the inner extending wires ( again not shown in fig2 ) to the assembly housing upon which the dynamometer handle assembly 10 is mounted . the configuration and dimension of the assembled elongate triangular portions , such as in one non - limiting and preferred embodiment , defines a handle configuration of 40 mm diameter and 155 mm length . referring further to the side view of fig3 , additional dimensions associated with the illustrated embodiment include the dedicated height of the elongated portions ( as measured from a top edge of the annular projecting base ) being 140 mm , a further reduced 120 mm extending from a top surface of the recessed profile 56 , the profile further exhibiting a height of 20 mm and a width of 10 mm . finally , the annular projecting end portions exhibit a maximum outer radial ( cross sectional ) dimension of 35 mm , the associated triangular shaped portion exhibiting a maximum cross sectional dimension of 20 mm , and a fairly minute gap of 1 . 75 mm exhibited between a mating inner tapered edge of the triangular shaped portion ( see at 60 in fig2 ) and a corresponding inner tapered edge ( further at 62 ) associated with the projecting base portion . it is also envisioned and understood that material constructions associated with the handle design can include any of aluminum and titanium , metal composite or other materials exhibiting the desired properties of elongated spring deformation ( also known as cantilever deformation ) and resilience . additional to the disclosure presented above , other arrangements can be made in which different handle diameters and lengths are used . the handle is further unique in the fact that it uses shear strain gauges to measure the force applied to the arm . by measuring the shear strain the force level recorded on the handle will be independent of load location . in one preferred application , there further exist two gauges per individual triangular shaped arm portion , and which are placed within the recessed defined areas ( or pockets as again shown at 56 in fig2 located near the base of the handle . the extending channel 58 is again provided for the strain gauge wires to pass through the base of the handle , allowing them to attach to the data acquisition system previously described and associated with a housing to which the handle assembly 10 is mounted . the cylindrical handle meter can provide more useful information and more reliable grip strength measurement for the following reasons : 1 . the cylindrical shape of the handle is more comparable with the tool and mechanical handles widely used at workplaces , 2 . it is more comfortable for a person to grip on the cylindrical handle than other prior art handle designs , 3 . the measured strength on the cylindrical handle represents the total grip force that can be used for tool and machine ergonomic design , together with the friction force and torque that can also be estimated from the total grip force , 4 . the grip force distributed at the different parts of the hand can be measured on the cylindrical handle meter which may be important information for the diagnosis of hand disorders .” additionally , and whereas the basic functions associated with the handle dynamometer exhibit similarities previously known dynamometer handles that are currently used for such grip strength measurement , the provision of the cylindrical handle meter constitutes an improvement over prior art handle designs in that it provides more useful information and more reliable grip strength measurement for the following reasons : ( i ) the cylindrical shape of the handle is more comparable with the tool and machine handles widely used at workplaces ; ( ii ) it is more comfortable for a person to grip on the cylindrical handle than is associated with other prior art handle designs ; ( iii ) the measured strength on the cylindrical handle represents the total grip force that can be directly used for tool and machine ergonomic designs , together with the friction force and torque that can also be estimated from the total grip force ; ( iv ) the grip force distributed at the different parts of the hand can be measured on the cylindrical handle meter , which may be important information for the diagnosis of the hand disorders . it is further envisioned that the cylindrical and triangular shaped handle meter present a wide range of applications . for example , these can be used to help diagnosis hand - arm vibration syndrome , carpel tunnel syndrome , and other disorders of the upper extremities . it can be used as one of approaches to examine the hand strength for job requirement , to monitor the recover progress after a hand surgery or injury , and to collect grip strength data for tool and machine design . having described our invention , other and additional preferred embodiments will become apparent to those skilled in the art to which it pertains , and without deviating from the scope of the appended claims .

0Human Necessities

fig1 shows in block diagram format a communications network 100 which includes access / egress communications switches 104 and 105 that are connected to a common voice information system 109 via trunk facilities 50 and 60 , respectively . switches 104 and 105 are processor - controlled , software - driven communications systems that are arranged to route calls to destinations specified in call setup information received from end - user devices such as analog telephone sets 101 and 106 . a well - known communications switch is the lucent technologies 5ess ® switch whose features and functionality are described in different articles published in the at & amp ; t technical journal , vol . 64 , no . 6 , part 2 , pp . 1305 - 1564 , july / august , 1985 . communications switch 104 ( 105 ) also includes internal tables that correlate a subscriber &# 39 ; s line to communications services features associated with that line . for example , the internal table of communications switch 105 indicates that the subscriber &# 39 ; s line for telephone sets 101 and 106 are plain old telephone service ( pots ) facilities 10 and 11 , respectively . illustratively , the internal table of communications switch 105 may also indicate that telephone 106 is provisioned for call waiting service . it is worth noting that although the communications system 100 of fig1 does not show ( for the sake of simplicity ) any toll switches or inter - exchange carrier network , it is to be understood that one or more toll switches may be included in communications system 100 . communications switches 104 and 105 exchange call processing messages via signaling trunks 90 and 91 and a signaling network 111 which is comprised of a plurality of interconnected packet switching nodes that route call processing messages to their appropriate destinations according to a defined protocol , such as the well - known common channel signaling ( ccs ) protocol . trunk 80 carries telephone traffic other than signaling information between switches 104 and 105 . also shown in fig1 is voice information system 109 that includes a call processing unit that is arranged to execute a set of scripts stored therein . such scripts are executed to answer an incoming call and to greet a caller with a pre - recorded voice announcement inviting the caller to leave a message for a called party . voice information system 109 selects a particular set of scripts to be executed based on particular call processing messages received from communications switch 104 ( 105 ). a call processing message may instruct voice information system 109 to play a specific announcement to a caller based on terminating supervisory signals or call progress tones ( busy , ring - no - answer ) associated with an attempted call . for example , an announcement may indicate to a caller that the line for the called party is currently busy and the caller may either press “ 1 ” to send a call - waiting alert signal to the called party , or may press “ 2 ” to record a message that will be delivered to the called party as soon as the called party &# 39 ; s line becomes available . such an announcement , hereinafter called a “ call - waiting announcement ” may be a generic announcement that is delivered to all callers in waiting attempting to reach any call waiting subscriber . alternatively , the announcement delivered by voice information system 109 may be a personalized announcement pre - recorded by the call - waiting subscriber . in the latter case , the call - waiting subscriber would dial a particular number associated with the administrative functions of voice information system 109 . the call - waiting subscriber would be prompted to enter his or her telephone number and a personal identification number ( pin ). thereafter , the call - waiting subscriber would be prompted to record his or her personalized announcement . voice information system 109 also includes a memory 110 and a storage area 107 . memory 110 stores the script call processing messages and the digitized file representations of the announcements . storage area 107 contains the voice mailboxes that store recorded messages for call waiting subscriber &# 39 ; s lines . a voice information system may be implemented using a suitably modified lucent technologies intuity ® voice system whose architecture and features are described in an article entitled “ conversant voice system and applications ” by pardue et al . that was published in at & amp ; t technical journal vol . 65 , issue 5 , pp . 34 - 47 , september / october 1986 . when voice messaging system is recording a message destined for a call - waiting subscriber , the network office switch to which the telephone set of the called party is connected , “ listens ” to supervisory signals ( busy or line available ) in order to take specific actions . for example , when switch 104 ( 105 ) detects that the line for a called party is available , switch 104 ( 105 ) may terminate the message recording process and apply a ringing tone to the called party &# 39 ; s telephone set . it is worth noting that although fig1 shows a single messaging processing system 109 being connected to both communications switches 104 and 105 , it is to be understood that multiple messaging processing systems may be connected to individual switches without departing from the principles being disclosed herein . optionally , communications switching system 100 of fig1 may be replaced with a computer network ( not shown ) that is comprised of interconnected processing nodes ( including a messaging complex ) arranged to a ) switch digital signals according to a common addressing protocol , such as the internet protocol ( ip ), and b ) to deliver messaging information to callers in - waiting . the process contemplated by this disclosure is initiated in step 201 when communications system 100 receives a second call that is directed to a called party who is already busy on a first call . in order to facilitate a clearer explanation of the inventive concept disclosed herein , it would be assumed that the second call is initiated from telephone set 101 , and is directed to telephone set 106 . upon receiving the call setup information from telephone set 101 , communications switch 104 forwards the call setup information to communications switch 105 via signaling network 111 . communications switch 105 uses its internal tables to ascertain whether the called party line i . e ., line 11 , is a call - waiting subscriber &# 39 ; s line . if line 11 is not provisioned for call waiting , as determined in step 202 , communications switch 105 sends a call processing message to communications switch 104 instructing switch 104 to apply a busy tone to telephone set 101 in step 203 . if line 11 is a call - waiting subscriber line , as determined in step 202 , communications switch 105 sends a call processing message to voice information system 109 to instruct voice information system 109 to execute the call waiting announcement script described above . such call - processing message includes the caller &# 39 ; s telephone number as well as the called party &# 39 ; s telephone number . specifically , voice information system 109 , upon receiving the call processing message from communications switch 105 , fetches memory 110 to retrieve the call - waiting announcement that is delivered to the caller in step 204 . as indicated above , the announcement offers the caller the option of either sending a call - waiting alert signal to the called party &# 39 ; s telephone set by pressing “ 1 ”, or to record a message to be delivered to the called party as soon as the line becomes available by pressing “ 2 ”. alternatively , the caller may be prompted to utter “ 1 ” or “ 2 ” when voice information system 109 includes speech recognition hardware and software . if the caller selects the first option , as determined in step 205 , voice information system 109 fetches memory 110 to retrieve a call processing message that is forwarded to communications switch 105 . upon receiving the call - processing message , communications switch 105 , in step 206 , applies an in - band call waiting alert signal to telephone set 106 . when the caller selects the second option , as determined in step 205 , voice information system 109 in step 207 , delivers a second announcement to the caller inviting him or her to start recording a message after the delivery of a high pitch tone . voice information system 109 time stamps the recorded message and stores such message in a voice mailbox associated with the telephone number of the call waiting subscriber . while the message is being recorded , communications switch 105 in step 208 , monitors the called party &# 39 ; s line i . e ., line 11 , to ascertain whether the line is no longer seized . if line 11 becomes available during the message recording process , as determined in step 209 , communications switch 105 in step 210 , interrupts the message recording process and applies a ringing tone to telephone 106 . if line 11 remains seized , throughout the message recording process , as determined in step 209 , communications switch 105 in step 211 , continues to monitor the line after the message recording process is terminated . communications switch 105 continues to monitor line 11 in step 211 until the line becomes available , as determined in step 212 . immediately after the line becomes available , communications switch 105 applies a ringing tone to the call waiting subscriber &# 39 ; s telephone set while simultaneously sending a call processing message to voice information system 109 to trigger the delivery of the recorded message to the call waiting subscribe . the call processing message includes the call waiting subscriber &# 39 ; s telephone number that is used by voice information system 109 to retrieve from storage area 107 the recorded message from the voice mail box associated with that telephone number . when the call - waiting subscriber answers the call , communications switch 105 establishes a communications path from the caller &# 39 ; s telephone set , i . e ., set 106 to voice information system 109 for delivery of the recorded message in step 213 . optionally , voice information system 109 may deliver an announcement before the recorded message . such an announcement may indicate , for example , the number of recorded messages , if appropriate , the time such recorded message was received by voice information system 109 , as well as the telephone number of the caller . if more than one message was recorded while the call - waiting subscriber was on the line , the recorded messages are delivered by voice information system 109 in the chronological order in which the messages were recorded , i . e ., first message recorded , first message delivered . alternatively , such recorded messages may be delivered in reverse chronological order , i . e ., last message recorded , first message delivered . if the call - waiting subscriber does not answer the call for delivery of the recorded message , communications switch 105 may re - initiate the call after a pre - determined period of time . alternatively , if the call - waiting subscriber is also a voice mail subscriber , communications switch 105 may apply a stutter dial tone to telephone set 106 when an off - hook condition is detected for such telephone set . after a recorded message is delivered to the caller , voice information system 109 , in step 214 , may optionally prompt the call - waiting subscriber to press a key on the dial pad of telephone set 106 , if the subscriber wishes for communications network 100 to dial the telephone number of the party who recorded the message . the foregoing is to be construed as being only an illustrative embodiment of the principles of this disclosure . persons skilled in the art can easily conceive of alternative arrangements providing functionality similar to this embodiment without any deviation from the fundamental principles or the scope of this disclosure .

7Electricity

referring now to the drawings and particularly to fig1 the preferred embodiment of a torque sensor unit 1 , according to the present invention , comprises a shaft member 2 about which an exerted torque is to be measured , and a sensor assembly 8 . the shaft member 2 is formed with tilted grooves 3a and 3b which are tilted with respect to the axis of the shaft member at a predetermined angle , e . g . 45 °. the tilting directions of the grooves 3a and 3b are opposite to each other so that anisotropy is provided between the sections of the grooves 3a and 3b . the tilted grooves 3a and 3b are separated by lands 4a and 4b extending in tilted fashion between the grooves . the sensor assembly 8 comprises a pair of annular coils 5a and 5b , arranged in opposition to the section where the grooves 3a and 3b are provided . the coils 5a and 5b are received on a yoke 7 having an magnetically separating annular projection 6 extending from the position intermediate between coil receptacle portions for receiving the coils 5a and 5b . the yoke 7 is formed of a material with a high permeability . the coils 5a and 5b form a bridge circuit together with resistors 11 and 12 . a variable resistor 13 for balancing is also disposed between junctions b and b &# 39 ; between the coil 5a and the resistor 11 and between the coil 5b and the resistor 12 . junctions a and c respectively between the coils 5a and 5b and between the resistors 11 and 12 are connected to an oscillator 14 . the oscillator 14 is designed to energize the coils 5a and 5b by an oscillating frequency signal . the junctions b and b &# 39 ; are connected to a differential amplifier 15 . the differential amplifier 15 is designed to output a signal indicative of the monitored torque through output terminals 16 and 17 . the coils 5a and 5b are energized by the signal supplied by the oscillator 14 , generating a magnetic flux extending through the associated portions of the shaft member 2 , for which associated portions of the grooves 3a and 3b are used to form magnetic circuits . in the shown embodiment , the coils 5a and 5b serve as the electromagnetic coils for forming these magnetic circuits and the detector coils for detecting variation of permeability in the associated portions . in the practical operation of monitoring torque to be exerted on the shaft member 2 , the oscillator 14 supplies a signal of constant amplitude ( v ) and constant frequency ( f ) to the coils 5a and 5b . consequently , the coils 5a and 5b generate magnetic flux therearound . the magnetic flux generated by the coils forms a magnetic loop circuit extending the gap between the yoke 7 and the shaft member 2 , and the grooved portions 3a , 3b of the shaft member . because the power applied to the coils 5a and 5b is alternating current , eddy currents are induced in the shaft member . the level of the eddy currents may be increased by increasing the frequency of the signal applied to the coils 5a and 5b . the magnitude of eddy currents is maximum at the radial center of the shaft member and zero at the external surface . therefore , the magnetization at the surface can follow variations of the magnetic field . however , variations of magnetization at the center is prevented by the strong eddy currents . therefore , the magnetic flux generated by coils 5a and 5b flows through the surface of the shaft member . for the magnetic flux flowing on the surface of the shaft member 2 , the grooves 3a and 3b serve as a resistance so that the area of flow of the magnetic flux is generally limited to the lands 4a and 4b defined between adjacent grooves 3a and 3b , respectively . therefore , configuration and tilting angle of the grooves 3a and 3b and the lands 4a and 4b substantially influences anisotropy . as shown in fig1 the tilting directions of the grooves 3a and 3b and the lands 4a and 4b are opposite to each other with equal tilting angle with respect to the axis of the shaft member 2 . the best tilting angle is selected at an angle corresponding to the direction of the primary stress exerted on the shaft member . since the primary stress is exerted at an angle of approximately 45 °, the tilting angles of the grooves 3a and 3b and the lands 4a and 4b employed in the shown embodiment are selected to be 45 °. as a result , the magnetostriction at the lands 4a and 4b , which are oriented at an outermost position , is maximum in response to the torque exerted on the shaft . assuming the torque t as shown in fig1 is exerted on the shaft member , maximum tension stress + σ is exerted on the lands 4a and maximum compression stress - σ is exerted on the lands 4b . assuming that the shaft member 2 has positive magnetostriction characteristics , permeability at the lands 4a increases according to increasing tension stress , while the permeability at the lands 4b decreases according to increasing compression stress . this causes an increase of inductance at the coil 5a and a decrease of inductance at the coil 5b . this destroys the balance in the bridge circuit of fig2 so that a torque detection output corresponding to the magnitude of the exerted torque appears on the output terminals 16 and 17 . on the other hand , when a torque in the opposite direction is exerted , maximum tension stress + σ is exerted on the lands 4b and maximum compression stress - σ is exerted on the lands 4a . the permeability at the lands 4b increases according to increasing tension stress and the permeability at the lands 4a decreases according to increasing compression stress . this causes an increase of inductance at the coil 5b and a decrease of inductance at the coil 5a . this destroys the balance in the bridge circuit of fig2 so that a torque detection output corresponding to the magnitude of the exerted torque appears on the output terminals 16 and 17 . assuming that the inductances of the coils 5a and 5b are respectively l 1 and l 2 , the resistance of both of the resistors 11 and 12 are r , the amplitude and the frequency of the alternating current power generated by the oscillator 14 are respectively v and f , the current levels i 1 and i 2 , flowing through the components a - b - c and a - b &# 39 ;- c of the bridge circuit , respectively can be illustrated by : from , the equations set out above , the potential v 1 at the junction b can be illustrated by : similarly , the potential v 2 at the junction b &# 39 ; can be illustrated by : therefore , the difference of potential at the junctions b and b &# 39 ; can be illustrated by | v 1 - v 2 |. this can be converted into : by calculating the above using the differential amplifier 15 , an output indicative of the torque can be obtained . it should be appreciated that , according to the shown embodiment , by tilting the symmetrically formed grooves with opposite tilting angles , influence of the temperature variation for the permeability can be successfully canceled maintaining a constant zero torque output point . this technology is advantageously introduced in order to provide an adequately high accuracy in measurement of the torque exerted on the shaft member . in a first embodiment , the part of the shaft member 2 serving as part of magnetic circuit or the whole of the shaft member is made of a steel which has the following composition : ni : less than or equal to 5 . 0 wt % and / or cr : less than or equal to 5 . 0 wt %. the content of c is preferred in the range set forth above . as will be appreciated , an adequate amount of c in the steel is necessary to provide sufficient strength for mechanical structural use , such as for axles or shafts in an automotive power train . in order to provide sufficient strength for the steel , 0 . 25 wt % is a minimum content for using the steel for forming driver shaft , column shaft and so forth . on the other hand , excessive content of c will lower toughness or degrade workability in cold rolling . therefore , a maximum content of c is set at 1 . 5 wt %. in the case that the steel is subject to carburizing , the content of c is limited to be less than or equal to 0 . 35 wt %, so that the c content during carburizing does not exceed 1 . 5 wt %. on the other hand , si is used as a deoxidation agent and , in addition , as a material for reinforcing strength . however , when an excessive amount of si is contained in the steel , it degrades toughness . therefore , the content of si has to be limited to be less than or equal to 1 . 0 wt %. on the other hand , mn is used as deoxidation flux and desulphurization flux . mn is known to improve hardenability and increase strength . however , an excessive amount of mn may cause degradation of workability . therefore , the maximum content of mn in the steel is set at 2 . 0 wt %. ni and cr are known as materials which can improve hardenability and improve strength of the material . on the other hand , ni has a property for influencing the sensitivity of torque variation . namely , increasing the content of ni will cause an increase of hysteresis which causes an increase of angle θ in fig3 causing an expansion of the distance h . in order to maintain the hysteresis in an acceptable range , the content of ni should be less than or equal to 5 . 0 wt %. on the other hand , increasing the content of cr reduces hysteresis . however , an excessive amount of cr tends to lower the sensitivity below an acceptable level . therefore , the maximum amount of cr to be contained in the steel is set at 5 wt %. the steel for forming the shaft member may contain one or more materials selected from the following materials : the materials set forth above may provide improved machinability so as to improve workability in finishing the shaft member . the steel for forming the shaft member may further contain one or more materials selected from the following materials : cu and mo are known as materials for increasing the strength of the base material of the steel . therefore , these materials can be added if desirable . however , when an excess amount of cu is added in the steel , it may lower hot workability . on the other hand , an excess amount of mo may adversely influence the toughness of the steel . therefore , the amount of cu and mo to be added is better to be limited in the range set forth above . b can be added for improving hardenability . furthermore , one or more selected among w , v , ti , nb , ta , zr , hf , al and n may be used for obtaining fine crystals and increasing the strength of the steel by precipitation hardening . according to the shown embodiment set forth above , experiments were performed with respect to examples 1 to 11 . in order to compare the result of the examples , an additional and comparative experiment was performed with respect to a comparative example 12 . the compositions of samples of the shaft member in examples 1 to 11 , the comparative example 12 , as well as heat treatment conditions , sensitivity and hysteresis are shown in the appended table i . in the experiments , the oscillator 14 was set to generate an alternating current having a frequency of 30 khz and an amplitude of 30 ma . by exerting a torque with a magnitude of 20 kgf . m , the sensitivity which corresponds to the rising angle θ of the line in fig3 and hysteresis which corresponds to the distance h of the lines in fig3 were checked in the experiments . as will be seen from the appended table i , the examples 1 to 11 show an adequately high sensitivity and an adequately small magnitude of hysteresis . in comparison with these examples , the comparative example exhibits substantially high sensitivity . however , in the comparative example , the magnitude of the hysteresis is unacceptably large . in a second embodiment , the part of the shaft member 2 ( serving as part of the magnetic circuit ) or the whole of the shaft member is made of a steel which has the following composition : si : less than or equal to 4 . 0 wt % ( when co is not contained , more than or equal to 0 . 5 wt % and less than or equal to 4 . 0 wt %); ni : less than or equal to 5 . 0 wt % and / or cr : less than or equal to 5 . 0 wt %. the content of c is preferred in the range set forth above . as will be appreciated , an adequate amount of c in the steel is necessary to provide sufficient strength for using as a steel for mechanical structural use , such as for axles or shafts in an automotive power train . in order to provide sufficient strength for the steel , 0 . 1 wt % is a minimum content for using the steel for forming driver shaft , column shaft and so forth . on the other hand , excessive content of c will lower toughness or degrade workability in cold rolling . therefore , a maximum content of c is set at 1 . 5 wt %. in the case that the steel is subject to carburizing , content of c is to be limited to be less than or equal to 0 . 35 wt % so that c content during carburizing does not exceed 1 . 5 wt %. on the other hand , si is used for deoxidation agent and , in addition , is known as a material for reinforcing the strength . however , when an excessive amount of si is contained in the steel , it degrades toughness . therefore , the content of si has to be limited to be less than or equal to 4 . 0 wt %. in the case that the composition of the shaft member does not contain co , an improvement of sensitivity is insufficient with a content less than 0 . 5 wt %. therefore , when co is not contained , the content of si has to be greater than or equal to 0 . 5 wt %. on the other hand , mn is used as deoxidation flux and desulphurization flux . mn is known to improve hardenability and increase strength . however , an excessive amount of mn may cause degradation of workability . therefore , the maximum content of mn in the steel is set at 3 . 0 wt %. al is effective for improving sensitivity and reducing hysteresis . furthermore , al is effective for making the crystal steel smaller and improves wear resistance and fatigue strength . al is especially advantageous when nitriding treatment is performed . however , when the al content exceeds 3 . 0 wt %, it lowers the steel &# 39 ; s toughness . therefore , the al content is limited to be less than or equal to 3 . 0 wt %. co improves sensitivity . therefore , co can be added to the material of the shaft member . when co is added , the content of si can be less than 0 . 5 wt % without causing a reduction in sensitivity . on the other hand , when an excess amount of co is added , hysteresis is increased and hardenability can be lowered . therefore , the content of co to be added is limited to be less than or equal to 5 . 0 wt %. ni and cr are known as materials which can improve hardenability and improve the strength of the material . on the other hand , ni has a property for influencing the sensitivity to torque variation . namely , increasing the content of ni will increase hysteresis , which will increase angle θ in fig3 causing an increase in the distance h . in order to maintain the hysteresis in an acceptable range , the content of ni is preferred to be less than or equal to 5 . 0 wt %. on the other hand , increasing the content of cr serves to reduce hysteresis . however , an excessive amount of cr tends to lower sensitivity below an acceptable level . therefore , the maximum amount of cr to be contained in the steel is set at 5 wt %. the steel for forming the shaft member may contain one or more materials selected from the following materials : the materials set forth above may provide improved machinability so as to improve workability in finishing the shaft member . the steel for forming the shaft member may further contain one or more materials selected from the following materials : cu and mo are known as materials for increasing the strength of the base material of the steel . therefore , these materials can be added if desirable . however , when an excess amount of cu is added in the steel , it may lower hot workability . on the other hand , an excess amount of mo may influence the toughness of the steel . therefore , the amount of cu and mo to be added is better limited to the range set forth above . b can be added for improving hardenability . furthermore , one or more selected among w , v , ti , nb , ta , zr , hf and n may be used to obtain fine crystal and to increase the strength of the steel by precipitation hardening . at first , an experiment was conducted for testing the relationship between sensitivity and content of si , and samples were formed of material steels having the following composition : al : 0 . 03 wt % the content of si was 0 . 25 wt %, 0 . 5 wt %, 1 . 0 wt %, 2 . 0 wt %, 4 . 0 wt % and 5 . 0 wt %. the samples were produced by melting the material steel in a vacuum induction furnace and then forged . the samples were then formed into round bars of 20 mm diameter . the samples were provided tilted grooves 3a and 3b and the lands 4a and 4b with tilting angle of 45 °. the grooves were respectively shaped to have a width of 2 mm , depth of 1 mm . respective samples were subject to oil hardening and carburizing at 910 ° c . for three hours and subsequently subject to tempering at 170 ° c . for two hours . for the torque sensor including the shaft member prepared as set forth above , the oscillator 14 output a signal with a frequency of 30 khz and an amplitude of 30 ma . at this condition , torque with a magnitude of 20 kgf . m was exerted for sensitivity testing . the result of the testing is shown in fig4 . as is clear from fig4 sensitivity increases as the content of si increases in the sample . however , as can be seen in fig4 a substantial increase in sensitivity cannot be obtained if the si content is greater than 4 wt %. according to the second embodiment set forth above , other experiments were performed with respect to examples 13 to 26 . in order to compare the result of the examples , an additional comparative experiment was performed with respect to comparative examples 27 and 28 . the composition of samples of the shaft member in examples 13 to 26 and the comparative examples 27 and 28 , as well as the heat treatment conditions , sensitivity and hysteresis are shown in the appended table ii . in the experiments , the oscillator 14 was set to generate alternating current having a frequency of 30 khz and an amplitude of 30 ma . by exerting a torque with a magnitude of 20 kgf . m , the sensitivity which corresponds to the rising angle θ of the line in fig3 and the hysteresis which corresponds to the distance h of lines in fig3 were checked in the experiments . as will be seen from the appended table ii , the examples 13 to 26 show satisfactorily high sensitivity and satisfactorily small magnitude of hysteresis . in comparison with these examples , the comparative example 27 exhibits acceptably high sensitivity . however , in the comparative example 27 , the magnitude of the hysteresis is unacceptably large . on the other hand , the comparative example 28 has unacceptably low sensitivity . further experiments were performed with respect to samples as shown in the appended table iii . in the table iii , there are shown examples 29 to 42 and comparative examples 43 and 44 . as seen from table iii , the samples in the examples had various , mutually distinct compositions and were subject to various heat treatment processes . for respective samples produced according to the conditions and compositions listed in the table iii , tests were performed with the same conditions as set forth with respect to the examples 13 to 28 . the sensitivity and hysteresis monitored with respect to each of the examples are shown in the table iii . as will be appreciated from the examples in table iii , the samples which were treated by the carburizing process had a better sensitivity level and smaller hysteresis as shown in the examples 29 to 42 . on the other hand , as observed with respect to the example 43 which had a co content of 6 . 52 wt % greater than the maximum acceptable content , i . e . 5 wt %; and with respect to the example 44 which has a ni content of 6 . 02 wt % greater than the maximum acceptable content 5 wt %, the hysteresis was unacceptably high , though these examples had high sensitivity levels . on the other hand , as seen from fig5 when the content of co is increased , sufficiently high sensitivity can be obtained even when the si content is smaller than 0 . 5 wt %. in a third embodiment , the shaft member forming part of the torque sensor according to the present invention is made of fe - al alloy which is provided by the following composition : total content 0 . 01 wt % to 5 . 0 wt % of one or two materials selected among b , si , ge , sn , pb , p , sb , cu , ni , co , mn , cr , mo , w , v , nb , ta , ti , zr , hf , be , sc , y and other rare earth metals ; and a remaining content of fe . al is effective for improving sensitivity and reducing hysteresis . furthermore , al is effective for making the crystal steel smaller and improves wear resistance and fatigue strength . al especially is advantageous when nitriding treatment is performed . therefore , the content of al is set to 11 . 0 wt % at the minimum . on the other hand , when the al content exceeds 15 . 0 wt %, it causes lowering or toughness . therefore , the al content is limited to be less than or equal to 15 . 0 wt %. for the fe - al alloy set out above , c in a content of 0 . 01 wt % to 0 . 50 wt % can be added . the additional one or two materials , i . e . the total content 0 . 01 wt % to 5 . 0 wt % of one or two materials selected among b , si , ge , sn , pb , p , sb , cu , ni , co , mn , cr , mo , w , v , nb , ta , ti , zr , hf , be , sc , y and other rare earth metals , are added to serve as deoxidation flux and desulphurization flux , in order to increase strength by solid solution precipitation hardening , and to aid fine crystallization of the steel , or to improve toughness . furthermore , c , w and cr serve to suppress diffusion mobility or to improve malleability . on the other hand , the excess amount of these materials may cause a lowering of workability , a lowering of toughness , a lowering of sensitivity of magnetostriction component and / or an increasing of hysteresis . therefore , the total content of these materials are selected in a range of 0 . 01 wt % to 5 . 0 wt %. experiments were performed with respect to samples having compositions as shown in the appended table iv . the samples were produced by melting 50 kg of fe - al alloy by the vacuum induction furnace , by forging and subsequent machining . the samples were subject to heat treatment according to the conditions as set forth in table iv . the samples were provided tilted grooves 3a and 3b and lands 4a and 4b with a tilting angle of 45 °. the grooves were respectively shaped to have a width of 2 mm and a depth of 1 mm . for the torque sensor including the shaft member prepared as set forth above , the signal output by the oscillator 14 has a frequency of 30 khz and amplitude of 30 ma . at this condition , torque with a magnitude of 20 kgf . m was exerted for testing sensitivity . the result of the testing is shown in the table iv . as will be clear from fig4 sensitivity increases according to an increase in the content of si in the sample . in addition , in order to test mechanical characteristics of the samples , a tensile test was performed . results of the tensile test are also shown in table iv . as seen from the appended table iv , the examples 45 , 46 and 47 contain al : 11 . 0 wt % to 15 wt %; and 0 . 01 wt % to 5 . 0 wt % of one or two materials selected among b , si , ge , sn , pb , p , sb , cu , ni , co , mn , cr , mo , w , v , nb , ta , ti , zr , hf , be , sc , y and other rare earth metals ; and the remaining content , fe . on the other hand , the examples 48 and 49 contain 0 . 01 wt % to 0 . 50 wt % of c , and one or two of cr , mo , w , v , nb , ta , ti , zr , hf in the total content of 0 . 01 to 0 . 05 wt . the examples 50 , 51 , 52 and 53 contain one or more of the materials selected among b , si , ge , sn , pb , p , sb , cu , ni , co , mn , be , sc , y or other rare earth metals ; c ; and one or more of cr , mo , w , v , nb , ta , ti , zr , hf . in these examples 45 to 53 , the sensitivity level is 1 . 3 v / kgf . m to 2 . 7 v / kgf . m . this sensitivity level is much higher than that of the comparative example 57 which employs steel for mechanical structural use according to jis s30c . in comparison with the examples 50 to 53 with the comparative example 54 which is composed of fe and al , it will be seen that the comparative example 54 has an acceptable level of sensitivity but lacks mechanical strength . this is good evidence that addition of the aforementioned materials will improve strength , toughness and workability . on the other hand , as seen from the comparative examples 55 and 56 , when the excess content of b , si , ge , sn , pb , p , sb , cu , ni , co , mn , cr , mo , w , v , nb , ta , ti , zr , hf , be , sc , y and other rare earth metal is added , the sensitivity becomes 0 . 7 v / kgf . m and 0 . 5 v / kgf . m , which are not acceptable . in a fourth embodiment , the shaft member forming part of the torque sensor according to the present invention is made of an fe - al alloy which contains 11 . 0 wt % to 15 wt % of al . the fe - al alloy is subject to heat treatment and the alloy is cooled from a temperature higher than or equal to 500 ° c . at a cooling speed of 500 ° c ./ hr . the alloy may further contain a total content 0 . 01 wt % to 5 . 0 wt % of one or two materials selected from among b , si , ge , sn , pb , p , sb , cu , ni , co , mn , cr , mo , w , v , nb , ta , ti , zr , hf , be , sc , y and other rare earth metals . as set forth in the former embodiment , al is effective for improving sensitivity and reducing hysteresis . furthermore , al is effective for making the crystal steel smaller and improves wear resistance and fatigue strength . al is especially advantageous when nitriding treatment is performed . therefore , the content of al is set at a minimum of 11 . 0 wt %. on the other hand , when the al content exceeds 15 . 0 wt %, it causes a lowering of toughness . therefore , the al content is limited to be less than or equal to 15 . 0 wt %. the additional one or two materials , i . e . a total content 0 . 01 wt % to 5 . 0 wt % of one or two materials selected among b , si , ge , sn , pb , p , sb , cu , ni , co , mn , cr , mo , w , v , nb , ta , ti , zr , hf , be , sc , y and other rare earth metals , are added to serve as deoxidation flux , desulphurization flux , in order to increase strength by solid solution precipitation hardening , to aid for fine crystallization of the steel , or to improve toughness . furthermore , c , w and cr serve to suppress diffusion mobility or to improve malleability . on the other hand , an excess amount of these materials may cause a lowering of workability , lowering of toughness , lowering of sensitivity of magnetostriction component and / or increasing of hysteresis . therefore , the total content of these materials are selected in a range of 0 . 01 wt % to 5 . 0 wt %. experiments were performed with respect to samples having compositions as shown in the appended table b . the samples were produced by melting 50 kg of fe - al alloy using a vacuum induction furnace , then forging and subsequent machining . the samples were subject to heat treatment according to the condition as set in the table v . the samples were provided tilted grooves 3a and 3b and the lands 4a and 4b with a tilting angle of 45 °. the grooves were respectively shaped to have a width of 2 mm , and a depth of 1 mm . for the torque sensor including the shaft member prepared as set forth above , the oscillator 14 supplied a signal with a frequency of 30 khz and amplitude of 30 ma . at this condition , torque in a magnitude of 20 kgf . m was exerted for testing sensitivity . the result of the testing is shown in the table v . as will be clear from fig4 the sensitivity increases according to an increase in the content of si in the sample . in addition , in order to test mechanical characteristics of the samples , a tensile test was performed . results of tensile test are also shown in table v . as seen from the appended table v , the examples 58 , 59 , 60 and 61 contain al in a range of 11 . 0 wt % to 15 wt %. for these samples , heat treatment for cooling from the temperature higher than or equal to 500 ° at a cooling speed 500 ° c ./ hr were performed . in this case , the examples 58 , 59 , 60 and 61 had sensitivities in a range of 1 . 5 v / kgf . m to 3 . 2 v / kgf . m , and hysteresis in a range of 0 % to 7 %. the obtained sensitivity and the hysteresis is generally acceptable . in comparison to this , in the case of the comparative example 69 which had al content in the range of 11 . 0 wt % to 15 . 0 wt % and which was subjected to heat treatment at lower cooling speed , had an unacceptably large hysteresis . on the other hand , the comparative example 71 has an al content of 9 . 5 wt %, which is smaller than the minimum content , i . e . 11 . 0 wt % but which was subjected to heat treatment satisfying the condition set forth above . however , the sensitivity was held at 1 . 0 v / kgf . m which is unacceptably low and had a hysteresis of 14 % which was unacceptably large . on the other hand , the comparative example 72 had an al content of 16 . 5 wt % which is greater than the acceptable maximum content , i . e . 15 wt %. for this comparative example , heat treatment satisfying the condition set forth above was performed . however , the sensitivity was 0 . 9 v / kgf . m and hysteresis was 7 %. however , the comparative example 72 was not satisfactory in the sensitivity level . on the other hand , the examples 62 , 63 and 64 contain a total content 0 . 01 wt % to 5 . 0 wt % of one or two materials selected among b , si , ge , sn , pb , p , sb , cu , ni , co , mn , cr , mo , w , v , nb , ta , ti , zr , hf , be , sc , y and other rare earth metals , and the heat treatment for cooling from a temperature higher than or equal to 500 ° c . at the cooling speed 500 ° c ./ hr was performed . further , the examples 65 and 66 contain 0 . 01 wt % to 0 . 50 wt % of c and 0 . 01 to 0 . 05 wt % of one or two of cr , mo , w , v , nb , ta , ti , zr , hf . for examples 65 and 66 , the heat treatment for cooling from a temperature higher than or equal to 500 ° c . at the cooling speed 500 ° c ./ hr was performed . for examples 62 to 66 , the sensitivity was in a range of 1 . 3 v / kgf . m to 2 . 7 v / kgf . m and hysteresis was in a range of 2 % to 6 %. as will be appreciated herefrom , one or more of the materials selected among b , si , ge , sn , pb , p , sb , cu , ni , co , mn , be , sc , y and other rare earth metals ; c ; and one or more of cr , mo , w , v , nb , ta , ti , zr , hf , had sensitivity levels much higher than that of the comparative example which contains only al . the comparative examples contain a sample , which is composed of only fe and al , and which has acceptable levels of sensitivity but lacks mechanical strength . this is good evidence that addition of the aforementioned materials will improve strength , toughness and workability . when the content of one or two materials selected among b , si , ge , sn , pb , p , sb , cu , ni , co , mn , cr , mo , w , v , nb , ta , ti , zr , hf , be , sc , y and other rare earth metals , is in excess of the maximum content , 5 . 0 wt % as in the comparative example 57 , the sensitivity was 0 . 7 v / kgf . m and the hysteresis was 17 %. both values were not acceptable . when the starting temperature of cooling in the heat treatment is 400 ° c . which is lower than 500 ° c . as in the comparative example 58 , the sensitivity was 0 . 8 v / kgf . m which is unacceptable . also , in this comparative example , hysteresis was also unacceptably large . for the samples corresponding to the examples 59 and 67 , output characteristics were tested by varying the cooling speed . the samples in example 59 are heated at 1100 ° c . for three hours and subsequently slowly cooled down to 700 ° c . from 700 ° c ., the samples in the example 59 were cooled at various cooling speeds . on the other hand , the samples in the example 67 were heated at 1100 ° c . for three hours and subsequently cooled at various cooling speeds . the outputs of the torque sensor were monitored and illustrated in fig6 . as can be seen in fig6 when the cooling took place in h 2 atmosphere or vacuum atmosphere at a cooling speed 100 ° c ./ hr and 300 ° c ./ hr , hysteresis was held higher than 10 %. when cooling was taken place in h 2 atmosphere or in vacuum at a cooling speed 500 ° c ./ hr , 1000 ° c ./ hr , 5000 ° c ./ hr , or when oil cooling took place in vacuum , hysteresis could be held below 10 %. a fifth embodiment of the invention will now be described . in the embodiments set forth previously , the shaft member 2 has a property which satisfies one of the following conditions ( a ), ( b ) and ( c ): ( b ) ratio between saturated magnetostriction and crystalline magnetic anisotropy coefficient k 1 ( j / m 3 satisfies , an elastic limit τ e ( kgf . mm 2 versus twisting stress can satisfy ; 0 . 2 % yield point τ 0 . 2 ( kgf . mm 2 to twisting stress can satisfy ; ( c ) a holding capacity hc ( oe ) of the magnetic force can satisfy : and / or the initial permeability μ i is in a range of : and the maximum permeability μ m is in a range of : the saturated magnetostriction λs is variable depending upon the material of the shaft member . the sensitivity of the exerted torque rose according to an increase in the saturated magnetostriction . therefore , it is preferable to maintain the saturated magnetostriction higher than or equal to 0 . 5 × 10 - 6 . on the other hand , when the saturated magnetostriction λs becomes in excess of 15 × 10 - 6 , hysteresis can increase to an unacceptable level due to a decrease of the ratio | λs / k 1 | of the saturated magnetostriction λs versus the crystalline magnetic anisotropy coefficient k 1 ( j / m 3 ). therefore , concerning the saturated magnetostriction , the condition set forth above is set . the crystalline magnetic anisotropy coefficient k 1 is an indication of the magnetic anisotropy of crystalline magnetic material . the magnitude of anisotropy is variable depending upon composition of the material , crystalline structure , metrographical structure and so forth . also , exerted stresses , i . e . twisting torque . the ratio | λs / k 1 | of the saturated magnetostriction λs versus the crystalline magnetic anisotropy coefficient k 1 ( j / m 3 ) corresponds to the maximum stress which can be exerted without causing hysteresis . therefore , when the stress exerted on the shaft member becomes greater than | λs / k 1 |, the output of the torque sensor begins to vary in a non - linear fashion causing hysteresis . for the case of a drive shaft in the automotive power train , a large torque may be exerted thereto . therefore , in view of the possible magnitude of the torque to be exerted , it is preferred to set the value of | λs / k 1 | to be greater than or equal to 6 × 10 8 ( j / m 3 ). on the other hand , even when the exerted stress is smaller than or equal to the | λs / k 1 | value , plastic deformation may be induced in the shaft member , such as a drive shaft , when a substantially large torque is exerted , if the elastic limit τ e ( kgf . mm 2 of the material steel is small . this plastic deformation of the shaft member may cause hysteresis . in order to avoid this , it is preferred to set the elastic limit τ e at a value greater than or equal to 20 kgf . mm 2 . otherwise , the 0 . 2 % yield point versus twisting stress is greater than or equal to 40 kgf . mm 2 . in order to test the performance of the shown embodiment , experiments were performed . the experiments were performed with respect to a shaft member made of a steel containing fe as a primary component , and c , si , mn , ni , cr and / or mo . in production , the composite material of 50 kg was molten in the vacuum induction furnace . the samples were subsequently treated by forging , normalizing and machining . then , hardening and tempering were performed in various conditions as shown in the appended table vi . the samples were provided tilted grooves 3a and 3b and the lands 4a and 4b with tilting angle of 45 °. the grooves were respectively shaped to have a width of 2 mm and a depth of 1 mm . for the torque sensor including the shaft member prepared as set forth above , the oscillator 14 supplied a signal with a frequency of 30 khz and an amplitude of 100 ma . at these conditions , torque with a magnitude of 30 kgf . m was exerted for testing sensitivity . a test was performed to monitor magnetic characteristics , mechanical characteristics and saturated magnetostriction λs . the magnetostriction λs was measured by a strain gauge . also , the crystalline magnetic anisotropy coefficient k 1 was monitored using a torque method . magnet keeping capacity hc , initial permeability μ i and maximum permeability μ m were read from b - h curves utilizing a magnetic ring test piece . the initial permeability μ i was derived when a permeability at magnetic field h is 5 ( oe ). twisting stress was measured by attaching a strain gauge and producing a shearing stress - strain curve . the point where the shearing stress - strain curve deviates from a straight line is read as the elastic limit τ e . the point where permanent deformation of 0 . 2 % occurs is regarded as shearing stress τ 0 . 2 . here , as seen from table vi , the examples 75 to 80 had hysteresis smaller than 10 %. the comparative example 81 , has saturated magnetostriction | λs |& gt ; 15 × 10 - 6 , the ratio of the saturated magnetostriction λs versus the crystalline magnetic anisotropy coefficient k 1 of | k 1 / λs |& lt ; 6 × 10 - 8 ( j / m 3 ), an hc less than 5 ( oe ), initial permeability greater than 100 and a maximum permeability greater than 250 . yet in this case hysteresis becomes 20 % though high sensitivity is obtained . the comparative example 82 , which has saturated magnetostriction | λs |& lt ; 0 . 5 × 10 - 6 , the elastic limit τ e less than 20 kgf . mm 2 , 0 . 2 yield point τ 0 . 2 less than 40 kgf . mm 2 , hc less than 5 ( oe ), initial permeability greater than 100 and maximum permeability greater than 250 , yet in this case hysteresis becomes 15 % and the sensitivity is unacceptably low . though the shown embodiment employs electromagnetic coils serving as both of the energization coil and detector coil , the present invention is applicable for the torque sensor which has dedicated coils for energization and detection as that in the prior art . fig7 ( a ) and 7 ( b ) show typical examples of the torque sensor assemblies having dedicated energization coils 30 and detector coils 32 both are wound around a common yoke 34 . for these examples , the preferred compositions and process conditions according to the preferred embodiments set forth above , are applicable for improved sensitivity and smaller hysteresis . while the present invention has been disclosed in terms of the preferred embodiment in order to facilitate better understanding of the invention , it should be appreciated that the invention can be embodied in various ways without departing from the principle of the invention . therefore , the invention should be understood to include all possible embodiments and modifications to the shown embodiments which can be embodied without departing from the principle of the invention set out in the appended claims . table i__________________________________________________________________________ chemical composition ( wt %) sensitivity hysteresissample no . c si mn ni cr cu mo others heat treatment ( mv / kgf · (%) __________________________________________________________________________inventionexample 1 0 . 30 0 . 30 0 . 70 0 . 51 2 . 00 -- -- -- heating at 850 ° c . 60 4 subsequent oil hardening tempering 550 ° c . × 2 hrexample 2 0 . 31 0 . 50 0 . 80 1 . 50 0 . 80 0 . 11 0 . 17 -- heating at 850 ° c . 76 5 subsequent oil hardening tempering 550 ° c . × 2 hrexample 3 0 . 35 0 . 25 1 . 00 0 . 81 2 . 50 -- -- b : heating at 850 ° c . 58 3 0 . 002 subsequent oil hardening tempering 550 ° c . × 2 hrexample 4 0 . 41 0 . 35 0 . 80 2 . 48 0 . 50 0 . 08 -- nb : heating at 900 ° c . 90 5 0 . 15 subsequent oil hardening ti : tempering 600 ° c . × 2 hr 0 . 05example 5 0 . 46 0 . 25 0 . 75 1 . 00 0 . 99 -- -- al : heating at 900 ° c . 58 4 0 . 03 subsequent oil hardening n : tempering 600 ° c . × 2 hr 0 . 01example 6 0 . 31 0 . 26 0 . 69 0 . 51 1 . 52 -- 0 . 18 pb : high frequency hardening 65 2 0 . 16 tempering 170 ° c . × 2 hr te : 0 . 035example 7 0 . 40 0 . 25 0 . 71 1 . 48 0 . 98 -- 0 . 20 al : high frequency hardening 74 4 0 . 01 tempering 150 ° c . × 2 hr n : 0 . 02example 8 0 . 45 0 . 31 0 . 75 2 . 51 0 . 51 0 . 10 -- ti : high frequency hardening 73 5 0 . 03 tempering 150 ° c . × 2 hrexample 9 0 . 43 0 . 30 0 . 80 0 . 53 1 . 89 -- 0 . 17 -- heating at 880 ° c . 50 3 subsequent oil hardening tempering 500 ° c . × 2 hrexample 10 0 . 78 0 . 28 0 . 70 0 . 35 2 . 51 0 . 13 0 . 17 ta : heating at 900 ° c . 30 2 0 . 08 subsequent oil hardening tempering 170 ° c . × 2 hrexample 11 0 . 83 0 . 25 0 . 79 3 . 20 0 . 51 0 . 07 -- -- heating at 900 ° c . 61 7 subsequent oil hardening tempering 170 ° c . × 2 hrcomparative 0 . 41 0 . 75 0 . 80 5 . 53 1 . 05 0 . 08 -- -- heating at 850 ° c . 150 19example 12 subsequent oil hardening tempering 550 ° c . × 2__________________________________________________________________________ hr table ii__________________________________________________________________________ chemical composition ( wt %) sensitivity hysteresissample no . c si mn al ni cr cu mo others heat treatment ( mv / kgf · (%) __________________________________________________________________________inventionexample 13 0 . 20 0 . 75 0 . 75 0 . 02 2 . 01 1 . 03 -- -- -- carburizing 910 ° c . × 3 hr 63 3 subsequent oil hardening tempering 170 ° c . × 2 hrexample 14 0 . 18 1 . 01 0 . 80 0 . 03 0 . 09 2 . 02 -- -- -- carburizing 910 ° c . × 3 hr 42 0 subsequent oil hardening tempering 170 ° c . × 2 hrexample 15 0 . 22 1 . 03 1 . 04 0 . 04 1 . 03 1 . 51 0 . 08 -- ti : carburizing 910 ° c . × 51 2 0 . 03 subsequent oil hardening tempering 170 ° c . × 2 hrexample 16 0 . 20 1 . 98 0 . 50 0 . 03 1 . 52 2 . 48 -- 0 . 35 n : carburizing 900 ° c . × 70 4 0 . 01 subsequent oil hardening tempering 170 ° c . × 2 hrexample 17 0 . 25 0 . 85 0 . 10 0 . 10 0 . 25 3 . 01 -- -- pb : heating at 900 ° c . 96 7 0 . 20 subsequent oil hardening tempering 170 ° c . × 2 hrexample 18 0 . 35 0 . 75 0 . 70 0 . 31 0 . 48 1 . 51 -- 0 . 16 -- heating at 850 ° c . 80 4 subsequent oil hardening tempering 500 ° c . × 2 hrexample 19 0 . 36 0 . 75 0 . 70 0 . 06 0 . 10 3 . 52 0 . 09 -- ti : heating at 850 ° c . 75 4 0 . 10 subsequent oil hardening nb : tempering 500 ° c . × 2 hr 0 . 05example 20 0 . 40 1 . 53 0 . 25 0 . 01 3 . 02 0 . 35 -- 0 . 15 s : heating at 850 ° c . 104 7 0 . 10 subsequent oil hardening te : tempering 500 ° c . × 2 hr 0 . 030example 21 0 . 42 1 . 02 0 . 81 0 . 02 2 . 51 0 . 48 0 . 13 -- n : high frequency hardening 89 6 0 . 01 tempering 170 ° c . × 2 hrexample 22 0 . 46 2 . 51 0 . 75 0 . 02 0 . 12 2 . 51 -- -- b : high frequency hardening 95 5 0 . 005 tempering 170 ° c . × 2 hrexample 23 0 . 30 0 . 80 0 . 81 1 . 01 0 . 26 2 . 00 -- 0 . 17 -- gas nitriding 86 6 550 ° c . × 50 hrexample 24 0 . 41 1 . 48 0 . 45 0 . 12 0 . 51 2 . 48 0 . 07 0 . 20 v : gas nitriding 78 5 0 . 21 550 ° c . × 50 hrexample 25 0 . 75 0 . 99 0 . 45 0 . 15 0 . 47 2 . 98 -- -- heating at 900 ° c . 42 3 subsequent oil hardening tempering 170 ° c . × 2 hrexample 26 0 . 81 1 . 49 2 . 02 0 . 07 0 . 12 0 . 52 -- 0 . 16 ta : heating at 900 ° c . 58 4 0 . 09 subsequent oil hardening tempering 170 ° c . × 2 hrcompar - ativeexample 27 0 . 20 0 . 98 0 . 65 -- 5 . 48 1 . 00 -- -- -- carburizing at 910 ° c . 3 75 4 tempering 170 ° c . × 2 hrexample 28 0 . 18 0 . 11 0 . 78 -- 0 . 10 2 . 00 -- 0 . 18 -- carburizing at 910 ° c . 3 104 7 tempering 170 ° c . × 2__________________________________________________________________________ hr table iii__________________________________________________________________________sample chemical composition ( wt %) sensitivity hysteresisno . c si mn al ni cr cu co others heat treatment ( mv / kgf · (%) __________________________________________________________________________inven - tionexample 29 0 . 21 0 . 25 0 . 76 0 . 02 2 . 02 0 . 98 -- 0 . 02 -- carburizing 910 ° c . × 3 hr 58 2 subsequent oil hardening tempering 170 ° c . × 2 hrexample 30 0 . 17 1 . 75 0 . 25 0 . 04 2 . 48 1 . 48 0 . 08 1 . 03 mo : 0 . 16 carburizing 910 ° c . × 3 hr 63 4 subsequent oil hardening tempering 170 ° c . × 2 hrexample 31 0 . 22 1 . 02 1 . 03 0 . 05 0 . 51 2 . 61 -- 0 . 51 ti : 0 . 14 carburizing 910 ° c . × 57 1 v : 0 . 05 subsequent oil hardening tempering 170 ° c . × 2 hrexample 32 0 . 20 0 . 30 0 . 81 0 . 03 0 . 99 3 . 03 -- 2 . 05 n : 0 . 01 carburizing 900 ° c . × 70 2 subsequent oil hardening tempering 170 ° c . × 2 hrexample 33 0 . 25 1 . 47 0 . 15 0 . 10 0 . 98 2 . 54 0 . 11 1 . 47 s : 0 . 07 heating at 900 ° c ., 98b - 7 sequent water hardening tempering 170 ° c . × 2 hrexample 34 0 . 34 0 . 77 0 . 78 0 . 05 3 . 02 0 . 52 -- 0 . 48 mo : 0 . 21 heating at 850 ° c ., 103 5 sequent water hardening tempering 500 ° c . × 2 hrexample 35 0 . 35 2 . 00 0 . 15 0 . 03 0 . 21 3 . 00 -- 1 . 52 pb : 0 . 20 heating at 850 ° c ., 92b - 4 sequent water hardening tempering 500 ° c . × 2 hrexample 36 0 . 40 0 . 08 2 . 51 0 . 06 2 . 54 0 . 76 -- 3 . 02 v : 0 . 27 heating at 850 ° c ., 111 6 zr : 0 . 10 sequent water hardening tempering 500 ° c . × 2 hrexample 37 0 . 43 1 . 97 0 . 51 0 . 02 0 . 56 2 . 48 -- 0 . 99 mo : 0 . 18 high frequency hardening 84 5 tempering 170 ° c . × 2 hrexample 38 0 . 46 0 . 35 1 . 76 0 . 04 1 . 48 0 . 52 -- 3 . 52 n : 0 . 02 high frequency hardening 107 6 tempering 170 ° c . × 2 hrexample 39 0 . 31 0 . 47 2 . 53 1 . 21 3 . 07 1 . 41 0 . 12 0 . 73 mo : 0 . 22 gas nitriding 96 7 550 ° c . × 50 hrexample 40 0 . 41 0 . 77 0 . 31 0 . 15 0 . 81 0 . 52 -- 1 . 55 v : 0 . 25 gas nitriding 88 6 550 ° c . × 50 hrexample 41 0 . 77 0 . 11 1 . 01 0 . 02 2 . 55 1 . 47 -- 4 . 03 -- heating at 900 ° c ., 79b - 4 sequent water hardening tempering 170 ° c . × 2 hrexample 42 0 . 81 0 . 20 0 . 65 0 . 20 0 . 70 3 . 51 -- 0 . 64 ti : 0 . 08 heating at 900 ° c ., 48b - 3 nb : 0 . 07 sequent water hardening tempering 170 ° c . × 2 hrcompar - ativeexample 43 0 . 21 0 . 24 0 . 75 -- 2 . 00 1 . 01 -- 6 . 52 -- carburizing at 910 ° c . 109 14 subsequent oil hardening tempering 170 ° c . × 2 hrexample 44 0 . 18 0 . 22 0 . 81 -- 6 . 02 3 . 01 0 . 06 0 . 45 mo : 0 . 23 carburizing at 910 ° c . 117 16 zr : 0 . 10 subsequent oil hardening tempering 170 ° c . × 2__________________________________________________________________________ hr table iv__________________________________________________________________________ mechanical strength chemical composition ( wt %) sensitivity ( tensile σ . sub . b ) sample no . al c si cu ni co mn cr mo v nb ti zr ( v / kgf · m ) ( kgf / mm . sup . 2 ) __________________________________________________________________________example 45 12 . 4 -- -- -- -- -- -- 1 . 1 -- -- -- -- -- 2 . 5 80example 46 12 . 8 -- -- -- -- -- -- -- 0 . 8 -- -- -- -- 2 . 7 82example 47 13 . 1 -- -- -- -- -- 1 . 5 -- -- -- -- -- -- 2 . 2 83example 48 13 . 3 0 . 05 -- -- -- -- -- -- -- 0 . 5 -- -- -- 1 . 4 87example 49 12 . 9 0 . 10 -- -- -- -- -- -- -- -- 0 . 3 -- 0 . 2 1 . 3 85example 50 12 . 0 0 . 10 -- -- -- 1 . 3 -- -- -- -- 0 . 5 -- -- 1 . 8 87example 51 12 . 9 0 . 05 -- -- 0 . 3 -- -- 0 . 5 -- -- -- 0 . 2 -- 1 . 8 88example 52 12 . 7 0 . 07 -- -- 0 . 2 -- 0 . 5 -- -- -- 0 . 3 -- -- 2 . 3 90example 53 13 . 5 0 . 03 -- 0 . 1 -- 2 . 0 -- 0 . 5 -- -- -- -- -- 2 . 0 85example 54 12 . 7 -- -- -- -- -- -- -- -- -- -- -- -- 3 . 2 73example 55 13 . 1 -- -- -- 2 . 5 3 . 0 -- -- -- 1 . 3 -- -- -- 0 . 7 86example 56 12 . 5 0 . 60 -- -- -- -- -- 0 . 5 -- 0 . 8 -- -- 0 . 2 0 . 5 90example 57 -- 0 . 31 0 . 27 -- -- -- 0 . 70 corresponding to . 0 . 09 75 jis s30c__________________________________________________________________________ * remaining contents are fe and inevitable impurity . table v__________________________________________________________________________ sensor characteristics tensilesample chemical composition ( wt %) sensitivity hysteresis strength σ . sub . bno . al others heat treatment ( v / kgf · m ) (%) ( kg / mm . sup . 2 ) __________________________________________________________________________inven - tionexample 58 12 . 0 -- -- -- -- heating at 1100 ° c . × 3 hr 2 . 3 7 75 oil cooling ( vacuum ) example 59 12 . 7 -- -- -- -- heating at 1100 ° c . × 3 3 . 2 0 73 slow cooling to 700 ° c . and oil cooling ( vacuum ) example 60 13 . 5 -- -- -- -- heating at 1100 ° c . × 3 1 . 9 2 78 slow cooling to 700 ° c . and n gas cooling ( 500 ° c ./ hr ) example 61 14 . 2 -- -- -- -- heating at 1100 ° c . × 3 hr 1 . 5 4 71 cooling at 600 ° c ./ hr ( h . sub . 2 atmosphere ) example 62 12 . 4 cr : 1 . 1 -- -- -- heating at 1100 ° c . × 3 hr 2 . 5 3 80 oil cooling ( vacuum ) example 63 12 . 8 mo : 0 . 8 -- -- -- heating at 1100 ° c . × 3 2 . 7 2 82 slow cooling to 700 ° c . and oil cooling ( vacuum ) example 64 13 . 1 mn : 1 . 5 -- -- -- heating at 1000 ° c . × 3 2 . 2 4 83 slow cooling to 800 ° c . and n gas cooling ( 500 ° c ./ hr ) example 65 13 . 3 v : 0 . 5 c : 0 . 05 -- -- heating at 1100 ° c . × 3 hr 1 . 4 6 87 cooling at 500 ° c ./ hr ( h . sub . 2 atmosphere ) example 66 12 . 9 nb : 0 . 3 zr : 0 . 2 c : 0 . 1 -- heating at 1100 ° c . × 2 1 . 3 3 85 slow cooling to 600 ° c . and n gas cooling ( 1500 ° c ./ hr ) example 67 12 . 0 co : 1 . 3 nb : 0 . 5 c : 0 . 1 -- heating at 1100 ° c . × 3 hr 1 . 8 4 87 cooling at 1000 ° c ./ hr ( h . sub . 2 atmosphere ) example 68 12 . 9 cr : 0 . 5 ni : 0 . 3 ti : 0 . 2 c : 0 . 05 heating at 1100 ° c . × 3 1 . 8 6 88 slow cooling to 580 ° c . and oil cooling ( vacuum ) compar - ativeexample 69 12 . 7 -- -- -- -- heating at 1100 ° c . × 3 hr 2 . 9 11 74 cooling at 300 ° c ./ hr ( vacuum ) example 70 12 . 9 nb : 0 . 3 zr : 0 . 2 c : 0 . 1 -- heating at 1100 ° c . × 3 hr 1 . 5 12 86 cooling at 200 ° c ./ hr ( h . sub . 2 atmosphere ) example 71 9 . 5 -- -- -- -- heating at 1100 ° c . × 3 hr 1 . 0 14 59 cooling at 700 ° c . and oil cooling ( vacuum ) example 72 16 . 5 -- -- -- -- heating at 1000 ° c . × 3 hr 0 . 9 7 80 cooling at 1000 ° c ./ hr ( h atmosphere ) example 73 13 . 1 co : 3 . 0 ni : 2 . 5 c : 1 . 3 -- heating at ° 1000 c . × 3 hr 0 . 7 18 86 cooling at 100 ° c ./ hr ( h . sub . 2 atmosphere ) example 74 13 . 5 -- -- -- -- heating at 400 ° c . × 5 hr 0 . 8 13 75 oil cooling ( vacuum ) __________________________________________________________________________ * remaining contents are fe and inevitable impurity . table vi__________________________________________________________________________ mechanical characteristics magnetic characteristics τ . sub . e τ . sub . 0 . 2sample no . λs | kl / λs | hc ( oe ) μ . sub . i μ . sub . m kgf / mm . sup . 2 kgf / mm . sup . 2__________________________________________________________________________inventionexample 75 3 × 10 . sup .- 6 . sup . 1 . 3 × 10 . sup . 10 42 40 110 56 . 7 90 . 2example 76 2 × 10 . sup .- 6 . sup . 2 . 1 × 10 . sup . 10 30 70 180 42 . 5 82 . 9example 77 5 × 10 . sup .- 6 7 . 6 × 10 . sup . 9 45 30 100 50 . 9 85 . 2example 78 8 × 10 . sup .- 6 4 . 3 × 10 . sup . 9 27 90 200 35 . 7 77 . 1example 79 10 × 10 . sup .- 6 3 . 8 × 10 . sup . 9 35 60 150 29 . 5 68 . 3example 80 3 × 10 . sup .- 6 . sup . 1 . 6 × 10 . sup . 10 2 . 54 300 800 14 . 5 30 . 5comparativeexample 81 30 × 10 . sup .- 6 2 . 5 × 10 . sup . 8 0 . 20 2000 10500 32 . 1 45 . 0example 82 & lt ; 0 . 5 × 10 . sup . - 6 1 . 5 × 10 . sup . 9 0 . 04 1500 82000 10 . 2 18 . 0 0 . 030 0 . 030__________________________________________________________________________ sensor characteristics sensitivity hysterisis sample no . heat treatment ( mv / kgf · m ) (%) __________________________________________________________________________ invention example 75 carburizing 910 ° c . × 3 38 3 subsequent oil hardening tempering 170 ° c . × 2 hr example 76 carburizing 910 ° c . × 3 31 0 subsequent oil hardening tempering 170 ° c . × 2 hr example 77 carburizing 910 ° c . × 3 44 5 subsequent oil hardening tempering 170 ° c . × 2 hr example 78 heating at 880 ° c . 70 4 subsequent oil hardening tempering 550 ° c . × 2 hr example 79 heating at 880 ° c . 82 7 subsequent oil hardening tempering 550 ° c . × 2 hr example 80 tempering at 900 ° c . 35 10 comparative example 81 heating at 1100 ° c . × 2 1500 20 subsequent furnace cooling example 82 heating at 1100 ° c . × 2 25 15 subsequent furnace cooling__________________________________________________________________________

6Physics

in accordance with the present invention the antifoam properties of an eo or po non - ionic fatty acid derivatives are enhanced by combining them with a quaternary ammonium surfactant . because quaternary ammonium surfactants are generally regarded as foam - generating compounds , the incorporation of such surfactants in combination with polyoxyethylene - polyoxyproplyene nonionic fatty acid derivatives to produce a successful foam control composition was contrary to the conventional wisdom in the art of foam control compositions . the preferred polyoxyethylene - polyoxyproplyene non - ionic fatty acid derivatives are those having hydrophile - lipophile ( hlb ) values of at least 10 , preferably at least 12 , and more preferably at least 16 , indicating a strong affinity for water . one such ethoxylated fatty acid derivative is poe ( 30 ) oleyl amine liquid with an hlb of 16 . 6 and an amine ne of 1910 . a preferred quaternary ammonium surfactant is alkyl dimethyl benzyl ammonium chloride . the quaternary function can be expressed by formula [ 1 ] wherein r 1 = c 6 h 6 and r 2 = c n h ( 2n + 1 ) where n = 8 - 18 . the weight ratio range of the eo / po derivative to the quaternary compound within the foam control composition is generally from 2 : 1 to 30 : 1 with a preferred ratio being in the range from 5 : 1 to 10 : 1 . the foam control compositions according to the invention may be formulated in aqueous solution and may be provided at superbatch concentrations that are water dilutable and can be made down ( diluted ) with water on site to achieve the desired concentration of actives and / or to avoid overfeeding . the foam control compositions formulated according to the invention can be added to aqueous systems , including concentrated brines , in an amount to produce final concentrations of the foam control composition from about 1 ppm to 5000 ppm by weight . an example foam control composition according to the invention may comprise 50 % ethoxylated amine and 5 % adbac quat and 45 % water by weight . in the following examples foaming , residual antifoam and drainage retention tests were conducted with a clay containing micronutrients as described in u . s . pub . pat . appl . no . 2007 / 0119222 , the entire contents of which are incorporated herein , by reference . this substance was chosen because it generally represents an insoluble material that is susceptible to foam generation when agitated in aqueous solution . the test material allows the opportunity to study foam reduction , adsorption of antifoam on solid surfaces and drainage retention of clay exposed to aqueous solutions of antifoam . in the following examples the oil - based defoamer utilized was fo420 ( commercially available from chemtreat , inc . richmond , va .) and the silicon - based defoamer utilized was fo220 ( commercially available from chemtreat , inc . richmond , va .). foam height was measured by weighing 3 grams of micronutrient clay into a 250 ml stoppered measuring cylinder . 100 ml of water was added to the cylinder and a measured amount of antifoam agent was added to this mixture . the solution is then manually shaken for 30 seconds to develop a foam head . the height of the foam head is measured in inches using a scale directly after shaking by placing the cylinder on a flat surface . results show that the oil - based defoamer and silicone - based defoamer are effective in controlling foam in this test . use of the adbac surfactant alone led to increased foam over the control while the ethoxylated fatty amine alone was only moderately successful in controlling the foam . the combination of the adbac and the ethoxylated fatty amine , however , was similar to the defoaming efficiency of the conventional defoamers . it is an intention of this invention that the foam control compositions formulated in accord with this disclosure do not leave significant residue on solid surfaces either minerals , food products , paper products or heat transfer surfaces . to test this property 5 g of the micronutrient clay used for the antifoam tests was exposed to 1 g of antifoam composition . conventional antifoams were compared to the foam control compositions according to the invention . micronutrient clay was dried at 105 ° c . for 12 hours to obtain a dry weight . 5 g was weighed into each test beaker and 50 ml of deionized water was added to each test . then 1 g of each antifoam component was added to the respective test beaker and gently stirred for 2 minutes . the solids from each test were filtered onto pre - weighed filter paper and then the solid materials were dried for 24 hours . although each of the clay samples lost weight during this test , there were differences in the weight loss attributed to the defoamers used . the clay in the presence of the silicon - based defoamer gained the most with a 92 % difference over the control . the composition represented by the invention gained only 4 . 45 % indicating minimal interaction with the clay solids . the data reflects that the foam control composition according to the invention exhibits has less interaction with the clay than either of the conventional antifoams . another feature of the invention is that foam control compositions formulated according to the disclosure may improve drainage of solids over conventional antifoams that tend to exhibit stronger interactions with the solids leaving a residue that may impact water retention negatively . in many food , paper and mining processes retention of water is an issue and antifoams that promote water rejection are advantageous and can reduce the cost and complexity of drying equipment or other processing required to remove excess water . to measure water retention the dry micronutrient clay deposits from the antifoam residual tests shown in table 2 were utilized for further testing . empty 250 ml glass beakers were pre - weighed . 3 g of each pretreated clay sample from table 2 was weighed and mixed with 50 g of deionized ( di ) water in a separate 250 ml beaker . this mixture was then poured through a glass funnel containing a number 40 whatman filter paper suspended above the pre - weighed flask . the solids stay on the filter paper and the filtrate collects in the pre - weighed flask . the flask and filtrate are re - weighed after 15 minutes was allowed for the liquid to drain from the clay . a control experiment was performed in the same manner without clay to measure the amount of water retained on the filter paper . results are calculated as follows the results show that the most water passed through the sample pretreated with the invention composition . the clay treated with the silicone - based anti - foam composition retained the most water — almost 3 % more than that retained by the clay treated with a foam control composition according to the present invention .

2Chemistry; Metallurgy

before describing the features of the present invention , it is appropriate to briefly describe the construction of one type of known cochlear implant system with reference to fig1 . known cochlear implants typically consist of two main components , an external component including a speech processor 29 , and an internal component including an implanted receiver and stimulator unit 22 . the external component includes an on - board microphone 27 . the speech processor 29 is , in this illustration , constructed and arranged so that it can fit behind the outer ear 11 . alternative versions may be worn on the body . attached to the speech processor 29 is a transmitter coil 24 which transmits electrical signals to the implanted unit 22 via an rf link . the implanted component includes a receiver coil 23 for receiving power and data from the transmitter coil 24 . a cable 21 extends from the implanted receiver and stimulator unit 22 to the cochlea 12 and terminates in an electrode array 20 . the signals thus received are applied by the array 20 to the basilar membrane 8 thereby stimulating the auditory nerve 9 . the operation of such a device is described , for example , in u . s . pat . no . 4 , 532 , 930 . the sound processor 29 of the cochlear implant can perform an audio spectral analysis of the acoustic signals and outputs channel amplitude levels . the sound processor 29 can also sort the outputs in order of magnitude , or flag the spectral maxima as used in the speak strategy developed by cochlear ltd . fig2 depicts a prior art agc in use with normal sensitivity control , under two different noise floor conditions . the two points on the vertical axis of the graph referred to as t and c correspond to the user &# 39 ; s threshold level and the user &# 39 ; s comfort level . the threshold level refers to the smallest amount of sound that the user is able to hear and the comfort level is the upper limit of sound that the user can experience which does not produce an uncomfortably loud sensation . in a first instance , a low noise floor level is present , and the response of the agc is indicated by the left hand locus 21 . in the second instance , a higher noise floor level is present , with the response of the agc being indicated by the right hand locus 22 . in both these different noise floor conditions the sensitivity has been adjusted so that the threshold level corresponds approximately to the determined noise floor level . essentially the sensitivity setting determines when the agc will become active and in both these instances , the agc becomes active as soon as the sound goes above the noise floor level . in both these conditions a linear gain is applied to the input signal between the t and c output levels with the amount of gain being constant in each instance , as can be seen by the gradient of each locus . that is , the higher gain in the first instance is the same for both low input signal levels and high input signal levels , and similarly , the lower gain in the second instance is the same for both low input signal levels and high input signal levels . in the first instance ( in which a lower noise floor is present ) the gain applied to the input signal is relatively higher , to ensure the agc becomes active as soon as the input sound goes above the noise floor level . conversely , in the second instance ( when a relatively higher noise floor level is present ), the gain applied to the input signal is relatively lower , again to ensure that the agc becomes active as the input sound goes above the noise floor level . in both cases , infinite compression of the input signal occurs when the output signal is at the c level such that any further increase in the input signal level results in an equivalent gain reduction to keep the output level stable . for each of the two situations the essential difference in the action of the agc is the point of onset of the agc . it can be seen that the dynamic range of the agc remains the same in each instance . fig3 depicts the gain of an amplifier according to the present invention used in an auditory prosthesis , such as the cochlear implant depicted in fig1 . review of the graph reveals a similar aspect to fig2 , in that the amplifier has a linear gain from a relatively low output signal level ( threshold t ) to a maximum output level at infinite compression c . in using an amplifier having a gain control operating as depicted in fig3 , a noise floor estimate is used to determine a lower point through which the slope passes . an upper point of the slope is fixed , and defined by the input signal threshold in max at which infinite compression occurs . as the noise floor level increases , the gradient of the slope changes to a higher gradient in a manner such that the dynamic input range is reduced , resulting in input signals below the noise floor not being amplified above threshold t , and signals above the noise floor being amplified by a lesser amount than would be the case for a lower noise floor level , leading to a steeper slope of the agc response . therefore , by monitoring the change in the noise floor level , the amplifier according to the present invention applies a differing amount of gain to the input signal , tailored to meet the specific requirements of the sound environment . in other words , the noise floor estimate is used to set the slope of the agc response so that the lower end of the agc response is adjusted to correspond to the determined noise floor . the gain control depicted by fig3 can be implemented , in one embodiment , using software in a microcontroller ( such as is depicted in fig4 and 5 ). in this case , a measurement of the signal amplitude at the output of the gain controlled amplifier is taken where the signal is conveniently high . the input signal is then calculated using the known gain set in the amplifier . this is then used to determine the noise floor estimate and as the noise floor varies , the amplifier response is varied in a manner such that input signals at a level equal to the current estimated noise floor value are magnified to an output signal equal to the hearing threshold level t , and the slope of the amplifier response is controlled so that the amplifier response always enters infinite compression at the same point ( where the input signal is at , for example , 70 db as in fig5 ). to achieve this , an output signal level tx . for an arbitrary input level x db ( decibels ) ( as shown in fig5 ), can be calculated by means of the equation : tinf is the threshold for infinite compression , corresponding to c . te is the threshold required to result in an audible ( t level ) stimulation , x db is an arbitrary input level , emin is the floor noise level and 70 db is an example of a fixed input signal threshold at which the amplifier response enters infinite compression . an iterative feedback algorithm can be used to implement this control procedure ( such as that depicted in fig6 ). as noted above , a level of the output signal is first determined at steps 61 and 62 . from that output signal level , the input signal level is then determined by subtracting the gain of the amplifier , at 63 . at 64 , the determined input level is compared to the lowest level emin , which is a comparison of the current estimated noise floor value ( emin ) with the actual measured input signal level . if the actual input signal level is lower than emin , the current estimated noise floor level ( emin ) is immediately updated to that lower level ( at step 65 ). it can be seen that the “ release ” time of the current estimated noise floor value ( emin ) is essentially zero . on the other hand , if the measured input signal level is greater than the current estimated noise floor value ( emin ), the current estimated noise floor value ( emin ) is raised slightly ( at 66 ). as noted previously , the “ attack ” time of the current estimated noise floor value is slow , typically of the order of five to ten seconds . a slow attack time compensates for those periods in which the input signal level is above the true noise floor , for example when human speech is received by the cochlear implant . output signal level tx is then calculated as discussed above with reference to fig5 ( at 67 and 68 ). finally , at steps 69 to 71 , the adaptive gain is implemented , having a fast attack time ( refer to 70 ), and a relatively slow release time ( refer to 71 ). an alternative gain control method in accordance with the present invention is represented in fig7 . in this embodiment , rather than adjusting the slope of the gain in accordance with the change in the noise floor level , a point at which the slope of the agc response changes can be adjusted . the slope of the response of the amplifier in this embodiment is linear at a first ratio to a breakpoint and is then linear at a second ratio different to the first ratio until infinite compression commences . in this embodiment , the position of the breakpoint preferably varies in response to changes in the monitored level of background noise . in the depicted embodiment , the first ratio is 1 : 1 and the second ratio is 2 : 1 . other ratios both between and outside these ranges of variation can be envisaged and also it is envisaged that there could be more than one breakpoint between more than two ratios . the lower the monitored noise floor level , the lower the breakpoint between the first and second ratios . in this case , more of the input signal is subject to a 2 : 1 compression than is the case at relatively higher monitored noise floor levels . as the monitored noise floor level increases , the region occupied by the 2 : 1 slope between the threshold and infinite compression decreases . at a predetermined noise floor level , the slope has no breakpoint between the two ratios and simply has a linear fixed ratio before reaching infinite compression . each of the parallel lines in fig7 corresponds to a particular level of the background noise , the noise floor . the parallel lines all have a slope of 1 : 1 in this example , meaning that , on each line no compression is applied when the input signal level is between threshold t and the infinite compression level c . each of these lines intersects either the line indicating levels for which compression of 2 : 1 is applied , or the horizontal line , which indicates levels at which infinite compression is applied . below the breakpoint indicated in fig6 , linear amplification is applied to input signals , while above the breakpoint , compression with a ratio of 2 : 1 is applied . in the present embodiment , the effective breakpoint varies in response to changes in the estimated level of background noise . specifically , the breakpoint is increased automatically as the noise floor increases . the breakpoint will remain on the line of 2 : 1 compression , and approaches the point of infinite compression as the noise floor increases from low values . an example of how this method may be implemented in practice is shown in a block diagram ( fig8 ). incoming sounds are detected by a microphone and converted into analog electric signals . these signals are amplified by a preamplifier with gain determined by a gain control signal . the amplified signals pass into an envelope detector . the output of the envelope detector is processed to provide a running estimate of the noise floor level . in addition , the output of the envelope detector is converted into a fast - acting gain - control signal which if applied directly to the gain - controlled preamplifier , would compress the input signal by a ratio of 2 : 1 . the estimate of the noise floor is converted into a second gain - control signal which if applied directly to the gain - controlled preamplifier , would cause the background noise to be amplified to a level close to or slightly above the level producing electric stimulation at the t level . the rate of change of the gain - control signal derived from the estimated noise floor is much slower than the rate of change of the gain - control signal derived from the envelope detector . at any instant of time , only one of these two gain - control signals is applied to the pre - amplifier . the selected gain - control signal is always that which results in the lower of the two possible pre - amplifier gains . the gain - control signal currently applied to the pre - amplifier is passed to the noise - floor estimator . this enables the noise - floor estimator to compensate for the particular gain being applied to the microphone signal at all times , so that the estimate refers to the level of noise actually detected by the microphone . alternatively , the noise - floor estimator may obtain its input signal from the microphone via a separate , fixed - gain pre - amplifier . further to this , an alternative implementation of the noise - floor estimator may be to generate a signal that tracks the temporal minima in the waveform produced by the envelope detector . for example , when the output of the envelope detector is below the current noise - floor estimate , the noise - floor estimate may be rapidly reduced to equal the envelope level . when the output of the envelope detector is above the current noise - floor estimate , the noise - floor estimate may increase slowly in level . the envelope detector may have an attack time , the time taken for the gain to decrease in response to an increase in the background noise level , of less than 5 ms and a release time of about 50 ms . for the noise - floor estimator , the attack time may be about 10 seconds , while the release time may be near zero . fig9 provides a depiction of the principle of operation of this method . shown is the relationship between the input ( in ) and output ( out ) signals of the entire agc scheme for various conditions . in min and in max are the minimum and maximum sound pressure levels referred to the microphone input of the speech processor . typically , in max is about 70 db spl , and in min is determined by the electrical noise level internal to the speech - processor circuitry . out t and out c are the signal levels produced by the agc circuit that result in electric stimulation at the t - level and c - level , respectively . maximumgain refers to the line on which an input at in min , the internal noise level , produces an output of out t , causing t - level stimulation . the lines labelled 1 : 1 , 2 : 1 , and ∞: 1 represent linear amplification , 2 : 1 compression , and infinite compression limiting , respectively . the parallel lines represent different linear gains based on the estimated level of the noise floor . these gains reduce , below maximumgain , for increasing noise - floor levels , represented on the diagram by a shift of the 1 : 1 line to the right . the operation of the embodiment illustrated in fig9 may be summarised by the following equation : 1 ) maximumgain is as described above ; 2 ) gain f corresponds to the line having 2 : 1 compression ratio , with a compression threshold of zero , a compression ratio of 2 : 1 , and fast ( syllabic ) time constants . this gain is based on the short - term amplitude of the input - signal level ( in ) by : 3 ) gain s defines the parallel lines having 1 : 1 compression ratio which adjust to noise floor changes ( ie : a noise - floor tracker ), having a compression threshold of in min , a 1 : 1 compression ratio , slow time constants , the gain , gains , is based on the estimated level of the noise floor , nf , by : 4 ) gain l provides the infinite compression for high input signal levels , ( ie acts as a limiter ), with a compression threshold of in max , an infinite compression ratio , fast time constants , the gain , gain l , is based on the short - term amplitude of the input - signal level ( in ) such that , if in is greater than in max , then : hence , the overall gain , gain agc , of the entire system at any time is the minimum of the above gain values . the implementation of the current embodiment provides that speech or other sounds received at a relatively high level are compressed using a moderate compression ratio , for example 2 : 1 , and short time constants , improving the understanding of speech for users of hearing devices . the level of background noise is tracked relatively slowly by the noise - floor estimator , and is used to set the pre - amplifier gain such that the noise will usually be perceived as comparatively soft by device users , avoiding the problem of background noise being perceived to have excessive loudness when a progressive compressor with a fixed compression ratio is used in a hearing device speech processor . excessive sound levels always receive infinite compression , and are converted to electric stimulation at the c - level , so they should never be perceived to have uncomfortable loudness . the implementation is efficient and is based on a small number of previously developed signal processing functions . it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive .

7Electricity

in order to better illustrate the advantages of the invention and its contributions to the art , a preferred embodiment of the invention will now be described in detail . referring now to fig2 , an electronic disabling device for immobilizing a target according to the present invention includes a power supply , first and second energy storage capacitors , and switches si and s 2 which operate as single pole , single throw switches and serve to selectively connect the two energy storage capacitors to down stream circuit elements . the first energy storage capacitor is selectively connected by switch s 1 to a voltage multiplier which is coupled to first and second stun gun output electrodes designated e 1 and e 2 . the first leads of the first and second energy storage capacitors are connected in parallel with the power supply output . the second leads of each capacitor are connected to ground to thereby establish an electrical connection with the grounded output electrode e 2 . the stun gun trigger controls a switch controller which controls the timing and closure of switches s 1 and s 2 . referring now to fig3 through 8 and fig1 , the power supply is activated at time t 0 . the energy storage capacitor charging takes place during time interval t 0 - t 1 as illustrated in fig1 a and 12b . at time t 1 , switch controller closes switch s 1 which couples the output of the first energy storage capacitor to the voltage multiplier . the fig3 b and fig6 voltage versus time graphs illustrate that the voltage multiplier output rapidly builds from a zero voltage level to a level indicated in the fig3 b and fig6 graphs as “ v high ”. in the hypothetical situation illustrated in fig5 a , a high impedance air gap exists between stun gun output electrode e 1 and target contact point e 3 . the fig5 a diagram illustrates the hypothetical situation where a direct contact ( i . e ., impedance e 2 - e 4 equals zero ) has been established between stun gun electrical output terminal e 2 and the second spaced apart contact point e 4 on a human target . the e 1 to e 2 spacing on the target is assumed to equal on the order of 10 inches . the resistor symbol and the symbol z load represents the internal target resistance which is typically less than 1 , 000 ohms and approximates 200 ohms for a typical human target . application of the v high voltage multiplied output across the e 1 to e 3 high impedance air gap forms an electrical arc having ionized air within the air gap . the fig5 c timing diagram illustrates that after a predetermined time during the t 1 to t 2 high voltage waveform output interval , the air gap impedance drops from a near infinite level to a near zero level . this second air gap configuration is illustrated in the fig5 b drawing . once this low impedance ionized path has been established by the short duration application of the v high output signal which resulted from the discharge of the first energy storage capacitor through the voltage multiplier , the switch controller opens switch s 1 and closes switch s 2 to directly connect the second energy storage capacitor across the electronic disabling device output electrodes e 1 and e 2 . the circuit configuration for this second time interval is illustrated in the fig4 a block diagram . as illustrated in the fig4 b voltage waveform output diagram , the relatively low voltage “ v low ” derived from the second output capacitor is now directly connected across the stun gun output terminals e 1 and e 2 . because the ionization of the air gap during time interval t 1 to t 2 dropped the air gap impedance to a low level , application of the relatively low second capacitor voltage v low across the e 1 to e 3 air gap during time interval t 2 to t 3 will allow the second energy storage capacitor to continue and maintain the previously initiated discharge across the arced - over air gap for a significant additional time interval . this continuing , lower voltage discharge of the second capacitor during the interval t 2 to t 3 transfers a substantial amount of target - incapacitating electrical charge through the target . as illustrated in fig4 b , 5c , 6 , and 8 , the continuing discharge of the second capacitor through the target will exhaust the charge stored in the capacitor and will ultimately cause the output voltage from the second capacitor to drop to a voltage level at which the ionization within the air gap will revert to the non - ionized , high impedance state causing cessation of current flow through the target . in the fig2 block diagram , the switch controller can be programmed to close switch s 1 for a predetermined period of time and then to close switch s 2 for a predetermined period of time to control the t 1 to t 2 first capacitor discharge interval and the t 2 to t 3 second capacitor discharge interval . during the t 3 to t 4 interval , the power supply will be disabled to maintain a factory preset pulse repetition rate . as illustrated in the fig8 timing diagram , this factory preset pulse repetition rate defines the overall t 0 to t 4 time interval . a timing control circuit potentially implemented by a microprocessor maintains switches s 1 and s 2 in the open condition during the t 3 to t 4 time interval and disables the power supply until the desired t 0 to t 4 time interval has been completed . at time t 0 , the power supply will be reactivated to recharge the first and second capacitors to the power supply output voltage . referring now to the fig9 schematic diagram , the fig2 circuit has been modified to include a third capacitor and a load diode ( or resistor ) connected as shown . the operation of this enhanced circuit diagram will be explained below in connection with fig1 and the related more detailed schematic diagrams . referring now to the fig1 electrical schematic diagram , the high voltage power supply generates an output current i 1 which charges capacitors c 1 and c 3 in parallel . while the second terminal of capacitor c 2 is connected to ground , the second terminal of capacitor c 3 is connected to ground through a relatively low resistance load resistor r 1 or as illustrated in fig9 by a diode . the first voltage output of the high voltage power supply is also connected to a 2 , 000 volt spark gap designated as gap 1 and to the primary winding of an output transformer having a 1 : 25 primary to secondary winding step up ratio . the second equal voltage output of the high voltage power supply is connected to one terminal of capacitor c 2 while the second capacitor terminal is connected to ground . the second power supply output terminal is also connected to a 3 , 000 volt spark gap designated gap 2 . the second side of spark gap gap 2 is connected in series with the secondary winding of transformer t 1 and to stun gun output terminal e 1 . in the fig1 circuit , closure of safety switch s 1 enables operation of the high voltage power supply and places the stun gun into a “ standby / ready - to - operate ” configuration . closure of the trigger switch designated s 2 causes the microprocessor to send a control signal to the high voltage power supply which activates the high voltage power supply and causes it to initiate current flow i 1 into capacitors c 1 and c 3 and current flow 12 into capacitor c 2 . this capacitor charging time interval will now be explained in connection with the simplified fig1 block diagram and in connection with the fig1 a and fig1 b voltage versus time graphs . during the t 0 to t 1 capacitor charging interval illustrated in fig1 , 12a , and 12 b , capacitors c 1 , c 2 , and c 3 begin charging from a zero voltage up to the 2 , 000 volt output generated by the high voltage power supply . spark gaps gap 1 and gap 2 remain in the open , near infinite impedance configuration because only at the end of the t 0 to t 1 capacitor charging interval will the c 1 / c 2 capacitor output voltage approach the 2 , 000 volt breakdown rating of gap 1 . referring now to fig1 and 14 , as the voltage on capacitors c 1 and c 2 reaches the 2 , 000 volt breakdown voltage of spark gap gap 1 , a spark will be formed across the spark gap and the spark gap impedance will drop to a near zero level . this transition is indicated in the fig1 timing diagrams as well as in the more simplified fig3 b and fig6 timing diagrams . beginning at time t 1 , capacitor c 1 will begin discharging through the primary winding of transformer t 1 which will rapidly ramp up the e 1 to e 2 secondary winding output voltage to negative 50 , 000 volts as shown in fig1 b . fig1 a illustrates that the voltage across capacitor c 1 relatively slowly decreases from the original 2 , 000 volt level while the fig1 b timing diagram illustrates that the multiplied voltage on the secondary winding of transformer t 1 will rapidly build up during the time interval t 1 to t 2 to a voltage approaching minus 50 , 000 volts . at the end of the t 2 time interval , the fig1 circuit transitions into the second configuration where the 3 , 000 volt spark gap gap 2 has been ionized into a near zero impedance level allowing capacitors c 2 and c 3 to discharge across stun gun output terminals e 1 and e 2 through the relatively low impedance load target . because , as illustrated in the fig1 timing diagram , the voltage across c 1 will have discharged to a near zero level as time approaches t 2 , the fig1 simplification of the fig1 circuit diagram which illustrates the circuit configuration during the t 2 to t 3 time interval shows that capacitor c 1 has effectively and functionally been taken out of the circuit . as illustrated by the fig1 timing diagram , during the t 2 to t 3 time interval , the voltage across capacitors c 2 and c 3 decreases to zero as these capacitors discharge through the now low impedance ( target only ) load seen across output terminals e 1 and e 2 . fig1 represents another timing diagram illustrating the voltage across gap 2 and the voltage across stun gun output terminals e 1 and e 2 during the t 2 to t 3 time interval . in one preferred embodiment of the fig1 circuit , capacitor c 1 , the discharge of which provides the relatively high energy level required to ionize the high impedance air gap between e 1 and e 3 , can be implemented with a capacitor rating of 0 . 14 microfarads and 2 , 000 volts . as previously discussed , capacitor c 1 operates only during time interval t 1 to t 2 which , in this preferred embodiment , approximates on the order of 1 . 5 microseconds in duration . capacitors c 2 and c 3 in one preferred embodiment may be selected as 0 . 02 microfarad capacitors for a 2 , 000 volt power supply voltage and operate during the t 2 to t 3 time interval to generate the relatively low voltage output as illustrated in fig4 b to maintain the current flow through the now low impedance dart - to - target air gap during the t 2 to t 3 time interval as illustrated in fig5 c . in this particular preferred embodiment , the duration of the t 2 to t 3 time interval approximates 50 microseconds . due to many variables , the duration of the t 0 to t 1 time interval may change . for example , a fresh battery may shorten the t 0 to t 1 time interval in comparison to circuit operation with a partially discharged battery . similarly , operation of the stun gun in cold weather which degrades battery capacity might also increase the t 0 to t 1 time interval . since it is highly desirable to operate stun guns with a fixed pulse repetition rate as illustrated in the fig8 timing diagram , the circuit of the present invention provides a microprocessor - implemented digital pulse control interval designated as the t 3 to t 4 interval in fig8 . as illustrated in the fig1 block diagram , the microprocessor receives a feedback signal from the high voltage power supply via a feedback signal conditioning element which provides a circuit operating status signal to the microprocessor . the microprocessor is thus able to detect when time t 3 has been reached as illustrated in the fig6 timing diagram and in the fig8 timing diagram . since the commencement time t 0 of the operating cycle is known , the microprocessor will maintain the high voltage power supply in a shut down or disabled operating mode from t 3 until the factory preset pulse repetition rate defined by the t 0 to t 4 time interval has been achieved . while the duration of the t 3 to t 4 time interval will vary , the microprocessor will maintain the t 0 to t 4 time interval constant . the fig1 table entitled “ gap on / off timing ” represents a simplified summary of the configuration of gap 1 and gap 2 during the four relevant operating time intervals . the configuration “ off ” represents the high impedance , non - ionized spark gap state while the configuration “ on ” represents the ionized state where the spark gap breakdown voltage has been reached . fig1 represents a simplified block diagram of a circuit analogous to the fig1 circuit except that the circuit has been simplified to include only capacitors c 1 and c 2 . the fig1 circuit is capable of operating in a highly efficient or “ tuned ” dual mode configuration according to the teachings of the present invention . fig2 illustrates an alternative configuration for coupling capacitors c 1 and c 2 to the stun gun output electrodes e 1 and e 2 via an output transformer having a single primary winding and a center - tapped or two separate secondary windings . the step up ratio relative to each primary winding and each secondary winding represents a ratio of 1 : 12 . 5 . this modified output transformer still accomplishes the objective of achieving a 1 : 25 step - up ratio for generating an approximate 50 , 000 volt signal with a 2 , 000 volt power supply rating . one advantage of this double secondary transformer configuration is that the maximum voltage applied to each secondary winding is reduced by 50 % such reduced secondary winding operating potentials may be desired in certain conditions to achieve a higher output voltage with a given amount of transformer insulation or for placing less high voltage stress on the elements of the output transformer . substantial and impressive benefits may be achieved by using the electronic disabling device of the present invention which provides for dual mode operation to generate a time - sequenced , shaped voltage output waveform in comparison to the most advanced prior art stun gun represented by the taser m26 stun gun as illustrated and described in connection with the fig1 block diagram . the taser m 26 stun gun utilizes a single energy storage capacitor having a 0 . 88 microfarad capacitance rating . when charged to 2 , 000 volts , that 0 . 88 microfarad energy storage capacitor stores and subsequently discharges 1 . 76 joules of energy during each output pulse . for a standard pulse repetition rate of 15 pulses per second with an output of 1 . 76 joules per discharge pulse , the taser m26 stun gun requires around 35 watts of input power which , as explained above , must be provided by a large , relatively heavy battery power supply utilizing 8 series - connected aa alkaline battery cells . for one embodiment of the electronic disabling device of the present invention which generates a time - sequenced , shaped voltage output waveform and with a c 1 capacitor having a rating of 0 . 07 microfarads and a single capacitor c 2 with a capacitance of 0 . 01 microfarads ( for a combined rating of 0 . 08 microfarads ), each pulse repetition consumes only 0 . 16 joules of energy . with a pulse repetition rate of 15 pulses per second , the two capacitors consume battery power of only 2 . 4 watts at the capacitors ( roughly 3 . 5 to 4 watts at the battery ), a 90 % reduction , compared to the 26 watts consumed by the state of the art taser m26 stun gun . as a result , this particular configuration of the electronic disabling device of the present invention which generates a time - sequenced , shaped voltage output waveform can readily operate with only a single aa battery due to its 2 . 4 watt power consumption . because the electronic disabling device of the present invention generates a time - sequenced , shaped voltage output waveform as illustrated in the fig3 b and 4b timing diagrams , the output waveform of this invention is tuned to most efficiently accommodate the two different load configurations presented : a high voltage output operating mode during the high impedance t 1 to t 2 first operating interval ; and , a relatively low voltage output operating mode during the low impedance second t 2 to t 3 operating interval . as illustrated in the fig5 c timing diagram and in the fig2 a , and 4 a simplified schematic diagrams , the circuit of the present invention is selectively configured into a first operating configuration during the ti to t 2 time interval where a first capacitor operates in conjunction with a voltage multiplier to generate a very high voltage output signal sufficient to breakdown the high impedance target - related air gap as illustrated in fig5 a . once that air gap has been transformed into a low impedance configuration as illustrated in the fig5 c timing diagram , the circuit is selectively reconfigured into the fig3 a second configuration where a second or a second and a third capacitor discharge a substantial amount of current through the now low impedance target load ( typically 1 , 000 ohms or less ) to thereby transfer a substantial amount of electrical charge through the target to cause massive disruption of the target &# 39 ; s neurological control system to maximize target incapacitation . accordingly , the electronic disabling device of the present invention which generates a time - sequenced , shaped voltage output waveform is automatically tuned to operate in a first circuit configuration during a first time interval to generate an optimized waveform for attacking and eliminating the otherwise blocking high impedance air gap and is then retuned to subsequently operate in a second circuit configuration to operate during a second time interval at a second much lower optimized voltage level to efficiently maximize the incapacitation effect on the target &# 39 ; s skeletal muscles . as a result , the target incapacitation capacity of the present invention is maximized while the stun gun power consumption is minimized . as an additional benefit , the circuit elements operate at lower power levels and lower stress levels resulting in either more reliable circuit operation and can be packaged in a much more physically compact design . in a laboratory prototype embodiment of a stun gun incorporating the present invention , the prototype size in comparison to the size of present state of the art taser m26 stun gun has been reduced by approximately 50 % and the weight has been reduced by approximately 60 %. it will be apparent to those skilled in the art that the disclosed electronic disabling device for generating a time - sequenced , shaped voltage output waveform may be modified in numerous ways and may assume many embodiments other than the preferred forms specifically set out and described above . accordingly , it is intended that the appended claims cover all such modifications of the invention which fall within the true spirit and scope of the invention .

7Electricity

the invention first of all relates to an arrangement of apparatus for a motor vehicle . as illustrated in fig1 and 4 to 8 , the arrangement is equipped with at least one reserved space 16 exhibiting , between a back wall 30 , which is solid or otherwise , and an opposite aperture 20 , an axis 25 , called longitudinal axis , and one or more side walls 15 , substantially parallel to the longitudinal axis . in fig1 and 2 , the axis 25 is perpendicular to the plane of the sheet of drawings . the term “ longitudinal ”, however , does not pre - ordain either the orientation of the back wall and / or of the aperture of the reserved space 16 , nor of its depth . according to the invention , the reserved space houses a plurality of equipment elements 1 , each consisting of at least one chassis 2 , equipped with first fixing means 3 . as illustrated in fig9 and 10 , the chassis 2 features , for example , between a front face 4 , open or otherwise , and a rear face 5 , open or otherwise , called end faces , at least one side face 6 , substantially parallel to the longitudinal axis 25 , especially perpendicular to the end faces 4 , 5 . the front , rear and / or side faces 4 , 5 , 6 define the contour of the equipment elements 1 , for example . at least one of the side face or faces 6 , called standard face , features a given dimension , called basic dimension , or a multiple of the said basic dimension , in its direction orthogonal to the longitudinal axis 25 , called standard direction . furthermore , the first fixing means 3 are provided regularly , at least in the case of some of them , on the standard side face or faces 6 , along its or their standard direction , as a function of the basic dimension or dimensions . by “ provided regularly ” it is understood that the fixing means are distributed , especially , at regular intervals . the equipment elements 1 in accordance with the invention thus feature one or more side faces 6 , the dimensions of which are equal to one or more basic dimensions a , b or a multiple of the basic dimension or dimensions . in that way “ bricks ” are made up , of a greater or lesser size , but always equal to a multiple of the size of one basic brick exhibiting side faces with dimensions a , b . on these bricks , the fixing means are distributed regularly on the basis of the basic dimensions a , b , either on the same equipment element 1 , or by association of several said equipment elements . the equipment elements 1 especially feature a housing , able to constitute a storage space and / or to house active , mechanical , electrical and / or electronic components , carrying out a given function . these take the form , particularly , of ash trays , bins , storage of various kinds , especially for cassettes , compact discs , loose change , spectacles , credit cards , road maps , remote controls , pens , and / or others , cup holders , tablets or confectionery , and / or others . these may also take the form , for example , of cassette or compact - disc players , badge readers , numerical , alphanumeric and / or other keyboards , current outlets , cigar lighter , data sockets , switches , telephone supports , electric torches and / or other things , handkerchief dispensers , compact - disc changers , electronics cards , and / or others . the first fixing means 3 are provided , for example , at least partly in the bulk of the standard faces 6 . they are therefore defined , especially , by the shape of the faces , which are intended to interact with forms in the negative shape . the first fixing means 3 consist , for example , of ribs 7 and / or grooves 8 , substantially parallel to the longitudinal axis 25 , provided on at least a part of the length parallel to this latter one of the elements , which are intended to interact , by fitting together , respectively , with grooves or ribs , with substantially complementary profiles , situated , as set out below , within one or more neighbouring equipment elements 1 within the reserved space 16 and / or consisting of small bars 31 . referring again to fig1 and 2 , it is observed that the ribs 7 and / or grooves 8 of the equipment elements 1 are spaced by a substantially constant distance between centres , equal to the corresponding basic dimension or to a fraction of the type 1 / n , n being a natural integer , of the said basic dimension . by way of non - limiting example , as illustrated in fig9 and 10 , the chassis 2 constituting the equipment elements 1 in accordance with the invention exhibits a substantially rectangular box shape , each of its side faces 6 being a standard face equipped with fixing means 3 in the form of ribs 7 and / or of grooves 8 , spaced mutually apart by the corresponding basic dimension a , b . that being so , the chassis 2 possibly features means 11 for connection to a current - supply circuit intended to supply power , especially lighting , and / or for data distribution / acquisition . this may , for example , take the form of one or more electrical connectors , provided in the region of the end faces 4 , 5 or side face 6 of the element 1 . they are provided , especially , regularly distributed as a function of the basic dimension or dimensions . according to one embodiment illustrated in fig4 the connection means 11 are situated at the rear of the equipment elements 1 and consist of a connector 32 which interacts with the connector 32 a of the reserved space 16 . according to another particular embodiment illustrated in fig5 and 6 , the connection means 11 are provided in the region of the aid fixing means 3 and are able to allow a current flow and / or data distribution / acquisition by way of at least one of the equipment elements 1 , to the outside , especially to or from other equipment elements 1 . to that end , the equipment elements 1 are provided , for example , with a current - supply circuit 1 a and / or a data distribution / acquisition circuit internally linking its connectors 12 , provided in the region of at least two of its fixing means 3 . referring again to fig1 and 2 , it is observed that at least a part of the wall or walls 15 of the reserved space 16 , called standard walls , features dimensions corresponding to one or multiples of the basic dimension or dimensions of the equipment 1 , in its or their direction substantially parallel to the standard direction or directions of the equipment 1 . the standard wall or walls 15 are equipped , at least in the case of some of them , with second fixing means 17 , regularly distributed on the basis of the basic dimension or dimensions a , b , able to interact with the first fixing means 3 of the equipment 1 , these being provided fastened together and / or to the walls 15 , individually , so as to be removable , one beside and / or above the others . thus an arrangement of apparatus is made available in a configuration which can easily be upgraded , of optimised size and of simple implementation . the arrangement of apparatus in accordance with the invention consists , for example , of at least one reinforcement 13 , equipped with support means 14 for the equipment elements 1 , the reserved space 16 being provided in the region of the support means 14 . it will be noted that , when empty , the reinforcement 13 is equipped with at least one reserved space 16 the wall or walls 15 of which feature the fixing means 17 , regularly spaced . as illustrated in fig1 according to a first variant embodiment , the support means 14 consist of one face of the amid reinforcement 13 , defining one standard wall 15 of the reserved space 16 equipped with second fixing means . as illustrated in fig2 according to another embodiment , the support means 14 consist of a casing 18 , able to be fastened to the rest 19 of the reinforcement . the casing 18 features , for example , a back wall and an aperture 20 between which extend side faces 21 constituting the walls of the reserved space 16 . referring again to fig1 it is observed that the arrangement could , furthermore , possibly comprise a multiplexed circuit 22 , especially for current supply and / or for data flow . according to another embodiment , as already set out above , the current supply and / or the flow of data could be implemented by way of at least one of the equipment elements 1 itself , from at least one connection point provided in the region of one of the walls 15 of the reserved space 16 . the use of conductors the fixing of which still remains a problem , or of connection rails on a back plane panel , is thereby avoided . that being so , in the embodiment represented in fig2 the grooves 8 formed on the inner wall 15 of the casing 18 are masked by a cover ( not represented ). in order to overcome this drawback , the variant represented in fig7 and 10 shows that : the elements 1 include only grooves 8 on their side faces 6 , the inner walls 15 of the reserved space 16 include only ribs 7 , these grooves 8 are combined , when necessary , with profiled bars 31 which then make it possible not to have the grooves opening out on the front face . another variant illustrated in fig8 consists in providing , in the back wall of the reserved space 16 , a plurality of housings 207 able to receive tenons 208 of the elements 1 ; said fixing means 3 are provided on the side faces 6 and possibly on the walls 15 , such as clips 210 , these means being located at the opposite end from the back wall of the reserved space 16 , so as to balance the weight of the elements 1 . the invention also relates to a dashboard for a motor vehicle comprising an arrangement of apparatus as described above . this is provided , especially , at the central part , the reserved space 16 being situated under the rest 19 of the reinforcement 13 , designed to consist of a cover 23 of the dashboard , situated at the upper part . naturally , other embodiments , within the scope of the person skilled in the art , could have been envisaged without in any way departing from the context of the invention , especially the use of screws , rivets , clips , etc . located according to the invention at regular intervals as defined above for the standard walls .

1Performing Operations; Transporting

a prior art communication system 100 is shown in fig1 . modem transmitter 101 generates a signal suited for transmission over a band - limited channel102 which introduces various channel impairments , such as linear ( amplitudeand phase ) distortion and additive noise . this corrupted signal is then processed by modem receiver 103 which tries to correct for the damaging effects introduced by the channel impairments . in a prior art implementation of transmitter 101 , for an uncoded modem , i . e ., a modem not incorporating any error correction , the serial stream ofbinary data is directly fed to symbol mapping apparatus 104 which assigns discrete multilevel , typically multidimensional , symbols to successive blocks of bits according to some mapping rule . one such mapping rule , which is used for ccitt &# 39 ; s v . 32 standard for uncoded data transmission at 9 . 6 kb / s using quadrature - amplitude modulation ( qam ), is defined by the 16 - point signal constellation 301 shown in fig3 . each signal point in a constellation has an associated bit code . for example , signal point 304 has the code 1111 . in this example , four bits are mapped into one of 16 possible two - dimensional ( or complex ) symbols . these symbols are generatedat a rate of 2400 symbols per second , which yields the desired bit rate of 9 . 6 kb / s , and are then passed through transmit filter 109 which provides the proper spectral shaping for transmission over band - limited telephone channel 102 . a typical receiver for such an uncoded signal would simply consist of adaptive linear equalizer 110 and slicer 111 in receiver 103 . linear equalizer 110 compensates for the linear impairments in the channel , and slicer 111 decides which one of the 16 points of signal constellation 301 in fig3 has been received in each symbol period . for example , if the output of equalizer 110 is complex point 303 , then the slicer will choose the point in the signal constellation that is closest in euclidean distance to point 303 , which is point 304 in this illustrative example . after slicing , the receiver performs a symbol - to - bitmapping operation ( not shown ) which recovers a binary data stream of 9 . 6 kb / s from the received sliced symbols . it should , of course , be mentioned that a qam signal requires modulation in the transmitter and demodulation in the receiver . these operations , which are well - known , have been omittedfrom the figures for purposes of simplicity . in yet another prior art implementation of transmitter 101 , for a coded modem , the incoming binary data stream is first passed through a trellis encoder 105 via the dotted line connections in lieu of to symbol mapping apparatus 104 . for example , ccitt &# 39 ; s v . 32 standard for 9 . 6 kb / s data transmission has a coded option for which trellis encoder 105 consists of a convolutional encoder that generates an additional bit for each four incoming bits , and a symbol mapper that maps the resulting 5 bits into oneof the 32 possible two - dimensional symbols defined by signal constellation 302 in fig3 . in this example , trellis encoder 105 uses the redundancy inthe signal constellation to assure that only well - defined allowed sequencesof symbols are transmitted . the receiver of a coded v . 32 modem typically consists of linear adaptive equalizer 110 in receiver 103 , whose output isfed to trellis decoder 112 via the dotted line connections instead of to slicer 111 . such a decoder implements a maximum - likelihood sequence estimation algorithm called the viterbi algorithm . the decoded sequences are then fed to a symbol - to - bit mapper to restore the 9 . 6 kb / s bit stream . it has been shown theoretically and confirmed experimentally that , for trellis coded modems , a receiver incorporating linear adaptive equalizer 110 and trellis decoder 112 works well and provides increased immunity against additive noise generated in the channel . the coded version of the v . 32 modem can be used to achieve acceptable performance over the public switched telephone network for data rates up to about 14 . 4 kb / s , except that the number of points in signal constellation 302 has to be increased . illustratively , a data rate of 14 . 4kb / s can be achieved with a symbol rate of 2400 bauds and 6 bits of information per symbol . since an additional bit is required for coding , a total of 128 two - dimensional points are required in the signal constellation . for data rates of 19 . 2 kb / s , and more , it is not feasible to just keep increasing the number of points in the signal constellation because the modem , even with coding , would become overly sensitive to the additive noise generated in the telephone channel . instead , one can keep the number of points to a reasonable amount and increase the rate at whichthe symbols are sent through the channel . unfortunately , an increase in symbol rate results in an increase of the bandwidth used by the transmitted analog signal which , in turn , results in a severe amplitude distortion of the signal at the lower and higher frequencies when it passes through the telephone channel . linear equalizer 110 , in fig1 is notoriously bad at dealing with severe amplitude distortion because of theso - called noise enhancement problem . a linear equalizer essentially &# 34 ; inverts &# 34 ; the channel , that is , it introduces a large gain in the frequency regions where the channel introduces a severe loss . while such an action equalizes the channel and removes intersymbol interference , it also amplifies the noise , thus degrading the performance of the receiver . it has been determined that for data transmission at 19 . 2 kb / s , and more , over the public switched telephone network , it is not desirable to use a linear equalizer , and that a decision feedback equalizer ( dfe ) should be utilized instead . such an equalizer introduces less noise enhancement but , unfortunately , cannot be used in conjunction with standard trellis coding , as will be explained hereinbelow . a communications system 200 incorporating the present invention is shown infig2 . at transmitter 201 the incoming binary data stream with bit rate r d is first fed to error correction encoder 204 , which encodes it onto another bit stream with , generally , a somewhat higher bit rate r c . illustratively , encoder 204 may implement a reed - solomon code or one of its well - known variations , such as interleaved reed - solomon codes . the bit stream at the output of encoder 204 is then passed through switch 205 which , in accordance with the invention , routes successive bits , or blocks of bits , to a plurality of m parallel encoders 206 - i , where i = 1 , 2 ,. . . , m . this routing is conveniently done in a cyclic fashion in which case bit b n is fed to encoder 206 - 1 , bit b n + 1 is fed to encoder 206 - 2 , and so forth , and after m bits , bit b n + m is again fed to encoder 206 - 1 to start a new cycle . alternatively , blocks of successive bits can also be fed in a cyclic fashion , i . e ., in some ordered arrangement , to encoders 206 - i . illustratively , encoders 206 - i may each bea convolutional encoder of the type that is used in a standard trellis encoder . switch 207 takes the outputs of encoders 206 - i , preferably in a cyclic fashion , and feeds them to symbol mapping apparatus 208 which generates two - dimensional symbols of the type shown in fig3 at a symbol rate 1 / t , where t is the symbol period . in the illustrative example where encoders 206 - i are convolutional encoders , the cascade of any of the encoders 206 - i with symbol mapper 208 can be thought of as being functionally equivalent to a trellis encoder . the cascade of the parallel arrangement of encoders 206 - i and symbol mapper 208 is then functionally equivalent to m parallel trellis encoders with each generating output symbols at a rate , 1 / mt , that is m times slower than the rate , 1 / t , at which symbols are transmitted over the telephone channel . time - division multiplexing , or interleaving , of the outputs of the m trellis encoders then produces the desired symbol rate of 1 / t . at receiver 203 , the received signal is first equalized by dfe 210 whose detailed operation will be explained hereinbelow . the output samples of dfe 210 are rerouted by switch 215 to a parallel bank of m decoders 216 - i , where i = 1 , 2 , . . . , m . the rerouting , or deinterleaving operation performed by switch 215 has to be consistent with the interleaving operation performed by switch 207 at the transmitter . that is , if interleaving was done by taking the outputs of encoders 206 - i in a cyclic fashion , then switch 215 has to feed successive outputs from dfe 210 in a cyclic fashion to decoders 216 - i . illustratively , each decoder 216 - i may be implemented as a trellis decoder that generates decoded output symbols at a rate that is m times slower than the rate at which symbols are transmitted through the channel . switch 217 takes the outputs of decoders 216 - i , preferably in a cyclic fashion , and time multiplexes them onto a bit stream with bit rate r c . this bit stream is then fed to decoder 218 which perfomrs error correction and produces an information bit streamwith bit rate r d . it should be noted that in fig2 the operation of the transmitter switches must be synchronized and the operation of the receiver switches must be synchronized . however , the operation of the transmitter switches need not be synchronized with those in the receiver . in order to appreciate the improvement in performance provided by communications system 200 , it is necessary to understand the shortcomings of an arrangement that tries to combine a dfe with standard trellis coding . the dfe 210 shown in fig2 provides less noise enhancement than alinear equalizer because it subtracts out some of the intersymbol interference introduced by the channel &# 39 ; s amplitude distortion rather than simply inverting the channel &# 39 ; s amplitude characteristic . this is achieved by using adaptive feedforward filter 211 , slicer 213 , adaptive feedback filter 214 , and subtractor 212 . slicer 213 operates in the same fashion asslicer 111 in fig1 which was used to decode the symbols of an uncoded 9 . 6kb / s modem . that is , in a given symbol period it selects the point in the signal constellation that is closest , in euclidean distance , to the complex sample that is present at its input . when slicer 213 makes an error , by selecting the wrong symbol , this error will generally influence the slicing of subsequent samples generated by subtractor 212 and lead to more slicing errors , even though additive noise alone might not have generated these errors . this phenomenon , which is due to the feedback pathprovided by feedback filter 214 , is inherent in the operation of the dfe and is called error propagation . the effect of error propagation is to introduce a strong , bursty , impulsive noise after subtractor 212 . notice , from fig3 and 4 , that standard trellis coding requires an increase in the size of the signal constellation when compared to an uncoded system providing the same bit rate . in the case of fig3 and 4 , a doubling of the number of points in the signal constellation was necessary when going from the uncoded option to the trellis - coded option . this increase in the number of points in the signal constellation results in a decrease in the distance between adjacent points . it should be apparent that if the outputs of linear equalizer 110 in fig1 were passedthrough a slicer for both the coded and uncoded modes of operation , then the likelihood of making wrong decisions , because of additive noise , wouldbe significantly larger for the coded system than the uncoded system . ( in the illustrative example of the coded option of the v . 32 modem , the outputs of linear equalizer 110 are first processed by trellis decoder 112before slicing occurs , and the net result is an actual increase in robustness in the presence of noise .) thus , if dfe 210 were used in receiver 103 rather than linear equalizer 110 , then the likelihood of slicer 213 making an error would be significantly larger for the coded mode of operation than the uncoded mode of operation . in addition , as was mentioned hereinabove , each slicing error is also likely to induce subsequent slicing errors because of the error propagation effect . it has been found experimentally that the noisy bursts generated by a dfe can severely degrade the performance of a standard trellis decoder to a point where , for certain channels , an uncoded system using a dfe or a trellis - coded system using a linear equalizer will provide a better performance than a system using standard trellis coding and a dfe . the improvement in performance provided by communications system 200 , in accordance with the invention , is due to the concatenation of two corrective actions against the strong , bursty , impulsive noise that is generated at the output of subtractor 212 when error propagation occurs . the first action consists in separating this bursty noise into smaller disturbances that are easier to handle by a decoding device such as a trellis decoder . this is achieved through the use of encoders 206 - i at thetransmitter and decoders 216 - i at the receiver , where i = 1 , 2 , . . . , m . when a burst of noise occurs at the output of subtractor 212 , successive samples of this noise are fed to different decoders 216 - i . as a result , each of the decoders has to handle a smaller amount of noise and is more likely to correct for this noise than would be the case if one single decoder had to correct for the whole burst of noise . it has been found experimentally that a parallel arrangement of m trellis decoders ( m & gt ; 1 ), for example , always performs better than a system using only one trellis decoder ( m = 1 ). however , it has also been found that , for certain channels , one of the trellis decoders , say 216 - 1 for illustration purposes , may still have a noise sample at its input that is strong to interfere with the decoding process . in this case , the bit stream obtainedafter switch 217 consists of bursty blocks of bits , generated by decoder 216 - 1 , which are likely to be in error and are interleaved with other blocks of bits , generated by the other decoders 216 - i , i ≠ 1 , which are generally not in error . there are well - known coding schemes , such as the various variations of the reed - solomon codes , which are well suited tohandle this type of bursty strings of errored bits . encoder 204 at the transmitter and decoder 218 at the receiver implement such a coding scheme , and provide a second corrective action that further mitigates the damaging effects of the dfe &# 39 ; s error propagation problem . it should be pointed out that the use of encoder 204 usually results in a slight increase of bandwidth for the analog data signal that is transmitted over channel 202 . however , this increase in bandwidth can generally be kept small enough so that the resulting degradation in modem performance is faroutweighed by the benefits that accrue from the usage of encoder 204 at thetransmitter and its corresponding decoder 218 at the receiver . there is a third technique that can further improve the performance of receiver 203 in fig2 . this technique can be used when the parallel arrangement of m convolutional encoders 206 - i and symbol mapper 208 in transmitter 201 are m trellis encoders as explained hereinabove . in this case decoders 216 - i in receiver 203 have to be implemented as a parallel bank of m trellis decoders . the technique consists of implementing a &# 34 ; smart &# 34 ; slicer whose decision - making process , in a given symbol period , isdetermined by information that is received from one of the decoders 216 - i . for illustration purposes , it will be assumed that in the symbol period under consideration the output of subtractor 212 is coupled through switch215 to the input of trellis decoder 216 - 1 . in the next symbol period , the technique described hereinbelow would be repeated with decoder 216 - 2 , and so forth . before describing the technique , a brief discussion of the operation of a trellis encoder will be given with reference to the coded v . 32 signal constellation 302 in fig4 . when a trellis code is designed , the coded ( redundant ) signal constellationis partitioned into increasingly smaller subsets as explained , for example , in &# 34 ; channel coding with multilevel / phase signals ,&# 34 ; g . ungerboeck , ieee transactions on information theory , january 1982 . for the purpose of this discussion , only the first partitioning needs to be considered . for signalconstellation 302 this partitioning can , for example , divide the 32 points into two subsets a and b which have 16 points each , and the smallest distance between adjacent points in a subset is the same as the smallest distance between adjacent points in uncoded constellation 301 . for example , if points 305 and 307 belong to subset a , then points 306 and 308belong to subset b . in any given symbol period , only one of the two subsets , either a or b , can be used to select the symbol that has to be transmitted over the channel . the subset that has to be used is determinedby the so - called state of the encoder during this symbol period . transitionfrom one state , in a given symbol period , to another state , in the next symbol period , it not arbitrary and is defined by the selected convolutional encoder . going back now to receiver 203 , assume that trellisdecoder 216 - 1 has received a new input sample from subtractor 212 through switch 215 . trellis decoder 216 - 1 can monitor all the allowed sequences ofstate transitions and attach a likelihood metric to each sequence by processing a long - enough string of input samples . thus , it can determine whether the new received sample is more likely to belong to either subset a or subset b . it can then feed this information to smart slicer 213 via dotted line 219 which then slices with respect to the reference points that are either in subset a or subset b depending on the information received from decoder 216 - 1 . if the state information used by smart slicer213 were always correct , then its performance ( probability of making an error ) would be equivalent to the performance of a more simplistic , or &# 34 ; dumb &# 34 ;, slicer operating an uncoded signal constellation 301 . in practice some degradation in performance is observed , but the smart slicer always outperforms the dumb slicer when operating on coded constellation 302 . as is the case for most of the modem functions shown in fig2 when the technique is used for voiceband modems , the smart slicer can conveniently be implemented as a subroutine in a program executed by a digital signal processor ( dsp ). it should , of course , be noted that while the present invention has been described in terms of several illustrative embodiments , other arrangementswill be apparent to those of ordinary skill in the art . for example , while the embodiments of the present invention have been described in reference to discrete functional elements , the function of one or more of these elements can be provided by one or more appropriately programmed general - purpose processors , or special - purpose integrated circuits , or digital signal processors , or an analog or hybrid counterpart of any of these devices . for example , while the present invention has been describedin reference to particular two - dimensional signal constellations , the invention is also applicable to other two - dimensional signal constellations . indeed , the present invention is applicable to signal constellations having other than two dimensions . also , while a reed - solomon error correction code is implemented in encoder 204 and decoder 218 , other types of codes may be used which correct bursts of error bits . in addition , while in the disclosed embodiment , encoders 206 - i and symbol mapping apparatus 208 operate as trellis encoders and decoders 206 - i operate as trellis decoders , each encoder 206 - i may operate independently of the symbol mapping apparatus so as not to constitutue a trellis encoderbut , instead , a block or convolutional encoder . in such application , decoders 216 - i would each operate as a block or convolutional decoder . finally , the present invention is not limited to voiceband applications butcan be used in virtually any communication applications including high - definition televison systems .

7Electricity

referring now to the drawings wherein are shown preferred embodiments and wherein like reference numerals designate like elements throughout , there is shown in the drawings to follow the decision steps involved in a method of the present invention . this method effectively manages the gate assignments for a plurality of aircraft arrivals into an airport . as discussed above , the overall goal of the present invention is to increase gate , aircraft and other asset efficiency through the real time management of the gate / ramp parking asset from a system perspective . it is important to note that the present invention is a unique , novel combination of several process steps . the various processes involved in these steps include : 1 . a data collection process that collects all of the specified data necessary for the specified airport , and the selected set of assets , aircraft and gates applicable to this specified airport . 2 . an asset trajectory tracking ( i . e ., three spatial directions and time ) process that continuously monitors the current position and status of all aircraft , gates and other assets . 3 . an asset trajectory predicting process that inputs the asset &# 39 ; s ( aircraft gates and other assets ) current position and status ( speed , direction , etc .) into an algorithm which predicts the asset &# 39 ; s future position and status for a given specifiable time or a given specifiable position . 4 . an initial gate assignment process that assigns gates based on the predicted aircraft landing time , gate availability , gate restrictions , passenger connections , etc . 5 . a goal function value calculation process that assesses how well the current gate assignment solution set meets the operator &# 39 ; s / airline &# 39 ; s / airport &# 39 ; s / caa &# 39 ; s specified operational / business and other specified goals based on the trajectory and status of these specified aircraft , gates and other assets . 6 . a goal function optimization gate assignment process that generates various alternative solutions for the set of aircraft scheduled to arrive at the specified airport and the set of gates available at that airport and calculates each scenario &# 39 ; s goal function value , with the highest goal function value corresponding to the assignment set of gates which yields the highest degree of attainment ( i . e ., optimized ) of the operator &# 39 ; s / airline &# 39 ; s / airport &# 39 ; s / caa &# 39 ; s operational / business and other specified goals . ( these solution set scenarios arising as a result of specifiable , realistic changes in the gate assignments , wherein these scenarios include calculations for the changes caused by the changed trajectories and interdependences and other available factors that affect the aircraft and gate trajectories , usage and other gate functions ). 7 . a selection process that chooses the gate / ramp parking assignment solution set that yields the highest degree of attainment ( i . e ., optimized ) of the operator &# 39 ; s / airline &# 39 ; s / airport &# 39 ; s / caa &# 39 ; s operational / business and other specified goals . 8 . a negotiation , validation and approval process , as required , which entails an airline / airport / caa or other outside agency approving the assignment of these new , gate assignments for each of the specified aircraft . 9 . a communication process which allows the airline / airport / caa , other system operator or automated process to communicate the arrival gate assignments , predicted aircraft arrival times and pertinent data to the effected personnel and systems so as to implement the assigned gate / ramp parking assignments . 10 . a closed loop monitoring process , which involves continually monitoring the specified data and updating the trajectories of the specified assets . using this updated data , the monitoring process continuously measures the goal function “ value ” of the current gate assignment solution . further , the goal function optimization process continuously generates alternative gate assignment scenarios using the updated information as it becomes available . when the difference between the goal function value of the current gate assignments and the goal function value of the highest alternative gate assignment scenarios crosses a threshold , as defined by the operator , the airline / airport / caa or other system operator can be notified , and / or the present invention can assign and communicate the new gate / ramp parking assignments so as to implement the assigned gate / ramp parking assignments and then the process begins anew . fig3 provides a flow diagram that represents a simplified view of decision steps involved in the control of an airport gate whose gate / ramp parking assignments are sought to be optimized . it denotes ( step 301 ) how the value of the current gate / ramp parking assignments must first be determined for the initial gate assignment solution set , i . e ., the starting point . while in reality , the selection of the initial aircraft gate assignment , and the next and the next could be arbitrary ; one method of selection could be based on that the first aircraft to land is assigned the first gate to be available . the initial gate assignment is only used as a starting point and baseline to measure the goal function value of the alternative gate / ramp parking assignments as generated by the goal function optimization process ( step 302 ). in step 302 , this method is seen to evaluate alternative gate / ramp parking assignment solution sets to determine if a gate / ramp parking assignment solution set can be found that better meets the operational , business , safety and efficiency goals of the operator . if this cannot be done , this method involves then jumping to step 305 , which communicates the starting point gate assignments to all interested parties . but , if alternative gate / ramp parking assignments can better meet the specified operational / business goals of the operator , the value of the new gate / ramp parking assignments must be compared to the benefit produced ( step 303 ). if the value difference does not justify the changes to the current gate / ramp parking assignments ( i . e ., the difference between the current gate assignment goal function value and the new gate / ramp parking assignments goal function value does not cross the threshold value as determined by the operator ), the process must once again default to step 305 . conversely , if the goal function value of new gate / ramp parking assignment solution set is high enough , the method then entails assigning the new gate / ramp parking assignments and then implementing the new gate / ramp parking assignments by communicating the new gate / ramp parking assignments goals to all interested parties ( step 304 ). finally , the method involves monitoring all of the specified data for the aircraft and specified airport ( gates , personnel , etc .) to determine if each of the aircraft and gate trajectories will meet their current / new gate / ramp parking assignments goal ( step 306 ). it further involves continually evaluating the goal function “ value ” of the current gate assignment solution set using updated data and comparing it against the value of alternative solution sets based on the latest specified and updated data which are continuously generated by the goal function optimization process . if the operator &# 39 ; s goals are not being met , or the value of the goal function for an alternative gate / ramp parking assignment solution set using the updated data differs by a threshold amount from the goal function value of the current gate assignment solution set , the updated gate / ramp parking assignments are communicated to the appropriate personnel for implementation and the entire process is restarted . the method of the present invention continuously analyzes aircraft , gate and other specified data from present time up to “ n ” hours into the future , where “ n ” is defined by the operator / airline / airport / caa . the overall time frame for each analysis is typically twenty - four hours , with the embodiment of the present invention described herein actually assigning the aircraft gate / ramp parking spots between three and five hours into the future and then continuously monitoring the aircraft and other assets . the three to five hour time window prior to landing is felt to be the current optimal time to assign gates based on the fact that earlier than three hours passengers and bags begin to arrive and need a gate at which to assemble , while prior to five hours the accuracy of the data begins to deteriorate . as data accuracy increases and ground handling processes improve , this gate assignment process time window can be expanded . further , until such time as newer processes allow , within the current art , gate assignments under three hours prior to landing begins to have negative effects , such as reduced product quality ( making passengers move to a new gate ) and increased labor costs ( coordination of the gate change and labor required to move the bags collected at the original gate ). this method is seen to avoid the pitfall of sub - optimizing particular parameters . the method of the present invention accomplishes this by assigning weighting values to various factors within the goal function that comprise the airline / airport / caa &# 39 ; s gate / ramp parking assignment operational and other specified goals . additionally , while the present invention is capable of providing a linear ( i . e ., gate by gate optimization ) solution to the optimized gate / ramp parking assignment of a plurality of aircraft approaching an airport , it is recognized that a multi - dimensional ( i . e ., optimize for the whole set of aircraft , gates , other airline assets and needs , airport assets , etc .) gate / ramp parking assignment solution provides a solution that can better meet the operational / business goals of the user airline or system operator . for hub airports , the gate assignment process can be a daunting task as thirty to sixty of a single airline &# 39 ; s aircraft ( along with numerous aircraft from other airlines ) are scheduled to arrive at the hub airport in a very short period of time . the aircraft then exchange passengers , are serviced and then take off again . the departing aircraft are also scheduled to takeoff in a very short period of time . typical hub operations are one to one and a half hours in duration and are repeated eight to twelve times per day . fig4 illustrates samples of the various types of data sets , mathematical functions and processes of the present invention that are used in this decision making process , these include : air traffic control objectives , generalized surveillance , aircraft kinematics , communication and messages , airspace structure , airspace and runway availability , user requirements ( if available ), labor resources , aircraft characteristics , aircraft arrival / departure times , weather , gate availability , maintenance , other assets , and operational / business goals . fig5 illustrates the optimization processing sequence of the present invention . in step 501 , a set of aircraft and gates at a specified airport are selected whose gate assignments into a specified airport , during a specified “ time window ,” are sought to be optimized . in one embodiment of the present invention , the aircraft from outside this window are not submitted for optimization in this scheduling process , but they are taken into account as far as they may impose some limitations on those who are in the selected set of aircraft . in step 502 , all of the specified data necessary to optimize the gate assignment process is collected . next , in step 503 , the positions and future movement plans for all of the aircraft , gates and other assets , etc . is identified with input from databases which include automatic dependent surveillance ( ads ), faa &# 39 ; s aircraft situational data ( asd ), those of the airlines ( if available ) and any other information ( e . g ., weather ) available as to the position and intent of these assets . the calculation of the trajectories for the selected set of aircraft , gates , etc ., can be computed using an assortment of relatively standard software programs ( e . g ., “ aeralib ,” from aerospace engineering & amp ; associates , landover , md . and / or uspto publication ser . no . us - 2003 - 0050646 - a1 —” method and system for tracking and prediction of aircraft trajectories ”) with inputted information for each asset that includes information such as filed flight plan , current position , altitude and speed , data supplied from the airline / user / pilot , usage , etc . in step 504 , a predicted aircraft landing / gate arrival time is calculated based on the calculated trajectories for the specified set of aircraft . then , in step 505 , a figure of merit is calculated and when the figure of merit exceeds a specified threshold , the predicted landing times and other data is used for an initial set of gate assignments for the aircraft . as discussed above , this initial gate assignment process can be accomplished in many different ways since it represents the baseline , or a starting point from which to begin and measure the value of alternative gate assignment solution sets . therefore , the present invention computes the goal function value of the for the initial gate assignment solution set . this value is a measure of how well this set of gate assignments meets the operator &# 39 ; s or other specified operational / business goals . in step 506 , this goal function is optimized with respect to these initial gate assignments by identifying potential changes to these gate assignments so as to increase the value of the solution as determined by the goal function . the solution space in which this search is conducted has requirements place upon it which ensure that all of its potential solutions are operational . these requirements include those such as , but not limited to : no two aircraft occupy the same gate at the same time slot , certain size aircraft can only park at certain gates , etc . this goal function can be defined in many ways . however , one preferred method is to define it as the sum of the weighted components of the various factors or parameters ( e . g ., such factors that need to be individually weighted include : utilizing all of the gates efficiently , less passengers miss their connections , less taxi time for late aircraft , that no aircraft lands and need wait for a gate , that when departing , no aircraft will block another , that when deplaning or loading the aircraft there is less confusion for the passengers that are boarding another aircraft nearby , etc .) that are used to measure how well a gate / ramp parking assignment solution set meets the specified operational / business goals . in step 507 , once all of the alternative gate assignment solution sets are evaluated , the one that best meets the specified operational / business goals is identified and gate / ramp parking assignments are completed . in step 508 , this new set of gate assignments is communicated to all interested parties for implementation . even after these new gate assignments are implemented , the status of the specified aircraft , gates and other assets continues to be monitored , trajectories calculated , predictions made , alternative gate scenarios generated , goal function values calculated , etc . the goal function value of the current gates assignments is calculated using the updated data and is continuously compared to potential alternative gate / ramp parking scenarios so as to identify a gate / ramp parking assignments solution set that better meets the specified operational / business goals . therefore , if the current gates assignments , calculated using the updated data , crosses a specified threshold amount from the goal function value of one of the alternative gate scenario sets , updated gate assignments are made or the entire process begins anew and appropriate adjustments are made to the specified aircraft &# 39 ; s gate assignments . one must also be aware that although the present invention is capable of continuously changing the actual gate / ramp parking assignments , this would be impracticable . therefore , one of the weighted parameters could be a penalty or negative value for changing the assigned gate / ramp parking assignments once they have been communicated to all pertinent personnel for implementation . this could be one method of determining an acceptable difference as to when to act between the current gates assignment goal function value and the potential alternative gate / ramp parking scenarios goal function value . the present invention &# 39 ; s ways of optimizing an airport &# 39 ; s gate / ramp assignments differs from the current industry practices in several , important ways . first , many of the current airline gate / ramp parking assignment processes are often done too early ( i . e ., months in advance ) and only manually changed on an individual aircraft by aircraft basis when things beginning to deteriorate . or , as is done by some airport , the process is done too late , after the aircraft land . some of the key elements inherent within the present invention are timing of the gate / ramp parking assignment , an increase in the number of parameters considered , the accuracy of the specified data , better prediction of the asset trajectories ; all of which are utilized in a goal function optimization process . in one embodiment of the present invention , the gate assignment process is accomplished as soon as the accuracy of the specified data is high enough , but prior to the ramp personnel starting to collect and store baggage or prior to too many passengers arriving at the airport for the next flight of the aircraft . the goal is to assign the gate or parking spot as late in the process a possible , which allows the system to have access to a more stable data set ( the likelihood of trajectory changes is low ), but not too late in the process , so as the quality and cost of other process , i . e ., bag collection and / or passenger waiting process or product quality , is lowered in the application of the present invention in the year 2004 time frame , this gate assignment timing is thought to be three to five hours prior to the aircraft actually arriving at the gate . in the three to five hour window prior to landing , the accuracy of the specified data is high enough , while few , if any passengers , bags or cargo has arrived at the specified airport for the next flight of the aircraft . as described above , the accuracy of the asset trajectories is important , especially the aircraft landing and gate arrival time predictions . it is obvious that if the trajectories are too inaccurate , the quality of any solution based on these trajectories will be less than might be desired . therefore , after any trajectory is built , the present invention must determine the accuracy of the specified trajectory . the present invention determines the accuracy of all trajectories ( aircraft , gates , personnel , etc .) based on an internal predetermined set of rules and then assigns a figure of merit ( fom ) to each trajectory . for example , if an aircraft is only minutes from landing , the accuracy of the estimated landing time , and therefore the fom is very high . there is simply too little time for any action that could alter the landing time significantly . conversely , if the aircraft has filed its flight plan ( intent ), but has yet to depart los angeles for atlanta , there are many actions or events in the current environment that would decrease the accuracy of the predicted arrival time . it is easily understood that one aspect of the fom for these predictions is a function of time . the earlier in time the prediction is made , the less accurate the prediction will be and thus the lower its fom . the closer in time the aircraft is to landing , the higher the accuracy of the prediction , and therefore the higher its fom . effectively , the fom represents the confidence the present invention has in the accuracy of the predicted trajectories . along with duration of the period being predicted by a calculated trajectory , other factors that determine a fom include : available of wind / weather data , availability of information from the pilot , maintenance , etc . an additional method to improve the fom is to drive the trajectories to a specific goal as is done in u . s . pat . no . 6 , 721 , 714 entitled , “ method and system for tactical airline management ” issued apr . 4 , 2004 and u . s . pat . no . 6 , 463 , 383 entitled , “ method and system for aircraft flow management by airlines / aviation authorities ” issued oct . 8 , 2002 . once the trajectories are built and their foms are determined high enough , the goal function optimization process can begin . such a computation of the goal function optimization often involves an algorithm that assigns a numerical value to each of its parameters based on the operator &# 39 ; s goals . often these parameters are interdependent , such that changes in one can negatively affect another . if the goal function is defined simply as the sum of the parameters for the various aircraft whose operation and safety are sought to be optimized , we have what can be thought as a linear process . alternatively , if we define our goal function to be a more complicated , or nonlinear , function so that we take into consideration how changes in one aircraft &# 39 ; s predicted gate departure time might necessitate a change in another aircraft &# 39 ; s gate assignment , it is less clear as to how to better optimize the goal function . however , as is well known in the art , there exist many mathematical techniques for optimizing even very complicated goal functions . it is further recognized that a nonlinear ( i . e ., optimize for the whole set of aircraft , gates , airport assets , personnel , etc .) solution will often provide a solution for the total operation of the airport gates , including all aspects of the aircraft arrival / departure flow that better meets the specified operational / business goals . to provide a better understanding how this goal function process optimization routine may be performed , consider the following mathematical expression of a typical gate scheduling problem in which a number of gate assignments , 1 . . . n , are expected to be assigned at time values t 1 . . . t n . they need to be rescheduled so that : the time difference between the gate departure of outbound aircraft and gate arrival of inbound aircraft is not less than some minimum , δ ; the number of gate re - assignments is as little as possible ; some aircraft may only be parked at specific gates . we use d i to denote the change ( negative or positive ) our rescheduling brings to t i . we may define a goal function that measures how “ good ” ( or rather “ bad ”) our changes are for the whole gate pool as where r i are application - defined coefficients , putting the “ price ” at changing each t i ( if we want to consider rescheduling the i - th gate “ expensive ”, we assign it a small r i , based , say , on safety , airport capacity , arrival / departure demand and other factors ), thus effectively limiting its range of adjustment . the sum runs here through all values of i , and the exponent , k , can be tweaked to an agreeable value , somewhere between 1 and 3 ( with 2 being a good choice to start experimenting with ). the goal of the present invention is to minimize g 1 as is clear herein below . next , we define the “ price ” for a departure and arrival gate being assigned gate too close in time to each other . for the reasons , which are obvious further on , we would like to avoid a non - continuous step function , changing its value at δ . a fair continuous approximation may be , for example , g 2 = σ ij p (( δ −| d ij |)/ h ) where the sum runs over all combinations of i and j , h is some scale factor ( defining the slope of the barrier around δ ), and p is the integral function of the normal ( gaussian ) distribution . d ij stands here for the difference in time of arrival / departure between both gate , i . e ., ( t i + d i )−( t j + d j ). thus , each term is 0 for | d ij & gt ;& gt ; δ + h and 1 for | d ij |& lt ;& lt ; δ − h , with a continuous transition in - between ( the steepness of this transition is defined by the value of h ). as a matter of fact , the choice of p as the normal distribution function is not a necessity ; any function reaching ( or approaching ) 0 for arguments & lt ;& lt ;− 1 and approaching 1 for arguments & gt ;& gt ;+ 1 would do ; our choice here stems just from the familiarity . a goal function , defining how “ bad ” our rescheduling ( i . e ., the choice of d ) is , may be expressed as the sum of g 1 and g 2 , being a function of d 1 . . . d n : g ( d 1 . . . d n )= kσ i c i d i 2 + σ ij p (( δ −| d ij |)/ h ) with k being a coefficient defining the relative importance of both components . one may now use some general numerical technique to optimize this function , i . e ., to find the set of values for which g reaches a minimum . the above goal function analysis is applicable to meet many , if not all , of the individual goals desired by an airline / aviation authority . to illustrate this optimization process , it is instructive to consider the following goal function for n gate : g ( t 1 . . . t n )= g 1 ( t 1 )+ . . . + g n ( t n )+ g 0 ( t 1 . . . t n ) where each g i ( t i ) shows the penalty imposed for the i - th gate arriving at time t i , and g 0 — the additional penalty for the combination of arrival times t 1 . . . t n . the latter may , for example , penalize when two gate take the same arrival slot . g i ( t )= a × ( t − t s ) 2 + b × ( t − t e ) 2 so as to penalize an gate for deviating from its scheduled time , t s , on one hand , and from its estimated ( assuming currents speed ) arrival time , t e , on the other . let us assume that for the # 1 gate t s = 10 , t e = 15 , a = 2 and b = 1 . then its goal function component computed according to the equation above will be a square parabola with a minimum at t close to 12 ( time can be expressed in any units , let us assume minutes ). thus , this is the “ best ” gate assignment for that gate as described by its goal function and disregarding any other gate in the system . with the same a and b , but with t s = 11 and t e = 14 , the # 2 gate &# 39 ; s goal function component looks quite similar . now let us assume that the combination component , is set to 1000 if the absolute value ( t i − t 2 )& lt ; 1 ( both gate occupy the same slot ), and to zero otherwise . the minimum ( best value ) of the goal function is found at t 1 = 11 and t 2 = 12 , which is consistent with the common sense : both gate are competing for the t 2 = 12 minute slot , but for the # 1 gate , the t 1 = 11 minute slot is almost as good . one &# 39 ; s common sense would , however , be expected to fail if the number of involved gate exceeds three or five , while this optimization routine for such a defined goal function will always find the best goal function value . finally , to better illustrate the differences between the present invention and the current art used for managing an airport &# 39 ; s gate / ramp parking , consider the following examples : example 1 — consider the problem of 5 aircraft ( flights a , b , c , d , and e ) approaching atlanta airport , which need to park at gates 1 through 5 . in the current art , most gate assignments are scheduled weeks or months in advance . unfortunately , as can be expected given the many independent decisions and variance that exists in the aircraft flow within the current art , the actual daily operation differs from the schedule , sometimes significantly . this randomness and variance leads to a flight by flight set of unique goals that are impossible to meet , or even consider weeks in advance . for example , these unique goals might include that gate 1 is planned to be occupied 13 minutes longer than normal today because the flight occupying gate 1 arrived late . or that flight a needs 55 minutes of maintenance , but only was originally scheduled on the gate for 35 minutes , which will impact the next aircraft arrival at the gate . or that if flight b can get to a gate 6 minutes early , it will prevent the flight crew from being illegal for the next flight . or that flight c is 20 minutes late . these unique goals are specific to today &# 39 ; s operation and this set of unique goals changes each and every day . but along with the unique goals , there are other general goals that flights a , b , c , d and e and every aircraft want to meet every day , all day . these general goals include that all aircraft have a gate to park when they land , all flights are on schedule , all personnel and equipment necessary to service the aircraft are available when the aircraft reaches the gate , all passengers make their connections , the time on the gate is minimum , no aircraft blocks or delays another aircraft when departing and the aircraft are in the correct queue for departure such that they arrive at the next destination on schedule , etc . using the present invention , most if not all of the above operational / business goals are known only hours before the aircraft lands and needs a gate . therefore , in one embodiment of the present invention this data is processed with a set of weighting factor applied to each parameter ( as set by the operator ) where a higher number indicates a higher attainment of the specified operational / business goals , to determine a goal function value for each possible gate / ramp parking assignment solution set that is evaluated . using this information , the goal function optimization process would examine the possible gate / ramp parking assignment solution sets to find one that better meets the operational / business goals of the operator . in this example of one embodiment of the present invention , the goal function optimization would seek the gate / ramp parking assignment solution set that has the higher goal function value . further , in this simple example of 5 aircraft and 5 gates , it is easy to calculate that there are 120 possible gate / ramp parking assignment solution sets . manually examining even this simple example to find a more optimal gate / ramp parking assignment solution set that better meets many of the specified goals is a difficult task . but when you expand the arrival bank to 50 aircraft , many with numerous unique goals and consider that 10 to 12 banks of such aircraft arrive at a hub airport each day , the problem of finding an acceptable gate solution for each aircraft takes much longer . this is why , in the current art , airlines assign gates weeks to months in advance , and alter the gate assignment if difficulties arise . but when the randomness and variance , so evident in the aircraft arrival flow within the current art , begin to deteriorate the schedule , changes are required . since these unique goals are unknown when the schedule is written , the only way to account for these unknowns is by adding buffer time ( empty gates or extra flight time ) and trying to deal with any problems once they develop . to buffer the current gate assignments , airlines routinely add minutes to both their schedule block time and scheduled gate time to deal with this randomness . this added time is a very expensive way to try and solve the problem . further , dealing with a problem , any problem after the problem occurs makes the solution much more difficult . for example , since in the current art many of these unique parameters are not tracked or considered , the gate manager only learns that there is a problem in the last 30 minutes of flight or even after the aircraft lands . so even with additional “ production time ” or buffer time added into the schedule , the flight arrives , and the gate , and all of the other gates are already occupied and the flight , and its passengers sit , waiting for a gate , 10 , 20 or even 30 minutes . that said , tactically assigning gates 3 to 5 hours prior to landing , provides a more optimal solution . not only can the gate / ramp parking assignment solution account for the general goals , but it can also account for the unique goals of each aircraft in the arrival flow . the use of a computer and a software based goal function optimization process , inherent within one embodiment of the present invention , allows an airline to not only tactically manage its gate process tactically , but encompass the unique goals necessary to better meet an airline &# 39 ; s operational / business goals . in this example , let us first start by collecting the specified goals and data . first is the goal . in this example , the goal is to try to have a gate available as soon as each aircraft arrives . using the goal function parameter , we will assign a value of zero if the aircraft has to wait for a gate and one if the aircraft does not have to wait for the gate , further , as discussed above , the unique goals include that gate 1 is free at 1305z , flight a requires 55 minutes of maintenance at the gate , flight b needs to be at gate 6 minutes early to prevent the flight crew from being illegal for the next flight , flight c is 20 minutes late and flights d and e have no special requirements . additionally : all flights usually are scheduled for 35 minutes on the gate . flight a is scheduled to be at the gate at 1255 , and will be at the gate at 1255 flight b is scheduled to be at the gate at 1245 , but will be at the gate at 1237 flight c is scheduled to be at the gate at 1255 , but will be at the gate at 1315 flight d is scheduled to be at the gate at 1250 , but will be at the gate at 1255 flight e is scheduled to be at the gate at 1240 , but will be at the gate at 1251 gate 1 is open at 1305 , with the next aircraft scheduled to arrive at 1355 gate 2 is open at 1245 , with the next aircraft scheduled to arrive at 1405 gate 3 is open at 1235 , with the next aircraft scheduled to arrive at 1330 gate 4 is open at 1253 , with the next aircraft scheduled to arrive at 1345 gate 5 is open at 1250 , with the next aircraft scheduled to arrive at 1340 next , once the data is determined stable enough ( i . e ., the figure of merit is high enough ) the initial set of gate assignments is set . since the initial set of gate assignments can be somewhat arbitrary , the present invention can assign the gates as follows : flight a assigned to gate 1 flight b assigned to gate 2 flight c assigned to gate 3 flight d assigned to gate 4 flight e assigned to gate 5 in this example , the present invention is trying to optimize the gate assignment function such that none of the 10 aircraft have to wait for a gate . as can be seen from the initial gate assignments and the collected data there are some problems with the initial gate assignments . flight a will arrive at 1255 , but gate 1 will not be available until 1305 ( a 10 minute wait ), and flight a , because of maintenance , will not be ready to depart until 55 minutes after arriving at the gate at 1400 , which will cause the next aircraft arriving at 1355 to wait for the gate . flight b will arrive at 1237 , but gate 2 is not available until 1245 , which will make the crew illegal for their next leg . flight c will arrive at gate 3 at 1315 and with a 35 minute gate time will depart at 1350 , which will cause the next aircraft to wait 20 minutes for a gate . the gates for flights d and e are open when they arrive and the aircraft have no special requirements or down line conflicts with the next arriving aircraft . the above gate assignment leads to a goal function value of 6 , since 4 of the 10 aircraft will have to wait for a gate . using the goal function process , the present invention will set a value of the initial gate assignment and then work to seek a gate assignment solution with a higher goal function value . after searching the possible gate assignment solution sets , the goal function optimization process determines that the following gate assignment solution set better meets the operator &# 39 ; s goal since no aircraft will land and be required to wait for a gate . flight a assigned to gate 2 flight b assigned to gate 3 flight c assigned to gate 1 flight d assigned to gate 4 flight e assigned to gate 5 using this gate assignment solution set , flight a will arrive at gate 2 at 1255 , the gate will be available at 1245 , and , after 55 minutes of maintenance , it will be ready to depart at 1350 , which will not interfere with the next aircraft arriving at 1405 . flight b will arrive at gate 3 at 1237 and gate 3 is available at 1235 , which will make the crew legal for their next leg . flight c will arrive at gate 1 at 1315 and with a 35 minute gate time will depart at 1350 , which will not interfere with the next aircraft . the gates for flights d and e are open when they arrive and the aircraft have no special requirements or down line conflicts with the next arriving aircraft . the above gate assignment leads to a goal function value of 10 , since none of the 10 aircraft will have to wait for a gate . once the gate assignments are decided , the present invention would communicate the gate assignments to the appropriate personnel ( pilot , maintenance , passengers , etc .) for implementation . for example , the pilot needs to know towards witch gate to taxi , the ramp and maintenance personnel need to which gate to go to meet the aircraft and the passengers need to know where to go to board their flights . finally , the present invention would continue to monitor the specified goals and data for changes , calculate the current goal function value based on the updated data and determine the need for reassigning and implementing updated gates . example 2 — when aircraft in a hub bank depart , they often depart at or close to the same time . in the current art , without tactical departure information considered in the gate assignment process , these aircraft routinely block each other as they push back from the gate . for example , aircraft # 1 pushes back from gate a at 1230 . aircraft # 2 , which is to the right of # 1 at gate b , pushes back at 1232 , # 3 , to the right of # 2 , at 1234 and # 4 , to the right of # 3 , at 1236 . because of the ramp configuration , all aircraft must turn to their right to taxi to the runway and with the gates so close together , aircraft must wait until the aircraft to its right moves . this means that even though aircraft # 1 is ready to taxi soon after it pushes from gate a , it must wait for # 2 to leave from gate b , which must wait for # 3 to depart , which must wait for # 4 to turn out . in other words , assuming that all aircraft require the same amount of time to push from the gate and prepare to taxi , aircraft # 1 must wait a minimum of 6 extra minutes to begin taxi , # 2 must wait an extra 4 minutes and # 3 an extra 2 minutes . and further decreasing the efficiency of the operation the first come , first serve process of the atc system assigns the first takeoff to aircraft # 4 , the first aircraft in line and the first to taxi . this further delays aircraft # 1 , # 2 and # 3 . in the method of the present invention , the predicted departure times are used in the gate assignment goal function process to determine a more efficient gate assignment solution . in this example , assuming all other parameters are equal , the gate assignments would be reversed , such that aircraft # 4 would be assigned gate a , aircraft # 3 assigned gate b , etc . then as the aircraft depart , aircraft # 1 , the first to depart , would be the on to the farthest right and immediately able to taxi after the push back process . in fact , there would be no taxi delay for any of the 4 aircraft . example 3 — given the increased predictability of the aircraft arrival / departure time based on the tactical gate assignment , the process of the present invention helps the airlines / users / pilots to more efficiently sequence the ground support assets such as gates , fueling , maintenance , flight crews , etc . for example , less gate changes are required , less labor is needed to make such changes , and the entire gate assignment arrival process becomes more predictable and stable , thus allowing the airline &# 39 ; s secondary processes ( crews , cleaners , fuelers , etc .) to increase efficiency . example 4 — hub operations typically require a large number of actions to be accomplished by an airline in a very short period of time , thus requiring the maximum utilization of the assets . one such group of important assets is the gates . typically in a tightly grouped hub operation , the departures of an airline &# 39 ; s aircraft from the last hub operation compete for gate assets with the arrivals of the same airline for the next hub operation . if an aircraft is early or late , it can have a negative impact on the passengers and the throughput of the airport . for example , if the winds are such that many of the aircraft in an arrival bank arrive 20 minutes early , more often than not , these aircraft must wait for a gate , even though some gates are available . by only assigning gates in the 3 to 5 hour window prior to arrival , the gate assignment process can take into account the early arrivals and assign gates to try and accommodate all of the early arriving aircraft . further , if all of the arriving aircraft cannot be immediately assigned gates when they land , by identifying this gate constraint much earlier in the arrival process ( 3 to 5 hours or more prior to landing ), some aircraft can be held at their departure point or slowed enroute ( see u . s . pat . no . 6 , 463 , 383 —“ method and system for aircraft flow management by airlines / aviation authorities ”). example 5 — further , one can look at the example of the impact of a tactical gate assignment process to the aircraft passenger boarding . if a flight on gate a is 5 hours late , it can happen that it is boarding at the exact same time as an on schedule departure at gate b . if both of these flights are full , large international aircraft ( b747 ), the number of people trying to board is well in excess of 600 people . if these two gates are close together , the boarding lines can cross , creating confusion for the passengers and airline personnel . additionally , the passengers of the late flight are already stressed and by boarding both aircraft simultaneously , right next to each other , more stress is added to the passengers . example 6 — numerous aviation delays are caused by the unavailability of an arrival gate or parking spot once the aircraft lands . as discussed , current airline / airport gate management techniques typically assign gates either too early ( i . e ., months in advance ) and only make modifications after a problem develops , or too late ( i . e ., when the aircraft lands ). many passengers are familiar with the frustration of landing and waiting for their gate to become available . this leads to situations where the gate for a particular aircraft is not available , yet other gates are empty , which is even more frustrating since the passengers can usually see the open gates and cannot understand why they cannot park at the open gate . unfortunately , if one waits until the aircraft lands to seek an alternative gate , it is a difficult task and passengers don &# 39 ; t realize the complexity and disruption of changing a gate assignment after the aircraft lands . for example , passengers for the aircraft &# 39 ; s next flight are waiting at the initial gate . by changing the gate assignment for a particular aircraft late in the process , these passengers are forced to move to a different gate . additionally , all of the bags for these passengers are waiting to depart at the original gate . by changing the gate , someone must collect these bags and move them to the new gate . further , all of the personnel at both gates must be notified of the change . in the present invention , the aircraft trajectories are meshed with the gate trajectories in real time 3 to 5 hours prior to arrival . for example , it is known 4 hours to arrival that flight 123 will land 15 minutes early at 1205 pm , and is scheduled to taxi to gate 12 . but gate 12 is occupied by flight 321 until 1215 pm , which is flight 321 &# 39 ; s scheduled departure . in the current art , while the data may be displayed to a gate manager , the complexity of manually changing the gate is difficult so that it is likely that flight 123 would land and wait 10 minutes for the gate . in the present invention , using the goal function optimization , there are many possibilities to avoid this 10 minute delay . one such option would be to assign flight 321 to a different gate and flight 456 to gate 12 , since flight 456 is scheduled to depart gate 12 at 1155 am . or an alternative scenario is to assign flight 123 to gate 15 , where flight 456 is parked . by running the goal function optimization process in the 3 to 5 hour window , it opens many possibilities to preclude flight 123 from waiting for a gate once it lands . using the present invention , this simultaneous boarding problem can be identified earlier and an alternative gate assignment solution can be sought . in this case , as the on schedule aircraft is within the gate assignment window , given the predicted departure time of the late aircraft , the on schedule aircraft can be assigned a different gate so that the two boarding processes , although still done simultaneously , are not intertwined . not only does this lower the passenger stress and improve product quality , the lowering of the confusion will often lead to a faster , more efficient boarding process , less confusion and less potential errors . the foregoing description of the invention has been presented for purposes of illustration and description . further , the description is not intended to limit the invention to the form disclosed herein . consequently , variations and modifications commensurate with the above teachings , and combined with the skill or knowledge in the relevant art are within the scope of the present invention . the preferred embodiments described herein are further intended to explain the best mode known of practicing the invention and to enable others skilled in the art to utilize the invention in various embodiments and with various modifications required by their particular applications or uses of the invention . it is intended that the appended claims be construed to include alternate embodiments to the extent permitted by the current art .

6Physics

fig1 depicts the improved catheter assembly 10 of the present invention . the catheter assembly 10 comprises a safety inserter 12 and a catheter 14 . referring to fig2 and 3 , the catheter 14 comprises a flexible tube 16 defining a lumen 18 therethrough . a sharpened needle tip 20 is secured to a distal end of the flexible tube 16 . a hub 22 is formed at a proximal end of the catheter 14 . the hub 22 facilitates connection of the catheter 14 with an administration line ( not shown ) to provide for the communication of fluids through the catheter 14 , as will be easily understood by those skilled in the art . the flexible tube 16 advantageously is preferably formed of a soft thermoplastic material . preferably , the flexible tube 16 is formed of a material having a hardness value between 50 and 90 shor a , more preferably between 65 and 85 shor a , and most preferably approximately 70 shor a . in a preferred embodiment , the flexible tube 16 is formed of polyurethane . a suitable polyurethane is sold under the tradename carbothane ™ by thermedics corporation of woburn , mass . and has a hardness value of approximately 70 shor a . the soft flexible tube 16 minimizes the trauma to the internal surface of the anatomical passageway into which the catheter 14 is placed . thus , movement of the patient and / or the catheter 14 located outside the patient is not substantially translated to movement of the portion of the flexible tube 16 within the patient &# 39 ; s anatomical passageway . when the catheter 14 is disposed within an anatomical passageway such as a blood vessel , the flexibility of the tube 16 allows the catheter 14 to be flow directed to the center of the blood vessel , the area of highest velocity flow which is sometimes referred to as the “ hemodynamic center ” of the vessel . the minimization of trauma to the internal surface of the blood vessel allows the catheter 14 to remain viable for longer periods than heretofore feasible . when used intravenously , the catheter 14 of the present invention may remain viable for a treatment period in excess of seven days , and preferably in excess of ten days . in some instances the catheter 14 may remain viable for two weeks or more . the increased viability of the catheter 14 has many advantages . for example , it decreases the number of times a patient will need to be “ stuck ” due to the removal and reinsertion of a catheter 14 during the course of treatment . in addition , it minimizes the number of times medical practitioners are exposed to sharp needles and the potential for accidental sticks . it also decreases the cost , in terms of both time and materials , associated with the use of multiple catheters during the course of treatment . the flexibility of the tube 16 also allows for an increased length of tube to be extended within the patient &# 39 ; s anatomical passageway as the application may require . flexible tubes containing flexible interwoven wires in the tubular wall such as manufactured by h . v . technologies of trenton , ga . are available . these tubes have the advantage of high strength , high radiopacity and high flow rates because of decreased wall thickness . walls of only 0 . 003 inches are possible . the size of the flexible tube 16 varies by application . generally , the outside diameter of the flexible tube 16 will range from approximately 0 . 02 to 0 . 08 inches . a flexible tube 16 of a preferred embodiment for intravenous use has an outside diameter of 0 . 035 inches , a wall thickness of 0 . 005 inches , and thereby forms a lumen of 0 . 025 inches in diameter . referring to fig3 and 5 a sharpened needle tip 20 is secured to a distal end of the flexible tube 16 . in one aspect of the invention the sharpened needle tip 20 is formed by cutting the end off a conventional sharpened cannula . the cannula comprises an elongated tube defining a lumen and having an oblique angled cut to form its sharp end . the needle tip 20 therefore has an inner surface 24 defining a lumen 28 . the proximal end of the needle tip 20 forms a short tube 30 ( fig3 ). the distal end of the needle tip 20 has a piercing point 26 . preferably , the sharpened needle tip 20 is formed of a metal . one suitable metal is a 300 series stainless steel . the needle tip 20 may be a suitable length for the application at issue . preferably , it is approximately 0 . 1 to 0 . 25 inches in length . the outside diameter of the needle tip 20 corresponds to the inside diameter of the flexible tube 16 of the catheter 14 . preferably , the diameter of the lumen 28 defined by the inner surface of the needle tip 20 is approximately 60 - 90 % of the outside diameter so as to maintain the structural integrity of the needle tip 20 during use . at least a portion of the proximal end of the needle tip 20 extends into the distal end 17 of the flexible tube 16 . in a preferred embodiment wherein the needle tip 20 has length of 0 . 23 inches , approximately 0 . 13 inches extend within the flexible tube 16 . referring to fig5 preferably the outer surface 32 of the needle tip 20 is adjacent the inner surface 34 of the flexible tube 16 . the proximal edge of the needle tip 20 forms an annular shoulder 36 within the flexible tube 16 . the lumen 28 of the sharpened needle tip 20 is in fluid communication with the lumen 18 defined by the flexible tube 16 . preferably , the lumen 28 of the sharpened needle tip 20 is coaxial with the lumen 18 defined by the flexible tube 16 . referring to fig3 the proximal end of the flexible tube 16 is attached to a hub assembly 22 and is in fluid communication therewith . the hub assembly 22 facilitates connection of the catheter 14 to a communication line from which fluids are administered to a patient . any suitable hub assembly 22 may be utilized as is understood in the art . as shown in fig3 in a preferred embodiment , the catheter 14 further comprises a strain relief 38 disposed around the flexible tube 16 . the strain relief 38 facilitates the attachment of the flexible tube 16 to the hub 22 and also provides additional structural integrity to the flexible tube 16 . this is useful if the catheter 14 needs to clamped . for example , after the catheter 14 is inserted into a patient , a hemostasis clip may be applied to prevent the flow of fluids through the catheter 14 while an administration line is connected . by applying the clip to the outer surface of the strain relief 38 , it will close the lumen 18 of the flexible tube 16 without creating the risk of damaging the flexible tube 16 which is in fluid communication with the patient &# 39 ; s anatomical passageway . in a preferred embodiment , the flexible tube 16 and strain relief 38 are fixed within a hub 22 . alternatively , they can be fixed to an outer surface of a hub 22 or other apparatus so long as fluid communication is maintained through the catheter 14 and hub 22 . referring to fig1 and 6 , the safety inserter 12 of the catheter assembly 10 comprises a base 40 , a body portion 42 and a distal portion 44 . in a preferred embodiment , the base 40 facilitates handling of the catheter assembly 10 during insertion of the catheter 14 and subsequent removal of the inserter 12 . the base 40 therefore preferably includes a surface 43 for gripping during the insertion and removal process . the base 40 further defines a flashback chamber 46 , which can also be configured to accommodate a luer . as shown in fig1 a hydrophilic plug 11 is inserted into the flashback chamber which facilitates venting of air from the flashback chamber 46 while also preventing leakage of blood or fluids therefrom . the base 40 of the inserter is adapted to engage the hub 22 of the catheter 14 . in a preferred embodiment , the base 40 forms a friction fit with the hub 22 . referring to fig6 and 7 , the body portion 42 of the safety inserter 12 is sized to fit within the lumen 18 of flexible tube 16 of the catheter 14 , but not within the lumen 28 formed by the sharpened needle tip 20 . the distal end portion 44 of the safety inserter 12 is sized to fit within the lumen 28 formed by the sharpened needle tip 20 of the catheter 14 . the distal edge 47 of the distal end portion 44 of the inserter 12 need not be sharp , and is preferably blunt to avoid the possibility of damage to the catheter 14 or the risk of needle stick injuries . in a preferred embodiment , the body portion 42 of the safety inserter 12 is formed by a cannula 48 having an outside diameter corresponding to the diameter of the lumen 18 defined by the flexible tube 16 of the catheter 14 . a smaller cannula 50 is fixed within the larger cannula 48 . the small cannula 50 extends out from a distal end of the large cannula 48 to form the distal end portion 44 of the safety inserter 12 . the outside diameter of the smaller cannula 50 corresponds to the inside diameter of the sharpened needle tip 20 and the inside diameter of cannula 48 . alternatively , the safety inserter 12 may be manufactured as a unitary piece . when the safety inserter 12 is engaged within the catheter 14 , the distal edge 53 of the large cannula abuts the annular shoulder 36 formed at the proximal edge of the sharpened needle tip 20 . in a preferred embodiment , the sharpened needle tip 20 is formed by cutting the sharp end off a sharpened cannula 48 . the remaining cannula is then used as the large cannula 48 of the safety inserter 12 . this assures that the needle tip 20 and large cannula 48 are properly sized . the lumen 49 defined by the large and small cannulas 48 , 50 may be in communication with the flashback chamber 46 of the base 40 . in one embodiment , the small cannula 50 extends into the flashback chamber 46 ; however , the cannula 50 may terminate distal the flashback chamber 46 as will be easily understood . the sharpened needle tip 20 may be secured to the flexible tube 16 in any suitable manner . a particularly effective means of attachment comprises the use of a radio frequency ( rf ) welder . application of the rf energy heats the flexible tube 16 material of the catheter 14 and causes it to adhere to the sharpened needle tip 20 . additionally , it causes the simultaneous melting and some commingling of the two plastic materials forming the flexible tube 16 and retaining material 52 to further promote the securement of the needle tip 20 . in a preferred embodiment , the catheter 14 , as shown in fig5 further comprises a retaining material 52 adjacent the distal end of the flexible tube 16 and disposed around at least a portion of the outer surface of the needle tip 20 . preferably , the retaining material 52 forms an annular ring surrounding the outer circumference of the needle tip 20 . a mandrel ( not shown ) is preferably placed within the flexible tube 16 and the needle tip 20 during the attachment process . alternatively , a safety inserter 12 of the present invention can be used for this purpose . the retaining material 52 and a portion of the flexible tube 16 are then heated with the rf welder . pressure may also be applied to the outer surface of the flexible tube 16 and the retaining material 52 . the retaining material 52 adheres to the needle tip 20 and tube 16 during the welding process . likewise , the tube 16 adheres to the needle tip 20 during welding . the retaining material 52 preferably comprises a plastic having a hardness greater than the material forming the flexible tube 16 . preferably the retaining material is a polyurethane . in one preferred embodiment the retaining material is a polyurethane having a hardness value of approximately 99 shor a . the retaining material may , of course , be of any other hardness . in another aspect of the invention , a first set of one or more cavities 54 a , b are formed in the outer surface 32 the needle tip 20 . the cavities 54 a , b extend from the outer surface 32 of the needle tip 20 toward the inner surface 24 . preferably , the cavities extend from the outer surface 32 to the inner surface 24 forming a hole through the outer circumference of the needle tip 20 . during the attachment process , the needle tip 20 is positioned within the distal end of the flexible tube 16 with the first set of one or more cavities 54 a , b located distal the end of the flexible tube 16 . the retaining material 52 is formed in an annular shape around the circumference of a portion of the needle tip 20 extending beyond the flexible tube 16 and covering the holes 54 a , b . a mandrel is placed within the flexible tube 16 and needle tip 20 . the retaining material 52 is heated with the rf welder . in its molten state the retaining material 52 fills the first set of one or more cavities 54 a , b to further secure the needle tip 20 to the flexible tube 16 . in addition , the retaining material 52 adheres to the tube 16 . in another aspect of the invention , a second set of one or more cavities are formed in the outer surface 32 of the needle tip 20 . preferably , the cavities 56 a , b extend from the outer surface 32 to the inner surface 24 forming a hole through the outer circumference of the needle . alternatively , the cavities may be indentations that do not extend through the needle tip 20 . during the attachment process , the needle tip 20 is positioned within the distal end of the flexible tube 16 with the first set of one or more attachment cavities 54 a , b located beyond the end of the flexible tube 16 , and the second set of one or more attachment cavities 56 a , b located within the lumen 18 defined by flexible tube 16 . the retaining material 52 is formed in an annular ring around the circumference of the needle tip 20 as described above . another advantage of the invention is the harder ( 99 shor a ) material can be formed to eliminate any transition shoulder between the point of the needle tip 20 and the flexible tube 16 thereby minimizing trauma during insertion . an rf welder is applied to the retaining material 52 and flexible tube 16 as described above . the first set of one or more cavities 54 a , b is filled with the retaining material 52 . the material of the flexible tube 16 fills the second set of one or more cavities 56 a , b . the cavities 54 , 56 can be any suitable size , depending upon the size of the needle tip 20 and the corresponding flexible tube 16 . in a preferred embodiment the cavities 54 , 56 form holes in the needle tip 20 having a diameter of 0 . 005 inches . a sufficient number of holes may be used , but not so many that would interfere with the structural integrity of the needle tip 20 . in a preferred embodiment of the invention , the first and second sets of cavities 54 , 56 each comprise two holes . it should be understood that the tube 16 retaining material 52 and needle tip 20 may be adhered without the use of holes or indents . moreover , the tube 16 may be adhered to the needle tip 20 without the use of a retaining material 52 as will be understood by those skilled in the art . for example , the tube 16 may be rf bonded directly to the needle tip 20 and the distal end 17 of the tube may be sloped toward the needle tip 20 in the bonding process to eliminate a shoulder which may harm a vessel wall upon insertion of the catheter 14 in a passageway of a patient . of course , the needle tip 20 may be provided with external projections which communicate with indents or holes in the flexible tube 16 and / or retaining material 52 to add in securing the tip 20 to the tube 16 and / or material 52 as will be easily understood by those of skill in the art . fig8 and 9 illustrate another embodiment of the invention wherein an improved needle tip 58 has been adapted to minimize trauma to the interior of the anatomical passageway in which it is inserted . the conventional needle tip 20 shown , for example , in fig5 has a piercing point 26 at its most distal end . the piercing point 26 is aligned with the outer surface 32 of the short tube 30 forming the proximal end of the needle . in the embodiment wherein the needle tip 20 is formed by cutting an end off a sharpened cannula , the point 26 is in a place defined by a portion of the wall of the cannula . the improved needle tip 58 of this further aspect of the invention has a piercing point 60 substantially aligned with a central axis 62 of the lumen 64 . preferably , the improved needle tip 58 is formed by bending a conventional needle tip 20 so that the piercing point 60 of the needle tip 58 is so aligned . alternatively , the needle can be manufactured in the desired configuration . by providing the needle point 60 substantially along the central axis 62 of the lumen 64 of the needle tip 58 , the risk of the needle tip 58 piercing the opposing wall of a passageway or vessel of a patient is significantly reduced , both during the insertion process and while the catheter 14 is disposed within a patient &# 39 ; s anatomical passageway . in practice , a healthcare worker sometimes inserts a standard needle tip 20 too far , so that it enters the vessel and then pierces the opposing wall of the vessel . upon withdrawal of the needle tip , internal bleeding occurs . by placing the point 60 along the central axis 62 , the risk of piercing the opposite vessel wall is significantly reduced because the catheter is typically inserted into the vessel at an acute angle to the longitudinal axis of the vessel , as will be easily understood by those of skill in the art . similarly , the point 60 of needle tip 58 will naturally be less likely to contact the inside wall of an anatomical passageway in which it is disposed thereby reducing the risk of trauma to the patient . having thus described the construction of certain preferred embodiments of the apparatus of the present invention and the associated method of making the same , a preferred treatment method utilizing the apparatus of the invention is described . the safety inserter 12 is initially placed within the catheter 14 . the distal end portion 44 of the safety inserter 12 extends within the lumen 28 defined by the needle ( fig7 ). the distal edge 47 of the distal end portion 44 extends sufficiently far into the needle tip 20 to provide support during insertion but not so far that the blunt end 47 of the inserter will interfere with the piercing point 26 of the needle tip 20 . the body portion 42 of the inserter extends within the flexible tube 16 of the catheter 14 . the distal edge 53 of the outer cannula 48 forming the base portion 42 preferably abuts the proximal edge 36 of the needle tip 20 to allow the practitioner to urge the catheter 14 into a patient &# 39 ; s anatomical passageway by applying force to the inserter 12 , which is translated to the needle tip 20 . in one preferred application the catheter 14 is urged into a patient &# 39 ; s vein to provide intravenous treatment to the patient . once the catheter 14 is properly placed within the patient &# 39 ; s anatomical passageway , a homeostasis clip or suitable device is applied to close the flexible tube 16 . preferably the clip is applied to the strain relief 38 . the catheter 14 is held in place while the inserter 12 is removed . the blunt inserter 12 is eventually discarded . the hub 22 of the catheter 14 may then be connected to a fluid communication line such as a standard administration set . the catheter 14 , including the sharpened needle tip 20 , remains disposed within the patient &# 39 ; s anatomical passageway . fluid communication is established through the catheter 14 wherein fluids are infused into or withdrawn from the patient by removal of the clip . preferably , the catheter 14 remains in place during the entire period in which the patient is treated with a catheter 14 . thereafter , the catheter 14 is removed . because the sharpened needle tip 20 is disposed at the end of a flexible tube 16 as opposed to a rigid cannula as in prior art inserters , the risk of accidental sticks is minimized . furthermore , because the catheter 14 is often removed at the conclusion of treatment , there is typically a lesser degree of haste involved , thereby allowing the medical practitioner to more easily exercise the proper degree of care in removing and discarding the needle tip 20 . fig1 and 11 illustrate further aspects of the invention , which are particularly useful for applications which do not require a flashback . these include epidural catheters and catheters used to access implanted ports such as described in u . s . pat . no . 5 , 403 , 283 issued on apr . 4 , 1995 to luther and entitled “ percutaneous port catheter assembly and method of use ”. the inserters 61 and 63 do not include a lumen through their length and preferably are closed at their distal end . this aspect of the invention is particularly suitable for epidural catheters since the catheter is ideally formed so as not to introduce tissue into the epidural space . an open lumen at the distal end of the catheter 14 may cause tissue to be carried into the epidural space during the insertion process . referring to fig1 , the inserter 61 is sized to fit within the lumen 18 defined by the flexible tube 16 and the lumen 28 formed by the sharpened needle tip 20 . the distal end 62 of the inserter 61 preferably corresponds roughly to the shape of the needle tip 20 . the distal end 62 of the inserter is preferably blunt to prevent the inserter 61 from piercing or penetrating the skin of a person . the end of the inserter may be sand - blasted to provide the dull or blunted distal end 62 . fig1 illustrates an embodiment that is particularly suitable for use in epidural applications . the needle tip 65 has a distal end 69 configured in the toughy or hustead configuration of conventional epidural needle points . the insert 63 corresponds roughly to the shape of the needle tip 65 , and is preferably dulled or blunted at its distal end 68 . although the present invention has been described in terms of certain preferred embodiments , other embodiments of the invention will become apparent to those of skill in the art in view of the disclosure herein . accordingly , the scope of the present invention is not intended to be limited by the foregoing , but rather by reference to the attached claims .

0Human Necessities

the following discussion describes exemplary embodiments of the invention in detail . this discussion should not be construed , however , as limiting the invention to those particular embodiments . practitioners skilled in the art will recognize numerous other embodiments as well . for a definition of the complete scope of the invention , the reader is directed to the appended claims . u . s . patent application ser . no . 11 / 518 , 086 , filed sep . 8 , 2006 , is incorporated herein by reference for all purposes . as used herein the term “ granular material ” includes feed , seed , grain , and fertilizer . turning now to fig1 , an exemplary embodiment 10 of the present invention is illustrated . as illustrated further in fig2 , an exemplary embodiment 10 is shown by which a user can disperse granular material stored in a bucket 20 , having a camouflaged fabric cover 21 and a threaded top 22 , an interior funnel 24 , attached within the bucket fasteners 26 a - d , with rivets 27 a - d attaching the fasteners to the bucket , and rivets 29 a - d attaching the fasteners to the funnel , the funnel having a hole 28 at the bottom 34 of the bucket , coinciding with a hole 23 in the bucket bottom ( as illustrated in fig3 ). as part of a downspout assembly 30 , a plate 32 is within the bucket 22 at the bottom , the plate having a hole 36 at which a first conduit 40 is fixed and extends downwardly such that granular material within the bucket may pass through the funnel hole 28 , the plate 32 , the bucket bottom hole 23 , and the first conduit 40 . the downspout assembly includes a second conduit 42 which telescopes on the first conduit 40 and is fixable at various positions with relation to the first conduit using set screw 44 , which screws into the second conduit and bears against the first conduit . as illustrated for an exemplary embodiment in fig3 and fig4 , the second conduit 42 is positionable in a lowered position and raised position , respectfully . in some exemplary embodiments ( not shown ) the first conduit is attached to the funnel instead of the plate 32 , and in some exemplary embodiments the first conduit is an extension of the funnel through the plate 32 . additionally , for the exemplary embodiment of fig1 and fig2 , a frame 50 is provided having a platform section 52 with holes 54 a - b aligning with holes 56 a - b in the plate 32 for attachment using screws 58 a - b , the frame platform section thus supporting and securing the bucket 20 . granular material within the bucket is protected by a multi - component lid assembly 60 which threadably attaches to the bucket threaded top 22 . as further shown in fig5 , the lid assembly 60 has a bottom portion 62 that threadably attaches to the bucket 20 . the lid bottom portion has concentric elevations 64 a - b about its center . a center bolt and nut combination 66 fastens a second portion 68 , which is constructed of aluminum . a third portion 70 , constructed from plywood , is attached to the second portion using four screws 72 a - d , and spaced from the second portion using nylon spacers 74 a - d . a fourth portion 76 , constructed from foam is positioned on the third portion 70 as a seat cushion , and is held in place by a camouflaged fabric cover 78 , which surrounds the fourth portion and is stapled to the third portion . in use , the seat may be swiveled about the center bolt and nut combination 66 , the aluminum third portion 70 sliding easily on the first portion elevations 64 a - b . further , the exemplary embodiment illustrated in fig1 and fig2 provides a spreader assembly 80 , which is attached to the plate 32 using bracket 82 and back plate 81 which have holes 84 a - b and 86 a - b , respectively . as shown in combination with partial section fig6 , the holes 84 a - b and 86 a - b align with holes 88 a - d in the plate 32 and receiving screws 90 a - d for attachment using nuts 91 c - d ( two not shown ) such that the spreader assembly is contained within a frame 50 enclosure 92 in such a manner that the frame enclosure extends lower than the spreader assembly . the spreader assembly includes a box 94 attached to back plate 81 and positioned within the spreader assembly bracket 82 , the box having an openable end 96 , the end being openable by the removal of cap 100 . as shown in further detail in fig6 , the box 94 has an opening 104 through which a motor 106 within the box partially protrudes , the motor being attached to the box using screws 108 a - b . a shaft 110 rotates when the motor is activated , and is attached to a spreader plate 112 , the spreader plate being attached to the shaft using screw 113 , the spreader plate having deflector blades 114 . the rotating shaft drives the spreader plate into rotation with the motor . as shown in additional detail in fig7 , the motor receives power through conventional wiring 116 that connects the motor to a 9 - volt battery 117 positionable in either of brackets 118 a - b , the battery brackets being within and attached to the box 94 . a hand - operated push button actuator 120 has a coiled cord 122 that extends through the box , through rubber grommet 119 , and is wired to the motor 106 . by holding the button down , the user causes the motor to run , thus turning the spreader plate 112 . additionally , fig1 and 2 show the frame 50 of the exemplary embodiment 10 to include a vertical brace member 140 to which the frame platform 52 and frame enclosure 92 are attached . an aluminum top attachment member 142 is attached to the top center of the brace member and is joined to bucket 20 handle structure 144 using a screw 146 which threadably attaches to a threaded hole in the top attachment member 142 , as shown in fig8 . padded backpack straps 150 a - b , adjustable in length , have first ends 152 a - b , and are removably attached to brace member holes 154 a - b using clevis pin — circle cotter combinations 156 a - b , as shown in additional detail in fig9 for the right shoulder strap 150 b . similarly , the straps have second ends 158 a - b attached to brace member holes 160 a - b using clevis pin — circle cotter combinations 162 a - b . also , an adjustable padded and buckled waist strap 164 is attached , using snaps 165 a - b to the brace member . a padded lower back cushion 166 is also provided and attached to the brace member 140 using snaps 167 a - d , along with a padded and a padded neck cushion 168 . in some exemplary embodiments the push button actuator 120 is removably attached to the frame brace 140 using a hook - and - pile fastener 123 , as shown in fig1 . additional views of the exemplary embodiment of fig1 are provided in fig1 and fig1 . turning now to fig1 , an exemplary embodiment of the present invention is shown to provide an all terrain vehicle attachment assembly 200 for supporting the device 10 on an all terrain vehicle , having a rear structure , e . g . a rack 202 made of tubular steel . the attachment assembly provides two rigid , elongated members 204 a - b , each having a hole 208 a - b , which aligns with a hole 206 a - b in the frame enclosure 52 and attached with screws 210 a - b and wing nuts 211 a ( one shown ). each member 204 a - b also has a buckle strap 212 a ( one shown ) positioned on each member for wrapping about the frame enclosure and further attaching the frame enclosure to the member . [ in some exemplary embodiments the strap uses a hook and pile fastener .] the attachment assembly further provides clamps having u - bolts 214 a - d a u - bolt closing member 216 a - d , and a pair of wing nuts 218 a - h , for completing the clamping of the elongated members 204 a - b to portions of the rack 202 . in the exemplary embodiment of fig1 , the elongated members are of a length such that the frame and bucket are in a position completely behind the rear structure . turning now to fig1 , whereby an exemplary embodiment of the present invention is illustrated and shown to include an attachment assembly 300 for use with a vehicle that has rear structure in the form of a conventional receiver hitch having an opening for receiving a square - shaped member with a hole , the hitch having a hole for inserting a pin through the hitch and the square - shaped member hole to secure the square - shaped member . in the exemplary embodiment of fig1 , the attachment assembly includes an insertion member having a square - shaped first member 302 with a hole 304 such that the pin is insertable through the hitch and first member hole , thus securing the first member in the hitch . the first member extends rearwardly from the vehicle and at its end has an upwardly facing member 306 for receiving a second square - shaped member 308 and securing the second member using a clevis pin and cotter combination 310 . the second member extends upwardly and has at its end an upwardly facing member 312 for receiving the vertical end 314 of a welded tee 316 and securing the welded tee using a clevis pin and cotter combination 320 . two elongated members 322 a - b are attached to the welded tee using bolt and wing nut combinations 324 a - b . the elongated members have holes 326 a - b that align with frame enclosure holes 206 a - b and are attached to the frame enclosure 52 using bolt and wing nut combinations 328 a - b . each elongated member 322 a - b also has a buckle strap 330 a - b for additional securement of the elongated members to the frame enclosure 52 . in some exemplary embodiments , the first member 302 , second member 308 , and welded tee 316 are two inch square steel tubing , and the upwardly facing receiving members 306 , 312 are two and one / half inch square steel tubing . in some exemplary embodiments the first member 302 extends rearwardly to a length that allows the upwardly extending second member 308 to clear a typical pickup tailgate in its lowered position , or the rear rack on an all terrain vehicle . turning now to fig1 , an exemplary embodiment of the present invention is shown to include a suspension assembly 400 for suspending the device , above the ground , from an elevated object , e . g . a tree limb 402 . the suspension assembly has a conventional pulley 404 and a securing device 406 , ( e . g . a length of rope ) for hanging the pulley on the elevated object , a rope 408 having a first end 410 and a second end 412 , the rope being positioned for travel through the pulley , a hanger 414 having at least two end members 416 , 418 , the end members being configured to engage the bucket handle structure 144 when the hanger moves vertically , and a hanger securing device 420 positioned on the rope first end for attaching the rope to the hanger , such that the user , when pulling on the rope second end , causes the hanger securing device to lift the hanger , the hanger end members engaging the bucket handle structure such that the device is elevated . when the device is at the desired height , the user ties the rope second end to a suitable object . turning now to fig1 . in some exemplary embodiments , the wired remote actuator 120 and coiled wire 122 , and related conventional wiring 116 , are replaced with a wireless remote actuator assembly 500 , having a receiver 502 , antenna 504 , conventional wiring 506 , and a wireless handheld actuator 508 , having a button 510 . by pressing and releasing the button , the user causes the motor 106 to run , thus turning the spreader plate 112 . a second press and release turns the motor off . some exemplary embodiments include aluminum tubing for the frame 50 , a plastic bucket 20 , urethane foam for cushions in the belt 164 , lower back cushion 166 , and backpack shoulder straps 150 a - b , a aluminum plate 32 , an aluminum funnel 24 , box 94 , support bracket 82 , back plate 81 , and battery brackets 118 a - b , and an aluminum first conduit 40 and second conduit 42 . some exemplary embodiments include 600d polyester weather resistant urethane 2 - pass for the camouflaged fabric portions , e . g . the bucket cover 21 , seat cushion cover 78 , and the covers for straps 150 a - b , neck cushion 168 , lower back cushion 166 , and the cushion in the padded waist belt 164 , a representative camouflaged portion 600 being illustrated in fig1 . some exemplary embodiments include urethane 2 - pass foam for cushions and pads . some exemplary embodiments include a 3950 rpm 12v dc high - torque ( 1360 gm - cm ) motor 106 with a ¼ inch flat , ⅛ inch diameter stainless steel shaft . some exemplary embodiments include a 315 mhz frequency , fixed code transmitter 508 , compatible with a 3 - 13 . 8 vdc , 5 ma standby , 15 ma led flashing at 12 vdc receiver 502 . some exemplary embodiments include a bucket capacity of approximately five gallons ( 0 . 0189 cubic meters ). in the use of some exemplary embodiments , the user arrives at the site onto which the user desires to spread a granular material , e . g . feed . for sites inaccessible by vehicle , the user will use the device as a backpack , such that the feed may be dispersed behind the user while walking . the user first removes the lid assembly 60 , pours the desired amount of feed into the bucket 20 , and replaces the lid assembly . the second conduit 42 of the downspout assembly 30 has been previously positioned to a setting whereby the lower end of the second conduit is close enough to the spreader plate 112 that the feed will be retained on the plate and within the second conduit , thus discharge of feed from the bucket is stopped . the user then adjusts the shoulder straps 150 a - b and dons the device as a backpack . once on the user &# 39 ; s shoulders the user fastens the padded belt about the waist and adjusts the belt such that some of the weight is borne by the waist rather than the shoulders . when the user walks and reaches the terrain upon which it is desired to disperse the feed , the user detaches the remote push - button hand control 120 from its hook and pile attachment 123 to the frame brace 140 . when the user pushes the button the circuit is completed in the conventional wiring 116 , such that the motor 106 is activated , and the motor shaft 110 rotates the spreader plate 112 . the spinning spreader plate , acting through the deflector blades 114 , now actively propels the feed from the spreader plate behind the user as the user is walking , for so long as the user is pushing the button . when the user reaches a terrain where feed is not needed , or stops for a rest , the user releases the button , the motor stops , the spreader plate stops , and the feed ceases being discharged from the bucket through the downspout assembly . if , during the course of the walk , the user determines that feed should be dispersed at an increased rate , the user loosens the set screw 44 , raises the second conduit with respect to the first conduit , and tightens the set screw . the increased spacing between the second conduit lower end and the spreader plate will allow feed to be discharged from the bucket at a higher rate . during a rest break , the user removes the device from the user &# 39 ; s shoulders and sets the device down on the frame 50 . the frame height is such that the seat portion 70 , 76 , 78 of the lid assembly 60 is at an appropriate height for the user to sit down on the seat portion . for the user &# 39 ; s comfort the seat is cushioned and swivels . in an additional use of some exemplary embodiments , the user with a vehicle , such as an all terrain vehicle with a rear rack , quickly configures the device for an attachment to the rear rack . the shoulder straps , for access convenience , are removed by pulling the circular cotters from the clevis pins 156 a - b , 162 a - b , and the waist belt 164 and lower back cushion 166 are unsnapped 165 a - b , 167 a - b and removed . the attachment assembly 200 has two elongated steel members 204 a - b that are positioned on the rear rack , and attached using the u - bolt brackets 214 a - d . the steel members are movable fore or aft before tightening the brackets , depending on how close to the front of the rear rack the user wants the device to be placed . ( the farther aft the device is placed , the less feed will contact the all terrain vehicle while being dispersed .) once the brackets are tightened the device is placed on the elongated steel members until frame enclosure holes 206 a - b align with holes 208 a - b on the elongated members , and bolt and wing nut combinations 210 a - b are utilized to attach the frame to the elongated members . then buckle straps 212 a on the elongated members are connected and tightened for additional attachment of the frame to the elongated members . exemplary embodiments including the wireless hand held actuator 508 are particularly useful when the device is attached to the all terrain vehicle , because a single push of the actuator button starts the motor 106 and the motor stays running until the button is pushed a second time , allowing hands to be free as the vehicle moves and the spreader plate is spinning . in an additional use of some exemplary embodiments , the user desires to utilize the hitch receiver on a pickup to position the device . the user assembles the attachment assembly 300 , by inserting the first member 302 into the pickup &# 39 ; s hitch receiver and securing it with a pin through a hole 304 in the first member . the user then inserts the second member 308 into the upward - facing portion 306 of the first member and secures it using the clevis pin and cotter combination 310 . the user then inserts the vertical portion 314 of a welded tee 316 into an upward - facing portion of the second member 312 and secures the joinder using the clevis pin and cotter combination 320 . two steel elongated members are then attached by the user to the welded tee using bolts affixed to the welded tee and then secured with wing nuts 324 a - b . holes 326 a - b in the elongated members are aligned with holes 206 a - b in the frame enclosure 52 , and bolt and wing nut combinations 328 a - b are used to attach the frame to the elongated members . once the wing nuts are tightened buckle straps 330 a - b on the elongated members are fastened and tightened about the frame . in the remote areas where the user is likely to desire to spread feed , a person in the back of the pickup can reach the wired handheld control 120 to activate the spreader assembly , or in exemplary embodiments with the wireless handheld control 508 , the driver can activate the spreader assembly from the passenger compartment of the pickup . the user is able to operate with the tailgate down , in that the first member extends rearwardly a sufficient distance for the second member to clear the back edge of the tailgate . should the user desire a stationary feed spreader , the device is readily adaptable from the backpack configuration to the stationary configuration using a suspension assembly 400 , where the user hangs a pulley 404 from an elevated object such as a tree limb 402 , using a length of rope 406 which is tied off on the tree trunk . a second length of rope 408 is run through the pulley and hooked to a hanger 414 using a clip 420 on the first end 410 of the rope . the hanger is positioned such that its hooks 416 and 418 are beneath the bucket handle structure 144 . when the user pulls on the rope second end 412 the hooks engage the handle structure and the device is pulled from the ground to an acceptable height , and the user ties off the rope second end to the tree trunk . using the wireless remote handheld actuator 508 , the user initiates the spreader assembly for the desired amount of time by pushing the button , then pushing the button again at the end of the desired time . turning now to fig1 - 29 , wherein an exemplary embodiment 700 of the present invention is depicted and shown to have a modified frame 702 , bucket 720 , spreader assembly 760 , downspout assembly 790 , controller ( s ) 800 , 802 , 804 and seat assembly 820 . in previously described exemplary embodiments , such as the embodiment depicted in fig2 , the bucket 20 was attached to the frame 50 using fasteners through bucket holes 56 a , 56 b and frame holes 54 a , 54 b . in some exemplary embodiments of the type depicted in fig1 - 21 , the bucket 720 has a bottom 722 , having four circumferentially spaced bottom slots 724 a - d , and two sets 726 a - b of aligned braces 728 , each brace having a slot 730 . the brace slots 730 are aligned with the bottom slots 724 a - d such that each brace set 726 a - b partially encompasses one of two forwardly extending , substantially horizontal frame member 704 a , b , as shown in more detail in fig2 for one of the horizontal frame members 704 a . four pairs of downwardly extending , threaded posts 732 a - d are positioned among the braces , two pairs for each brace set 726 a - b , each pair of posts having a clamp bar 734 a - b ( two shown ) attached using conventional screws 736 a - c ( three shown ). the attached clamp bars retain the horizontal frame members 704 a , b . in the exemplary embodiments depicted in fig1 - 21 a deflector plate 780 is positioned between the frame back 706 and the spreader assembly 760 , being attached to two of the threaded post pairs 732 a , c by brackets 782 a and 782 b ( fig2 ) extending from outer sections of the deflector plate to the threaded post pairs , as shown in more detail in fig2 . turning now to fig2 - 26 , wherein an exemplary embodiment of the present invention is shown to include a modified spreader assembly 760 that cooperates with a modified downspout assembly 790 . the bucket 720 has an integrated conduit 738 and a taper 740 joining and directing feed particles to the integrated conduit . the downspout assembly also includes a sliding conduit 792 that telescopes on the integrated conduit 738 , the sliding conduit being fixable along the length of the integrated conduit 738 using set screw 794 . the use of finer grained feed particles is enhanced when reducing inserts 796 , 798 are positioned within the sliding downspout 792 , the reducing inserts providing various combinations of internal diameter and length for precise adjustment of feed particle flow onto the spreader plate 762 . in exemplary embodiments depicted in fig2 , the spreader assembly 760 includes the spreader plate 762 , rotatably attached to a motor 764 , the motor being suspended from the interior top 766 of a motor box 768 . the motor box 768 is attached to a frame plate 712 ( fig1 ) using screws 770 a , b ( two shown ). ( in some exemplary embodiments the screws are replaced by rivets .) the motor box 768 has a removable front plate 772 held in place by a top overhang portion 773 and a wing nut 774 ( fig1 ) attached to a motor box screw 775 . a motor box side plate 776 has an opening 777 for the cord ( not shown ) for a pushbutton controller system ( fig2 ). a power source , e . g . a 9v battery having battery terminal 778 , is held within the motor box 768 by a clamp 779 . as schematically illustrated in fig2 for some exemplary embodiments , the motor 764 wiring 806 presents a connection 808 which is alternately joinable to three controller systems 800 , 802 , 804 each presenting a connection member 810 , 812 , 814 that mates with the motor connection 808 . for example , if the operator wants the motor 764 to run in response to a pushbutton controller system 800 , the operator leaves the directly wired pushbutton controller connection 810 attached to the motor connection 808 , i . e . the default configuration . if the operator wants the motor 764 to run in response to a remote device ( not shown ), the operator removes the front plate 772 , detaches the pushbutton controller connection 810 from the motor connection 808 and battery terminal 778 attaches the remote controller system 802 connection 812 to the motor connection 808 , attaches the remote controller 802 to the battery terminal 778 , then reattaches the front plate . likewise , if the operator wants the motor to run in response to a timer , the operator removes the front plate 772 detaches the pushbutton controller connection 810 from the motor connection 808 and battery terminal 778 , attaches the timer controller system 804 connection 814 to the motor connection 808 , attaches the timer controller 804 to the battery terminal 778 , then reattaches the front plate 772 . in practice the timer controller system 804 is the optimum choice for placement of the device as a stationary feeder which will be unattended . turning now to fig2 - 29 , wherein an exemplary embodiment is depicted and is shown to include a combination seat and lid assembly 820 , which is threadably attachable to the threaded bucket top 742 . as illustrated for some exemplary embodiments in fig2 , the bucket top 742 also receives a frame rear extension 708 with a screw 710 attaching the frame rear extension 708 to the bucket top 742 . the seat and lid assembly 820 has a lid member 822 having a internally threaded center post 824 and four circumferentially spaced side ports 826 a - c ( three shown ) for drainage of water that accumulates on the lid 822 . as shown in more detail in fig2 , the top vertical height of the center post 824 is higher than the bottoms of the side ports 826 a - c . this prevents water from entering through the top of the center post 824 and then entering the bucket interior with the feed . the assembly 820 also has a seat member 830 having a downwardly extending bolt 832 that threads into the lid center post 824 and is secured by a nut 834 and washer 836 . with respect to the above description then , it is to be realized that the optimum apparatus for a particular application or use of the device , will include various material and size adjustments , and will include alterations in the shape and direction of the members of the attachment assemblies , which will occur to those skilled in the art upon review of the present disclosure . all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . the descriptions in this specification are for purposes of illustration only and are not to be construed in a limiting sense .

0Human Necessities

the feed device shown in fig1 and 2 and reference 1 serves the purpose of supplying a hand tool , for example an inside - feed paint roller or a brush with the medium to be processed , and is essentially composed of a reservoir 2 fashioned as lower part for the acceptance of the medium as well as of an upper part 3 detachably connected to the reservoir 2 into which a gripping opening 4 for transporting the feed device 1 is formed . the medium is supplied with a conveying pump 11 to a discharge line 20 to which a line leading to the hand tool ( not shown ) can be connected . as may especially be derived from fig3 and 4 , the conveying pump 11 comprises a cylinder 12 having a cylinder space 13 into which a piston pump 14 is introduced , and also comprises an admission valve 18 and a discharge valve 19 . the admission valve 18 is directly introduced into the correspondingly fashioned cylinder 12 . the discharge valve 19 , by contrast , is provided in a valve housing 17 attached to the cylinder 12 , the valve housing 17 being connected to the discharge line 20 via an ascending line 21 . an electric motor 41 is provided for driving the pump piston 14 , this electric motor 41 being capable of being switched on and off with a switch 5 attached in the upper part 3 and being supported in partitions 6 and 6 &# 39 ; of the upper part 3 . the electric motor 41 is connected in drive terms to a piston rod 15 of the pump piston 14 via gear wheels 42 and 43 as well as via a cam lever 44 . as a result of lifting motions of the pump piston 14 , the rotational motion of the electric motor 41 is converted into an axial motion of the piston rod 15 with the cam lever 44 , the medium to be processed is suctioned into the cylinder space 13 via a filter 45 , which is secured to the cylinder 12 with the assistance of a bayonet - type closure 46 , when the admission valve 18 is opened and the discharge valve 19 is closed , and is conveyed from this cylinder space 13 to the discharge line 20 that engages through an opening 8 formed in the upper part 3 when the admission valve 18 is closed and the discharge valve 19 opens . in order to be able to adapt the conveying pump 11 to reservoirs dimensioned differently in height , these being entered with dot - dash lines in fig1 and 2 , the ascending line 21 , 21 &# 39 ; is fashioned variable in length . in order to accomplish this in a simple way that is nonetheless operationally reliable , connection pieces 22 and 23 or , respectively , 22 &# 39 ; and 23 &# 39 ; are attached to the vale housing 17 as well as to the discharge line 20 , these connection pieces being adjustably arranged inside one another and being capable of being locked at different heights . an adjusting lever 25 or 25 &# 39 ; serves this purpose , this being applied according to fig3 to the valve housing 17 and , according to fig4 to the discharge line 20 . the adjusting lever 25 or 25 &# 39 ; pressing against the connection piece 23 or the connection piece 22 &# 39 ; with pre - stress comprises a catch - nose 26 that can optionally engage into the notchings 28 , 28 &# 39 ; and 28 &# 34 ; worked into the connection piece 23 or the connection piece 22 &# 39 ;. the adjusting lever 25 or 25 &# 39 ; is also equipped with a gripping member 27 in order to press the lever down and , thus , release the interlock . for varying the length of the ascending line 21 or 21 &# 39 ;, consequently , the adjusting lever 25 or 25 &# 39 ; need merely be deformed such that the catch - nose 26 thereof no longer engages into the notching 28 &# 39 ; and the two connection pieces 22 , 23 or 22 &# 39 ;, 23 &# 39 ; can then be adjusted relative to one another . the connection pieces 22 , 23 or 22 &# 39 ;, 23 &# 39 ;, between which a seal 24 is introduced for sealing the resultant annular gap , are in turn locked by engaging the catch - nose 26 into the notching 28 or 28 &# 34 ;. so that the connection pieces 22 , 23 or 22 &# 39 ;, 23 &# 39 ; are guided in anti - twist fashion , a web 29 is applied to the cylinder 12 in the embodiment of fig3 this web 29 engaging into a longitudinal channel 30 formed in the connection piece 23 . in the modified embodiment of fig4 by contrast , a web 29 &# 39 ; that is guided in a longitudinal channel 30 &# 39 ; of the connection piece 22 &# 39 ; is attached to the connection piece 23 &# 39 ;. so that the cylinder space 13 of the cylinder 12 allocated to the pump piston 14 remains the same , even given a variation in length of the ascending line 21 or 21 &# 39 ;, the piston rod 15 is provided with three attachment eyelets 16 , 16 &# 39 ; and 16 &# 34 ; for the cam lever 44 , these eyelets being arranged at distances from one another that correspond to the distances between the notchings 28 , 28 &# 39 ; and 28 &# 34 ;. not only is the rotational movement of the cam lever 44 converted into the linear lifting motions of the piston rod 15 in this way , but the position of the pump piston 14 can also be adapted to the respective length of the ascending line 21 . in the illustrated exemplary embodiment , the conveying pump is interchangeably introduced into the reservoir 2 . to this end , the latter is provided with an opening 7 and a plate - like cover 31 is applied to the discharge line 20 , this cover 31 comprising an all around collar 32 that engages into the opening 7 . a guide member 33 for the piston rod 15 of the pump piston 14 is also attached to the cover 31 . when the conveying pump 11 is taken out , the component parts being capable of being economically manufactured of impact resistant plastic , the medium to be processed can thus be unproblemmatically filled into the reservoir 2 . the distance between the filter 45 to be arranged in the bottom region of a reservoir 2 and the discharge line 20 and , thus , the length of the ascending line 21 &# 34 ;, however , can also be varied , as shown in the case of the conveying pump 11 &# 34 ; of fig5 in that at least one of the connection pieces 22 &# 34 ; and 23 &# 34 ; forming this ascending line as well as the potentially appertaining component parts are optionally dimensioned different in length . this possibility of varying the length of the ascending line 21 &# 34 ; is illustrated by the illustrated parting lines . as is apparent from the foregoing specification , the invention is susceptible of being embodied with various alterations and modifications which may differ particularly from those that have been described in the preceding specification and description . it should be understood that we wish to embody within the scope of the patent warranted hereon all such modifications as reasonably and properly come within the scope of our contribution to the art .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

fig1 is a block diagram of the major building blocks of the present disclosure . shown is the measurement loop between a finite state machine ( fsm ) 11 , a plurality of low drop out ( ldo ) regulators 12 , wherein each ldo regulator has an output driver circuit od 13 , and on chip measurement ( ocm ) circuit 14 . an automatic tester ate 10 communicates with the fsm 11 to initiate on chip testing and receives back from the fsm test results . after tests have been initiated by the ate , the fsm 11 assumes control and executes commands to perform a series of tests on the plurality of ldo circuits 12 . in the mean time the ate 10 proceeds to , perform other tests on the integrated circuit chip in parallel to the tests performed on the ldo circuits 12 . after the ate 10 signals the fsm 11 to start the on - chip testing , the fsm communicates with a particular ldo circuit 12 to connect to the ocm circuit 14 an analog signal that is to be measured by the ocm circuitry . at the same time the fsm 11 communicates with the ocm circuitry 14 what measurements are to be performed . after the ocm circuitry 14 has performed a measurement , the ocm circuitry communicates a pass or fail signal to the fsm , and the fsm 14 then communicates the test results back to the ate , which is performing other tests on the integrated circuit chip containing the ldo circuits . on most integrated circuit chips there is more than one ldo circuit as indicated by the “ n ” in the ldo block of fig1 . each of the “ n ” ldo circuits is measured by the ocm circuitry 14 , and the results of each measurement are communicated to the fsm 10 and then the ate 11 . in fig2 is shown a block diagram of the measurement circuitry of the ocm 14 connected to the output drivers od 13 of the ldo circuit 12 . the output driver ( od ) 13 is a pass transistor that has been segmented into at least two transistor parts operating in parallel to be able to supply the demand for current from circuitry on the integrated circuit chip and allow testing by test circuitry that has limited current capability , e . g . the atm . when a voltage output of the ldo circuit is to be measure by the ocm 14 , the fsm 11 signals the ocm 14 to select an output voltage vldo from an output driver od 13 using the vldo select circuit 21 . further since the output driver is segmented into a plurality of driver transistors to accommodate the limited current capability of the tester , the fsm chooses which segmented driver transistor is to be connected to the ocm . each of the segmented driver transistors of the output driver od of a particular low drop out voltage generator will in turn be connected to the ocm 14 and thereafter the fsm will select the next output driver 13 of the next ldo circuit 12 to be selected for test by the vldo select circuit 21 . the vldo select circuit 21 is an analog switch that connects the output voltage of each of the ( n ) ldo circuits 12 to the comparator 22 under the control of the fsm . also connected to the input of the comparator 22 is a “ hi ” and a “ low ” reference from the vref select circuit 23 . depending upon the measurement being performed , the value of the “ hi ” and “ low ” reference signals connected to the input of the comparator 22 are adjusted by the fsm 11 . the purpose of the comparator is to assure that the voltage output of each ldo falls within the test limits set by the “ hi ” and “ low ”, which are outputted from the vref select circuit 23 under the control of the fsm to the comparator 22 . after each measurement by the comparator 22 , the comparator communicates the results the measurement results back to the fsm 11 , wherefrom the fsm relays the measurement results back to the ate 10 . the output driver ( od ) 13 of the ldo circuit 12 is formed by a segmented transistor in which each segment is connected in parallel to provide the required current in normal operations and selected separately for test purposes . when a ldo is to be measured for the ability to produce a voltage within test limits , an output driver transistor segment is selected and through an i - load select circuit 23 connected to a current source circuit . the i - load select circuit 23 is a low impedance analog switch , and the current source is selectable to perform as either a source , or a load , for the output driver od 13 of the ldo circuit 12 being tested . in fig3 is shown a plurality of ldo circuits found on an integrated circuit chip and used to supply various voltages necessary to operate the circuits on the integrated circuit chip . there are n ldo circuits each having , a select sel ( n ) input , an enable en ( n ) input and each delivering a regulated voltage vldo ( n ). the fsm selects and enables each ldo circuit of the plurality of ldo circuits in turn and signals the ocm 14 to perform voltage measurements on the output of each ldo circuit when selected , enabled and connected to the current source circuit to provide the source and load conditions to the ldo 12 output driver 13 circuitry . fig4 is a schematic diagram of the output driver circuit 13 forming a part of the ldo circuit 12 . the output driver circuit 13 is formed by a plurality of driver transistors m 1 , m 2 , to mn connected in parallel between a voltage vdd and the circuitry being driven by the ldo circuit . during test , the circuitry being driven , or connected to , is the load select circuit 23 and through which the current source circuit 25 . the current source circuit 25 is the circuit that provides source and load currents to the output driver transistors 13 for test purposes . each gate of the mn driver transistors is separately selected by switches s 1 , s 2 , and sn and biased off by switches s * 1 , s * 2 and s * n to allow individual testing of each output drive transistor m 1 , m 2 to mn . during normal operation of the ldo all switches s 1 , s 2 , to sn are closed and all switches s * 1 , s * 2 to s * n are open to allow all output driver transistors to operate in parallel to produce the necessary ldo output current . fig5 is a circuit diagram of the current source circuit 25 of the ocm 14 that is used to provide a current source , or load , to the output driver circuits 13 during test of the ldo circuits 12 . the current source 25 comprises two current mirror circuits the current can be sinked using a nmos current mirror , comprising transistors m 4 and m 5 , or sourced using a pmos current mirror , comprising transistors m 1 and m 2 . whether the current is sinked or sourced is determined by the “ sink source ” signal , which selects switch sa to form a source and is inverted 28 to select switch sb to form a load for the ldo circuit . a reference for the current mirror circuitry is generated by an idac ( current dac ) 28 that controls the reference generator 27 . in order to generate several output currents “ i test ”, the current coming from the idac can be adjusted with the “ i select ” signal . the reference current “ i ref ” can be generated from an accurate source ( bandgap ). the output current “ i test ” provided by the current source can be in the range of several milliamps . but this is depending on the number of segments of the pass transistor being tested . fig6 is a diagram of the comparator circuit 22 that measures whether the ldo circuit output voltage vldo is between a hi vref and a low vref . the output voltage of the ldo circuit is connected to a minus input terminal of amplifier 30 and to the positive input terminal of amplifier 31 , where a hi vref is connected to the positive input terminal of amplifier 30 and a low vref is connected to the negative terminal of amplifier 31 . the outputs of both amplifiers are connected to inputs of an “ and ” circuit 32 , which produces a high state in the compare output when the ldo output voltage vldo falls between vref hi and vref low . the compare out signal is connected to the fsm , which passes the test results back the ate . while the disclosure has been particularly shown and described with reference to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made without departing from the spirit and scope of the disclosure .

6Physics

the present invention will be described in detail with reference to the embodiment shown in the accompanying drawings . [ 0031 ] fig1 is a diagram showing an overall configuration of a network system to which this embodiment may be applied . this network system is connected with clients 10 — user terminals which receive application services — via a network 20 such as the internet . the network 20 is also connected with an application system 30 . in terms of role separation , the application system 30 comprises a web server 40 which provides html services and an application server 50 which provides application services . however , it is also possible to view the application system 30 as a single server which combines the web server 40 and application server 50 . [ 0032 ] fig2 is a diagram showing a configuration of the application server 50 . the application server 50 to which this embodiment is applied comprises a login servlet ( servlet01 ) 51 , session timer acquisition servlet ( servlet02 ) 52 , and session timer setting servlet ( servlet03 ) 53 . also , it comprises a customer database ( db ) 55 which stores the ids and passwords ( pw ) of customers . the login servlet ( servlet01 ) 51 creates an object ( sess01 ) for storing user information of a client 10 and a cookie ( cookie01 ) for identifying the client 10 and sends them to the client 10 together with an html file containing an applet which generates a window ( referred to as webpad ) for displaying the time remaining before a timeout on a web session . the webpad window displays a timeout value at regular intervals and provides means for changing the timeout interval if the user desires . the timeout value represents the time when an object itself disappears regardless of the intention of the user if no communication takes place between the client 10 and application system 30 which is a server . since webpad is viewed by operating systems simply as a window ( software ), it can be implemented in any operating system which has a window system . the session timer acquisition servlet ( servlet02 ) 52 acquires the time remaining before a timeout using an api ( application program interface ) of the http session object ( sess01 ) and sends it to the client 10 . the session timer setting servlet ( servlet03 ) 53 extends the time remaining before the timeout using the api ( application program interface ) of the http session object ( sess01 ) and sends the updated remaining time to the client 10 . [ 0035 ] fig3 is a flowchart showing processes of the login servlet ( servlet01 ) 51 . first , servlet01 receives the id and password of a user from the client 10 ( step 101 ) and checks the received user id and password against the customer database 55 ( step 102 ). based on the results of the check , servlet01 judges whether the user is ok or not ( step 103 ). if the user is not ok , servlet01 returns an error screen ( reply : response ) ( step 104 ). if the user is ok , servlet01 creates an http session object ( sess01 ) capable of storing user information of the client 10 ( step 105 ). then , servlet01 creates a cookie ( cookie01 ) for identifying the client 10 ( step 106 ) and returns the html file ( app01 . html ) of an application ( reply : response )( step 107 ). in other words , a program for generating the window ( webpad ) is sent together with a program for application - related data entry . the html file ( app01 . html ) of the application is an html file containing the html file of webpad as a pane of a frame . it consists of entry . html and webpad . html . methods for user authentication include methods , such as challenge - response authentication , which employ web server 40 capabilities and a method employing certificates issued by u . s . company verisign inc . as well as a method employing the login servlet ( servlet01 ) 51 . [ 0037 ] fig4 is a flowchart showing processes of the session timer acquisition servlet ( servlet02 ) 52 . first , the session timer acquisition servlet ( servlet02 ) 52 identifies the http session object ( sess01 ) by the cookie ( cookie01 ) attached to an http request from the client 10 ( step 111 ). then it acquires the time t 1 remaining before the timeout using an api “ getmaxinactiveinterval ( )” of the http session object ( sess01 ) made by the login servlet ( servlet01 ) 51 ( step 112 ). next , it returns the acquired remaining time t 1 ( reply : response ) ( step 113 ). [ 0038 ] fig5 is a flowchart showing processes of the session timer setting servlet ( servlet03 ) 53 . first , the session timer setting servlet ( servlet03 ) 53 identifies the http session object ( sess01 ) by the cookie ( cookie01 ) attached to the http request from the client 10 ( step 121 ). next , it extends the time t 1 remaining before the timeout t 2 using the api “ setmaxinactiveinterval ( )” of the http session object ( sess01 ) created by the login servlet ( servlet01 ) 51 ( step 122 ). then , it acquires the updated remaining time t 3 by the getmaxinactiveinterval ( ) call and returns it to the client 10 ( reply ) ( step 123 ). now , the processes performed by the client 10 will be described . [ 0040 ] fig6 is a flowchart of processes performed by the client 10 . the user accesses the url of the web server 40 from the client 10 terminal ( step 201 ), downloads a login screen ( login . html ), and displays an initial screen on a display ( step 202 ). then the user enters his / her user id and password , which are sent to the web server 40 ( application system 30 ) ( step 203 ). if there is any problem with the user id or password , error . html is sent from the application system 30 for error display . if there is no problem with the user id and password , the html application file ( app01 . html ) and cookie ( cookie01 ) generated by the application server 50 are received from the application system 30 ( step 204 ) and a data entry screen containing webpad is displayed ( step 205 ). then , data entry processing ( step 206 ) and webpad processes ( step 207 ) are carried out . two html files ( entry . html and webpad . html ) have been embedded in the received html application file ( app01 . html ) by means of frame tags . the user can enter data by checking the timeout interval with reference to the webpad display on the screen produced by the webpad processes . if the user judges that there is not enough time , he / she can extend the time remaining before the timeout , for example , by entering an extended time on webpad and sending it to the application server 50 with a click of a send button . at this time , the http session has not timed out , and thus the processing can be continued with no missing data . [ 0042 ] fig7 is a flowchart of webpad processes . first , the webpad processing acquires the timeout interval ( the time remaining before the timeout ) on the http session of the application server 50 ( step 211 ). after generation , webpad calls the session timer acquisition servlet ( servlet02 ) 52 of the application server 50 and receives the remaining time t 1 which was acquired by getmaxinactiveinterval ( ) called by the session timer acquisition servlet ( servlet02 ) 52 . then , it displays the remaining time t 1 received from the application server 50 , starts the timer ( step 212 ), and updates and displays the remaining time at each timer update event ( step 213 ). next , webpad judges whether an extension button click event has occurred or not ( step 214 ). if it has not , webpad returns to step 213 . if it has , webpad reads time t 2 from an overtime entry field and checks the validity of the time t 2 ( step 215 ). then , webpad calls the session timer setting servlet ( servlet03 ) 53 using the time t 2 as a parameter ( step 216 ). then , it displays the updated remaining time t 3 , starts the timer ( step 217 ), and returns to step 213 . now , webpad . html , a html file which implements webpad will be described . fig8 is a diagram showing components of webpad . html69 . as described above , webpad . html69 is embedded in the html application file ( app01 . html ) replied from the login servlet ( servlet01 ) 51 of the application server 50 . as shown in fig8 webpad . html69 consists of main java script 60 which displays session timeout values and updates them using an internal timer ; script functions including function 1 ( func1 ) 61 which is a display processing script , function 2 ( func2 ) 62 which is an extension button processing script , function 3 ( func3 ) 63 which is a timeout processing script ; applet tag information 65 ; and so forth . function 1 ( func1 ) 61 , which is a display processing function , calls an applet ( aplt01 ) for starting the session timer acquisition servlet ( servlet02 ) 52 , acquires a session timeout interval , and then sets the value of the session timer in the value sstm of a global variable . function 2 ( func2 ) 62 , which is called by an event handler when the extension button is clicked ( or when the send button is clicked after an overtime is specified , etc . ), calls an applet ( aplt02 ) for extending a session time in this function and writes the extended session time into the value sstm of the global variable . function 3 ( func3 ) 63 , which is called when the internal timer times out , updates the session timeout interval tm01 (“ sstm − 1 ” minutes if the internal timer is set at 1 minutes ), redisplays the updated session timeout interval tm01 , and sets the next internal timer ( 1 minute ). the java applets called according to the applet tag information 65 include aplt01 and aplt02 . aplt01 is a java applet with a method getter ( ) which takes a string cookie as an argument . getter creates an url object ( using host , port , and other arguments ) and url connection object and calls the session timer acquisition servlet ( servlet02 ) 52 by attaching an http request header and a cookie to the created objects . the return value from the servlet is a session timeout value , which is regarded as the return value of the getter ( ) method . aplt02 is a java applet with a method setter ( ) which takes as arguments a string - type cookie and integer type overtime t 1 . setter creates an url object ( using host , port , and other arguments ) and url connection object and calls the session timer setting servlet ( servlet03 ) 53 by attaching an http request header and a cookie to the created objects . the return value from the servlet is a new session timeout value , which is regarded as the return value of the setter ( ) method . [ 0047 ] fig9 is a flowchart showing processes of webpad . html which consists of the components shown in fig8 . first , webpad . html declares gui parts ( buttons and input areas ) ( step 301 ) as well as the applet ( aplt01 / aplt02 ) to be used ( step 302 ). next , it declares scripts ( step 303 ) and calls the function 1 ( func1 ) 61 for acquiring the session timeout interval ( step 304 ). then , it sets the value ( 1 minute ) of the internal timer and the function 3 ( func3 ) 63 to be called after the timeout , in the api ( e . g ., settimeout for the window object ) for setting the internal timer ( step 305 ). [ 0048 ] fig1 a and 10b are flowcharts showing processes of the function 1 ( func1 ) 61 called in step 304 . fig1 a shows a flow of main processes of the function 1 ( func1 ) 61 while fig1 b shows the processes of the getter method of the java applet ( aplt01 ) called by the function 1 ( func1 ) 61 . as shown in fig1 a , the function 1 ( func1 ) 61 acquires a cookie ( step 401 ) and then calls the getter method of the java applet ( aplt01 ) using the cookie value as an argument ( step 402 ). then , the session timer value obtained through the processes shown in fig1 b is stored in the value sstm of the global variable ( step 403 ). as shown in fig1 b , the getter method ( string cookie ) of the java applet ( aplt01 ) called in step 402 creates a url object using a host name , port number , and servlet name as arguments ( step 411 ) and then creates a url connection from the url object ( step 412 ). next , it sends a startup request to the session timer acquisition servlet ( servlet02 ) 52 of the application server 50 by attaching a necessary http header and cookie to the url connection object ( step 413 ). then , it receives the session timeout value in a stream format as a return value from the session timer acquisition servlet ( servlet02 ) 52 ( step 414 ). this return value is used in the process of step 403 shown in fig1 a . [ 0050 ] fig1 is a flowchart showing processes of the function 3 ( func3 ) 63 in case of a timer event interrupt on webpad . html . in case of a timer event interrupt , the function 3 ( func3 ) 63 updates the value sstm of the global variable of the session timer ( decremented by 1 minute ) ( step 501 ) and displays the updated sstm as the time remaining before the timeout ( step 502 ). then it is judged whether or not the sstm is zero ( step 503 ). if it is zero , the processing is terminated . if it is not zero , the internal timer value is set again , the function 3 ( func3 ) 63 to be called after the timeout is set , and the internal timer is restarted ( step 504 ). [ 0051 ] fig1 a and 12b are flowcharts showing processes of the function 2 ( func2 ) 62 after the user sets an overtime and clicks the send button on webpad . html , generating an event interrupt . fig1 a shows a flow of main processes of the function 2 ( func2 ) 62 while fig1 b shows the processes of the setter method of the java applet ( aplt02 ) called by the function 2 ( func2 ) 62 . as shown in fig1 a , in case of an event interrupt , the function 2 ( func2 ) 62 acquires the time t 2 from the overtime entry field ( step 601 ) and judges whether the time t 2 is valid or not ( step 602 ). if it is not valid , the function 2 ( func2 ) 62 finishes its processes . if it is valid , the function 2 ( func2 ) 62 acquires a cookie ( step 603 ). then , the function 2 ( func2 ) 62 calls the setter method of the java applet ( aplt02 ) using the acquired cookie value and overtime t 2 as arguments ( step 604 ). the return value of the setter ( ) method is set in the session timer sstm ( step 605 ). as shown in fig1 b , the setter method of the java applet ( aplt02 ) called in step 604 creates a url object using a host name , port number , and servlet name as arguments ( step 611 ) and then creates a url connection from the url object ( step 612 ). next , it sends a startup request to the session timer setting servlet ( servlet03 ) 53 by attaching a necessary http header and cookie as well as a new timer value to the url connection object ( step 613 ). then , it receives the session timeout value in a stream format as a return value from the session timer setting servlet ( servlet03 ) 53 ( step 614 ). this return value is used in the process of step 605 shown in fig1 a . [ 0054 ] fig1 a and 13b show display examples of a data entry screen displayed on a browser of the client 10 . fig1 a shows the data entry screen containing webpad while fig1 b shows an example of a gui ( graphical user interface ) on webpad . the data entry screen shown in fig1 a is displayed based on the html application file ( app01 . html ) obtained from the login servlet ( servlet01 ) 51 of the application server 50 . it presents not only a typical entry screen such as a travel reservation entry screen , but also a webpad display 70 which is a window for displaying the time remaining before a timeout . the webpad display 70 is generated , by means of frame tags , as a pane in a browser screen run by the client 10 . the webpad display 70 shown in fig1 b consists of a time display 71 which provides information about the time remaining before a timeout and an overtime entry display 72 which allows the user to enter a desired overtime . the client 10 generates and displays the webpad window on the browser of the client 10 machine . the time display 71 first displays the remaining time t 1 obtained from the session timer acquisition servlet ( servlet02 ) 52 of the application server 50 and then displays the remaining time updated at each timer update event , for example , in minutes . the overtime entry display 72 allows the user to enter a desired overtime , for example , by the minute and then click the send button to apply the extension which is desired by the user . clicking the send button causes the processes of the function 2 ( func2 ) 62 shown in fig1 a and 12b to be performed . in the example of fig1 b , the user is allowed to enter a desired overtime , but it is also possible to provide radio buttons , i . e ., a plurality of buttons , for example , at 10 - or 5 - minute intervals and accept the extension selected by the user by clicking a desired button . it is also possible to display information about the time remaining before a timeout , for example , by means of the length of clock hands or a bar ( analog display or the like ) instead of the time display 71 or in addition to the time display 71 . in the example described above , webpad is displayed as a pane in the browser screen . however , it is also possible to provide the webpad display 70 itself as a separate window using the “ open ” function of the java ( r ) script window object , or display the timeout interval in the original window and display only the overtime panel in a separate window . when using a separate window , java script &# 39 ; s capabilities allow the window to be displayed by two to three lines of script . in this way , according to this embodiment , the user ( client 10 ) is provided with the window ( called webpad ) which presents the timeout value normally contained in the http session object ( sess01 ) at regular intervals when a web application of the application server 50 is started at the request of the client 10 . if the user wants to extend a timeout on a web session to continue input for a travel reservation or the like , he / she can enter a desired overtime and send it to the server from the window . in short , the use of webpad will increase the added value , reliability , and efficiency of b - to - c applications . although the application system 30 consists of the web server 40 and application server 50 according to the embodiment described above , a single server may constitute the application system 30 . also , even if the web server 40 and application server 50 are physically separated from each other , their functions are intertwined and cannot necessarily be clearly distinguished actually .

7Electricity

the present invention will be described below with those preferred embodiments in connection with attached drawings . however , it should be understood that the descriptions here are only illustrative , without an intend of limiting the protection scope of the present invention . also , the following description omits details of those known structure and techniques so that concepts of the invention are not obscured unnecessarily . schematic layer structure according to one embodiment of the present invention is shown in the figures . however , these figures are not drawn to scale , and some details may be exaggerated and other details may be omitted for simplicity . shapes , relative sizes and positions of various regions / layers shown in the figures are only illustrative . variations may exist due to manufacturing tolerance and technical limitations . moreover , those skilled in the art may design the regions / layers having different shapes , relative sizes and positions in view of actual requirement . fig1 - 8 are cross sectional views of the semiconductor structure at various stages of the process for manufacturing a fin according to one embodiment of the present invention . the steps according to one embodiment of the present invention will be described in detail hereinafter in connection with the appended drawings . first , referring to fig1 , shallow trench isolations ( stis ) 102 are formed in a semiconductor substrate 101 . specifically , the semiconductor substrate 101 can be made of a substrate material well known in the field of semiconductor manufacturing . in the embodiment of the present invention , it is preferably a bulk si substrate . as shown in fig2 , a dielectric layer 103 is then formed on the semiconductor substrate 101 . the dielectric layer 103 can be made of sio2 , teos , si3n4 , or other dielectric materials . in the embodiment of the present invention , it is preferably made of sio2 , which can be formed by thermal growth and has a thickness of about 30 - 70 nm . the dielectric layer 103 effectively protects a fin to be formed during the subsequent etching process . fig3 a shows a top view of the semiconductor substrate 101 , and fig3 b is a cross sectional view taken along line aa in fig3 a . as shown in fig3 a and 3b , the semiconductor substrate 101 is etched to form at least two trenches which are embedded in the semiconductor substrate 101 . although only two trenches are shown in the figures , it is apparent for one skilled person that there can be any number of trenches in the semiconductor substrate 101 . the etching process for forming the trenches 104 can be , for example , performing electron beam lithography on a positive photoresist and performing reactive ion etching to form two adjacent steep trenches 106 which have a dimension of about 400 nm * 400 nm and a spacing of 10 - 60 mt the shape of the trenches is only illustrative and there is no limitation to this in the present invention . a fin 105 is formed between the trenches , which is also referred as “ a silicon island ”. the fin has a width which may be selected as appropriate , for example , 10 - 60 nm . fig4 is a schematic view of the semiconductor structure after sidewall spacers are formed in the semiconductor structure shown in fig3 . as shown in fig4 , the sidewall spacers are formed at both sides of the fin 105 . the sidewall spacers may have a single - layer or multi - layer structure , and may have a “ d ” shape or “ i ” shape or other shapes . there is no limitation without any limitation to this in the present invention . the formation of sidewall spacers protects the fin 105 from being damaged during the subsequent etching process . first , a second dielectric layer is formed to cover the whole semiconductor structure , which , for example , is made of sio2 , teos , or other dielectric materials . in the embodiment of the present invention , it is preferably teos . the second dielectric layer can be formed by chemical vapor deposition , atomic layer deposition , or other approaches , and may have a thickness of about 20 - 60 nm . the second dielectric layer is then etched , for example , by reactive ion etching ( rie ) so as to form sidewall spacers 106 . as shown in fig5 , a suspended fin 105 ′ is then formed at the bottom of the trenches 104 and below the fin 105 . specifically , the semiconductor substrate 101 is further etched through the trenches 104 so that the trenches 104 further extend into the semiconductor substrate 101 , which increase the depth of the trenches 104 , and extend towards the bottom of the fin 105 until two adjacent trenches 104 communicate with each other below the fin 105 , so as to form a suspended fin 105 ′ and trenches 104 ′ which communicate with each other at the bottom . the further etching through the trenches 104 includes isotropic dry etching or wet etching . preferably , dry etching is used for the further etching through the trenches 104 , up to a depth of 100 - 300 nm below the bottom of the fin 105 in the semiconductor substrate 101 . alternatively , wet etching can also be used . the etching rate and time in the etching process may be controlled in accordance with the thickness of the fin 105 , so as to ensure that a portion of the silicon substrate below the fin is etched away completely and the adjacent trenches communicate completely with each other at respective bottom portions in the etching process . as shown in fig6 and 7 , an isolation dielectric layer 107 ′ is then formed at the bottom of the trenches 104 ′ and below the fin 105 ′ in the semiconductor substrate . first , referring to fig6 , a filling dielectric layer 107 is deposited on the semiconductor substrate , which fills the whole trenches 104 ′ and the cavity below the fin 105 ′. the filling dielectric layer 107 is made of sio2 , teos , low temperature oxide ( lto ), or other dielectric materials . in the embodiment of the present invention , it is preferably made of teos . the filling dielectric layer 107 can be formed by chemical vapor deposition ( cvd ), and can have a thickness of about 250 - 500 nm . as shown in fig7 , the filling dielectric layer 107 is etched back so as to completely expose the suspended fin 105 ′, and a portion of the filling dielectric layer 107 remains at the bottom of the trenches , which forms an isolation dielectric layer 107 ′ for providing isolation between the device and the substrate . the isolation dielectric layer 107 ′ facilitates suppressing formation of bottom parasitic transistors , eliminating leakage current passage at bottom , and improving performance of the device . in the etchback , the dielectric layer at the top of the suspended fin 105 ′ and the sidewall spacers at both sides of the suspended fin 105 ′ are both removed , and a portion of the filling dielectric layer below the suspended fin 105 ′ is removed so that the trenches 104 ′ communicate with each other at respective bottom portions . a suspended fin according to one embodiment of the present invention is thus formed . in the semiconductor structure shown in fig7 , there is an isolation dielectric layer 107 ′ below the fin which facilitates suppressing formation of bottom parasitic transistors , eliminating leakage current passage at bottom , and improving performance of the device . as shown in fig8 , a gate dielectric layer 108 and a gate electrode 109 are then formed on the whole semiconductor substrate , and are further etched to provide a gate stack . the gate dielectric layer 108 can be made of conventional gate dielectrics , such as sio2 , or other high k dielectrics , such as sion , hfalon , hftaon , hfsion , al2o3 , or the like . in one embodiment of the present invention , it is preferably made of hfsion . the gate dielectric layer 108 can be formed by low pressure chemical vapor deposition , metal - organic chemical vapor deposition , atomic layer deposition , or the like , and has an equivalent oxide thickness ( eot ) of 5 - 100 å . the gate electrode 109 can be made of refractory metals , such as w , ti , ta , mo , or metal nitrides , such as tin , tan , hfn , mon , or other materials . the gate electrode 109 can be formed by low pressure chemical vapor deposition , metal - organic chemical vapor deposition , atomic layer deposition , or the like , and has a thickness of 2000 - 5000 å . optionally , after forming the gate stack , the method further comprises the step of performing tilt angle ion implantation so as to form source / drain extensions in the fin ; or performing tilt angle ion implantation so as to form implanted halos in the fin . a gate sidewall spacer is then formed at side surfaces of the gate stack . the formation of the gate sidewall spacer can be implemented with conventional methods , which will not be described in detail here . ion implantation is then performed on both sides of the gate stack in the semiconductor substrate so as to form source / drain regions , and the source / drain regions are then silicided . finally , interconnects are formed by metallization for being coupled with electrodes . the metallization can be implemented with conventional methods , which will not be described in detail here . moreover , the above embodiment of the present invention illustrates formation of a suspended fin in a bulk silicon substrate , which facilitates manufacturing a gate - all - around device in a bulk silicon substrate . the inventive method is a typical quasi - planar top - down process , which can be implemented by a simple manufacture process , and is easy to be integrated into and compatible with a planar cmos process . in the above description , no details are given for patterning and etching various layers . nevertheless , one skilled person will appreciate that the layers and regions having desired shapes can be formed by various approaches well known in the field . moreover , one skilled person may propose a process completely different from the above processes for providing the same structure . various embodiments of the present invention have been described above . it should be understood that they have been presented by way of example , and not limitation on the protection scope of the present invention . the protection scope is defined by the attached claims and their equivalences . one skilled person will readily recognize that various modifications and changes may be made to the present invention , without departing from the true scope of the present invention .

7Electricity

the present invention is a method for cutting a fowl carcass to create an edible fowl wing cut that includes the radius bone and muscles ( meat ) adhering to the radius bone . in butchered meats , the wing cut generally consists of both the ulna bone and radius bone as well as the associated muscles . however , the present invention discloses a method for cutting a fowl &# 39 ; s wing to create a single boned edible wing cut . in recent years , convenience and quality of presentation have become increasingly important to both consumers and food service distributors ( e . g ., restaurants ). the present invention is directed to the preparation and service of an innovative meat product , one which provides a discrete and easy to handle meat product that has a high meat - to - bone ratio . such a product is quite suitable as an appetizer on a restaurant menu and can provide high profit margins for food service distributors , while also providing a high quality and meat - heavy product for the consumer ( i . e ., high product value from the consumer &# 39 ; s perspective ). while particularly suited to being served as a restaurant appetizer , the inventive meat product may also be sold for home preparation and consumption . in addition , since the meat is borne on only a single generally central bone , consumption is simplified . fig1 shows an enlarged skeletal view of the pectoral limb ( wing ) of a fowl . the fowl wing 10 includes a humerus bone 12 , an ulna bone 14 , a radius bone 16 , a radial carpal bone 18 located at a posterior edge 19 of the wing 10 , a first joint 30 and a second joint 38 . fig2 shows one illustrative environment for the butchering of a fowl carcass 20 . any arrangement for supporting the carcass 20 will suffice for practicing the present invention so long as the wing area of the fowl carcass 20 is suitably accessible for processing . in the illustrated example , the fowl carcass 20 is supported by a suitable apparatus 22 , thereby freeing both of the butcher &# 39 ; s hands ( such as hands 24 and 25 ) for use in the process . the butcher is then able to grasp the fowl wing 10 in one hand 24 while handling a cutting utensil 26 ( i . e ., knife ) in the other hand 25 . fig3 shows a first butchering incision 28 made in the fowl carcass 20 . the incision is made while grasping a distal portion of the fowl wing 10 . the first butchering incision 28 is from the front of the fowl wing 10 ( from the “ front ” side 13 , as shown in fig3 ) beginning at the level of the elbow and moving towards a first joint 30 . the first incision 28 cuts parallel to the radius bone 16 and through the patagium 32 ( wing membrane ). the first incision 28 separates the radius bone 16 from the patagium 32 . fig4 illustrates a second butchering incision 34 made in the fowl carcass 20 . during the second incision 34 , the cutting utensil 26 cuts through a portion of the first joint 30 toward the ulna bone 14 and continues roughly at a right angle to the major extent of the first incision 28 . as the second incision 34 is made , the butcher ( while grasping the fowl wing 10 in hand 24 ) twists the wing 10 generally in the direction of the arrow 36 . ( fig4 ). the cutting and twisting of the fowl wing 10 separates the humerus bone 12 from the radius bone 16 . additionally , the twisting dislocates the first joint 30 between the humerus bone 12 and radius bone 16 allowing the cutting utensil 26 to pass through the portion of the first joint 30 . alternatively , the butcher can twist the wing 10 generally in the direction of the arrow 36 after the second incision 34 is completed . ( fig4 ). however , this could make it more difficult for the cutting utensil 26 to pass through the portion of the first joint 30 . as the second incision 34 continues , the cutting utensil 26 is drawn along the ulna bone 14 ( in contact therewith ) towards a second joint 38 located between the radial carpal bone 18 and the ulna bone 14 and the radius bone 16 . the cutting utensil 26 is drawn generally in the direction of arrow 34 towards the second joint 38 . fig5 shows the removal of an edible fowl wing cut 42 from the fowl carcass 20 . the butcher removes the edible fowl wing cut 42 by moving the hand 24 to grasp the radius bone 16 along with the muscles ( meat ) adhering to the radius bone and skin . a final incision 44 is then made by moving the cutting utensil 26 to cut away from the ulna bone 14 and move through a portion of the second joint 38 . the final incision 44 cuts between the distal end of the radius bone 16 and the proximal area of the radial carpal bone 18 . as the final incision 44 is made , the butcher twists the radius bone 16 in the direction of arrow 48 ( fig5 ) to dislocate the joint cavity 38 , allowing the cutting utensil 26 to cut through the a portion of the second joint 38 . once the cutting utensil 26 is through the portion of the second joint 38 and the associated muscles , the edible fowl wing cut 42 is separated from the remaining fowl wing 10 parts , and can be further individually processed as desired . alternatively , the butcher can twist the radius bone 16 in the direction of arrow 48 after cutting away from the ulna bone 14 . ( fig5 ). however , this could make it more difficult for the cutting utensil 26 to pass through the portion of the second joint 38 . fig6 shows a completed edible fowl wing cut 42 of the present invention . the edible fowl wing cut 42 includes only the radius bone 16 , muscles ( meat ) and cutaneous tissues ( skin ) 50 overlying these muscles . the edible fowl wing cut 42 contains the following muscles : m . extensor carpi obliqus , m . medialis extensor digiti , m . extensor et adductor digitorum , m . pronator longus , m . pronator brevis , m . extensor digiti secundi et terti , m . supinator medialis , m . supinator lateralis and m . extensor carpi radialis profundus . each fowl carcass 20 will produce two edible fowl wing cuts 42 , one from the left side and one from the right side . the final product is a single boned meaty fowl wing cut with meat along all sides of the radius bone 16 . the skin may be left on the meat or removed , as desired . if left on , the skin totals 6 - 8 % by weight of the cut 42 . the final product has a meat - to - bone ratio of approximately 79 . 17 % meat to 20 . 83 % bone . a typical wing cut that includes both the ulna bone 14 and the radius bone 16 only has a meat - to - bone ratio of approximately 73 . 88 % meat to 26 . 12 % bone . therefore , the completed edible fowl wing cut 42 is intended to have as much meat as possible on the radius bone 16 creating a high meat - to - bone ratio product that is easy to consume . although the present invention has been described with reference to one embodiment thereof , changes may be made in form and detail . for example , the description and figures refer specifically to a method for preparing wing cuts from the radius bone and adhering meat of a turkey . however , the method of the present invention could be applied to any fowl species including , but not limited to , turkeys , chickens , geese , pheasants , ducks , ostriches , or any other animal . additionally , as noted above , the cutaneous tissues ( skin ) 50 can be removed from the wing cut 42 , creating a skinless edible fowl wing cut . the skinless fowl wing cut allows individuals concerned with calorie intake and fat content to enjoy the wing cut 42 without consuming the skin . alternatively , the muscles ( meat ) adhering to the radius bone 16 can be trimmed to create a less meaty edible wing cut and / or muscle ( meat ) can be left with the ulna bone 14 creating a smaller portion size . further , the method for cutting a fowl carcass to create an edible fowl wing cut can be performed in an alternative manner , such as performing the cutting and separating steps in a reverse order . this is done by first making an initial incision at the posterior edge 19 of the wing 10 at the level of the second joint 38 between the radius bone 16 and the radial carpal bone 18 . the initial incision is made in the opposite direction of the incision 44 . second , the cutting utensil 26 is drawn into the second joint 38 between the radius bone 16 and the radial carpal bone 18 . third , the cutting utensil 26 is turned to make an incision along the ulna bone 14 towards the first joint 30 . the third incision is made in the opposite direction of the incision 34 . after the cutting utensil 26 enters the first joint 30 , it is turned to provide a transverse cut through the patagium 32 ( the wing membrane ) to exit the wing 10 . the transverse cut is made in the opposite direction of the incision 28 . the transverse cut separates the radius bone 16 from the humerus bone 12 and completes the separation of the edible fowl wing cut 42 from the remaining fowl wing 10 parts . no matter what technique is used to separate the fowl wing cut 42 from the wing 10 , the fowl wing cut 42 can then be further processed as desired ( e . g ., frozen , seasoned , cooked , etc .) to create a final servable food product . the fowl wing cut 42 can be sold as a raw cut , marinated or non - marinated , or after further processing . although the present invention has been described with reference to preferred embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention .

0Human Necessities

the technical content of the present invention will become apparent by the detailed description of the following embodiments and the illustration of related drawings as follows . the disclosure of “ oral gene delivery with cyclo -( d - trp - tyr ) peptide nanotubes ”, published on mol . pharmaceutics , 2012 , 9 ( 5 ), pp 1231 - 1249 , is incorporated herein in its entirety by reference . the self - assembly of cyclo -( d - trp - tyr ) peptide ( bachem , bubendorf , switzerland ) pnts was prepared as the following description . briefly , 0 . 1 to 10 mg of cyclo -( d - trp - tyr ) peptide powder may be used to be dissolved in 0 . 015 to 0 . 75 ml of trifluoroacetic acid ( tfa ). wherein , the concentration of the tfa may be 0 . 1 to 5 %, preferably 3 . 5 %. in the preferred embodiment , 5 mg of cyclo -( d - trp - tyr ) peptide powder may be dissolved in 0 . 5 ml of trifluoroacetic acid ( tfa ) in an eppendorf tube . then , double distilled water was added into the eppendorf tube at 0 to 25 ° c . the eppendorf tube was left opened and then floated in an airtight vial which was filled with 15 ml of double - distilled water . the white suspension of nanotube may be obtained after incubation for 10 to 72 h at 0 to 25 ° c . preferably , the white suspension of nanotube may be obtained after incubation for 24 h at 25 ° c . pnts were harvested by centrifugation and washed repeatedly with double - distilled water to remove the residual tfa . specifically , the amount of cyclo -( d - trp - tyr ) peptide powder and tfa may be varied and should not be construed as limited to the embodiments set forth herein . the self - assembly of cyclo -( d - trp - tyr ) peptide ( bachem , bubendorf , switzerland ) pnts was prepared as the following description . briefly , 0 . 1 to 10 mg of cyclo -( d - trp - tyr ) peptide powder may be used to be dissolved in 0 . 1 to 10 ml of ethanol . wherein , the concentration of the ethanol may be 1 to 100 %, preferably 50 %. in the preferred embodiment , 5 mg of cyclo -( d - trp - tyr ) peptide powder may be dissolved in 10 ml of ethanol in a beaker and the white suspension of nanotube may be obtained after incubation for 1 to 48 h at 0 to 25 ° c . preferably , the white nanotube may be obtained after incubation for 24 h at 25 ° c . pnts were harvested after ethanol and water evaporation . specifically , the amount of cyclo -( d - trp - tyr ) peptide powder and ethanol may be varied and should not be construed as limited to the embodiments set forth herein . pcmv - lacz and pcmv - hrluc plasmids , carrying the lacz gene encoding β - gal and hrluc gene encoding humanized renilla reniformis luciferase , respectively , under the control of the cytomegalovirus ( cmv ) promoter , were the transferred dna in the present invention . these plasmids were amplified in the escherichia coli host strain dh5α and purified by equilibrium centrifugation on a cscl - ethidium bromide gradient . the purity of the plasmid dna prepared was determined by electrophoresis on an agarose gel followed by ethidium bromide staining . dna concentration was measured by ultraviolet ( uv ) absorption at 260 nm . plasmid dna , pcmv - lacz , was labeled with tm - rhodamine ( lable it nucleic acid labeling kit ; mirus , madison , wis .) according to the manufacturer &# 39 ; s and labeling reagent . briefly , pcmv - lacz was mixed with labeling buffer and labeling reagent . after incubating at 37 ° c . for 2 h , the labeled dna was further purified by ethanol precipitation and confirmed by hplc with tsk - gel g5000 pwxl column ( tosoh bioscience , tessenderlo , belgium ) under a 0 . 7 ml / min flow rate of water ( ph 5 ) mobile phase and fluorescence detector ( excitation : 546 nm ; emission : 576 nm ). the prepared may be used to formulate with various biomolecules , such as peptides , proteins , nucleic acids , drugs and the like . wherein , the nucleic acid may comprise dna , shrna and sirna . in an embodiment , pnts may be formulated with different kinds of plasmid , e . g . pcmv - lacz and pcmv - hrluc . the concentration of the plasmid to be formulated with the pnts may be 0 . 01 to 0 . 3 μg / μl , wherein the concentration of the pnts may be 0 . 05 to 5 % ( w / v ). in a preferred embodiment , the pcmv - lacz / pnt or tm - rhodamine - labeled pcmv - lacz / pnt or pcmv - hrluc / pnt complexes were formulated by gently mixing plasmid dna ( 0 . 26 μg / μl ) with pnts ( 0 . 15 %, w / v ) in an eppendorf tube for 1 to 24 h at 4 to 37 ° c . and should not be construed as limited to the embodiments set forth herein . the pnt suspension was dropped on the mica surface and dried in a vacuum system . samples were then coated with gold particles using a sputter coating method under vacuum of 2 mbar at 20 ma for 8 min and further observed by sem . sem ( s - 2400 / hitachi instruments inc ., san jose , calif .) was operated at an accelerating voltage of 15 kv and 20 kv . pnts were dried under vacuum system and then embedded in epoxy resin and followed by thin section preparation . sample films with an 80 nm thickness were picked up on 200 mesh carbon - coated copper grid for tem imaging . bright - field tem imagings of the pnts were performed on a tem ( h - 600 , hitachi instruments inc ., san jose , calif .) operating at 80 kv . images were taken under 40000 × zoom field . a 10 μl pnt suspension was placed on a mica surface without further treatment . the afm ( dicpii ; digital instruments / veeco metrology group , santa barbara , calif .) was operated in a constant tapping mode . the cantilevers were standard nanoprobe silicon single crystal lever ( nsc15 / aibs ; mikromasch , estonia ). the constant force mode was used with a recommended scan frequency of 328 khz . a scanner with a 2 μm scanning range was used , and all images were collected within a 4 μm 2 square area . a sample of 10 μl of tm - rhodamine labeled pcmv - lacz / pnt complexes were placed on a slide surface and air - dried . the labeled and without labeled groups were fixed exposure times imaged by a fluorescence microscope ( olympus bx40 , japan ). the association of pnts was evaluated using pyrene as a fluorescence probe . the fluorescence spectrum of pyrene in the pnt solution was measured using a hitachi f - 4500 fluorescence spectrophotometer ( hitachi , tokyo , japan ). the emission spectrum scan was performed from 350 to 460 nm using a fixed excitation wavelength of 339 nm with a constant pyrene concentration of 6 × 10 − 7 m . the pnt concentrations were from 1 . 6 μg / ml to 1 . 6 mg / ml . cac was determined by the pyrene i 1 / i 3 ratio method . the ratio of the fluorescence intensity at 373 nm ( i 1 ) and at 383 nm ( i 3 ) was plotted against the logarithm of the concentration of associating molecules . the cac value was determined from the crossover point of the rapidly varying part and the nearly horizontal part at low concentrations . the size of pnt suspensions at various concentrations and the zeta potential of pcmv - lacz , pnts alone , and pcmv - lacz / pnt complexes in water were measured by quasielastic laser dynamic light scattering ( dls ) ( hydro 2000s and nano series nano - zs , respectively ; malvern instruments , malvern , u . k .) as incorporated by reference 17 . all measurements were performed at 25 ° c . at a measurement angle of 90 ° with an assumed refractive index ratio of 1 . 33 . to determine the association constant of the binding of tyr in pnts and the plasmid dna , fluorescence measurements were performed . the emission spectra ( emission slit 2 . 5 nm , f - 4500 spectrophotometer , hitachi instruments inc ., tokyo , japan ) were measured upon excitation at 280 nm ( excitation slit 2 . 5 nm ), where both of trp and tyr residues were excited and at 295 nm where only trp residues were selectively excited . the binding constant k of tyr to dna was evaluated by the change of intensity in fluorescence emission spectra of pnts in the presence of different concentrations of dna excitation at 280 nm and according to equation 1 as incorporated by reference 18 and 19 . here f 0 and f are the fluorescence intensity from the fluorophore , tyr , at 280 nm in the absence and the presence of different concentrations of dna , respectively . an amount of 40 μg of pcmv - lacz was added to 2 - fold serial dilutions of pnt suspension and incubated for 24 h at ambient conditions , respectively . the pcmv - lacz / pnt complexes were centrifuged at 16000 g for 10 min at 25 ° c ., and the precipitates were collected for further phenol - ciaa ( chloroform / isoamyl alcohol = 1 : 1 ; v / v ) extraction . after extraction , the dna pellets were dissolved in water and quantified by pcr ( qpcr ). qpcr was performed using a sybr green pcr master mix in an abi prism 7300 sequence detection system ( applied biosystems , 7300 system sequence detection system ( sds ) software , version 1 . 3 ). the primers for β - gal ( forward : 5 ′- cta cac caa cgt aac cta tcc c - 3 ′ ( seq id no : 1 ) and reverse : 5 ′- ttc tcc ggc gcg taa aaa tgc g - 3 ′ ( seq id no : 2 )) were used . the conditions for the pcr were as follows : 50 ° c . for 2 min , 95 ° c . for 10 min , and 40 cycles of 95 ° c . for 15 sec and 60 ° c . for 1 min . all samples were run in duplicate with a set of plasmid standards that contained 1 × 10 2 to 1 × 10 8 copies of the lacz gene . the quantification values were obtained from the threshold cycle ( ct ) number at which the increase in signal associated with an exponential growth of pcr products began to be detected using sds software . to observe the effect of pnts on plasmid release , a franz cell with a 0 . 2 μm membrane disk filter ( supor - 200 , pall life sciences , ann arbor , mich ., usa ) was used for the in vitro release study . an active diffusion area of 0 . 63 cm 2 was exposed to the donor and receiver compartments of franz cell , containing 6 ml of phosphate buffer solution ( pbs ; ph 7 . 4 ) in receiver site . an amount of 490 μl of naked pcmv - lacz ( 0 . 26 μg / μl ) or pcmv - lacz formulated with pnts ( 1 . 5 mg / ml ) was added to the donor compartment , and 0 . 2 ml samples were taken from the receiver compartment at designed sampling times ; the volume in the receiver compartment was maintained by the addition of 0 . 2 ml of pre - warmed pbs . samples were quantified by qpcr same as described in the loading efficiency of pcmv - lacz / pnts section ( section 8 ). the release time profile of dna was obtained by plotting the cumulative amount of dna released against time . stability of pcmv - lacz / pnts with dnase i , simulated gastric acid , or bile digestion the protection of pcmv - lacz with pnts against dnase i was carried out as described in the following procedure . briefly , the mixtures of 13 units of rq1 rnase - free dnase i ( promega biotech co ., ltd ., madison , wis .) and 100 μg of pcmv - lacz with or without pnts in a total volume of 200 μl were incubated at 37 ° c . the mixtures were sampled with 10 μl each after incubating with dnase i at 37 ° c . for 0 , 5 , 10 , 15 , 20 , 30 , 40 , 50 , 60 , 70 , 80 , 100 , and 120 min , and then 1 μl of rq1 dnase i stop solution ( promega biotech co ., ltd ., madison , wis .) was immediately added into each sample . the stability of pcmv - lacz / pnt formulation with simulated gastric acid was performed as following . briefly , pcmv - lacz solution with or without pnts was adjusted to ph 2 with simulated gastric acid . after incubating at 37 ° c . for 0 , 30 , 60 , 90 , 120 , 180 , 240 , 300 , and 360 min , the 10 μl samples collected at indicated time points were neutralized with 25 mm ethylenediaminetetraacetic acid ( edta ) solution ( ph 8 ). the stability of pcmv - lacz with pnts against bile was carried out as following description . bile , isolated from mice bile duct , was added to pcmv - lacz or pcmv - lacz / pnts solution at a final concentration of 10 % ( v / v ) and incubated at 37 ° c . at 0 , 10 , 20 , 30 , 40 , 60 , 90 , 120 , 180 , 240 , 300 , and 360 min time points , each 10 μl of samples were mixed with 25 mm edta solution ( ph 8 ). the resulting solutions were directly loaded onto a 0 . 8 % agarose gel for electrophoresis , and then the gel was stained with ethidium bromide . the qualification of band intensities was performed with a kodak edas290 analysis system ( kodak scientific imaging system , new haven , conn .). since there are no available methods to determine the in vivo fate of pnt after oral delivery , the inventors have mimicked the in vivo situation and analyzed the degradation of pnts in the presence of simulated gastric acid ( ph 2 ). briefly , 0 . 2 mg of pnts pre - stained with thioflavin t ( 4 μm ), a dye that has been used to stain pnts , for 5 min was incubated with 150 μl of simulated gastric acid for 0 , 20 , 40 , 60 , 80 , and 100 min . the morphological change of thioflavin t pre - stained pnts at different time points of treatment was analyzed with fluorescence microscopy ( olympus bx40 , japan ) and on a mica surface observed with afm as previous section . the animal protocol was approved by the laboratory animal research committee of taipei medical university . male nude mice ( balb / cann - foxn1nu / crlnarl ) at 6 - 8 - week age were used for in vitro duodenal penetration and in vivo oral delivery studies and were purchased from the national laboratory animal breeding and research center ( taipei , taiwan ). they were maintained under specific pathogen - free conditions . for the in vitro dna permeation studies , nude mice were sacrificed by cervical dislocation and upper duodenal sections , from the pylorus to 1 cm distal to the ligament of treitz , were retrieved . duodenal tissues were gently rinsed three times in 4 or 37 ° c . phosphate buffered saline ( pbs ) or pretreated with pbs containing 150 mm of sodium azide for 15 min and then placed in an in vitro vertical diffusion apparatus . a tissue surface area of 0 . 13 cm 2 was exposed to the donor and receiver compartments of franz cell , containing 3 ml of pbs in receiver site . an amount of 150 μl of naked dna ( 0 . 26 μg / μl ) or dna formulated with four different concentrations of pnts ( 0 . 01 , 0 . 2 , 0 . 8 , and 1 . 5 mg / ml ) was added to the donor compartment , and an aliquot of 0 . 2 ml sample was taken from the receiver compartment at indicated sampling times ; the volume in the receiver compartment was maintained by the addition of 0 . 2 ml of pre - warmed pbs . samples were then followed by the phenol - ciaa extraction and ethanol precipitation . the purified dna was re - dissolved in te buffer , and the concentration was quantified by qpcr , the same as described in the loading efficiency of pcmv - lacz / pnts section ( section 8 ). the apparent permeability coefficient ( p app ) was calculated according to the following equation : p app =( dc / dt ) v / a × c 0 , where v ( dc / dt ) is the steady state rate of dna appearing in the receiver chamber after the initial lag time , c 0 is the initial plasmid concentration in the donor chamber , and a is the area of duodenal tissue exposed ( 0 . 13 cm 2 ). data from all experiments were pooled to determine the mean and standard error . the analysis of variance ( anova ) using dunnett &# 39 ; s multiple comparison tests with a 95 % confidence level determined the significance of differences between each group of experiments . for the in vivo studies , nude mice were fasted but allowed free access to water for 24 h before the experiments . formulations ( pcmv - lacz / pnts or pcmv - hrluc / pnts ) were administered with a stomach feeding needle for mice ( kn - 342 ; natume seisakusho ). eight doses of formulated complexes ( 150 μl ), containing plasmid ( 0 . 26 μg / μl ) and pnts nanotubes ( 1 . 5 mg / ml ), were administrated at 3 h intervals ( 9 a . m ., 12 a . m ., 3 p . m ., and 6 p . m .). mice receiving only plasmid dna served as control groups . to evaluate gene transfer in vivo , mice were sacrificed by cervical dislocation at 48 and 72 h after the first dose and all organs and tissues including the duodenum , testis , kidney , stomach , heart , liver , brain , lung , spinal cord , and spleen were removed and processed immediately for individual analysis . the β - gal expression was quantified with the enzyme substrate chlorophenol red - β - d - galactopyranoside ( cprg ; gene therapy systems , san diego , calif .). color development was measured at 580 nm . for renilla luciferase activity measurement , tissues were lysed and mixed with luciferase substrate using a renilla luciferase assay kit ( promega , madison , wis .). the luciferase activity was measured in a photoluminometer ( thermo varioskan flash , thermo scientific , ca ) over 10 sec and was calculated as the number of relative light units ( rlu ). total tissue proteins were measured with a dc protein assay reagent kit ( bio - rad , hercules , calif .) and used to normalize the β - gal and renilla luciferase activity for each sample . statistical comparisons were determined by anova ( dunnett &# 39 ; s multiple comparison tests ) with a 95 % confidence level . animal tissues were first washed with ice - cold pbs solution and immersed in fixation solution ( 4 % paraformaldehyde ) for 1 . 5 h at 4 ° c . tissues were then stained with x - gal solution at 37 ° c . for 2 days and further dehydrated in 40 % sucrose solution for 12 h . cryosections ( 10 μm ) of the o . c . t .- embedded tissues were fixed with acetone / methanol ( 1 : 1 ) on ice for 10 min . for pcmv - lacz delivery , the additions of egta and mg ion , as well as the reaction at high ph conditions , were applied in this assay to reduce the endogenous β - gal activity . after hematoxylin and eosin ( he ) staining , the slides were sealed with leica cv mount . the sections were observed using optical microscope ( olympus bx40 , japan ). for pcmv - hrluc delivery , the sections were blocked by 1 % bovine serum albumin ( bsa ) for 30 min at room temperature . the cryosection was hybridized with rabbit anti - renilla luciferase antibody ( 1 : 100 , mbl international corporation , woburn , mass . ), incubated in moisture conditions at 4 ° c . overnight , and then washed by pbs and hybridized with donkey anti - rabbit igg - fitc ( 1 : 100 , santa cruz biotechnology inc ., santa cruz , calif .) in the dark for 1 h at room temperature . the section was washed with pbs , stained with propidium iodide ( pi , 40 ng / ml , roche diagnostic corp ., indianapolis , ind .) for the localization of the nucleus , and then sealed with leica cv mount . the control and experimental groups were observed by a fluorescence microscope ( olympus bx40 , japan ) with fitc and pi filter at the fixed exposure time . to trace the distribution of delivered dna , the complexes of tm - rhodamine labeled pcmv - lacz / pnts were administrated following methods described in the oral gene transfer in vivo section . mice receiving no treatment served as control groups . mice were sacrificed by cervical dislocation at 1 h after the first dose and β - gal expressing tissues including the stomach , duodenum , liver , and kidney were removed and immersed in fixation solution ( 4 % paraformaldehyde , merck , darimstadt , germany ) for 24 h . after dehydration with the concentration gradient of ethanol ( 70 %, 80 %, 95 %, and 100 %), tissues were embedded into paraffin blocks . after de - paraffinization , re - hydration , and dapi ( 1 μg / ml ) staining for 20 min , sections were observed using a confocal laser scanning microscope ( leica tcs sps , germany ) with a diode ( 50 mw ) and dpss ( diode pumped solid state ; 10 mw ) laser light source . to observe the uptake of pnts at biomembranes and trace the distribution of delivered pnts , thioflavin t ( 4 μm ) pre - stained pnts were administrated following the methods described in the oral and topically eye drop gene transfer in vivo section . mice receiving no treatment served as control groups . mice were sacrificed by cervical dislocation at 1 h after the first dose , and β - gal or hrluc expressing tissues including the stomach , duodenum , liver , lung , brain , kidney , and cornea were removed and processed for cryosection following the methods described in the section of tissue section for pcmv - lacz delivery and pcmv - hrluc delivery . after dapi ( 1 μg / ml ) staining for 20 min , sections were sealed with leica cv mount and observed by a fluorescence microscope ( olympus bx40 , japan ) with a fixed exposure time . stomach , duodenum , liver , and kidney were harvested at 1 , 2 , and 3 h after the oral first dose and at 4 h with the oral second dose at 3 h intervals of plasmid dna or plasmid dna formulated with pnts . total dna was extracted from the homogenized tissues . homogenate was lysed with 0 . 5 % sds and protease k ( 10 mg / ml ) solution at 60 ° c . overnight . total dna was then phenol - chloroform extracted , ethanol precipitated at 4 ° c . overnight , washed with 70 % ethanol , and dissolved with te buffer . a 5 μg portion of total dna from stomach and duodenum samples and a 50 μg portion of total dna from liver and kidney samples were separated on 0 . 8 % agarose gel by electrophoresis with a 1 kb ladder . the gels were then denatured with 0 . 5 n naoh , followed by neutralized with 1 m tris buffer ( ph 7 . 4 ). dna bands were then transferred to nytran ny 13n membranes ( schleicher & amp ; schuell , dassel , germany ) and followed by a uv light cross - link at 254 nm with 0 . 15 j / cm 2 of energy . after pre - hybridization with ultrahyb hybridization buffer ( ambion , austin , tex .) for 4 h , membranes were incubated at 42 ° c . for 16 h with biotin - 14 - datp ( bionick labeling system , invitrogen life technologies ) labeled a cmv - lacz dna fragment which was obtained from the digestion of pcmv - lacz with psti restriction enzyme . finally , membranes were performed with chemiluminescent detection using the phototope - star detection kit ( new england biolabs , ipswich , mass ., usa ) and then exposed to kodak biomax light film ( kodak , rochester , n . y ., usa ). forty - eight and seventy - two hours after the first oral dose of pcmv - lacz / pnts or pcmv - hrluc / pnt formulation , total rna was extracted from the stomach , duodenum , liver , and kidney with trizol reagent ( invitrogen life technologies , carlsbad , calif ., usa ) according to the manufacturer &# 39 ; s instructions . total rna ( 2 . 5 μg ) was reverse - transcribed with superscript ii reverse transcriptase ( invitrogen life technologies , carlsbad , calif ., usa ) primed with oligo - dt ( 10 μm ). the amount of cdna was quantified by rt - qpcr the same as described in the loading efficiency of pcmv - lacz / pnts section . for hrluc mrna analysis , the primers for renilla luciferase : forward : 5 ′- tcc ctg atc tga tcg gaatgg g - 3 ′ ( seq id no : 3 ), and reverse : 5 ′- ctt ggt gct cgt agg agtagt g - 3 ′ ( seq id no : 4 ), were used . to image the pcmv - hrluc delivery , mice were anesthetized with a mixture of oxygen / isofluorane and received with 0 . 7 mg / kg of colenterazine ( biotium inc ., hayward , calif ., usa ) by cardiac puncture . the photon emission transmitted from dissected organs was measured with an ivis imaging system 200 series ( xenogen , alameda , calif .) with a fixed exposure time . the intensity was recorded as a maximum ( photons / s / cm 2 / sr ). with reference to part a of fig1 for an optical microscope view , parts b - e of fig1 for scanning electron microscope ( sem ) views , parts f - g of fig1 for transmission electron microscope ( tem ) views , and parts h - i of fig1 for atomic force microscope ( afm ) views and cross section of afm image along the line in part h of fig1 , of peptide nanotube devices prepared with trifluoroacetic acid ( tfa ) in accordance with an embodiment of the present invention , the needle - shaped pnts , prepared with tfa , composed of cyclo -( d - trp - tyr ) peptide were observed by optical microscopy in part a of fig1 . the pnts prepared with tfa were appeared to be 500 nm in width and 15 μm in length . in a preferred embodiment , the pnts prepared with tfa may be 100 - 800 nm in width and 1 - 20 μm in length . referring to parts b - g of fig1 , higher magnification images of the scanning electron microscope ( sem ) and transmission electron microscope ( tem ) showed that these needle - shaped pnts prepared with tfa had a hollow tubular structure with an open circle end . the sem imaging in part e of fig1 revealed some small nanotubes with estimated 20 - 30 nm diameters around the bundle of multi - walled pnts prepared with tfa , indicating the obtained pnts prepared with tfa may be formed by single nanotubes bundled or aggregated together . images of afm in parts h - i of fig1 further showed that cyclo -( d - trp - tyr ) peptide pnts prepared with tfa were long tubes with approximately 700 nm in width and 180 nm in height . with reference to fig2 for a schematic view of self - association and size distribution of peptide nanotube devices prepared with tfa in accordance with an embodiment of the present invention , the self - association of pnts prepared with tfa was evaluated using pyrene as a fluorescence probe . the critical association concentration ( cac ) was determined by the pyrene i 1 / i 3 ratio , a well - known property reflecting the microenvironment polarity . referring to the solid circular symbol , results showed that the cac of pnts prepared with tfa was above the 0 . 01 mg / ml concentration . to further evaluate the formation of pnts prepared with tfa , the sizes of pnts prepared with tfa at concentrations of 1 . 6 μg / ml to 1 . 6 mg / ml were analyzed by quasielastic laser dynamic light scattering ( dls ). referring to the open circular symbol , the results showed that the overall sizes of pnts prepared with tfa were between 20 and 30 μm when concentrations of pnts prepared with tfa were above the cac , while the overall sizes of pnts prepared with tfa decreased dramatically to below 5 μm as the concentrations of pnts prepared with tfa were below the cac . these results indicated that the assembly of pnts prepared with tfa depended on the peptide concentration . in addition , referring table 1 , the overall size of pnts prepared with tfa at a 1 . 5 mg / ml concentration was averaged at 17 μm measured by dls ; this was similar to the length estimated on the images obtained by optical and sem microscopes . to ensure that pnts prepared with tfa were remained in a tubular shape , pnts prepared with tfa at this concentration ( 1 . 5 mg / ml ) were used for all further studies including the in vitro duodenal permeability and in vivo oral delivery . furthermore , as shown in table 1 , the overall size of pcmv - lacz / pnt formulation was averaged to be 19 μm measured by dls and similar to the length of pcmv - lacz / pnt formulation observed by optical and sem microscopes . the similar size distribution of pnts prepared with tfa and pcmv - lacz / pnts prepared with tfa suggested that the presence of plasmid dna did not affect the sizes of pnts prepared with tfa . to analyze the effect on surface charge , the zeta potential of the pcmv - lacz / pnt formulation was measured . the results revealed that the zeta potential of pcmv - lacz or pnts prepared with tfa alone in water was − 50 . 2 mv and − 7 . 3 mv , respectively . the zeta potential was shifted to − 56 . 5 mv when pcmv - lacz formulated with pnts prepared with tfa . the mono - dispersion and more negative zeta potential of pcmv - lacz / pnts prepared with tfa indicated that the plasmid dna was associated on the surface of pnts prepared with tfa . with reference to parts a - d of fig3 for an afm view of pcmv - lacz plasmid alone , a sem view of pcmv - lacz plasmid formulated with peptide nanotube prepared with tfa , an afm views of pcmv - lacz plasmid formulated with peptide nanotube devices prepared with tfa , and a cross section of afm image along the line in part c of fig3 , respectively , in accordance with an embodiment of the present invention , to further confirm the association of dna on pnt surface , sem and afm imagings of pcmv - lacz / pnts prepared with tfa were performed . referring to parts b and c of fig3 , results showed that aggregated particles were found on the surface of pnts prepared with tfa . in addition , referring to part d of fig3 , the rugged cross section of pcmv - lacz / pnt formulation was imaged by an afm in contrast to the smooth surface of pnts prepared with tfa alone shown in parts d , h and i of fig1 . furthermore , with reference to fig4 for a fluorescence microscope view of tm - rhodamine labeled pcmv - lacz plasmid formulated with peptide nanotube devices prepared with tfa , tm - rhodamine labeled pcmv - lacz ( p / pnts ) was also associated with pnts prepared with tfa detected by a fluorescence microscope . in addition , with reference to parts a and b of fig1 for scanning electron microscope ( sem ) views , parts c and d of fig1 for an atomic force microscope ( afm ) view and a cross section of afm image along the line in part c of fig1 , and part e of fig1 for an fluorescence microscope view of peptide nanotube devices prepared with ethanol in accordance with an embodiment of the present invention , the needle - shaped pnts composed of cyclo -( d - trp - tyr ) appeared to be 50 - 200 nm in width and 400 - 2000 nm in length , observed by sem and afm . it showed that these needle - shaped pnts revealed some small peptide nanotubes with estimated 20 - 30 nm diameters around the bundle of multi - walled pnts , indicating the obtained pnts may be formed by single nanotubes bundled or aggregated together . the self - association of pnts was evaluated using pyrene as fluorescence probe . the critical association concentration ( cac ) was determined by the pyrene i 1 / i 3 ratio , a well - known property reflecting the microenvironment polarity . referring to table 2 , results showed that the cac of pnts was above 0 . 01 mg / ml concentration . to further evaluate the formation of pnts , the sizes of pnts at concentrations of 1 . 5 mg / ml were analyzed by quasielastic laser dynamic light scattering ( dls ). the results showed that the overall sizes of pnts were between 1 - 3 μm . the similar size distribution of pnts and pcmv - hrluc / pnts suggested that the presence of plasmid dna did not affect the sizes of pnts . to analyze the effect on surface charge , the zeta potential of the pcmv - hrluc / pnts formulation was measured . table 2 revealed that the zeta potential of pcmv - hrluc or pnts alone in water was − 35 mv and 4 mv , respectively . the zeta potential was shift to − 43 mv when pcmv - hrluc formulated with pnts . the mono - dispersion and negative zeta potential of pcmv - hrluc / pnts indicated that the plasmid dna was associated on the surface of pnts . to understand the involvement of trp and tyr residues of pnts prepared with tfa in association with dna , the fluorescence emission spectra of pnts with or without dna was examined . with reference to parts a - c of fig5 for emission fluorescence spectra of pcmv - lacz plasmid formulated with peptide nanotube devices prepared with tfa in accordance with an embodiment of the present invention , the emission intensity contributed by both trp and tyr of pnts prepared with tfa , with an excitation at 280 nm , was significantly decreased when dna added , as shown in part a of fig5 . however , referring to part b of fig5 , the emission intensity of fluorescence with excitation at 295 nm which was specific for trp in pnts prepared with tfa was not influenced by the addition of dna . the results indicated that quenching of the emission spectra with excitation at 280 nm was due to dna interaction with tyr but not trp residues in pnts prepared with tfa . furthermore , referring to part c of fig5 , the level of quenching at tyr fluorescence emission spectra was found augmented with increasing concentration of dna used . with reference to part d of fig5 for a linear plot of pcmv - lacz plasmid formulated with peptide nanotube devices prepared with tfa in accordance with an embodiment of the present invention , the binding constant ( k ) of tyr residues in pnt to dna and the mole fraction of bound dna were calculated to be 3 . 2 × 10 8 m − 1 and 1 . 2 mole fraction of dna bound to tyr , respectively . furthermore , with reference to part a of fig6 for a schematic view of qpcr quantification analysis of the amount of pcmv - lacz absorbed in peptide nanotube devices prepared with tfa in accordance with an embodiment of the present invention , the amount of plasmid dna in the pnts - formulated complexes quantified by qpcr was 3 × 10 10 copies dna / mg pnts . with reference to part b of fig6 for a schematic view of pcmv - lacz release profile in peptide nanotube devices prepared with tfa in accordance with an embodiment of the present invention , the release rate of dna with pnt formulation was evaluated by using a franz diffusion cell with a 0 . 2 μm pore size of the membrane . the accumulated amount of released dna from pnt formulation versus time in minutes was shown in part b of fig6 . the rate of dna released was calculated by the least - squares higuchi method , m r / m ∞ = kt 1 / 2 , and to be 3 . 57 × 10 11 copies dna / t 1 / 2 . however , the release rate of dna without pnt formulation was 5 . 92 × 10 11 copies dna / t 1 / 2 . these results indicated that dna formulated with cyclo -( d - trp - tyr ) peptide pnts possesses a slow release property . stability of pcmv - lacz / pnts prepared with tfa with dnase i , simulated gastric acid , or bile digestion to determine whether the pcmv - lacz / pnt formulation would enhance the stability of dna against enzymatic , acid , and bile degradations , an in vitro dnase i , simulated gastric acid , and bile digestion assay was carried out by the incubation of dnase i , simulated gastric acid , or bile with pnts - formulated dna at 37 ° c . with reference to parts a - c of fig7 for schematic views of the stability of pcmv - lacz formulated with peptide nanotube devices prepared with tfa with treatment of dnase i , gastric acid and bile , respectively , in accordance with an embodiment of the present invention , the supercoiled pcmv - lacz with a size of 7 . 2 kb was observed from dnase i digestion , simulated gastric acid hydrolysis , and bile digestion for 50 , 60 , and 180 min with pnts , respectively . however , naked dna was completely digested soon after incubation with dnase i within 10 min , with simulated gastric acid within 30 min , and with bile within 60 min . to evaluate the stability of pnts prepared with tfa after oral delivery , the inventors incubated thioflavin t pre - stained pnts prepared with tfa with simulated gastric acid to mimic the in vivo situation . parts a and b of fig8 are fluorescence microscope and bright field views of the stability of peptide nanotube devices prepared with tfa with treatment of gastric acid for indicated time intervals , and an afm view of the stability of peptide nanotube devices prepared with tfa with treatment of gastric acid , respectively . referring to part a of fig8 , the results showed that a decrease in both length and width of pnts prepared with tfa was detected over the tested period of time in the presence of simulated gastric acid . referring to part b of fig8 , the result of afm imaging also observed the degradation of pnts prepared with tfa when treated with gastric acid , indicating the occurrence of degradation . to evaluate whether the concentration of pnts prepared with tfa affected the permeability of dna in small intestine after oral administration , in vitro duodenal penetration was performed with a franz cell . as shown in table 3 , the apparent permeability coefficient of plasmid dna was significantly increased from 49 . 2 ± 21 . 6 × 10 − 10 cm / s for naked dna to 395 . 6 ± 142 . 2 × 10 − 10 cm / s for dna formulated with 1 . 5 mg / ml of pnts penetrating from apical to basolateral direction at 37 ° c . the apparent permeability coefficients of plasmid formulated with pnt at 4 ° c . or in the presence of sodium azide were also analyzed to investigate the energy effect . additionally , penetrating from basolateral to apical , the reverse direction was performed . the results showed that the apparent permeability coefficient of pnt formulated plasmid dna was decreased at 4 ° c . or in the presence of sodium azide compared to that performed at 37 ° c ., indicating the energy - dependent penetration . the apparent permeability coefficient was also decreased when penetration processed in the reverse direction . after 48 and 72 h of the first oral pcmv - lacz / pnts dose , the mice were sacrificed , and the β - gal activity in various organs , including the duodenum , testis , kidney , stomach , heart , liver , brain , lung , spinal cord , and spleen , were evaluated using cprg as the substrate . as shown in table 4 , results showed that the β - gal activity significantly increased in the kidney ( 41 %) at 48 h and in the stomach ( 49 %), duodenum ( 63 %), and liver ( 46 %) at 72 h after oral administration of the first dose of pcmv - lacz / pnts ( p & lt ; 0 . 05 ). no β - gal activity was detected in all tissues after oral administration of plasmid dna or pnts prepared with tfa alone compared with that in the control group . with reference to fig9 for histological views of x - gal staining of the various tissues of nude mice with oral delivery of pcmv - lacz formulated with peptide nanotube devices prepared with tfa in accordance with an embodiment of the present invention , results of histological analysis showed that β - gal activity , which was indicated as blue - green color , was found in the stomach , duodenum , liver , and kidney . wherein , mse denoted mucosa surface epithelium , gp denoted gastric pits , fg denoted fundus gland , pa denoted parietal cells , ch denoted chief cells , ye denoted villous epithelium , lp denoted lamina propria , cr denoted crypt cells , vi denoted duodenal villi , l denoted lobules , he denoted hepatocyte , se denoted sinusoidal endothelial cells , pv denoted portal vein , gl denoted glomerular , and pt denoted proximal tubular . there were no pathological and inflammatory characteristics observed in all images of tissue sections from animals receiving pcmv - lacz / pnt formulation . to trace the presence of plasmid dna in stomach , duodenum , liver , and kidney , mice was orally delivered with tm - rhodamine - labeled pcmv - lacz formulated with pnts prepared with tfa . after 1 h of the first dose , mice were sacrificed , and the organs were processed for paraffin sectioning and for confocal laser scanning microscope imaging . with reference to fig1 for fluorescence microscope views of the various tissues of nude mice with oral delivery of tm - rhodamine labeled pcmv - lacz formulated with peptide nanotube devices prepared with tfa in accordance with an embodiment of the present invention , tm - rhodamine signals were found in stomach , duodenum , liver , and kidney where β - gal enzymatic activity was also detected . section a is tm - rhodamine images ( red ), section b is dapi images ( blue ), section c is merged images of images in sections a and b , section d is bright field images merged with the dapi image , and section e is tm - rhodamine image merged with the image in section d . wherein , mse denoted mucosa surface epithelium , gp denoted gastric pits , fg denoted fundus gland , pa denoted parietal cells , ch denoted chief cells , ye denoted villous epithelium , lp denoted lamina propria , cr denoted crypt cells , vi denoted duodenal villi , l denoted lobules , he denoted hepatocyte , se denoted sinusoidal endothelial cells , pv denoted portal vein , gl denoted glomerular , pt denoted proximal tubular , and bl with arrows denoted blood . in addition , tm - rhodamine was found in blood circulating in the stomach , duodenum , liver , and kidney . to further prove the existence of plasmid dna in the stomach , duodenum , liver , and kidney those with significant lacz gene expression , the presence of pcmv - lacz plasmid dna was analyzed by southern blot analysis at indicated time after oral administration of naked pcmv - lacz or pcmv - lacz / pnts prepared with tfa . with reference to fig1 for southern blot analysis of the tissue dnas from various tissues of mice with oral delivery of naked pcmv - lacz or pcmv - lacz formulated with peptide nanotube devices prepared with tfa , respectively , in accordance with an embodiment of the present invention , there was pcmv - lacz dna along with shorter fragmented dnas in samples of stomach , duodenum , and liver at 1 h and in kidney at 1 and 2 h after oral administration of pcmv - lacz / pnt formulation . however , only fragmented dna was found in the samples of stomach and duodenum when mice receive naked plasmid dna . the mrna of lacz gene in four organs was also confirmed by rt - qpcr in samples from mice administered eight doses of pcmv - lacz / pnts prepared with tfa after 48 and 72 h of the first dose . as shown in table 5 , the results revealed that lacz mrna was detected in samples from stomach , duodenum , liver , and kidney tissues at 48 and 72 h . however , no pcr product was detected when using cdna from tissues of the plasmid dna - treated control group . in addition , plasmid with the hrluc reporter was used to confirm the above results . the mrna level , ex vivo bio - luminescence imaging , renilla luciferase quantitative activity , and distribution in tissue sections of delivered dna were analyzed . similarly , hrluc mrna was detected in stomach , duodenum , liver , and kidney tissues at 48 and 72 h after oral delivery of eight doses of pcmv - hrluc / pnts prepared with tfa as shown in table 5 . with reference to fig1 for an ex vivo bioluminescence view of the various tissues of mice with oral delivery of pcmv - hrluc formulated with peptide nanotube devices prepared with tfa in accordance with an embodiment of the present invention , results of ex vivo bioluminescence imaging revealed that the renilla luciferase activity was observed in these four organs . the intensity variation of the signals was shown in different colors , as demonstrated by the color bar next to the figure . referring to table 6 , the renilla luciferase activity was significantly increased in the duodenum ( 59 %) and kidney ( 40 %) at 48 h and in the stomach ( 53 %), duodenum ( 68 %), and liver ( 43 %) at 72 h after oral administration of eight doses of pcmv - hrluc / pnts prepared with tfa ( p & lt ; 0 . 05 ). no significant renilla luciferase activity was detected in all tissues after oral administration of plasmid dna or pnts prepared with tfa alone compared with that in the control group . with reference to fig1 for immunohistological analysis of the various tissues of mice with oral delivery of pcmv - hrluc formulated with peptide nanotube devices prepared with tfa in accordance with an embodiment of the present invention , results of immunohistological analysis further confirmed that renilla luciferase protein , which was shown in green in the figure , was found in the stomach , duodenum , liver , and kidney with nucleus stained with propidium iodide , shown in red . wherein , mse denoted mucosa surface epithelium , gp denoted gastric pits , fg denoted fundus gland , pa denoted parietal cells , ch denoted chief cells , ye denoted villous epithelium , lp denoted lamina propria , cr denoted crypt cells , vi denoted duodenal villi , l denoted lobules , he denoted hepatocyte , se denoted sinusoidal endothelial cells , pv denoted portal vein , gl denoted glomerular , and pt denoted proximal tubular . to trace the presence of pnts prepared with tfa in tissue sections of the stomach , duodenum , liver , and kidney , mice were orally administered with thioflavin t ( tht ) pre - stained pnts prepared with tfa . with reference to fig1 for tht image ( green ) merged with dapi image ( blue ) ( a ), bright field image ( b ), and tht image merged with dapi image and bright field image ( c ), respectively , of histological analysis of the various tissues of mice with oral delivery of peptide nanotube devices prepared with tfa in accordance with an embodiment of the present invention , the results revealed the smaller pnts prepared with tfa (& lt ; 5 μm in length ), which was green in the figure , were found in the sections of stomach , duodenum , liver , and kidney , indicating the presence of degraded pnts prepared with tfa in these tissues . wherein , fg denoted fundus gland , ye denoted villous epithelium , lp denoted lamina propria , cr denoted crypt cells , vi denoted duodenal villi , l denoted lobules , and pt denoted proximal tubular . after 48 h of the first oral pcmv - hrluc / pnts dose , wherein the pnts of which is prepared with ethanol , mice were sacrificed and the renilla luciferase quantitative activity in various organs , including duodenum , testis , kidney , stomach , heart , liver , brain , lung , spinal cord and spleen were evaluated . referring to table 7 , results showed that the renilla luciferase activity significantly increased in liver , kidney , brain , stomach , duodenum , and lung at 48 h after oral administration of the first dose of pcmv - hrluc / pnts ( p & lt ; 0 . 05 ). with reference to parts a and b of fig1 for immunohistological analysis of liver tissues and lung tissues , respectively , of mice with oral delivery of pcmv - hrluc formulated with peptide nanotube devices prepared with ethanol in accordance with an embodiment of the present invention , results of histological analysis showed that hrluc activity was found in liver and lung , detected by anti - renilla antibody , as shown in green . on the other hand , with reference to parts a and b of fig1 for histological analysis of the brain tissues and lung tissues of mice with orally delivery of tht pre - stained peptide nanotube devices prepared with ethanol in accordance with an embodiment of the present invention , to trace the presence of pnts in tissue sections of brain and lung , mice were orally administrated with tht pre - stained pnts . referring to parts a and b of fig1 , the results revealed that the pnts prepared with ethanol , shown in green , were found in the sections of brain and lung area , indicating the presence of pnts in these tissues . with reference to parts a and b of fig1 for tht images merged with dapi image and bright field image of histological analysis of the epithelial layers of the cornea tissues , and part c of fig1 for a tht image merged with dapi image and bright field image of histological analysis of the stroma layers of the cornea tissues of mice with topically eye drop delivery of tht pre - stained peptide nanotube devices prepared with ethanol in accordance with an embodiment of the present invention . after 2 hours of the first topically eye drop of tht pre - stained pnts dose , cornea tissues of mice were obtained and the pnts observed in various layer of cornea , including epithelial area and stroma area . referring to parts a - c of fig1 , the results revealed that the smaller pnts , shown in green , were also found in the layer of epithelial area and stroma area of the cornea tissues , indicating the presence of pnts in these tissues . in summary , the association of plasmid dna with cyclo -( d - trp - tyr ) peptide pnts enhanced the duodenal permeability of plasmid dna in vitro . the in vivo study revealed that the β - gal activity and renilla luciferase were significantly increased after the first dose of plasmid / pnt formulation by oral administration . the organs with increased lacz expression , including the duodenum , stomach , liver , and kidney , were confirmed by the presence of dna using both southern blot analysis and tm - rhodamine - labeled dna tracing . both lacz and hrluc mrnas were detected in these four organs at 48 and 72 h after the first dose of oral delivery . these results implicate the potential application of cyclo -( d - trp - tyr ) peptide pnts as a nano - vector for oral gene delivery to the duodenum , stomach , liver , brain , lung , and kidney as well as in cornea by topical eye drop delivery . while the means of specific embodiments in present invention has been described by reference drawings , numerous modifications and variations could be made thereto by those skilled in the art without departing from the scope and spirit of the invention set forth in the claims . the modifications and variations should in a range limited by the specification of the present invention . ( 1 ) na , k . ; jung , j . ; lee , j . ; hyun , j . thermoresponsive pore structure of biopolymer microspheres for a smart drug carrier . langmuir 2010 , 26 , 11165 - 11169 . ( 2 ) na , k . ; lee , s . a . ; jung , s . h . ; hyun , j . ; shin , b . c . elastin - like polypeptide modified liposomes for enhancing cellular uptake into tumor cells . colloids surf ., b 2012 , 91 , 130 - 136 . ( 3 ) tong , y . c . ; yu , t . y . ; chang , s . f . ; liaw , j . nanopolymeric micelle effect on the transdermal permeability , the bioavailability and gene expression of plasmid . mol . pharmaceutics 2012 , 9 , 111 - 20 . ( 4 ) chen , c . c . ; liu , y . c . ; wu , c . h . ; yeh , c . c . ; su , m . t . ; wu , y . c . preparation of fluorescent silica nanotubes and their application in gene delivery . adv . mater . 2005 , 17 , 404 - 407 . ( 5 ) huang , x . ; teng , x . ; chen , d . ; tang , f . ; he , j . the effect of the shape of mesoporous silica nanoparticles on cellular uptake and cell function . biomaterials 2010 , 31 , 438 - 448 . ( 6 ) o &# 39 ; connell , m . j . ; boul , p . ; ericson , l . m . ; huffman , c . ; wang , y . ; haroz , e . ; kuper , c . ; tour , j . ; ausman , k . d . ; smalley , r . e . reversible water - solubilization of single - walled carbon nanotubes by polymer wrapping . chem . phys . lett . 2001 , 342 , 265 - 271 . ( 7 ) chin , s . f . ; baughman , r . h . ; dalton , a . b . ; dieckmann , g . r . ; draper , r . k . ; mikoryak , c . ; musselman , i . h . ; poenitzsch , v . z . ; xie , h . ; pantano , p . amphiphilic helical peptide enhances the uptake of single - walled carbon nanotubes by living cells . exp . biol . med . 2007 , 232 , 1236 - 1244 . ( 8 ) cui , d . ; tian , f . ; ozkan , c . s . ; wang , m . ; gao , h . effect of single wall carbon nanotubes on human hek293 cells . toxicol . lett . 2005 , 155 , 73 - 85 . ( 9 ) lam , c . w . ; james , j . t . ; mccluskey , r . ; hunter , r . l . pulmonary toxicity of single - wall carbon nanotubes in mice 7 and 90 days after intractracheal instillation . toxicol . sci . 2004 , 77 , 126 - 134 . 928 ( 10 ) porter , d . w . ; hubbs , a . f . ; mercer , r . r . ; wu , n . ; wolfarth , m . g . ; sriram , k . ; leonard , s . ; battelli , l . ; schwegler - berry , d . ; friend , s . ; andrew , m . ; chen , b . t . ; tsuruoka , s . ; endo , m . ; castranova , v . mouse pulmonary dose and time course responses induced by exposure to multi - walled carbon nanotubes . toxicology 2010 , 269 , 136 - 147 . ( 11 ) ji , z . ; zhang , d . ; li , l . ; shen , x . ; deng , x . ; dong , l . ; wu , m . ; liu , y . the hepatotoxicity of multi - walled carbon nanotubes in mice . nanotechnology 2009 , 20 , 445101 . ( 12 ) kam , n . w . s . ; jessop , t . c . ; wender , p . a . ; dai , h . nanotube molecular transporters : internalization of carbon nanotube - protein conjugates into mammalian cells . j . am . chem . soc . 2004 , 126 , 6850 - 6851 . ( 13 ) kang , b . ; chang , s . ; dai , y . ; yu , d . ; chen , d . cell response to carbon nanotubes : size - dependent intracellular uptake mechanism and subcellular fate . small 2010 , 6 , 2362 - 2366 . ( 14 ) champion , j . a . ; mitragotri , s . role of target geometry in phagocytosis . proc . natl . acad . sci . u . s . a . 2006 , 103 , 4930 - 4934 . ( 15 ) qiu , y . ; liu , y . ; wang , l . ; xu , l . ; bai , r . ; ji , y . ; wu , x . ; zhao , y . ; li , y . ; chen , c . surface chemistry and aspect ratio mediated cellular uptake of au nanorods . biomaterials 2010 , 31 , 7606 - 7619 . ( 16 ) bhirde , a . a . ; patel , s . ; sousa , a . a . ; patel , v . ; molinolo , a . a . ; ji , y . ; leapman , r . d . ; gutkind , j . s . ; rusling , j . f . distribution and clearance of peg - single - walled carbon nanotube cancer drug delivery vehicles in mice . nanomedicine 2010 , 5 , 1535 - 1546 . ( 17 ) liaw , j . ; chang , s . f . ; hsiao , f . c . in vivo gene delivery into ocular tissues by eye drops of poly ( ethylene oxide )- poly ( propylene oxide )- poly ( ethylene oxide ) ( peo - ppo - peo ) polymeric micelles . gene ther . 2001 , 8 , 999 - 1004 . ( 18 ) xiao , j . ; wei , x . ; wang , y . ; liu , c . fluorescence resonance energy - transfer affects the determination of the affinity between ligand and proteins obtained by fluorescence quenching method . spectrochim . acta a 2009 , 74 , 977 - 982 . ( 19 ) mishra , b . ; barik , a . ; priyadarsini , k . i . ; mohan , h . fluorescence spectroscopic studies on binding of a flavonoid antioxidant quercetin to serum albumins . j . chem . sci . 2005 , 117 , 641 - 647 .

1Performing Operations; Transporting

referring to fig1 the shock absorber 10 using a seal 12 according to the preferred embodiments of the present invention is shown . the shock absorber 10 comprises an elongated tubular pressure cylinder 14 defining a damping fluid containing working chamber 16 . disposed within the working chamber 16 is a reciprocable piston 18 that is secured to one end of an axially extending piston rod 20 . the upper portion of the piston rod 20 is laterally supported by an annular rod guide 21 which is disposed on the upper portion of the pressure cylinder 14 . upward movement of the piston 18 with respect to the piston rod 20 is limited by an annular spacer 24 which is disposed between the piston 18 and a radially extending step portion 26 of the piston rod 20 . downward movement of the piston 18 with respect to the piston rod 20 is limited by a threaded nut 28 or similar type fastening element which is threadably received upon the lower portion 30 of the piston rod 20 . a helical coil spring 32 is arranged concentrically of the nut 28 and is supported at the lower end thereof by a radially outwardly extending flange 34 on the lower end of the nut 28 . the upper end of the spring 32 bears against a spring retainer 36 which in turn acts against the underside of the lower valve disks 38 to thereby resiliently urge the valve disk 38 into sealing engagement with valve seats 40 in the piston housing 42 . in addition , a plurality of upper valve disks 43 are provided between the piston housing 42 and the annular spacer 24 . the upper valve disks 43 and the lower valve disks 38 are used to control the flow of damping fluid through a plurality of flow passages 44 . a further explanation of the construction and operation of the piston 18 is disclosed in u . s . pat . no . 4 , 113 , 072 , which is hereby incorporated by reference . those skilled in the art will appreciate that , upon reciprocal movement of the piston 18 , damping fluid within the working chamber 16 is transferred between the upper and lower portions of the working chamber 16 , and between the working chamber 16 and the fluid reservoir 22 . by controlling the flow of damping fluid between the upper and lower portion of the working chamber 16 , the shock absorber 10 is able to controllably dampen relative movement between the body and the suspension of the automobile to which it is attached so as to optimize both ride and comfort and road handling ability . a base valve , generally designated by the numeral 45 , is located within the lower end of the working chamber 16 and is used to control the flow of damping fluid between the working chamber 16 and an annular fluid reservoir 46 . the annular fluid reservoir 46 is defined as the space between the outer periphery of the cylinder 14 and the inner periphery of a reservoir tube or cylinder 48 which is arranged centrally around the exterior of the pressure cylinder 14 . the construction and operation of the base valve 45 may be of the type shown and described in u . s . pat . no . 3 , 771 , 626 , which is hereby incorporated by reference . the upper and lower ends of the shock absorber 10 are provided with generally cup - shaped upper and lower end caps 50 and 52 respectively . the end caps 50 and 52 are secured to opposing ends of the reservoir tube 48 by a suitable means such as welding . accordingly , the housing for the shock absorber 10 comprises the end caps 50 and 52 as well as the reservoir tube 48 . the shock absorber 10 is shown as being provided with a dirt shield 54 which is secured at its upper end to the upper end of the piston rod 20 . suitable end fittings 56 are secured to the upper end of the piston rod 20 and the lower end cap 52 for operatively securing the shock absorber 10 between the body and the axle assembly of the automobile . the annular seal 12 is disposed between the piston rod 20 and the end cap 50 . the upper surface of the annular seal 12 is separated from the end cap 50 by an annular anti - extrusion ring 58 . the anti - extrusion ring 58 is able to prevent the seal 12 from extruding between the space separating the piston rod 20 and the end cap 50 . further , downward movement of the seal 12 is prevented by an annular retainer seal 60 which is upwardly biased by an oil seal spring 62 which is disposed on the upper surface of the rod guide 21 . as shown in fig2 the seal 12 comprises first and second surfaces 64 and 66 . the first surface 64 is disposed adjacent to the end cap 50 and is operable to prevent the flow of damping fluid between the end cap 50 and the first surface 64 of the seal 12 . the second surface of the seal 12 is disposed adjacent to the piston rod 20 and is operable to prevent the flow of damping fluid between the piston rod 20 and the second surface 66 of the seal 12 . the seal 12 further comprises an upper annular indented region 68 and a lower annular indented region 70 . the upper annular indented region 68 is used to receive the anti - extrusion ring 58 so as to prevent upward movement of the seal 12 during operation . the lower annular indented region 70 is used to receive the retainer seal 60 to prevent downward movement of the seal 12 . while the seal 12 may be made from low nitrile buna - n , other suitable materials may be used . the seal 12 further comprises a plurality of annular lips 72 - 78 separated by a plurality of annular recesses 80 - 84 . the annular lip 72 is disposed closest to the damping fluid in the working chamber 16 and is separated from the annular lip 74 by the annular recess 80 . similarly , the annular lip 74 is located closer to the damping fluid in the working chamber 16 than the annular lip 76 , and is separated from the annular lip 76 by the annular recess 82 . in addition , the annular lip 76 is located closer to the damping fluid in the working chamber 16 than the annular lip 78 , and is separated from the annular lip 78 by the annular recess 84 . the annular lips 72 and 78 serve not only to limit the flow of damping fluid leaking from the shock absorber 10 , but also act as dirt barriers to prevent dirt from the environment from entering the working chamber 16 of the shock absorber 10 . to provide means for lubricating the seal 12 , a plurality of grooves 86 are provided . the grooves 86 extend axially with respect to the piston rod 20 , and are disposed on the annular lip 72 adjacent to the piston rod 20 . the grooves 86 are radially displaced by approximately 90 °, though it is to be understood that other suitable radial distances may be used . the cross - section of the grooves 86 are semicircular in shape , and have a radius selected to maximize the amount of damping fluid which is stored in the annular recess 80 by means of capillary action in the manner described below . while the optimum radius of the grooves 86 are selected empirically , an approximation of the radius can be obtained using the following formula : ## equ1 ## where : r is the radius of the grooves ; in the seal shown in fig4 the radius of the grooves may typically be 0 . 005 - 0 . 008 inches . by placing the grooves 86 in the annular lip 72 of the seal 12 , damping fluid drawn upward along the surface of the piston rod 20 into the annular recess 80 through the grooves 86 during movement of the piston rod 20 is held in the annular recess 80 by capillary action . because the grooves 86 permit damping fluid entering the annular recess 80 to be retained by capillary action within the annular recess 80 after movement of the piston rod ceases , the annular lips 72 - 78 become lubricated with a relatively small movement of the piston rod 20 after movement of the piston rod 20 begins . this is in contrast with seals which do not have the grooves 86 according to the present invention , in which damping fluid was delivered to the annular lips 72 - 78 only after the automobile to which the shock absorber 10 was attached encountered a sufficiently rough surface so that the portion of the piston rod 20 disposed within the damping of the working chamber 16 passed over the seal . a representative comparison of the resulting force required to move the piston rod 20 with and without the lubrication provided by the grooves 86 is shown in fig5 . the solid line 88 represents the force which is associated with moving the piston rod 20 when the annular lip 72 has four grooves disposed according to the preferred embodiment of the present invention . in contrast , the dotted line 90 represents the force associated with moving the piston rod 20 when there is an absence of grooves on the annular lip 72 . as shown , movement of the piston rod 20 using a seal according to the preferred embodiment of the present invention requires somewhat less than ten pounds before movement of the piston rod 20 is permitted . this is in contrast to the seals which do not have the grooves according to the preferred embodiment of the present invention , in which movement of the piston rod is achieved only after a force of 40 pounds was applied to the piston rod . it will be appreciated , however , that the absolute force required to move the piston rod 20 with and without the grooves 86 is dependent upon a number f factors . while it will be apparent that the preferred embodiment illustrated above is well calculated objects , it will be appreciated that the present invention is susceptible to modification , variation and change without departing from the scope of the invention . for example , second and third preferred embodiments of the present invention are shown in fig6 and 7 , where the elements 112 , 164 , 166 , 172 - 186 of fig6 correspond to the elements 12 , 64 , 66 , 72 - 86 of fig2 and the elements 212 , 264 , 266 , 272 - 276 , 280 , 282 and 286 of fig7 correspond to the elements 12 , 64 , 66 , 72 - 76 , 280 , 282 and 286 of fig2 . while the present invention was described in conjunction with a shock absorber , it also may be used with struts or other suitable damping devices . further , the seal may be used in different applications , and may have either a greater or fewer number of grooves . in addition , the shape of the grooves may be different and a larger or smaller number of annular lips may be used . accordingly , the scope of the invention is to be measured against the scope of the following claims .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

with reference to fig2 the hydraulic pump with permanent - magnet motor m having a preset direction of rotation , generally designated by the reference numeral 10 , comprises a bipolar permanent - magnet rotor which is operatively connected to an impeller 11 with curved vanes 14 , which is arranged inside a volute 12 . the particularity of the invention is constituted by the fact that the volute 12 is almost symmetrical with respect to an imaginary line which connects the discharge port 13 to a rotation axis 15 of the impeller . by virtue of the prevailing symmetry of the volute of the impeller , if the impeller were to rotate with its vanes swept forward , the fluid , i . e ., the water to be pumped , would be subjected to a higher acceleration and most of the energy would be transferred to the fluid in the form of kinetic energy . during rotation with the vanes swept forward , for a same impeller with a similarly orientated volute , the negative torque is greater than when the impeller turns with its vanes swept backward and is in any case greater than the torque that can be delivered by the motor . the total load to be turned , which corresponds to the inertial load of the rotor of the impeller plus the dynamic load due to the energy transferred to the fluid , would be very high and therefore the motor would be unable to start ; accordingly , in the subsequent cycle rotation reversal would occur , producing rotation with the vanes swept backward , thus obtaining unidirectionality without having to apply electronic controls or mechanical antireversing protrusions . it has been observed experimentally that the trailing - edge angle a , i . e ., the angle formed between the direction of an imaginary continuation of the vane and the tangent to the imaginary circle that circumscribes said vane , is preferably less than 30 °. the lower hydraulic load that occurs during rotation with the vanes swept backward allows to turn impellers which have a larger diameter than radial - vane configurations , achieving higher performance and better efficiency . this type of effect becomes significant for vanes with trailing - edge angles α of less than 30 °. it should be observed that if the pump is started in air , it might turn in any direction , since it is not contrasted by the fluid , whereas if the same pump is immersed in the fluid for which it is designed the motor will be unable to deliver the required torque for rotation with the vanes swept forward and will automatically reverse its motion , restoring the design conditions . it is noted that the particular shape of the volute is extremely important , since if one uses the classic archimedean - spiral volute , as described above for fig1 the pump is still be able to pick up in reverse , reducing its flow - rate considerably but having a negative torque which is equivalent to rotation in the opposite direction with a higher flow - rate . from the above description it is thus evident that the present invention achieves the intended aim and objects , and that the particular refinements used , i . e ., the presence of curved vanes in a volute which has a predominantly symmetrical shape , allows to obtain considerably high hydraulic efficiencies in addition to providing unidirectionality . the invention thus conceived is susceptible of numerous modifications and variations , all of which are within the scope of the inventive concept . all the details may further be replaced with other technically equivalent elements . in practice , the materials employed , as well as the dimensions and the contingent shapes , may be any according to requirements . the disclosures in italian patent application no . mi2000a000763 from which this application claims priority are incorporated herein by reference .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

it has been found that aqueous pharmaceutical vehicles containing a film forming polymer and an ionic polysaccharide can be gelled and rendered resistant to shear thinning by contacting the mixture with a counter - ion . the gel compositions can be made isotonic or iso - osmotic and adjusted to the ph of mammalian body fluids , such as lacrimal tears . the ph and osmotic pressure of such bodily fluids are 7 . 4 and 290 mosm / kg , respectively . it is advantageous to deliver a pharmacologically active medicament to an area of the mammalian body requiring pharmacological treatment under desired ph and osmotic pressure conditions which , for instance , match those of bodily fluids . optionally , the pharmaceutical compositions of the invention can be provided in a sterile condition . a complete listing of useful water soluble , film forming polymers is not possible . representative useful polymers are the water soluble alkyl celluloses , i . e ., methyl and ethyl cellulose ; the hydroxyalkyl celluloses , i . e ., hydroxypropylemethyl cellulose and hydroxyethyl cellulose ; hyaluronic acid and water soluble salts thereof , i . e ., sodium hyaluronate ; chondroitin sulfate and water soluble salts thereof i . e ., sodium chondroitin sulfate ; polymers of acrylamide , acrylic acid , and polycyanoacrylates ; polymers of methyl methacrylate and 2 - hydroxyethyl methacrylate ; polydextrose , cyclodextrin ; polydextrin ; maltodextrin , dextran ; polydextrose ; gelatin , collagen , natural gums , i . e ., xanthan , locust bean , acacia , tragacanth , carrageenan , and agar ; derivatives of polygalacturonic acid such as pectin ; polyvinyl alcohol ; polyvinyl pyrrolidone ; polyethylene glycol ; and polyethylene oxide . a preferred film forming agent is carboxymethyl ullulose and its sodium salt . more complete descriptions of some of the preferred water soluble , film forming polymers are as follows . cyclodextrin also known as cycloamylose is a cyclic oligosaccharide . cyclodextrins are produced by the enzyme conversion of prehydrolized starch to a mixture of alpha , beta , and gamma cyclodextrins and some linear dextrins . the cyclodextrins are composed of glucose units linked together by alpha ( 1 - 4 ) glycosidic bonds . sodium hyaluronate also known as hyaluronic acid is composed of repeating units of sodium glucuronate and n - acetylglucosamine . sodium hyaluronate was originally extracted from the comb of the rooster . hyaluronic acid is a common biological agent present in a number of sources including the human umbilical cord . sodium hyaluronate can also be manufactured by fermentation of a strain of streptococcus zooepidemicus . polydextrose is a randomly bonded condensation polymer of dextrose which is only partially metabolized by mammals . the polymer can contain a minor amount of bound sorbitol , citric acid , and glucose . chondroitin sulfate also known as sodium chondroitin sulfate is a mucopolysaccharide found in every part of human tissue , specifically cartilage , bones , tendons , ligaments , and vascular walls . this polysaccharide has been extracted and purified from the cartilage of sharks . carrageenan is a linear polysaccharide having repeating galactose units and 3 , 6 anhydrogalactose units , both of which can be sulfated or nonsulfated , joined by alternating 1 - 3 and beta 1 - 4 glycosidic linkages . carrageenan is a hydrocolloid which is heat extracted from several species of red seaweed and irish moss . maltodextrins are water soluble glucose polymers which are formed by the reaction of starch with an acid and / or enzymes in the presence of water . further details of the composition and derivation of other useful water soluble , film forming polymers can be found in the handbook of pharmaceutical excipients , published by the american pharmaceutical association washington , d . c . copyright 1986 , incorporated herein by reference . the gel forming ionic polysaccharides found useful in the represent invention are hydrophilic colloidal materials and include the natural gums such as gellan gum , alginate gums , i . e ., the ammonium and alkali metal salts of alginic acid and mixtures thereof . in addition , chitosan , which is the common name for deacetylated chitin is useful . chitin is a natural product comprising poly -( n - acetyl - d - glucosamine ). gellan gum is produced from the fermentation of pseudomonas elodea to yield an extracellular heteropolysaccharide . the alginates and chitosan are available as dry powders from protan , inc ., commack , n . y . gellan gum is available from the kelco division of merck & amp ; co ., inc ., san diego , calif . generally , the alginates can be any of the water - soluble alginates including the alkali metal alginates , such as sodium , potassium , lithium , rubidium and cesium salts of alginic acid , as well as the ammonium salt , and the soluble alginates of an organic base such as mono -, di -, or tri - ethanolamine alginates , aniline alginates , and the like . generally , about 0 . 2 % to about 1 % by weight and , preferably , about 0 . 5 % to about 3 . 0 % by weight of gellan , alginate or chitosan ionic polysaccharides , based upon the total weight of the composition , are used to obtain the gel compositions of the invention . in general , the drug delivery composition of the invention will contain about 0 . 01 % to about 60 % by weight of medicament or pharmaceutical , about 1 % to about 50 % by weight of the water soluble , film forming polymer , together with the above amounts of ionic polysaccharide and the balance water . in special situations , these amounts of gel forming ionic polysaccharide and water soluble , film forming polymer may be varied to increase or decrease the gel properties . many polysaccharides may be used with the present invention to enhance the physical properties of the gel . for example , carboxymethylcellulose may reduce the rate of erosion of the polymer when compared to the polymer without the carboxymethylcellulose . in this regard , the carboxymethylcellulose competes with the polymer for the association of the water molecule , therefore , enhancing the stability of the gel to remain intact when in an aqueous environment . when polysaccharides are utilized to enhance the physical properties of the gel , cross - linking of the polysaccharide is not necessary . polysaccharides that have not been crosslinked , and can be used to enhance the physical properties of the gel , include hydroxyalkyl cellulose and methylcellulose . more specifically , the useful polysaccharides are natural cellulose , hyaluronic acid and water soluble salts thereof , i . e . sodium hyaluronate , chondroitin sulfate and water soluble salts thereof , i . e . sodium chondroitin sulfate ; polydextrose , cyclodextrin , polydextrin , maltodextrin , dextran ; polydextrose ; gelatin , collagen , natural gums , i . e . xanthan , locust bean , acacia , tragacanth , carrageenan , and agar , and derivatives of polygalacturonic acid such as pectin . a preferred polysaccharide is carboxymethylcellulose . the drug delivery composition of the invention will contain about a 0 . 1 % to about 25 % by weight of the non - crosslinked polysaccharide to enhance the physical properties of the gel . if an irreversible gel is required or an elastic gel , that is , one that retains its shape , cross - linking is required . cross - linking is the physical , co - valent or ionic bonding of two or more molecules of the same polymer . any cross linking agent having more than one functional group wherein the function group is either chemical or ionic may be utilized to cross link the polysaccharides described above . as known in the art , cross linking can ococur between molecules of similar polymers by physical reaction as long as appropriate functional groups are present on the polymers . useful counter - ions for gelling the gellan gum or alginate ionic polysaccharides in combination with the film forming , water soluble polymer compositions of the invention are cationic gelling agents , preferably , comprising a divalent or trivalent cation . useful divalent cations include the alkaline earth metals , preferably , selected from the group consisting of calcium and strontium . useful trivalent cations include aluminum . the most preferred counter - ions for gelling gellan gum or alginate ionic polysaccharides are contained in ionic compounds selected from pharmaceutically - acceptable gluconates , flourides , citrates , phosphates , tartrates , sulfates , acetates , borates , chlorides , and the like having alkaline earth metal cations such as calcium and strontium . especially preferred counter - ion containing inorganic salts for use as ionic polysaccharide gelling agents include such inorganic salts as the chloride salts , such as strontium chloride , calcium chloride , and mixtures thereof . generally , a molar ratio of counter - ion to gellan , 5 chitosan or alginate of about 1 : 1 to about 10 : 1 , preferably , about 2 : 1 to about 5 : 1 , and , most preferably , about 3 : 1 to about 5 : 1 is used . while the counter - ion , such as calcium or other counter - ions may be obtained by contact of the compositions of the invention with bodily fluids , it is preferred that a counter - ion in latent form be used in combination with the gellan gum or alginate ionic polysaccharide and film forming , water soluble polymer compositions of the invention . alternatively , a counter - ion can be combined with the ionic polysaccharide and water soluble , film forming polymer compositions of the invention utilizing a two part system in which the counter - ion is topically or otherwise applied to the compositions of the invention subsequent to their topical or other application . incorporation of the counter - ion in a latent form together with the ionic polysaccharide and film forming , water soluble polymer compositions of the invention may be accomplished by either encapsulating an aqueous solution of one of the counter - ion gelling agents , previously described above or by the incorporation of the counter - ion gelling agent into a matrix which provides for the controlled , slow - release of gelatin - encapsulated controlled release compositions disclosed in u . s . pat . no . 4 , 795 , 642 , incorporated herein by reference , disclose the preparation of a gelatin shell encapsulating a controlled release formulation in which the gelatin composition includes calcium chloride as the gelling agent . alternatively , the counter - ion can be the incorporated as an aqueous solution of a cationic gelling agent encapsulated in a vesical composed , for instance , of alpha - tocopherol , as disclosed in u . s . pat . no . 4 , 861 , 580 , incorporated herein by reference . generally , aqueous compositions comprising chitosan can be gelled with multivalent anion gelling agents , preferably , comprising a metal polyphosphate , such as an alkali metal or ammonium polyphosphates , pyrophosphates , or metaphosphates . representative metaphosphate , pyrophosphate , and polyphosphate gelling agents include sodium and potassium , polyphosphates , sodium and potassium pyrophosphates , sodium and potassium metaphosphates , and sodium and ammonium ( mono -, di -, tri -) phosphates . with specific reference to the use of the compositions of the invention as ophthalmic drug delivery compositions , laser ablatable shields , or corneal protective compositions , it is noted that , generally , for the avoidance of adverse physiological effects to the eye , it is desirable that the ph and osmolality of the pharmaceutical vehicle be matched to the ph and osmolality of the eye . in addition , it is noted that a large percentage of drugs administered to the eye are lost as a result of lacrimal drainage . this applies especially in situations in which a liquid composition containing a pharmacologically active medicament is applied to the cornea of the eye . accordingly , in such cases , only a small fraction of the pharmaceutical composition administered to the eye remains in contact with the cornea for a few minutes and an even smaller fraction penetrates into the cornea . to overcome these disadvantages , it is known to use viscous solutions , gels , ointments , or solid eye implants containing pharmacologically active medicaments . while progress has been made in the delivery of drugs by the use of solid implants , many patients find it difficult to tolerate the introduction of the implants into the conjunctival areas . to solve this problem , drug delivery vehicles which are liquid at room temperature and assume a semi - solid form at human body temperature have been proposed , such as those described in u . s . pat . no . 4 , 188 , 373 , which disclose the use of pluronic ® polyols . in u . s . pat . no . 4 , 861 , 760 and u . s . pat . no . 4 , 474 , 751 , ophthalmic drug delivery systems are disclosed which show liquid - gel phase transitions . in the &# 39 ; 751 patent , polymers are disclosed which are tetra substituted derivatives of ethylenediamine , propylenediamine , butylenediamine , pentylenediamine , or hexylenediamine . these are described as block copolymers of poly ( oxypropylene ) and poly ( oxyethylene ) of various chain lengths . these polymers were utilized as aqueous drug delivery vehicles contain from 10 % to 50 % by weight of polymer based on the weight of the total drug delivery vehicle . in the &# 39 ; 760 patent , the liquid - gel phase transition compositions for ophthalmological use contain polymers which form gels at concentrations 10 - 100 fold lower than those used in systems such as the &# 39 ; 751 patent , involving thermogelation . accordingly , the drug delivery vehicles of the &# 39 ; 760 patent are said to be very well tolerated by the eye . the polymers utilized in the drug delivery vehicles of the &# 39 ; 760 patent are described as polysaccharides obtained by fermentation of a microorganism . the drug delivery vehicles and corneal protective shield compositions of the invention are an improvement over those compositions used in prior art methods of ophthalmological drug delivery in that the compositions can be not only optimized for physiological tolerance in the eye by formulating the vehicles useful as drug delivery compositions so as to have isoosmotic , hyperosmotic , and hypoosmotic characteristics in the gel state but are made more useful because of increased resistance to shear thinning , as the result of higher gel strength . these advantages are obtained by the incorporation of an ionic polysaccharide in admixture with a film forming , water soluble polymer . by matching the osmolality of the drug delivery compositions of the invention , for instance , to those of the lacrimal fluid of the eye , it is possible to eliminate burning or other discomfort upon application of the drug delivery vehicles of the invention to the eye . the gel compositions formed upon contact with a counter ion for the ionic polysaccharide allow retention of the gel at the desired locus for longer intervals thus increasing the efficiency of action of the delivered drug . drugs or diagnostic agents which can be administered by means of the drug delivery vehicles according to the invention are , for example : antibacterial substances such as beta - lactam antibiotics , such as cefoxitin , n - formamidoylthienamycin and other thienamycin derivatives , tetracyclines , chloramphenicol , neomycin , carbenicillin , colistin , penicillin g , polymyxin b , vancomycin , cefazolin , cephaloridine , chibrorifamycin , gramicidin , bacitracin and sulfonamides ; nalidixic acid and its analogs such as norfloxacin and the antimicrobial combination fluoroalanine / pentizidone , nitrofurazones and analogs thereof ; antihistaminics and decongestants such as pyrilamine , chlorpheniramine , tetrahydrazoline , antazoline and analogs thereof ; mast - cell inhibitors of histamine release , such as cromolyn ; anti - inflammatories such as cortisone , hydrocortisone , hydrocortisone acetate , betamethasone , dexamethasone , dexamethasone sodium phosphate , prednisone , methylprednisolone , medrysone , fluorometholone , prednisolone , prednisolone sodium phosphate , triamcinolone , indainethacin , sulindac , its salts and its corresponding sulfides , and analogs thereof ; miotics and anticholinergics such as echothiophate , pilocarpine , physostigmine salicylate , diisopropylfluorophosphate , epinephrine , dipivaloylepinephrine , neostigmine echothiopate iodide , demecarim bromide , carbamoyl choline chloride , methacholine , bethanechol , and analogs thereof ; mydriatics such as atrophine , homatropine , scopolamine , hydroxyamphetamine , ephedrine , cocaine , tropicamide , phenylephrine , cyclopentolate , oxyphenonium , eucatropine , and analogs thereof ; other drugs can be used in the treatment of conditions and lesions of the eyes such as : antiglaucama drugs , for example , timalol , and especially its maleic salt and r - timolol and a combination of timolol or r - timolol with pilocarpine , as well as many other adrenergic agonists and / or antagonists : epinephrine and an epinephrine complex , or prodrugs such as bitartrate , borate , hydrochloride and dipivefrine derivatives ; carbonic anhydrase inhibitors such as acetazolamide , dichlorphenamide , 2 -( p - hydroxyphenyl ) - thiothiophenesulfonamide , 6 - hydroxy - 2 - benzothiazolesulfonamide , and 6 - pivaloyloxy - 2 - benzothiazolesulfonamide ; antiparasitic compounds and / or anti - protozoal compounds such as ivermectin , pyrimethamine , trisulfapidimidine , clindamycin and corticosteroid preparations ; compounds having antiviral activity such as acyclovir , 5 - iodo - 2 &# 39 ;- deoxyuridine ( idu ), adenosine arabinoside ( ara - a ), trifluorothymidine , interferon , and interferon - inducing agents such as poly i : c ; antifungal agents such as amphotericin b , nystatin , flucytosine , natamycin and miconazole ; anesthetic agents such as etidocaine cocaine , benoxinate , dibucaine hydrochloride , dyclonine hydrochloride , naepaine , phenacaine hydrochloride , piperocaine , proparacaine hydrochloride , tetracaine hydrochloride , hexylcaine , bupivacaine , lidocaine , mepivacaine and prilocaine ; ( a ) those used to examine the retina such as sodium fluorescein ; ( b ) those used to examine the conjunctiva , cornea and lacrimal apparatus , such as fluorescein and rose bengal ; and ( c ) those used to examine abnormal pupillary responses such as methacholine , cocaine , adrenaline , atropine , hydroxyamphetamine and pilocarpine ; ophthalmic agents used as adjuncts in surgery , such as alpha - chymotrypsin and hyaluronidase ; immunosuppressants and anti - metabolites such as methotrexate , cyclophosphamide , 6 - mercaptopurine and azathioprine and combinations of the compounds mentioned above , such as antibiotics / antiinflammatories combinations such as the combination of neomycin sulfate and dexamethasone sodium phosphate and combinations concomitantly used for treating glaucoma , for example , a combination of timolol maleate and aceclidine . in general the drug delivery composition of the present invention will contain from about 0 . 01 % to about 60 % by weight of the medicament or pharmaceutical , from about 1 % to about 50 % of the polymer , the above amounts of ionic polysaccharide , and the balance water . in special situations , however , the amounts may be varied to increase or decrease the dosage schedule . if desired , the ophthalmic drug delivery vehicle , laser ablatable corneal mask , and corneal protective compositions of the invention may also contain preservatives , cosolvents , suspending agents , viscosity enhancing agents , ionic - strength and osmolality adjustors and other excipients in addition to the medicament and buffering agents . suitable water soluble preservatives which may be employed in the inventive drug delivery vehicle are sodium bisulfite , sodium thiosulfate , is ascorbate , benzalkonilirn chloride , chlorabutanol , thimerosal , phenylmercuricborate , parabens , enzylalcohol phenylethanol and others . these agents may be present , generally , in amounts of about 0 . 001 % to about 5 % by weight and , preferably , in the amount of about 0 . 01 to about 2 % by weight . suitable water soluble buffering agents are alkali or alkali earth carbonates , phosphates , bicarbonates , citrates , borates , acetates , succinates and the like , such as sodium phosphate , citrate , borate , acetate , bicarbonate , carbonate and tromethamine ( tris ). these agents are present in amounts sufficient to maintain the ph of the system at 7 . 4 ± 0 . 2 and preferably , 7 . 4 . as such the buffering agent can be as much as 5 % on a weight basis of the total composition . representative buffering agents or salts useful in maintaining the ph at about 7 . 4 ± 0 . 2 are alkali or alkali earth carbonates , chlorides , sulfates , phosphates , bicarbonates , citrates , borates , acetates and succinates . representative preservatives are sodium bisulfite , sodium thiosulfate , ascorbate , benzalkonium chloride , chlorobutanol , thimerosal , phenylmercuric borate , parabens , benzylalcohol and phenylethanol . the corneal mask compositions of the invention are an improvement over the prior art thermo - reversible gels containing a polyoxyalkylene polymer as the sole polymer , in that the compositions of the invention provide greater gel strength because they are more resistant to shear thinning and are characterized as thermally - irreversible . these advantages are obtained by the incorporation of an ionic polysaccharide in admixture with a water soluble , film forming polymer . they can be optimized for optimum physiological tolerance in the eye by formulating the compositions so as to have a neutral ph and isotonic characteristics . these former advantages are obtained by the incorporation of an ionic polysaccharide in admixture with a water soluble , film forming polymer . by matching the osmolality and ph of the laser ablatable corneal mask compositions of the invention to those of the lacrimal fluid of the eye , it is possible to eliminate burning or other discomfort upon application of the corneal mask of the invention to the eye . the higher gel strength compositions upon contact with a counter - ion allow retention of the gel as an in situ formed corneal mask for long intervals . the preparation of the drug delivery compositions , corneal protective compositions , and ablative corneal shield compositions of the invention is described below . the examples which follow were prepared , generally , in accordance with the following preparation procedure . a mixture of a water soluble , film forming polymer and ionic polysaccharide is stirred or shaken in admixture with the aqueous buffer solution to bring about a more rapid solution of the polymer . the pharmacologically active medicaments and various additives such as salts and preservatives can subsequently be added and dissolved . in some instances the pharmacologically active substance must be suspended since it is insoluble in water . the ph of 7 . 4 1 0 . 2 is obtained by of appropriate buffering agents . the following examples illustrate the various aspects of the invention but are not intended to limit its scope . where not otherwise specified throughout this specification and claims , temperatures are given in degrees centigrade and parts , percentages , and proportions are by weight . in this example there is described a composition of the invention suitable for ophthalmic use as a laser ablatable corneal mask or protective corneal shield . the is composition was characterized as iso - osmotic and neutral i n ph . an aqueous solution was made by dissolving the hydroxypropyl methyl cellulose in aqueous buffer solution together with the sodium alginate . the hydroxypropyl methyl cellulose was characterized as grade f50lv premium , obtained from the dow chemical company . the sodium alginate , characterized as high viscosity grade hf 120 was obtained from protan , inc . the proportions of ingredients in percent by weight are as follows : ______________________________________hydroxypropyl methyl cellulose 2 . 0sodium alginate , high viscosity 1 . 0glycerin 0 . 25boric acid - sodium borate buffer 96 . 75______________________________________ the boric acid - sodium borate buffer was prepared as follows : in a two liter volumetric flask , 24 . 7 grams of boric acid and 3 . 8 grams of sodium borate decahydrate were dissolved in two liters of purified water , usp . the formulation of this example had a measured ph of 7 . 2 and an osmolality of 277 mosm / kg . a small amount of the formulation was placed on a glass slide and evenly spread 5 so as to create a thin film . the film was subsequently sprayed with an aqueous solution of calcium chloride having a concentration of 21 to about 5 % by weight . the film was characterized as strong , transparent , and resembled a thin , soft hydrophilic corneal contact lens which would be useful as a protective corneal mask or as an ablatable mask useful in laser keratectomy . the product was further characterized by measuring the average penetration in millimeters determined using a precision penetrometer with a 1 / 4 size ( 9 . 38 grams , astm d - 1043 ) cone and plunger . the penetration of the aqueous solution of polymers prepared above was greater than 20 mm . subsequent to treatment of this solution with a few drops of a 2 %- 5 % by weight aqueous solution of calcium chloride , a gel was formed in which the penetration was reduced to 5 mm . in these examples there are described compositions of the invention for ophthalmic use as a corneal protective mask or as a laser ablatable corneal mask . utilizing the same procedure as described in example 1 , an aqueous composition containing sodium hyaluronate and sodium alginate was prepared in two separate compositions . sodium hyaluronate is commercially available from meiji seika inc . example 2 was hypoosmotic having an osmotic pressure of 249 mosm / kg and example 3 was hyperosmotic having an osmotic pressure of 319 mosm / kg . both compositions were characterized as neutral in ph . the formulations have the following proportions by weight : ______________________________________ example 2 example 3______________________________________sodium hyaluronate 1 . 0 1 . 0sodium alginate , high viscosity 1 . 0 1 . 0glycerin . 0 . 5boric acid - sodium borate buffer 98 . 0 97 . 5______________________________________ these compositions were evaluated as described in example 1 by spreading a small amount of the formulation on a glass slide and subsequently spraying the coated slide with a 5 % by weight aqueous solution of calcium chloride . similar strong , transparent , soft films were obtained which would be useful as a protective corneal shield or as a laser ablatable corneal mask . example 3 was further characterized by measuring the average penetration in millimeters determined using a precision penetrometer with a 1 / 4 size ( 9 - 38 grams , astm d - 1043 ) cone and plunger . the penetration of the aqueous solution of polymers prepared above was greater than 20 mm . subsequent to treatment of this solution with a few drops of a 2 %- 5 % by weight aqueous solution of calcium chloride , a gel was formed in which the penetration was reduced to 5 . 9 mm . in this example there is described a composition of the invention for ophthalmic use as a protective corneal shield or a laser ablatable corneal mask . an aqueous mixture comprising polyvinyl pyrrolidone and sodium alginate , high viscosity was prepared as follows : the percentages below are by weight . ______________________________________polyvinyl pyrrolidone 0 . 8sodium alginate , high viscosity 1 . 0glycerin 0 . 3boric acid - sodium borate buffer 97 . 9______________________________________ the composition was characterized as neutral in ph having a ph of 7 . 2 . the composition was hypoosmotic having an osmolality of 270 mosm / kg . the product was further characterized by measuring the average penetration in millimeters determined using a precision penetrometer with a 1 / 4 size ( 9 . 38 grams , astm d - 1043 ) cone and plunger . the penetration of the aqueous solution of polymers prepared above was greater than 20 mm . subsequent to treatment of this solution with a few drops of a 5 % by weight aqueous solution of calcium chloride , a gel was formed in which the penetration was reduced to 4 . 1 mm . in this example there is described a composition of the invention for ophthalmic use as a laser ablatable mask or as a protective corneal shield . in accordance with the procedure of example 1 , chondroitin sulfate and sodium alginate were prepared as an aqueous solution utilizing the percentages by weight indicated below . ______________________________________sodium chondroitin sulfate 2 . 0sodium alginate , high viscosity 1 . 0glycerin 0 . 3boric acid - sodium borate buffer 96 . 7______________________________________ the aqueous solution was characterized as neutral in ph having a ph of 7 . 0 . the aqueous solution was hyperosmotic having a measured osmolality of 354 mosm / kg . the penetration utilizing a precision penetrometer with a 1 / 4 size cone , as described above , was greater than 20 mm prior to treatment with a few drops of a 2 %- 5 % aqueous solution of calcium chloride . subsequent to treatment with the aqueous calcium chloride solution , a gel was formed in which the penetration was reduced to 5 . 1 mm . ion exchange resin beads sold under the trade name duolite were treated so as to incorporate calcium by first treating a 30 gram sample of the ion exchange resin with a solution of 0 . 1 molar hydrochloric acid so as to allow for the exchange of protons for sodium . after three washings with 0 . 1 molar hydrochloric acid , the beads were washed with water and then washed twice with a 2 % aqueous solution of calcium chloride . each of the washing steps took place over a period of 16 hours ( overnight ). the beads were thereafter filtered and washed with water utilizing coarse filter paper and a buchner glass filter assembly . the beads were then left overnight in a desiccator to dry . the dried beads of ion exchange resin which were obtained are utilized in the amount of 2 grams to fill a first compartment ( close to the needle of the syringe ) of a glass syringe utilized to apply liquids and dry materials . the syringe is sold under the tradename hypak . into the second compartment of the syringe , there is placed successively the solutions of examples 1 - 5 . pushing the plunger of the syringe forward results in mixing the solution of examples 1 - 5 with the ion exchange beads . after 5 to 10 minutes subsequent to mixing , the mixture is expelled from the syringe . after an additional 15 minutes the expelled material forms ( without drying ) a strong , transparent gel on the substrate on which it is expelled . these examples describe the successive application of an aqueous solution of examples 1 and 3 - 5 to the cornea of a rabbit eye and the conversion of the aqueous liquid to a gel by the application of a 10 % calcium chloride solution having a ph of 6 . 9 . the calcium chloride solution is applied to the concave surface of a contact lens prior to contacting the surface of the aqueous liquid coating applied upon the cornea of the rabbit eye . after applying the compositions of examples 1 and 3 - 5 to the cornea of a rabbit while placed under general anesthesia , a liquid coating is formed upon the cornea . subsequently , a 10 % aqueous solution of calcium chloride is applied to the concave surface of a hard contact lens and the contact lens is placed over the coating on the cornea of the rabbit eye . the time required for the formation of a gel is less than 5 minutes . thereafter , the contact lens is removed to expose a perfectly smooth and optically clear gelled surface of the composition of examples i and 3 - 5 . excimer laser keratectomy is thereafter performed utilizing an argon fluoride excimer laser ( 193 nm ). further details of the excimer laser keratectomey process can be found in archives of ophthalmology , vol . 106 , feb ., 1988 , entitled &# 34 ; excimer laser keratectomy with a rotating - slit delivery system &# 34 ;, hanna et al , incorporated herein by reference . these examples describe drug compositions of the invention suitable for ophthalmic use in comparison with control examples in in - vitro tests for drug release . ______________________________________ percentage by weight______________________________________timolol maleate 0 . 50poloxamer 407 16 . 00sodium phosphate , monobasic , monohydrate 0 . 15sodium phosphate , dibasic 0 . 63glycerin 0 . 75sterile water 81 . 97______________________________________ an eye drop or medicated contact lens composition was prepared using a suitable glass container in which the sodium phosphate salts and glycerin were dissolved in sterile water . the polymer was next mixed with the buffer solution at 65 ° c . for 1 hour , followed by a further 2 - 3 hours in cold conditions . to a fixed weight of the polymer solution was added and dissolved , an accurate amount of timolol maleate ( huhtamaki oy pharmaceuticals , turku , finland ) to make a 0 . 5 % w / w concentration . ______________________________________ percentage by weight______________________________________timolol maleate 0 . 50poloxamer 17 . 00sodium alginate , high viscosity 1 . 50sodium borate , decahydrate 0 . 16boric acid 1 . 00glycerin 0 . 30sterile water 81 . 27______________________________________ a medicated contact lens was prepared using a suitable glass container in which the sodium borate , boric acid and glycerin were dissolved in sterile water . sodium alginate was sprinkled in with stirring to form a uniform paste . the polymer was next mixed with this mixture at 65 ° c . for 1 hour , and for a further 2 - 3 hours under cold conditions . to a fixed weight of the polymer - alginate solution , was added and dissolved , an accurate amount of timolol maleate ( huhtamaki oy pharmaceuticals , turku , finland ) to make a 0 . 5 % w / w concentration . ______________________________________ percentage by weight______________________________________timolol maleate 0 . 50sodium hyaluronate 1 . 00sodium alginate , high viscosity 1 . 00sodium borate , decahydrate 0 . 19boric acid 1 . 21glycerin 0 . 50sterile water 95 . 60______________________________________ a medicated contact lens was prepared using a suitable glass container in which the sodium borate , boric acid and glycerin were dissolved to make a solution in sterile water . sodium alginate and sodium hyaluronate were sprinkled into this solution with continuous stirring to form a uniform paste . to a fixed weight of the hyaluronate - alginate mixture , there was added and dissolved an amount of timolol maleate ( huhtamaki oy pharmaceuticals , turku , finland ) to make a 0 . 5 % w / w concentration . an in - vitro evaluation of the contact lens of examples 16 - 18 was carried out as follows : the medicated contact lens was prepared by accurately weighing a big drop of the formulation on a glass microscopic slide ( 2 &# 34 ;× 1 &# 34 ;). two drops of a 5 % by weight calcium chloride counter - ion solution was next placed on the formula drop . after 1 minute , the excess calcium chloride was blotted away from the now formed corneal contact lens . the glass slide with contact lens in place was next placed at the bottom of the 1 liter dissolution vessel containing 500 ml of purified water , maintained at 37 ° c . the dissolution experiment was carried out as per method 2 ( paddle ) of the united states pharmacopoeia xxii , page 1579 , the united states pharmacopoeial convention , mack publishing company , 1990 . paddle stirring rate was 50 revolutions per minute . at regular time intervals , aliquots were removed from the vessels for analysis by high pressure liquid chromatography . six vessels were used for each formulation ( n = 6 ). ______________________________________time cumulative % of timolol released ( sd ) example 16 example 17 example 18______________________________________ 0 0 . 0 0 . 0 0 . 0 10 min 100 . 0 -- -- 30 min 100 . 0 -- -- 60 min 100 . 0 -- -- 120 min -- 80 . 3 ( 12 . 0 ) 77 . 9 ( 6 . 2 ) 240 min -- 90 . 0 ( 3 . 8 ) 93 . 9 ( 2 . 2360 min -- 90 . 1 ( 3 . 1 ) 94 . 9 ( 2 . 5 ) 480 min -- 95 . 7 ( 3 . 3 ) 97 . 5 ( 2 . 9 ) ______________________________________ it was observed that the drug is released in - vitro , by diffusion and not by the erosion of the lens . approximately 80 % of timolol maleate is released in 1 hour and the remaining amount gradually diffuses out in 3 to 4 hours . the lenses remained intact 48 hours after the start of the experiment . on the other hand , when 0 . 9 % sodium chloride was used in place of purified water as the dissolution medium , the drug was released by both erosion and diffusion , within the first hour . the lenses are first reduced in size and then dissolved away within 6 hours . this erosion is dependent on the replacement of calcium ions ( in the lens ) with sodium ions ( from the dissolution medium ). the break up in - vivo is expected to be slow and gradual and is dependent on the sodium concentration in the tear fluid . in the following examples there are described compositions having multiple uses . for instance , they may be used as vehicles for drug delivery by topical application or by injection or useful as a protective corneal shield or in a process for excimer laser keratectomy as a laser ablatable corneal mask . the procedure for preparation and the polymeric materials utilized in the composition are those described in example 1 . the tris - hydrochloride buffer utilized in this composition was prepared utilizing the ingredients and proportions by weight indicated below . ______________________________________tris ( tromethamine , usp ) 0 . 6058concentrated hydrochloric acid 0 . 4123purified water , usp 100______________________________________ the composition was found to have a ph of 7 . 4 and an osmolality in mosm / kg of 83 . the procedure for preparation of this buffer is as follows : the weighed amount of tris was placed in a 2 - liter volumetric flask and about 1 liter of purified water was added to the flask . the concentrated hydrochloric acid was added and the solution was made up to volume by adding the remaining water in the formulation . the calcium based counter - ion solution utilized to gel the inventive drug delivery compositions of examples 19 - 22 was prepared utilizing the following proportions of ingredients in proportions by weight . ______________________________________calcium chloride , dehydrate 1 . 2calcium gluconate , anhydrous 3 . 0purified water , usp 100 . 0______________________________________ the composition had a ph of 6 . 88 and an osmolality in mosm / kg of 299 . the calcium based counter - ion solution was prepared as follows : the calcium gluconate and calcium chloride in the required amount were placed in a 200 ml volumetric flask . approximately 100 ml of water were added to partially dissolve the salts . the solution was , thereafter , warmed to 80 ° c . to facilitate dissolution . the solution was cooled and the remaining water was added to make up to 200 ml volume . a composition containing both sodium alginate and sodium hyaluronate was prepared for use as a vehicle for drug delivery , a laser ablatable corneal mask , a protective corneal shield , or a composition for use in preventing post - surgical adhesions . the proportions by weight are as follows : the composition was found to have a ph of 7 . 6 and an osmolality of 297 mosm / kg prior to treatment with calcium ions by the addition of the previously described calcium based counter - ion solution . after treatment with calcium ions the osmolality was 302 mosm / kg . the product was further characterized by measuring the average penetration in millimeters as determined using a precision penetrometer with a 1 / 4 size ( 9 . 38 grams , astm d - 1043 ) cone and plunger . the penetration in millimeters prior to treatment of the composition of example 19 with calcium ions was greater than 20 mm . after treatment with calcium ions the penetration was 4 . 77 mm . a composition containing polyvinyl pyrrolidone and sodium alginate was prepared which is useful for the same applications as that formulation described in example 19 . the proportions in percent by weight of the ingredients of the composition are as follows : the composition had a ph of 7 . 59 and an osmolality in mosm / kg prior to treatment with calcium ions of 320 and after treatment with calcium ions of 289 . the penetration utilizing a precision penetrometer as further described in example 19 was greater than 20 prior to treatment of the composition with calcium ions and 6 . 57 after treatment with calcium ions . a composition useful for the same uses as stated in example 19 containing a combination of sodium alginate and chondroitin sulfate was prepared . the proportions of ingredients in percent by weight are as follows : ______________________________________sodium chondroitin sulfate 2 . 0sodium alginate 1 . 0sodium chloride 0 . 35tris - hydrochloride buffer 96 . 65______________________________________ the composition had a ph of 7 . 9 and an osmolality expressed in mosm / kg of 301 prior to treatment with calcium ions and 272 after treatment with calcium ions . the penetration utilizing a precision penetrometer as further described in example 19 was found to be greater than 20 mm prior to treatment with calcium counter - ions and 4 . 57 upon treatment with calcium ions utilizing the calcium counter - ion solution prepared above . a composition useful for the same uses as stated in example 19 containing a combination of hydroxypropyl methyl cellulose , and sodium alginate was prepared . the proportions of ingredients and their percent by weight are as follows : ______________________________________hydroxypropyl methyl cellulose 2 . 0sodium alginate 1 . 0sodium chloride 0 . 6tris - hydrochloride buffer 96 . 4______________________________________ the composition had a ph of 7 . 59 and an osmolality expressed in mosm / kg of 326 prior to treatment with calcium ions and 301 after treatment with calcium ions . while this invention has been described with reference to certain specific embodiments , it will be recognized by those skilled in the art that many variations are possible without departing from the scope and spirit of the invention , and it will be understood that it is intended to cover all changes and modifications of the invention , disclosed herein for the purposes of illustration , which do not constitute departures from the spirit and scope of the invention .

8General tagging of new or cross-sectional technology

in the drawing 1 is a dds type diffuser in which cereal kernels are countercurrently treated with water supplied to the diffuser 1 through a pipe 2 . the hydrated and softened kernels are transferred to a wet - mill 3 , whereas the water containing ash , soluble proteins and soluble pentosans are introduced into a boiler 4 in which it is boiled for 1 - 5 minutes . the wet - milled starch - containing material in the form of a slurry is introduced onto a screen 5 in order to remove fibres with pentosans attached thereto , germs and gluten . the separated material is introduced into a drier 6 , whereas the slurry is transferred to a first decanter 7 and subsequently to a second decanter 8 . water is added via a pipe 9 after the first decantation and decantation water from the second decanter 8 is recycled to the first decanter 7 through a pipe 10 . water from the first decanter 7 is recycled to the diffuser 1 through the pipe 2 . fresh water is introduced into the pipe 2 via a pipe 11 . the starch slurry obtained in the second decanter 8 is introduced into a jet cooker 12 in which it is heated to a temperature of about 85 ° c . bacterial α - amylase is introduced into the jet cooker 12 via a pipe 13 . the liquefied product is transferred to a saccharification tank 14 and fungal amylase or amyloglucosidase is introduced therein via a pipe 15 . the temperatur of the saccharification tank 14 is maintained at about 60 ° c . the saccharified product is introduced onto a filter 16 to form a filtrate which is introduced into an ultrafiltration apparatus 17 and a gluten fraction which is mixed with the solid fraction formed on the screen 5 . the permeate obtained in the ultrafiltration apparatus 17 is introduced into an ion exchanger column 18 , whereas the concentrate is either mixed with the fractions formed on the screen 5 and filter 16 or dried in a drier 19 . after having passed the ion exchanger column 18 , the refined hydrolysate is introduced into a boiler 20 in which it is concentrated to form a syrup which can be further processed . the effluent from the ion exchanger column 18 may be mixed with the concentrate from the ultrafiltration apparatus 17 . when boiling the hydration water from the diffuser 1 , the majority of the proteins and part of the pentosans precipitate . the precipitate is separated from the supernatant liquor and is mixed with the fractions formed on the screen 5 and the filter 16 . the supernatant liquor is transferred to an evaporator 21 in which it is concentrated . the concentrate is also mixed with the fractions formed on the screen 5 and filter 16 . the invention will be described in further detail with reference to the following examples . 10 kg wheat kernels were introduced into a dds type diffuser . water at a temperature of 50 °- 55 ° c . containing 0 . 2 % so 2 w / w was passed countercurrently with a flow of wheat kernels through the diffuser . the total retention time in the equipment was 8 hours . the process water used for the hydration softened the wheat kernels and minor quantities of solubles were extracted from the wheat . the ratio ( on weight basis ) of wheat kernels to water was 1 : 2 . the wheat kernels absorbed during a period of 2 hours their own weight of water , and their volume was doubled . the hydrated and softened kernels were passed through a coarse type tooth disc mill which fully disintegrated the kernels thus releasing starch , gluten , germ and fibres . the milk slurry containing starch , gluten , fibre , germ and solubles were passed over a screen , e . g . dsm type screen , so as to remove a fraction containing fibres and germs . the fraction was dried and processed into a cake . the crude starch / gluten slurry was passed through a centrifuge of the decanter type , whereby the slurry was concentrated and countercurrently washed with fresh water to reduce the content of soluble ash and soluble organic material . the supernatant liquid was recycled to the hydration and softening step . the concentration of the partly refined slurry was adjusted to 30 % dry substance based on starch and the slurry was liquefied by means of bacterial α - amylase in a jet cooker at 85 ° c . after liquefaction , the temperature of the slurry was adjusted to 60 ° c ., and the ph was adjusted to 4 . 8 . amyloglucosidase enzyme was added and the product obtained was saccharified for about 72 hours . the saccharified hydrolysate was passed through a decanter so as to remove the insoluble gluten fraction . the gluten fraction was sweetened off with fresh water . the hydrolysate from the decanter consisted of sugars and mainly colloidal proteins which are capable of passing through 0 . 1 - 0 . 3 micron pore openings , e . g . through a micropore filter . the hydrolysate was refined in an ultrafiltration apparatus . the colloidal material was fully retained by the ultrafiltration diaphragms . the resultant hydrolysate ( permeate ) from the ultrafiltration apparatus was water - clear and was further refined by conventional ion - exchange treatment . the permeate contained approx . 0 . 3 % ash and 0 . 5 % soluble proteins on dry sugar basis . the concentrated hydration liquid , the fibres and germs from the dsm screens , the protein fraction from the decanters and the concentrate from the ultrafiltration apparatus were mixed together and dried to produce a high quality animal feed raw material . the following table shows the dry substance balance up to the final refining of the hydrolysate . table______________________________________basis : 1000 g wheat kernels ( 12 % moisture ) wheat partly refined feed materialcomponent g hydrolysate , g g______________________________________starch and starch 651 . 00 653 . 00 57 . 00hydrolysatesprotein 81 . 0 3 . 25 77 . 75ash 16 . 00 1 . 95 14 . 05fat 17 . 00 17 . 00pentosans 45 . 00 45 . 00crude fibre 28 . 0 28 . 0others 42 . 0 32 . 0total dry solid 880 . 00 658 . 20 270 . 80water 120 . 00total 1000 . 00______________________________________ 250 g rye - type caro - kurz - ( 216 g dry substance containing 135 g starch ) were soaked for 8 hours at 50 ° c . in 750 g water to which 0 . 4 g nahso 3 had been added . after soaking , the rye kernels were gently wet - milled with water at a concentration of 15 % dry substance so as to avoid disintegration of the fibres . the fibres were removed by sieving and the insolubles ( starch / protein ) separated by centrifugation . the concentration of the cleared solution which contained 1 . 5 % dry substance was adjusted at 0 . 5 % dry substance and the viscosity measured at 25 ° c . it was 1 , 778 . the concentration of pentosans in the cleared solution was 12 . 1 % dry substance . the starch / protein mixture separated by centrifugation was liquefied with alpha - amylase and subsequently saccharified with amyloglucosidase and the insoluble proteins were removed by centrifugation . the glucose solution which was cloudy with colloidal material was converted into a completely clear glucose solution by ultrafiltration ( diaphragm uf - ca - 18 from kalle , wiesbaden , germany ). the concentrate obtained by ultrafiltration was pumped through the ultrafiltration module until it contained less than 1 % glucose . the concentrate had at that time a low viscosity and did not block the ultrafiltration module . 500 g barley - feed type barley - ( 440 g dry substance containing 317 g starch ) were softened for 6 hrs . at 50 ° c . in 1500 g water containing 0 . 1 % w / w so 2 . after softening the kernels were wet - milled with water at a concentration of 12 % dry substance , to avoid extensive disintegration of the fibres . the fibres were separated by means of a 350 μm screen and the insolubles passing through the screens and consisting mainly of starch and proteins were separated by centrifugation . the supernatant liquor from the centrifuging step contained 1 . 3 % dry substance . the solution was cleared by filtration and the concentration adjusted to 0 . 5 % dry substance . the viscosity was measured at 25 ° c ., the viscosity was 1 , 326 ( water = 1 , 000 ). the concentration of pentosans in the cleared solution was 8 . 75 % on dry substance . the starch / protein mixture separated by centrifugation was liquefied with alphaamylase and subsequently saccharified with amyloglucosidase and the insoluble proteins were removed by centrifugation . the glucose solution which contained colloidal material was converted into a completely clear glucose solution by ultrafiltration ( diaphragm uf - ca - 10 from kalle , wiesbaden , germany ). the concentrate obtained by ultrafiltration was pumped through the ultrafiltration module it contained less than 1 % glucose . the concentrate had at that time a low viscosity and did not block the ultrafiltration module .

2Chemistry; Metallurgy

reference will now be made in detail to the presently exemplary and preferred embodiments of the invention as illustrated in the accompanying drawings , in which like reference characters designate like or corresponding parts throughout the several drawings . the nature , objectives and advantages of the present invention will become more apparent to those skilled in the art after considering the following detailed description in connection with the accompanying drawings . fig1 illustrates an architecture in which one embodiment of the present invention may be implemented using one or more wireless devices , such as cellular telephone 12 , in communication across a wireless network 14 with at least one network server , such as application download server 16 , that selectively downloads or provided access to software applications or other data to the wireless devices across a wireless communication portal or other data access to the wireless network 14 . as shown here , the wireless device can be a cellular telephone 12 , with a graphics display 13 , a personal digital assistant 18 with pda screen 19 , a pager 20 with a graphics display 21 , which is shown here as a two - way text pager , or even a separate computer platform 22 that has a wireless communication portal and a display 23 , and may otherwise have a wired connection 24 to a network or the internet . the system 10 can include any form of remote computer module including a wireless communication portal , including without limitation , wireless modems , pcmcia cards , access terminals , personal computers , access terminals , telephones without a display or keypad , or any combination or sub - combination thereof . the application download server 16 is shown here on a local server - side network 26 with other computer elements in communication with the wireless network 14 , such as a database 28 with stored applications and data that contains software applications and data that are accessible and downloadable to the wireless devices 12 , 18 , 20 , 22 . fig2 is a block diagram of the hardware components of the wireless network providing communication between different wireless devices , an application download server , and a database in an exemplary embodiment of the present invention . the wireless network 14 is merely exemplary and can include any system whereby remote modules , such as wireless devices 12 , 18 , 20 , 22 , communicate over - the - air between and among each other and / or between and among components of a wireless network 14 , including , without limitation , wireless network carriers and / or servers . the application download server (“ ads ”) 16 and the stored applications database 28 will be present on the cellular data network with any other components that are needed to provide cellular telecommunication services . the server 32 may provide other functions used by one or other components , such as application management functions for the application download server . the server 32 and ads may use a synchronizer interface tool ( not shown ) to communicate data between the systems . the server or other components of the system may interface with other systems not shown to transmit or receive data . the synchronizer tool may be used in supporting communication with these other systems as well . the application download server 16 , and / or other servers communicate with a carrier network 40 , through a data link , such as the internet , a secure lan , wan , or other network . the carrier network 40 controls messages ( generally being data packets ) sent to a messaging service controller (“ msc ”) 42 . the carrier network 40 communicates with the msc 42 by a network , the internet and / or pots (“ plain ordinary telephone system ”). typically , the network or internet connection between the carrier network 40 and the msc 42 transfers data , and the pots transfers voice information . the msc 42 is connected to multiple base stations (“ bts ”) 44 . in a similar manner to the carrier network , the msc 42 is typically connected to the bts 44 by both the network and / or internet for data transfer and pots for voice information . the bts 44 ultimately broadcasts messages wirelessly to the wireless devices , such as cellular telephone 12 , by short messaging service (“ sms ”), or other over - the - air methods known in the art . the wireless device , such as cellular telephone 12 , has a computer platform 50 that can receive and execute software applications and display data transmitted from the application download server 16 . the computer platform 50 also allows the wireless device to interact with data and applications resident on network servers . the computer platform 50 includes , among other components , a display driver 52 that drives the graphics display 13 and renders images on the graphics display 13 based upon graphics data received at the computer platform 50 . the computer platform 50 also includes an application - specific integrated circuit (“ asic ”) 54 , or other processor , microprocessor , logic circuit , or other data processing device . the asic 52 is installed at the time of manufacture of the wireless device and is not normally upgradeable . the asic 52 or other processor executes the application programming interface (“ api ”) layer 56 that interfaces with any resident programs in the memory 58 of the wireless device . the memory can be comprised of read - only or random - access memory ( ram and rom ), eprom , eeprom , flash cards , or any memory common to computer platforms . the computer platform 50 also includes a local database 60 that can hold the software applications not actively used in memory 58 , such as the software applications downloaded from the application download server 16 . the local database 60 is typically comprised of one or more flash memory cells , but can be any secondary or tertiary storage device as known in the art , such as magnetic media , eprom , eeprom , optical media , tape , or soft or hard disk . the wireless device , such as cellular telephone 12 , can access and download many types of applications , such as games and stock monitors , or simply data such as news and sports - related data . the downloaded data can be immediately displayed on the display or stored in the local database 60 when not in use . the software applications can be treated as a regular software application resident on the wireless device 12 , 18 , 20 , 22 , and the user of the wireless device can selectively upload stored resident applications from the local database 60 to memory 58 for execution on the api 56 . the end - user of the wireless device 12 , 18 , 20 , 22 can also selectively delete a software application from the local database 60 . fig3 is a block diagram depicting the architecture of a synchronizer tool interface in an exemplary embodiment of the present invention . in one embodiment , the synchronizer tool 305 enables tables in one rdbms system to be synchronized with a destination system via a standard xml interface . it will be recognized by those skilled in the art that the xml language is an implementation choice and other languages may be used . furthermore , it will also be recognized that the synchronizer tool may be used to synchronize or communicate other information , not just information from rdbms tables , between computer systems or subsystems . in addition , the connections between the interface and the target and source systems may be by any communication media available , such as wireless , including rf , satellite and infrared communication , and wire - based communication methods . in one embodiment , the communications medium is ip based . data received from the rdbms 320 in the source system 310 is stored in the queue 325 of the synchronizer tool 305 . this data is translated into a common file format such as xml . by having a storage mechanism , such as a queue , the synchronizer tool can maintain the data for the rdbms 315 even if the source system 310 is off line . the synchronizer tool 305 may also be implemented to provide an acknowledgement to the source system 310 when the data sent to the target system 315 is replicated in the rdbms 315 ( the target system may provide an acknowledgement to the synchronizer tool 305 indicating this replication has occurred , acknowledge the receipt of the data , or acknowledge other processing was performed ). the source system 310 is connected to the synchronizer tool 305 . this connection may be by any communication mechanism , including wireless and / or wire - based connection ( or combination thereof ). the synchronizer tool 305 may be local to the source system 310 or it may be remote to it . the source system transfers information to the synchronizer via this connection . this information may be data for replication to a remote database , or may be any type of information destined for another system , such as a message request , data request or other data transfer . in one embodiment , the source system 310 sends this information to the synchronizer tool 305 using an xml format . the target system receives the information from the synchronizer tool 305 and may respond with an acknowledgement to the synchronizer tool 305 . alternatively , the synchronizer tool may interact directly with a subsystem in the target system 300 ( such as a rdbms 315 ) to perform a task such as data replication . note the definition of a target system 300 and source system 310 is somewhat arbitrary . in one instance a system may be the source system sending data to a target system while in another instance the same system is acting as the target system receiving data from another system . fig4 is a flowchart depicting the process of the synchronizer tool interface in an exemplary embodiment of the present invention . the method begins by having the source system translate data into a xml format ( step 400 ) or some other common format . this data may be in the form of scalar data for the target system , a request for information from the target system or other information to be transferred for processing by the target system . next the data is transmitted to and received by the synchronizer tool ( step 405 ). the data is stored in a persistent intermediate storage ( step 405 ), such as a queue within a synchronizer tool . this allows some independence between the source and target systems . the source system may make the request , have it stored in the queue and can go offline while the request gets transmitted to and / or processed by the target system . in addition , the synchronizer tool may send an acknowledgement to the source system that it received the data . the data in xml format is then transmitted from the synchronizer tool to the target system ( step 415 ). note that the “ data ” can be any piece of information desired to be sent to the target system . it may be data used for replication into an rdbms of the target system . alternatively , it may be any type of command or information sent to the target system for possible processing by the target system . in addition , there may be multiple target systems receiving this data . the synchronization tool may queue multiple data transmission requests for multiple destinations , including multi - target system destination requests . the method continues to initiate the translated command on a rdbms ( step 415 ). after translating the command into the appropriate language for the rdbms , it initiates this command by direct access to the target system &# 39 ; s rdbms or by sending the command to a processor , such as one in the target system , for execution . if the data is received at the target ( step 420 ), the “ yes ” branch is followed and an acknowledgement is sent to the source system ( step 425 ). the source system formats this acknowledgement into a format readable by the source system , such as in xml . if the source system is not online , the acknowledgement may be queued and further attempts may be made to the source system to inform it that the data was transmitted to the target system . the synchronizer tool may determine if the data was received by receiving an acknowledgement from the target system . if data is received at the target as determined in step 420 , such as may occur when the target system or rdbms is offline , then the “ no ” branch is followed and the data remains in the queue and will retry ( step 430 ) to initiate a transmission of the data to the target system as described in step 415 . there are many queuing algorithms and time parameters possible to determine when to initiate another transmission to the target system . the preferred algorithm and time is based on the processing capacity , efficiency , available resources ( such as available queuing memory ) as well as other implementation factors of the systems involved . the foregoing description of an implementation of the invention has been presented for purposes of illustration and description . it is not exhaustive and does not limit the invention to the precise form disclosed . modifications and variations are possible in light of the above teachings or may be acquired from practicing of the invention . for example , the described implementation includes software but one embodiment of the present invention may be implemented as a combination of hardware and software or in hardware alone . the invention may be implemented with both object - oriented and non - object - oriented programming systems . additionally , although aspects of the present invention are described as being stored in memory , those skilled in the art will appreciate that these aspects can also be stored on other types of computer - readable media , such as secondary storage devices , like hard disks , floppy disks , or cd - rom ; a carrier wave from the internet or other propagation medium ; or other forms of ram or rom . in addition , it should be noted that various changes and modifications could be made herein without departing from the scope of the invention as defined by the appended claims and their equivalents . furthermore , although elements of the invention may be described or claimed in the singular , the plural is contemplated unless limitation to the singular is explicitly stated .

7Electricity

referring now to fig1 a , a brushless , synchronous generator 10 includes a permanent magnet generator ( pmg ) 12 , an exciter portion 14 and a main generator portion 16 . the generator 10 further includes a motive power shaft 18 interconnecting a rotor 20 of the generator 10 and a prime mover 21 , such as a gas turbine engine . in a specific application of the present invention , the generator 10 and the prime mover 21 together may comprise an aircraft auxiliary power unit ( apu ) 22 , although the present invention is equally useful in other prime mover / generator applications . the rotor 20 carries one or more permanent magnets 23 which form poles for the pmg 12 . rotation of the motive power shaft 18 causes relative movement between the magnetic flux produced by the permanent magnet 23 and a set of three - phase pmg armature windings including phase windings 24a - 24c mounted within a stator 26 of the generator 10 . the exciter portion 14 includes a field winding 28 disposed in the stator 26 and a set of three - phase armature windings 30a - 30c disposed on the rotor 20 . a set of rotating rectifiers 32 interconnect the exciter armature windings 30a - 30c and a main generator portion field winding 34 also disposed on the rotor 20 . three - phase main generator portion armature windings 36a - 36c are disposed in the stator 26 . during operation in a generating mode , at least one , and preferably all three of the pmg armature windings 24a - 24c are coupled through a rectifier and voltage regulator ( not shown ) to the exciter portion field winding 28 . as the motive power shaft 18 is rotated , power produced in the pmg armature windings 24a - 24c is rectified , regulated and delivered to the field winding 28 . ac power is produced in the armature windings 30a - 30c , rectified by the rotating rectifiers 32 and applied to the main generator portion field winding 34 . rotation of the motive power shaft 18 and the field winding 34 induces three - phase ac voltages in the main generator portion armature windings 36a - 36c as is conventional . as seen in fig1 b , the ac voltages are supplied through a contactor set 37 to an apu power distribution network 38 and thence to one or more loads ( not shown ). often , it is desirable to use the brushless generator 10 as a motor to bring the prime mover 21 up to self - sustaining speed . this operation is accomplished by providing electrical ac power to the main generator portion armature windings 36a - 36c and suitably commutating the currents flowing in the windings 36a - 36c to cause the motive power shaft 18 to rotate . in a specific embodiment , the electrical power for the generator 10 is developed by an apu start converter 39 which receives external electrical power and which is connected by contactor sets 40a , 40b to the exciter field winding 28 and the armature windings 36a - 36c , respectively . various methods have been devised for controlling the power supplied to the armature windings 36a - 36c other than those described herein . such other methods could be used in place of those described herein to accomplish the desired results , as should be evident to one of ordinary skill in the art , without departing from the spirit and scope of the present invention . fig2 illustrates a preferred embodiment of the present invention , which includes the main generator portion 16 coupled to a prime mover 42 via the motive power shaft 18 and a starting system control 41 for operating the generator 10 in a starting mode to convert electrical power into motive power for starting the prime mover 42 . the starting system control 41 includes a rotor position sensor 44 which develops a signal representing the angular position of the motive power shaft 18 . the particular manner in which the rotor position signal is generated is not considered to be a feature of the present invention . the rotor position sensor 44 is coupled to a phase voltage transformation circuit 46 and a phase current transformation circuit 48 . the voltage transformation circuit 46 is responsive to phase voltages v a , v b and v c developed by a pulse - width modulated ( pwm ) main inverter 50 and generates the direct and quadrature voltage components , v d and v q , respectively , of the voltage generated by the inverter 50 , based upon the angular position signal generated by the position sensor 44 . the inverter 50 may be of conventional design including six power switches and six associated flyback diodes connected in a conventional three - phase bridge configuration . the phase current transformation circuit 48 is responsive to signals i a , i b and i c representing the magnitudes of phase currents developed by the main inverter 50 , as detected by current sensors 52a - 52c , and generates the direct and quadrature current components , i d and i q , respectively , of the current generated by the inverter 50 , based upon the angular position signal generated by the position sensor 44 . the transformation circuits 46 , 48 are conventional and are based upon park &# 39 ; s transformation , which is also referred to as the dq0 transformation . the angular position signal generated by the position sensor 44 is also supplied to a speed processor 60 which generates in a conventional manner a speed signal ω representing the sensed speed of rotation of the rotor 20 . the speed signal generated by the speed processor 60 is compared with a speed command ω *, which represents the desired speed at any point in time , by a summer 62 . the difference between the sensed and desired speed as determined by the summer 62 is provided as an error signal to a proportional - integral gain and compensation unit 64 . the output of the gain and compensation unit 64 is limited by a limiter 66 , which generates a quadrature current command , i q *, representing the desired quadrature current . the output of the speed processor 60 is also provided to a function generator 70 which generates a direct current command , i d *, based upon the speed signal generated by the speed processor 60 . at zero and relatively low speeds , as determined by the signal generated by the speed processor 60 , the function generator 70 outputs a direct current command having a maximum positive value . at intermediate speeds when excitation is supplied by applying dc power to the exciter field winding 28 , the function generator 70 outputs a direct current command which is zero in order to provide a near maximum torque - to - current ratio , and at higher speeds , the function generator 70 outputs a negative direct current command to provide phase advance in coordination with the weakening of the dc exciter field . the above manner in which the magnitude of the direct current command i d *, is controlled assumes that dc excitation is provided to the exciter field winding 28 during the starting mode . if dc excitation is not provided to the exciter field winding 28 during operation in this , the magnitude of the direct current command i d * should be maintained at a constant level , instead of changing in magnitude as described above . other variations in the manner in which the function generator 70 generates the direct current control command may be utilized . at any given time during startup of the generator 10 , the main generator portion 16 is alternately excited with purely direct current and purely quadrature current . the direct current builds the field in the main generator portion 16 , whereas the quadrature current , which is applied before the field substantially decays , generates torque on the rotor 20 . the alternate direct and quadrature excitation provided to the main generator portion 16 is controlled by an oscillator 72 connected to a pair of switches 74 , 76 . the switch 74 selectively provides the quadrature current command i q *, to a summer 80 , and the switch 76 selectively provides the direct current command i d *, to a summer 90 . the switches 74 , 76 are simultaneously switched , and at any given time , one of the switches 74 , 76 is connected to ground , and the other of the switches 74 , 76 is connected to receive its respective command signal , i q *, or i d *. as a result , the main generator portion 16 is excited with either purely direct excitation or purely quadrature excitation . the frequency and duty cycle of the oscillator 72 , which determine at what rate the switches 74 , 76 are switched and how long they remain in their two positions , respectively , may be selected based on the time constant of the main generator portion 16 so that the field generated within the main generator portion 16 ( via connection of switch 74 to its command signal i q *) does not significantly decay during the starting mode . for example , the oscillator 72 may have a fixed frequency of five hertz and a duty cycle of 50 % throughout the starting mode of operation so that each of the switches 74 , 76 is alternately provided in one position for 100 milliseconds and in the other position for 100 milliseconds . other frequencies and duty cycles may be utilized . the summer 80 which periodically receives the quadrature current command i q * also receives the sensed quadrature current signal i q from the phase current transformer circuit 48 . the summer 80 generates an error signal , representing the difference between the two signals , which is processed by a proportional - integral gain and compensation unit 82 to produce a quadrature voltage command v q *. that command signal is provided to a summer 84 along with the quadrature voltage signal v q generated by the voltage transformation circuit 46 . the difference between the signals as determined by the summer 84 is provided to a proportional - integral gain and compensation unit 86 . the summer 90 which periodically receives the direct current command i d * also receives the sensed direct current signal i d from the phase current transformer circuit 48 . the summer 90 generates an error signal , representing the difference between the two signals , which is processed by a proportional - integral gain and compensation unit 92 to produce a direct voltage command v d *. that command signal is provided to a summer 94 along with the direct voltage signal v d generated by the voltage transformation circuit 46 . the difference between the signals as determined by the summer 94 is provided to a proportional - integral gain and compensation unit 96 . the outputs of both the units 86 and 96 , representing the desired quadrature and direct phase voltages , respectively , are provided to an inverse transformation circuit 100 , which converts such signals into three voltage command signals v a *, v b *, and v c * in a conventional manner . the three voltage commands are provided to the main inverter 50 , which is of the three - phase type including six controllable power switches and six flyback diodes connected in a conventional bridge configuration , which is connected to drive the main generator portion armature windings 36 . the generator 10 may be operated in a generating mode , during which pmg armature windings 24a - 24c are coupled through a rectifier and voltage regulator ( not shown ) to the exciter portion field winding 28 . as the motive power shaft 18 is rotated , power produced in the pmg armature windings 24a - 24c is rectified , regulated and delivered to the field winding 28 . ac power is produced in the armature windings 30a - 30c , rectified by the rotating rectifiers 32 and applied to the main generator portion field winding 34 . rotation of the motive power shaft 18 and the field winding 34 induces three - phase ac voltages in the main generator portion armature windings 36a - 36c as is conventional . when the generator 10 is operated in the starting mode , purely direct excitation and purely quadrature excitation are alternately provided to the main generator portion armature windings 36 . the direct excitation maintains the field in the main generator portion 16 by applying direct current to the armature windings 36 , and the quadrature excitation provides torque by applying quadrature current to the armature windings 36 . various methods have been devised for supplying power to the main generator field winding 34 via the exciter 14 during the starting mode . however , depending upon the physical characteristics of the generator being started , it may not be necessary to supply power to the exciter 14 . if power is to be supplied to the exciter 14 via the field winding 28 during operation in the starting mode , rather than dc power , it may instead comprise ac power at 400 hz with a peak - to - peak voltage of 400 volts . the power may be supplied from a power source other than the main inverter 50 , or it may be generated based on one or more signals generated by the main inverter 50 . numerous modifications and alternative embodiments of the invention will be apparent to those skilled in the art in view of the foregoing description . accordingly , this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the best mode of carrying out the invention . the details of the structure may be varied substantially without departing from the spirit of the invention , and the exclusive use of all modifications which come within the scope of the appended claims is reserved .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

number 1 in fig4 indicates as a whole a voltage booster circuit for powering at least one piezoelectric actuator ( not shown ) of an injector ( not shown ), in particular a diesel engine injector . voltage booster circuit 1 comprises an input 2 supplied with a direct input voltage vi ( in particular , the 12 v direct voltage supplied by a vehicle battery ); and an output 3 having an output voltage vo that can be used to power a piezoelectric actuator ( not shown ) of an injector ( not shown ). voltage booster circuit 1 comprises a first inductor 5 ( of inductance lp ) having a first terminal 5 a connected to a first terminal 2 a of input 2 , and a second terminal 5 b communicating with a first terminal 7 a of a solid - stage switch 7 having a second terminal 7 b communicating with an electric line 9 . solid - state switch 7 is conveniently defined by a field - effect ( e . g . mos ) transistor . a first terminal of electric line 9 defines a second terminal 2 b of input 2 ; and a first capacitor 12 is interposed between the first and second terminal 2 a , 2 b of input 2 . a second inductor 15 ( of inductance ls ) has a first input terminal 15 a connected to second terminal 5 b of inductor 5 , and a second input terminal 15 b communicating via a diode 17 with a first terminal 3 a of output 3 . a second terminal 3 b of output 3 is defined by a second terminal of electric line 9 ; and a second capacitor 22 is interposed between the first and second terminal 3 a , 3 b of output 3 . according to the present invention , first inductor 5 is coupled magnetically to second inductor 15 . more specifically , the first and second inductor are defined by respective turns wound about the same core 23 . conveniently , first inductor 5 comprises n turns , and second inductor 15 comprises kn turns , where k & gt ; 1 . the k value can be an integer or a fractional value . in actual use , solid - state switch 7 is switched to operate voltage booster circuit 1 . capacitor 12 between the two input terminals 2 a and 2 b of voltage booster circuit 1 provides for filtering the noise generated by switching solid - state switch 7 . more specifically , when switch 7 is closed ( on phase ), current increases substantially steadily in first inductor 5 ; and the value of the current can be monitored , for example , using a measuring resistor 24 in series with switch 7 . at this phase , diode 17 is disabled , so no current flows in second inductor 15 . when the current carried by inductor 5 reaches a given threshold value i pk1 , switch 7 is opened by a control circuit ( not shown ) described later on . rapid opening of switch 7 ( off phase ) causes a sharp variation in the voltage in first inductor 5 , which is inverted and also affects second inductor 15 , diode 17 starts conducting , and the current carried by inductor 5 , which is now decreasing substantially steadily , is applied to second capacitor 22 , which charges . more specifically , when switch 7 opens , second inductor 15 is in series with first inductor 5 , and the total inductance value of the circuit increases . since the inductance value of an inductor is related to the geometry of the core and to the square of the number of turns , the total inductance value leq — which equals the sum of the effects of the two series inductors 5 and 15 — equals ( 1 + k ) 2 times the value of inductance lp of inductor 5 , i . e . : this is because both inductors 5 , 15 are wound with the same winding , and the magnetic flux links with all the turns of both inductors 5 , 15 . as a direct consequence of the energy - saving principle applied to the on and off phases : i . e . the current i pk2 flowing in the off phase , in which switch 7 is open , is reduced by a factor ( 1 + k ) with respect to the value reached at the end of the on phase , as shown in fig5 , where t indicates the value of the period controlling switching of switch 7 . repetition of the above operations ( on and off phases ) produces a charge current of capacitor 22 oscillating slightly about a desired charge current value . capacitor 22 , which is kept charged by an appropriate duty cycle as soon as the voltage at its terminals reaches the desired value , is therefore charged with current with a very low peak value , almost as though inductor 5 were an ideal current source . moreover , being proportional to the peak value of the current , the ripple current value in second capacitor 22 is also reduced by factor ( 1 + k ). second inductor 15 therefore provides for reducing the current oscillation to be withstood by capacitor 22 , which can therefore be smaller than the output capacitor of a boost voltage booster , is stressed to a lesser degree , and is thus far less subject to breakdowns . it can also be shown that the transfer function relating input voltage vi to output voltage vo is : v o v i = 1 + k · d 1 - d ; whereas the function relating current i l — which is the mean current flow in first inductor 5 — to output voltage vo of voltage booster circuit 1 is : i l = ( 1 + k ) · v o r · ( 1 - d ) where d is the duty cycle , k is the ratio between the turns of second inductor 15 and first inductor 5 , and r is the load resistance . since the output voltage can be regulated easily by appropriately selecting k and modifying duty cycle d accordingly , a desired voltage ( e . g . about 200v ) can be regulated regardless of the type of input supply ( 12v or 42v ). the voltage booster circuit has control means for effecting closed - loop control as dictated by peak current mode ; in particular : a first internal current control circuit which imposes a desired current value in first inductor 5 and therefore , via second inductor 15 , in the load , and turns switch 7 off when the desired current peak value is reached ; this control loop is extremely fast , may typically have a bandwidth equal to ¼ of switching frequency , and is totally unaffected by the imposed output voltage vo ; a second voltage control circuit , slower than the current control circuit , which determines the value of output voltage vo , and compares it with a reference value to obtain a desired current level for use in the above current loop , and so modify the duty cycle controlling switching of switch 7 . the two control circuits described provide protection against possible short - circuiting of voltage booster circuit 1 . that is , in the event of a sharp fall in output voltage , so that the voltage control increases the duty cycle , rapid attainment of the peak current value causes the current loop to turn the switch off earlier than the time established by the voltage loop ; conversely , in the event the current loop supplies too much current , thus increasing the output voltage , the voltage loop begins reducing the duty cycle . more specifically , mathematical proof is based on the state space mean , which is a type of analysis proposed by middlebrook and vorperian in the mid - 1970s . this type of analysis is only valid in continuous mode , i . e . when the time constants of the circuit ( related to inductance l and capacitance c ) are much greater than the switching period of switch 7 , which is almost always the case in switch circuits . in short , two states are examined : a first state , in which switch 7 is closed , and a second state , in which switch 7 is open . the state equations for the currents in the inductors and for the voltages in the capacitors are defined , and the currents and voltages are then averaged in time by multiplying them by the time periods in which the respective equations are valid . assuming switch 7 is closed , the first two equations are : { v lp = l p · ⅆ i l ⅆ t = v i ic = c · ⅆ v ⅆ t = - v r where : v lp is the voltage applied to first inductor 5 ; l p is the inductance of first inductor 5 ; i l is the current in first inductor 5 ; v i is the input voltage ; i c is the current in output capacitor 22 ; c is the capacitance of output capacitor 22 ; v is the output voltage ( constituting the power supply of the piezoelectric actuator ); and r is the equivalent load resistance ( e . g . 1 kω ). assuming switch 7 is open , the following equations are obtained ( bearing in mind that the inductance now is the equivalent inductance , and the voltage is that related to the whole winding ); { v leq = ( 1 + k ) 2 ⁢ l p · ⅆ i l ⅆ t = ( v i - v ) [ v lp = v leq 1 + k ] ic = c · ⅆ v ⅆ t = i l ′ - v r [ i l = ( 1 + k ) · i l ′ ] where : v leq is the voltage across the equivalent inductance ; l eq is the equivalent inductance ; i ′ l is the current in the equivalent inductance ; and k is the turn ratio between the primary and secondary inductor . averaging the whole within the switching period , i . e . multiplying by d or ( 1 - d ), depending on the time span in which the equations are valid , and substituting the terms in square brackets , give : v lp = l p · ⅆ i l ⅆ t = v i · d ⁢ ( v i - v ) · ( 1 - d ) 1 + k ic = c · ⅆ v ⅆ t = i l 1 + k ⁢ ( 1 - d ) - v r a substitution is then made : in particular , each variable is replaced with a term comprising a constant part ( indicated in upper case ), and a variable part expressing an infinitesimal variation ( indicated by a circumflex accent ): the laplace transform is then applied to the last two equations , ignoring any infinitesimal terms of an order greater than two : p · l p · i ^ l = ⁢ v i · d + v i · d ^ + v ^ i · d + ( v ^ i - v ^ ) · ( 1 - d ) 1 + k - ⁢ ( v i - v ) · d ^ 1 + k + ( v i - v ) · ( 1 - d ) 1 + k p · c · v ^ = i l + i ^ l 1 + k · ( 1 - d - d ^ ) - v ^ + v r separating the constant terms from the variable terms gives two separate systems of equations : { p · l p · i ^ l = v i · d ^ + v ^ i · d + ( v ^ i - v ^ ) · ( 1 - d ) 1 + k - ( v i - v ) · d ^ 1 + k p · c · v ^ = i ^ l 1 + k · ( 1 - d ) - i l 1 + k · d ^ - v ^ r { 0 = v i · d + ( v i - v ) · ( 1 - d ) 1 + k 0 = i l 1 + k · ( 1 - d ) - v r the transfer function of the booster circuit is obtained by calculating the constant terms with respect to the output and input voltage ratio , and with respect to the current in the inductor : { v v i = 1 + k · d 1 - d ← . t . f - modified ⁢ - ⁢ boost i l = v · ( 1 + k ) r · ( 1 - d ) { p · l p · i ^ l = ( 1 - d ) · v 1 + k · d · d ^ + v ^ i · d + ⁢ ( v ^ i - v ^ ) · ( 1 - d ) 1 + k - ( ( 1 - d ) · v 1 + k · d - v ) · d ^ 1 + k p · c · v ^ = i ^ l 1 + k ⁣ · ( 1 - d ) - v · ( 1 + k ) r · ( 1 - d ) 1 + k · d ^ - v ^ r by zeroing the variations in input voltage v i , the equation relating output voltage v ( p ) to the variation in duty cycle d can be determined , and can easily be shown to comprise a zero in the right half - plane , and two conjugate complex poles with a negative real part . f = 1 2 ⁢ ⁢ π · r · ( 1 - d ) 2 l · ( 1 + k ) · ( 1 + k · d ) clearly , changes may be made to the voltage booster circuit as described and illustrated herein without , however , departing from the scope of the present invention as defined in the accompanying claims .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

referring to fig1 , an electrostatic force directed assembly ( esfda ) device 10 provides an arc plasma source chamber 18 enclosing an arc cathode 14 opposed to an arc anode 20 , the later holding a precursor material 22 from which nanoparticles will be created . a plasma arc voltage source 12 couples the arc anode 20 to the arc cathode 14 to create the arc 16 which strikes the precursor material 22 for the production of the nanoparticles 42 . the arc cathode 14 and arc anode 20 may be , for example , tungsten and graphite respectively . the application of the arc 16 to the precursor material 22 creates an aerosol of nanoparticles 42 through physical vaporization of the solid precursor material 22 . this generation of nanoparticles creates a relatively broad size distribution of nanoparticles 42 . a significant fraction of the nanoparticles 42 are charged by the arc 16 or through plasma or thermionic emission , which makes esfda feasible without the use of further nanoparticle 42 charging device . the charging of the nanoparticles 42 may prevent their agglomeration . alternatively , the nanoparticle 42 production means may use aerosol reactors or may aerosolize colloidal nanoparticles 42 , in which case additional charging means may be required in such assemblies , or example using corona discharge electrodes . multiple precursor materials 22 may be used , for example , silver ( ag ) and tin oxide ( sno 2 ) for example from different arc assemblies or using a mixture of precursor materials 22 . the gaseous aerosol may thus comprise a mixture different nanoparticles 42 , including generally catalysts , photo - catalysts , or semiconductors . the nanoparticles 42 will typically be less than 100 nanometers in diameter and may have a mean diameter of less than 20 nanometers . the esfda device 10 further provides a room temperature carrier gas source 28 that is connected to the plasma source chamber 18 by way of a first inlet tube 26 and a second inlet tube 24 . the first and second inlet tubes are coupled together by a metering valve or flow meter 30 so that flow of the gas into the chamber 18 may be precisely controlled . the gas from the carrier gas source 28 is applied to the chamber 18 to carry the nanoparticles 42 created by the arc plasma source down a flow tube 38 . the flow tube 38 generally acts as an electrode and may comprise grounded metal conductor . a bypass tube 25 branches from the flow tube to the flow out of the flow tube 38 independent of the flow of carrier gas into the chamber 18 . the bypass tube 25 leads to a metering valve 34 and then connects to an exhaust tube 27 leading to a filter 32 disposed at the end of the exhaust tube 27 to catch any nanoparticles 42 that are diverted from the flow tube 38 . a substrate electrode 40 is provided beneath the flow tube 38 and a voltage source 36 is connected between the substrate electrode 40 , and the flow tube 38 to provide an electrical field therebetween . the voltage source 36 may be either positive or negative in nature , depending on the charge of the nanoparticles , so as to attract the nanoparticles to the substrate electrode 40 . supported by the substrate electrode 40 and in electrical communication with the substrate electrode 40 , are nanostructures 44 to which the nanoparticles will be assembled . in one embodiment , the nanostructures 44 are carbon nanotubes ( cnt ) coating a substrate electrode 40 that is a perforated copper grid . the holes in the grid appear to enhance the effect of the electrical field . a gap distance ( e . g ., 2 - 0 . 5 mm ) is maintained between the metal flow tube 38 and the substrate electrode 40 using , for example , a precision - machined ceramic spacer . the larger the gap between the flow tube 38 and the substrate electrode 40 , the higher applied voltage necessary to sufficiently attract the nanoparticles 42 to the nanostructures 44 . the presence of the voltage source 36 creates an electrical field in the neighborhood of the nanostructures 44 on the substrate electrode 40 . thus , after the nanoparticles 42 flow through the flow tube 38 , they are preferentially attracted to the nanostructure 44 surfaces on the substrate electrode 40 . this attraction results in nanoparticle 42 decoration of the nanostructures 44 , which will be discussed further below . the voltage source may provide a voltage of 2 kv - 500 v depending on the gap distance . the voltage is limited only by the breakdown voltage of the carrier gas ( about 3 × 10 6 v / m for dry air ). calculation from experiments show the maximum electric field near the surface of a 20 - nm carbon nanotube reaches 2 . 45 × 10 6 v / m for a voltage source 36 of 2 kv and a gap of 2 mm . in the absence of an electrical field , it has been determined that the nanoparticles 42 are not appreciably attracted to the nanostructures 44 and do not bond to the surfaces of the nanostructures . various different nanostructures 44 such as carbon nanotubes , nanorings , nanorods , and nanowires may be used in the present invention . the nanostructures 44 are produced using known methods in the relevant technological field or , alternatively , may be bought from known commercial sources , e . g ., carbon nanotechnologies , inc . and alfa aesar . referring now to fig2 a cross - sectional simplified tem image of a nanostructure 44 shows its surface decorated with a plurality of nanoparticles 42 . the nanoparticles 42 are bonded to the exterior surface of the nanostructures 44 . the adhesion between the nanoparticles 42 and the nanostructures 44 appears to be non - covalent in nature and thus preserves the sp 2 hybridization of the carbon atoms in that may be present in the nanostructures 44 . by maintaining this sp 2 hybridization , the unique intrinsic properties of the nanostructures 44 are preserved . the bonding between the nanostructures 44 and nanoparticle 42 may provide for good electrical conduction between the two . the nanoparticles 42 are generally evenly spaced across the external surface of the nanostructure 44 because of the electrical charge carried on each of the nanoparticles 42 which cause them to mutually repel one another leading to a minimum energy configuration of substantially uniform distribution . the average separation of the nanoparticles 42 bonded to the external surfaces of the nanostructures 44 can be controlled by adjusting the assembly conditions . for example , adjusting the duration of the flow of nanoparticles 42 over the substrate electrode 40 will control the packing density of the nanoparticles 42 on the nanostructures 44 as the packing density increases with increased assembly time . if the assembly time is sufficiently long , the entire surface of the nanostructure 44 may be coated with nanoparticles 42 . referring now to fig3 , similarly , controlling the flow rate of the nanoparticles 42 or the strength of the electrical field will control the size of the nanoparticles 42 assembled on the nanostructures 44 . as the nanoparticles 42 approach the substrate electrode 40 , they are held in a laminar flow represented by flow lines 46 applying an airflow force 50 on the nanoparticles 56 and 58 that is dependant on the size of the nanoparticles 56 and 58 . in contrast , an electrostatic force 48 perpendicular to the airflow force 50 and toward the substrate is dependent on the charge of the nanoparticles 56 and 58 which will be largely independent of their size . these competing forces create trajectory lines 52 and 54 that sort nanoparticles 42 of different sizes . trajectory line 52 is traveled by representative small nanoparticle 56 and depicts the result of a proportionally larger electrostatic force 48 than airflow force 50 while trajectory line 54 is traveled by relatively larger nanoparticle 58 represents a proportionally smaller electrostatic force 48 than airflow force 50 . larger nanoparticles 58 tend to be carried along further by the airflow force 50 due to their size relative to that of the smaller nanoparticles 56 allowing size distribution to be controlled . nanoparticle size can affect the properties of the nanoparticles 42 . to the extent that the amount of charge can be controlled on different nanoparticles 42 , this same effect may be used to sort nanoparticle materials or provide different size ratios among nanoparticles 42 of different materials . nanoparticles 42 reaching the nanostructures 44 are selected through their electrical mobility , the ability of a particle to move in an electrical field , characterized by the following equation : z p = ν p / e = nec c / 3πμd p , wherein ν p is the nanoparticle 42 velocity along electric field lines , e is the electrical field , n is the number of elementary charges carried by nanoparticles , e is the elementary charge , c c is the cunningham slip correction factor , d p is the diameter of the nanoparticles , and μ is the flow viscosity . the electric field need not be homogenous but can be further altered to control the distribution of the particles for example with electrode shapes , shields or photoelectric dissipation . some size selection is also intrinsic to the process of generating and conveying the aerosolized nanoparticles 42 . referring now to fig4 , the present invention may be used to construct a novel device in which a single nanotube 60 is disposed between a first electrode 64 and a second electrode 66 . an ohmmeter 62 or similar current sensitive device is placed between the two electrodes to measure the resistance of the nanotube 60 . nanoparticles 42 are lined up across the surface of the nanotube 60 using the assembly procedure discussed herein . alternatively , the nanotube 60 could be replaced by another type of conductive nanostructure 44 . as shown in fig6 , the nanoparticles 42 may be selected to attract other particles 70 in the environment and bond to them . this bonding creates a region of increased resistance along the nanotube 60 that may be measured by the ohmmeter 62 ( shown in fig4 ) to detect the presence of the particles 70 . as shown in fig7 , in an alternative embodiment , strands of nucleotides 72 may be attached to the nanoparticles ( before or after assembly ) to hybridize with complimentary nucleotides 74 in the environment . again , the result of this bonding of nucleotides 74 may be detected in changes in the flow of electrons 68 within the nanotube 60 near the bonded nucleotides 72 . this particular embodiment is useful in the field of biosensors sensitive to the presence of a particular biological agent . the nucleotide 72 is selected to bond only to the particular agent to be detected . referring to fig8 , a photoelectric nanoparticle 42 attached to the surface of a carbon nanotube 60 may be struck by a light ray 74 to eject electrons 68 collected by the nanotube 60 to create an improved photocell or photo sensor . referring now to fig5 a and 5 b , a carbon nanotube 60 is placed on the surface of a substrate 80 . using the disclosed assembly procedure , nanoparticles 42 are lined up across the surface of the nanotube 60 . by applying a high voltage or heat or oxidizing chemical to the nanotube 60 , the nanotube 60 can be destroyed leaving behind only the nanoparticles 42 which remain lined up in a row on the substrate as shown in fig5 b . this technique can be used with conductive or semiconductive nanoparticles 42 to create fine conductive or semiconductive paths ( for example , for integrated circuits ) or to create fiducial marks on the substrate 80 for studies of microscopic strain or the like . referring now to fig9 the nanoparticles 42 may be a catalyst that is used to grow additional nanotubes 60 branching from the nanotubes 60 on which the nanoparticles 42 were originally deposited . the resultant structure may have a relatively large surface area while having a relatively small volume and may , in turn , be coated with different nanoparticles 42 to provide for catalytic structures , photocells , or filters or the like . various alternatives are contemplated as being within the scope of the following claims , particularly pointing out and distinctly claiming the subject matter regarded as the invention .

1Performing Operations; Transporting

fig1 through 8 represent a frac nut assembly 10 according to an embodiment of the present invention . the assembly 10 has an annular shape comprised of two entirely separate members 12 and 14 , represented as halves of the assembly 10 , such that each member 12 and 14 has an arcuate shape that roughly defines a 180 degree arc . each member 12 and 14 has a full - lug 16 located midway between the extremities 18 and 20 of its arc ( i . e ., at about 90 degrees ), and half - lugs 22 and 24 located at the arc extremities 18 and 20 , respectively . the full - lugs 16 and half - lugs 22 and 24 extend radially from the outer circumference 26 of the assembly 10 , which is defined by the radially outward surfaces of the individual members 12 and 14 when assembled . the interior circumference of the assembly 10 has threads 28 for threadably engaging male threads ( not shown ) conventionally provided on a fitting of a hose or other suitable fluid conduit ( not shown ). as a result , the radially inward surface of each member 12 and 14 has a thread fragment that , when the members 12 and 14 are assembled , cooperate to define the complete threads 28 of the assembly 10 . the threads 28 are not continuous along the entire axis of the interior circumference , but instead are limited to one axial end of the assembly 10 and axially terminate at a shoulder 30 that is located at an opposite axial end of the assembly 10 and extends radially inward from the interior circumference of the assembly 10 . as such , the radially inward surface of each member 12 and 14 also defines a fragment of the shoulder 30 so that , when the members 12 and 14 are assembled , the fragments define the entire shoulder 30 of the assembly 10 . as represented in fig8 , the shoulder 30 of each member 12 and 14 is adapted to engage a radially - extending flange 42 at one end of a tube or pipe 40 that forms part of a frac tank port fitting . in practice , the pipe 40 is often in the form of a sleeve that is welded or otherwise attached to the structure that forms a port fitting ( inlet and / or outlet ) of a frac tank . by positioning the members 12 and 14 around the pipe 40 and then assembling the members 12 and 14 to form the frac nut assembly 10 , the shoulder 30 of the assembly 10 and the flange 42 of the pipe 40 cooperate to effectively capture the assembly 10 on the pipe 40 . the male threads of a hose fitting ( not shown ) can then be threaded into the female threads 28 of the assembly 10 to connect the hose to the pipe 40 and , consequently , the interior volume of the frac tank . in a similar manner , the female threads 28 of the assembly 10 are also adapted to secure a cap ( not shown ) for the purpose of closing the tank port fitting and permit transporting of the tank . because of their general shape , the members 12 and 14 are nearly duplicates or mirror images of each other . for example , their full - lugs 16 and half - lugs 22 and 24 can be ( and are preferably ) identical to each other . their shoulders 30 are also preferably identical . however , the members 12 and 14 must differ , at least in terms of their threads 28 , in order for their threads 28 to circumferentially align when the members 12 and 14 are mated to form a continuous female threaded form within the assembly 10 . the half - lugs 22 and 24 of the members 12 and 14 are mutually configured to permit assembling and securing of the members 12 and 14 together to form the assembly 10 . each half - lug 22 and 24 is provided with a through - hole 32 ( fig5 - 7 ) so that each pair of through - holes 32 defines a bolt hole that permits the members 12 and 14 to be secured together with bolts 34 ( fig1 and 2 ). the full - lugs 16 and the “ composite ” lugs formed by each pair of half - lugs 22 and 24 extend radially from the outer circumference 26 of the assembly 10 to enable the assembly 10 to be rotated with a hammer or other tool for the purpose of disconnecting a hose ( or removing a cap ) from the frac tank pipe 40 . notably , the heads of the bolts 34 are recessed within the through - holes 32 and completely beneath the surfaces of the half - lugs 22 and 24 so as not to interfere with a hammer that is being impacted against the half - lugs 22 and 24 . in addition , the assembly 10 can be disassembled from the pipe 40 by removing the bolts 34 to completely disassemble the assembly 10 . the half - lugs 22 and 24 of the members 12 and 14 are also mutually sized and oriented to facilitate the rotation of the assembly 10 through impacts with a hammer or other heavy tool . in particular , the half - lugs 22 and 24 of each member 12 and 14 define a portion of a planar radial surface , and the planar radial surfaces of the members 12 and 14 are complementary to define a planar radial interface 36 between the members 12 and 14 when mated to form the assembly 10 . notably , the planar radial surfaces defined by the half - lugs 22 and 24 uniformly mate in a surface - to - surface manner over their entire surfaces , starting at their innermost radius at the shoulder 30 and terminating at their outermost radius defined by the radially distal end of each half - lug 22 and 24 . as a result , the impact of a hammer against one half - lug 22 or 24 is uniformly distributed to the second half - lug 22 or 24 of the same pair , and also transmitted to the threaded interface between the assembly 10 and a threaded port fitting of a tank . furthermore , the planar radial interface 36 lies on a diameter of the assembly 10 so that the torque delivered to the assembly 10 is maximized by a hammer traveling in a direction generally tangential to the outer circumference 26 of the assembly 10 . various materials and processes can be used to manufacture the members 12 and 14 . the assembly 10 can have a wide range of sizes that will depend on the size of the pipe 40 and the hose fitting to which it is to be connected . nonlimiting examples are come 4 , 6 and 8 inch ( about 10 , 15 and 20 cm ) sizes used in the industry . suitable axial lengths for the assembly 10 will also depend on the size of the pipe 40 and hose fitting . the threads 28 are preferably acme threads . for an 8 - inch application , a suitable thread 28 has a pitch of about 0 . 354 inch ( about three threads per inch ). fig9 represents a frac nut assembly 50 according to another embodiment of the present invention . the assembly 50 of fig9 is similar to the assembly 10 of fig1 through 8 , with the most notable difference being that the annular shape of the assembly 50 is comprised of three entirely separate members 52 , 54 and 56 , represented as thirds of the assembly 50 , such that each member 52 , 54 and 56 roughly defines a 120 degree arc . as a result , the planar radial surfaces of the members 52 , 54 and 56 and the planar radial interfaces 62 they define lie on different radials of the assembly 10 set about 120 degrees apart . each member 52 , 54 and 56 has a pair of half - lugs 58 that are located at its arc extremity and extend radially from the outer circumference 60 of the assembly 50 ( defined by the assembled members 52 , 54 and 56 ) to define three composite lugs 64 that serve as the only lugs of the assembly 50 . as with the assembly 10 of fig1 through 8 , the interior circumference of the assembly 50 has threads ( not shown ) for threadably engaging male threads conventionally provided on a fitting of a hose adapted to be connected to a frac tank . the three - piece frac nut assembly 50 of fig9 can be manufactured from raw materials or by sectioning an existing one - piece frac nut through its lugs and machining through - holes in each resulting half - lug 58 to define bolt holes ( not shown ) for securing the members 52 , 54 and 56 together . other aspects and advantages of the assembly 50 of fig9 are consistent with the description of the assembly 10 of fig1 through 8 . while the invention has been described in terms of a specific embodiment , it is apparent that other forms could be adopted by one skilled in the art . for example , the frac nut assembly could differ in appearance and construction from the embodiment shown in the figures , and various materials could be used in its construction . therefore , the scope of the invention is to be limited only by the following claims .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

the method for producing the high solids suspension drug delivery system of the present invention essentially involves the combination of three processes : 1 .) pre - encapsulation of active pharmaceutical ingredients , 2 .) compounding of the liquid suspension comprising the lipid source in which dry solids are to be dispersed , and 3 .) molding of the resultant liquid suspension into suitable dosage form . in the pre - encapsulation stage , drug actives are prepared prior to being mixed in with the separately prepared melted lipid system . basically , any drug may be prepared for use with the delivery system of this invention as long as it exists as a dry particle . the drug actives are pulverized to within a discrete particle size range of from about 10 microns to 300 microns . a smaller particle size will present a greater overall surface area of itself to be encapsulated , thus rendering the encapsulation effect of the drug active to be more efficient . the taste masking and , to some extent , the controlled release capabilities of the present invention depend on the effectiveness of encapsulation of the drug active . the hydrophobic nature of the encapsulating film retains the taste associated with the hydrophilic drug active . encapsulation also prevents the early release of the drug to the animal &# 39 ; s system . a solvent system containing a filming agent is mixed with the drug particles and blended at slow speed in a planetary mixer . the solvent can be water or ethanol ; the filming agent may be ethylcellulose such as that marketed under the trademark ethocel ®. the filming agent , being hydrophobic , surrounds and coats the hydrophilic drug particles , forming micelles . the filming agent solvent solution is slowly added to the drug particles so that enough individual particles will adhere together to form larger granules having a size of approximately 300 - 500 microns . the degree of encapsulation can vary depending upon the number of layers of filming agent solvent solution applied . for taste masking purposes , however , extensive coating is not required . the film coating will have a thickness of about 1 micron or less . there exist various standard pharmaceutical coating techniques that are suitable for use with this invention , depending on the filming agent , type of active ingredient that is to be coated , and the drug release objective , such as immediate release vs . sustained release . prior to granulation with the filming agent solvent solution , the active drug particles may be blended with a disrupting agent . the disrupting agent is formed of dry material particles which are also hydrophilic , facilitating the granulation that occurs during the encapsulation process . it is capable of rupturing the encapsulation so that immediate release of the drug active upon ingestion by the animal can be achieved . one such type of disrupting agent may comprise a sodium starch glycolate marketed under the trademark explotab ® this material will expand in the presence of moisture and will therefore burst the encapsulation surrounding it . water is naturally present in gastrointestinal fluids and is able to pass by osmosis through the semi - permeable membrane of the film covering the particles . the water thus causes the starch to expand rapidly , blowing out the active particle from its encapsulation . inner layers of encapsulation are thus exposed to moisture with each successive outer layer being burst , leading to a chain reaction and relatively rapid disintegration of the product . the granulated blend of drug active particles is then dried to remove the solvent solution . the material may be tray dried or continuous dried in a floating bed type of device . the dried material is then screened between a 40 to 60 mesh screen to ensure particle size of 200 to 500 microns . the dried material can be stored for later use or may be blended with yet other dry materials , i . e ., other drug actives , excipients , etc ., in preparation for the compounding phase , in which the materials are enveloped by a continuous lipid coating within the lipid suspension . compounding is the process for dispersing dry solids formed into discrete particles , usually hydroscopic in nature , into a liquid system primarily comprised of lipids by which the dry solids are coated . it is this process that creates the carrier vehicle to transport the drug and for other desired materials which are also formed into discrete particles . the source of lipids can consist of a single component “ hard butter ”, which refers to a lipid system that has characteristics and / or a solid fat melting index similar to cocoa butter and is similar in rapid meltdown characteristics . typical lipids include , but are not limited to , partially hydrogenated vegetable oil , soybean oil , cottonseed oil , palm oil and palm oil and palm kernel oil . the lipid system could also consist of petroleum wax , vegetable or animal stearines , or a high solids sharp melting point vegetable fat , or also combinations of hard butters and stearines in order to achieve a high melting point along with the rapid meltdown . rapid meltdown also relates to rapid solidification , which is critical in the molding process to avoid the separation of solids in suspension from the liquid compound medium . it is also possible to use mineral oil or petrolatum as the liquid hydrophobic system . the lipid source is melted to the appropriate temperature , which can range from approximately 90 ° f . to 160 ° f . the lipid should not be allowed to get too hot or it will lose its lubricity . a surfactant , such as lecithen , is added to insure optimum coating of the hydrophilic solid materials that are to be introduced into the melted lipid system . optimally , the lethicen should be present in a concentration in a range between 0 . 5 to 1 . 0 % of the melted lipid system . other types of surfactants may also be utilized as long as they have a low hydrophilic to lipophilic balance ( hlb ) ratio , preferably between 1 to 3 . surfactants falling within this hlb ratio should be present in a concentration in a range between 0 . 5 to 25 % of the melted lipid system . typical surfactants include , but are not limited to , acetylated monoglyceriedes , alkyl aryl sulfonate , glycerol monostearate , oleic acid , poly oxyethylene lauric acid , and sodium oleate . once the lipid source has been melted and the surfactant added in , the dry hydrophilic ingredients are slowly added in for coating . the dry ingredients comprise the granulated encapsulated material prepared separately , and also other non - encapsulated material as discussed above . the lipid system is able to receive a significant amount of dry material such that the resultant suspension may comprise 20 - 40 % by weight lipophilic material , trapping 60 - 80 % by weight dry hydrophilic material . the suspended particles can range from a fraction of a percent of any particular particle type up to 80 % by weight , with the total of all particles not exceeding 80 % by weight of the entire suspension . however , in order to successfully achieve the viscosity characteristics desired for the suspension , the actual lipid phase cannot exceed 40 % of the compound base by weight . likewise , the lipid phase cannot be less than 20 % of the compound base by weight to achieve psuedoplasticity . it is important to maintain a continuous coating of the dry particles by the lipid system , yet not to such an extent that the desired theological characteristics of the suspension is lost . if the lipid is present at less than 20 % by weight of the suspension , the lipid coating will be too thin and will not exist in a continuous film . thus , the compound will appear as a powder . if the lipid is present at greater than 40 % by weight of the suspension , the desired psuedoplastic or thixotropic effect will not be achieved . instead , an oily suspension of granules will result . the size of the particle selected for suspension is also critical . the key to obtaining the desired rheological properties is to be enable the lipid phase to stretch or exhibit polymeric properties . with a sufficiently small particle size , ideally 10 - 300 microns , a large surface area exists over which the lipid film must stretch . this results in a continuous lipid film that essentially functions as a semi - permeable membrane with a surface thickness of approximately two microns . although the thickness of the film on the surface of the particles is extremely thin , it is nonetheless continuous and intact . therefore the whole system acts as a lipid material , which will inhibit rapid dissolution in an aqueous system , while still providing a semi - permeable mechanism for release of the drug active . the system is applicable essentially to dry materials that are water - soluble . highly oil - soluble materials would tend to be locked up in the film phase . accordingly , drug actives that are lipophilic would not be suitable for the drug delivery system of this invention , at least for taste - masking purposes . the dry material must be added slowly , as the improper addition of these solid materials will cause the compounded material to flip as if it were an emulsion , with the end result being a non - continuous system that fails to achieve the desired rheological characteristics . if made correctly , there should be no detection in the finished product of the granular nature of the solids added . it is critical when mixing , that the lipid phase have the ability to stretch and exhibit polymeric properties . the dry solids are added slowly to insure continuous filming and coating . improper processing will result in a mix of oil and particles , but the particles will not be coated with the lipid film and the desired pseudoplastic / thixotropic properties will not be obtained . the compounded materials will thicken with time and begin to take on the rheological properties required for this system . the suspension will become pseudoplastic allowing for easy forming , but being resistant to running or dripping unless shear is applied . the product will be homogeneous , having a surface appearance of the hard butter , or lipid , since the lipid is always on the outside of the dry materials as a continuous microfilm . the addition of the dry materials to the lipid system under this process could take between 30 minutes up to one hour ; the timing is generally the same , regardless of the quantity of the suspension to be compounded . the dry materials are best added incrementally , with two to four percent by weight of the total formula weight being added in to the lipid system at two to three minute intervals . the time may vary with the size of the particle . it is a slow process , and each particle must be dispersed within the lipid system . the compound is mixed using appropriate means known to those skilled in the art , such as a planetary mixer , swept surface mixer or a recirculating system . low to medium shear should be applied and should be kept below 1 , 000 rpms . high shear should be avoided as it creates too much friction , which can lead to decreased lubricity of the lipid that will adversely affect its ability to form a continuous film . the various dry solid materials can be compounded into the suspension up to 50 % by volume , with weight not being a factor . as a result , depending on the density of the suspended solids , the weight of the suspended solids within the high solid suspension could be 2 - 3 times the actual weight of the lipid it is suspended into while still maintaining the desired psuedoplastic characteristics . the high solids suspension is not limited by the density of the suspended particles . once the dry solid material is fully dispersed , the suspension is then cooled down to a temperature within a degree or two above whatever the solidification of the lipid base medium is . the suspension may optionally be put through a process called tempering , which is a process of raising and lowering the temperature just above and below the solidification point . this ensures formation of optimum lipid crystal structures ; lipids form polymorphic crystals , which eventually turn into optimum stable crystals . the objective is to form the optimum stable crystals quickly or use a lipid system that is self tempering . once the suspension is properly cooled and tempered it is pumped and metered into an appropriate mold where it is cooled at temperatures 10 ° to 40 ° f . below the solidification point of its lipophilic medium . this will result in a slight shrinkage because of the increased densification of the lipophilic phase once it turns into crystalline material . the shrinkage allows for rapid release from the mold . the finished product can be provided in various dosage forms and shapes depending upon the configuration of the mold . various other designs or indicia may be placed on the product , such as product name , numbers , drawings , etc . once formed , the product is packaged and prepared for storage . it is also possible to mold the product in large blocks for storage . these blocks can be melted down at a later time for appropriate dosage molding . alternatively , the liquid suspension could be super cooled below the actual crystallization point of the lipophilic material through a heat exchanger and then sheeted in a semi - soft format . it is then dropped through forming rolls containing the design or configuration that would emboss the final desired shape on the super - cooled sheet . once this sheet leaves the embossing rolls , cool air will set it rapidly . the following examples show ingredients and concentrations thereof for preparing various veterinary products comprising the drug delivery system of the instant invention . for each example , table a shows the formulation for preparing the pre - encapsulated drug active . table b shows the formulation for compounding the lipid base and dry materials for preparing the high solids suspension . while the examples herein are for specific drugs , it is to be understood that the preparation methods are applicable for any type of drug , whether for animal or human use . the range of drugs that can be carried in the system is very wide , and can comprise analgenics , anti - inflammatory agents , gastrointestinal medications , hormone products , cardiovascular preparations and immunoglobulins to name a few . many other types of drugs and products can also be carried as will be understood by those skilled in the art . 1 . blend drug active particles with explotab ® ( sodium starch glycolate ) in a 5 qt . planetary mixer . 2 . granulate with 4 % ethocel ® filming agent solution ( ethocel ® and ethanol ) by slowly adding a small stream of solution to the dry mix while mixing at slow speed . 3 . allow granulated material to tray dry until solvent is removed . 4 . screen through # 40 mesh screen to ensure particle size of between 200 - 500 microns . 1 . melt duratex ( vegetable stearines ) in jacketed mixing bowl ( 140 °- 150 ° f .) 3 . add and blend lecithin ( may be able to reduce heat to 135 ° f .) 5 . slowly add dry blend in incremental amounts every few minutes to melted fats ( with stirring ) and stir until smooth with no lumps ( approximately 1 hour ). maintain mixing and lower temperature 135 ° ( tempering ) then mold . 6 . cool at 70 ° f . until compound solidifies and shrinks . then flip mold to remove individual doses ; identification coded by reverse embossing within each mold . the method of this invention , therefore , allows for the delivery of pharmaceuticals in a solid delivery system that preserves the taste masking and controlled release characteristics that have been imparted to the pharmaceuticals through microencapsulation prior to compounding into the high solids suspension . the product thus prepared allows for a more effective delivery of required dosages and a more predictable controlled rate of delivery . the pseudoplastic nature of the high solids suspension allows it to become a carrier of other materials as well , thus creating more options with respect to which type of drugs are to be delivered orally and also with respect to their rate of release within the animals &# 39 ; system . uncoated time release pellets and other excipients are readily compounded into the lipid system . therefore , because there is no damage during molding procedures , the timing of release considerations of any drug are not restricted . the intact delivery of the drug actives allows for greater predictability of time release and greater certainty of ingestion by the subject recipients . the high solids suspension is very versatile and presents a number of options in selecting a final delivery form . because the products formed from the high solids suspension are intended for both animal and human use , different considerations come into play when preparing the product for the respective recipient . with respect to selection of the lipid base , chewing texture characteristics may be important . humans may have an aversion to waxy textured chewable products and would generally prefer a melt - in - the - mouth sensation . accordingly , a lipid having a melting range from about 90 ° to 100 ° f . would be used as the lipid source when preparing products for human consumption . animals generally have no objection to a waxy tasting substance , so a higher melting point lipid may be used when preparing products for animal consumption . taste masking is more readily accomplished with the high solids suspension because the suspending base is comprised of lipophilic material that envelopes other hydrophilic materials , i . e ., drug actives , pellets , disrupting agents , etc . flavorings thus need only be used to a level that is required for the resultant lower percentage lipophilic phase . this results in a very high flavoring effect with only the necessity of flavoring the 20 %- 40 % lipophilic portion of the formula , as opposed to the entire mass . lipophilic flavors can often be superior as masking media because of their solubility compared to water - soluble flavors . by incorporating flavors into the molded product , certain food types can be imitated . for instance , cheese flavorings could be added to cube shapes , or meat flavoring could be added to bone shapes . the high solids suspension created by the method of this invention produces a chewable product for delivering intact pharmaceutical actives upon ingestion by the subject recipient such that the encapsulation which affects the taste masking and controlled release characteristics of the drug is preserved due to the formation of the lipid crystalline structure in which the particles are suspended . when chewed , the molded suspension will break apart along cleavage lines of the crystalline structure , and will break apart between , rather than through , the suspended particles , thus minimizing or eliminating the actual crushing of the encapsulation surrounding the particles . heat in the subject recipient &# 39 ; s mouth , as well as friction and pressure generated by chewing , melt the crystalline structure . this liquefies the material for ease of swallowing , but does not itself affect the rapid release of active . the density of the product , which can be manipulated to have a specific gravity in the range between 1 . 1 to 2 . 0 , provides additional options for targeting the delivery of the carried drug . advantage can be made of the animal recipient &# 39 ; s anatomy for purposes of controlled release and for avoidance of premature passage of the drug through the animal &# 39 ; s digestive system . the high density of the product causes the digested material to physically drop to the bottom of the animal &# 39 ; s stomach where it will remain until substantially dissolved . having a much greater density than water , the material will have a resistance to being swept along with other digested material . the drug , therefore , will be able to remain in place until its entire dosage is effectively delivered . accordingly , the ability to control the density of the suspension enables increased effectiveness in the target delivery of drugs . as an alternative to a chewable form the product may be delivered to the animal in the form of a bolus , which would be intended for swallowing whole . this form may be desired for sustained release delivery situations . various changes and modifications may be made within this invention as will be apparent to those skilled in the art . such changes and modifications are within the scope and teaching of this invention as defined in the claims appended hereto .

8General tagging of new or cross-sectional technology

embodiments of the invention will be described with reference to the accompanying drawing figures wherein like numbers represent like elements throughout . before embodiments of the invention are explained in detail , it is to be understood that the invention is not limited in its application to the details of the examples set forth in the following description or illustrated in the figures . the invention is capable of other embodiments and of being practiced or carried out in a variety of applications and in various ways . also , it is to be understood that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting . the use of “ including ,” “ comprising ,” or “ having ” and variations thereof herein is meant to encompass the items listed thereafter and equivalents thereof as well as additional items . referring to fig1 there is depicted an embodiment of the invention which utilizes a fixed source laser ( also known as a fixed pump laser ) 100 in combination with a wave selective switch ( wss ) 102 , the wss comprising a single port ( i 1 ) disposed on one side of the wss 102 and a multiplicity ( k ) of ports ( p 1 , p 2 , . . . p k ) on the opposite side of the wss 102 . in this expedient , the wss 102 divides a broadband input signal into n frequency bands ( typically about 100 ghz in width ), each centered at a frequency ω i , and routes the individual demultiplexed signals to output ports p 1 , p 2 , . . . p k . these individual bands are commonly referred to as “ channels ”. it will be appreciated by those skilled in the art that the wss 102 is operable to route a signal from any input port to any output port . a given output port may simultaneously carry multiple channels , up to and including a full spectrum of channels carried on a broadband signal input to the wss 102 . it will be further appreciated that a wss 102 may provide additional capabilities , such as multicasting operations . in this regard , a signal from a given input channel can be distributed among multiple output ports . thus , the wss 102 depicted in fig1 can be employed to deliver entangled photon pairs to a plurality of users . in the example shown and described herein , k users u 1 . . . u k are individually coupled by optical fibers 106 1 - 106 k to output ports p 1 - p k of wss 102 . in this case , the source laser frequency is set to the middle of the wss 102 band : ω 0 = ω 1 + ω n . in order to deliver the entangled photon pairs to any pair of users { u i , u j }, complementary frequency channels m and n ( ω 0 = ω m + ω n ) may be routed to ports p i and p j , respectively . it will be appreciated by those of ordinary skill , that full connectivity can be achieved with a minimal number of fibers ( i . e ., k fibers for k endpoints ). this has the potential to confer a dramatic improvement in network scalability as compared to the conventional fixed , point - to - point arrangement discussed in the foregoing . the wss 102 further permits various combinations of connections to be concurrently set up and established . for example , channels ω 1 and ω 2 can be routed to u 1 , while channel ω n is routed to u 2 and ω n - 1 is routed to u 3 , where ω 0 = ω 1 + ω n and ω 0 = ω 2 + ω n - . in this manner , the following pairs of users { u 1 , u 2 } and { u 1 , u 3 } will receive the entangled pairs . it is unnecessary for each pair of users to obtain an entangled pair in each clock cycle , thus only each qkd connection requires an adequate supply of entangled photon pairs . it is also possible to set up multiple connections between a given pair of endpoints if their demand for qkd bandwidth is greater than the demand that can be supported by a single channel . in fact , due to its non - blocking switch capability , the wss can distribute the available qkd channels in any arbitrary pattern that may be desired , and reconfigure them as needed . if there is a need to support more than k end users , wss units may be cascaded to provide as many output ports as desired . in particular , the network may support more endpoints than there are wavelength channels ( k & gt ; n ), simply by scheduling the connection times and durations . the foregoing detailed description is to be understood as being in every respect illustrative and exemplary , but not restrictive , and the scope of the invention disclosed herein is not to be determined from the description of the invention , but rather from the claims as interpreted according to the full breadth permitted by the patent laws . it is to be understood that various modifications will be implemented by those skilled in the art , without departing from the scope and spirit of the invention .

7Electricity

there is shown in fig1 a delivery device 12 constructed in accordance with teachings of the invention for use in delivering a therapeutic solution to the tissue of a heart , especially a beating heart . the device 12 includes a needle assembly 14 adapted to be coupled to a syringe or other solution supply device 15 . the distal end of the needle assembly 14 is designated generally as 16 and the proximal end is designated as 18 . the needle assembly 14 includes an elongated body or cannula 20 with a sharpened needle tip 22 at its distal end . in the embodiment illustrated , the needle tip 22 is of a smaller diameter than the needle body 20 . a bore 24 extends through the needle assembly 14 and is in communication with the solution supply device 15 . during use , the device 12 may , for example , be inserted through a thoracoscopic port ( not shown ), giving thoracoscopic access to the patient &# 39 ; s heart . the therapeutic solution may then be injected from the solution supply device 12 through the bore 24 of the needle assembly 14 directly into the cardiac tissue in a predetermined quantity . in the currently preferred embodiment of the invention , the solution supply device is a conventional syringe 15 . the syringe 15 includes a hollow cylindrical body 30 having a distal necked - in end 32 . a plunger shaft 34 with a plunger 36 mounted on the distal end thereof and a thumb button 38 mounted to the proximal end thereof is slidably disposed within the cylindrical body , the plunger extending outward from the body . during use , the operator may actuate the plunger 36 by depressing the plunger thumb button 38 to deliver the therapeutic solution . the needle assembly 14 may be coupled to the syringe 15 by any appropriate coupling 39 . in the currently preferred design , a metal hub 39 is utilized which has a large bore for receiving the distal necked - in end 32 of the syringe 15 . the hub 39 further includes a smaller bore which communicates with the large bore and the bore 24 of the needle assembly 14 to establish fluid communication between the syringe 15 and the needle tip 22 for delivery of therapeutic fluid . while the solution supply device has been explained with regard to a syringe 15 , it will be appreciated by those of skill in the art that the supply device can be of any appropriate design . additionally , the supply device may include any appropriate metering device to control the amount of therapeutic substance injected at the injection site . for example , and as explained in international patent application wo 99 / 44656 , the syringe 15 may include a shaft having screw threads or include a ratchet mechanism which permits the plunger button to advance within the cylindrical body only a predetermined distance to permit only a predetermined amount of therapeutic solution to be administered at a given injection site . alternately , the administration of a controlled amount of the therapeutic solution may be facilitated by a computer controlled device . in accordance with the invention , the movement of the distal end 16 of the needle assembly 14 may be controlled by a steering mechanism ( designated generally as 40 ). the needle assembly 14 and steering mechanism 40 are enlarged and schematically illustrated in fig2 - 4 . the steering mechanism includes a steering cable 42 which is coupled to the needle body 20 at a distal attachment 44 toward the distal end 16 of the needle body 20 . the steering cable 42 extends toward the proximal end 18 of the needle assembly 14 and substantially the length of the needle assembly 14 . it will be appreciated by those of skill in the art that the assertion of a tensioning force on the proximal end 46 of the steering cable 42 flexes or arches the distal end 16 of the needle assembly 14 back towards the proximal end 18 of the needle assembly 14 along a dynamic radius of flexure as shown in fig3 . it will be appreciated by those of skill in the art that the needle assembly 14 increasingly arches , that is , the radius of flexure will decrease , as the level of tensioning force on the steering cable 42 is increased . to further control this radius of flexure and the location of the bend , a moveable steering sleeve 50 is provided . the steering sleeve 50 is essentially a hollow tube having an internal bore 52 , which is disposed about the needle body 20 such that the sleeve 50 may slide axially along the needle assembly 14 , the steering cable 42 extending through the bore 52 . as may be seen in fig3 and 4 , during operation , the length of the needle body 20 which remains straight and the length of the needle assembly 14 which arches is determined by the position of the steering sleeve 50 relative to the distal attachment 44 of the steering cable 42 . in this way , the radius of flexure is determined , at least in part , by the position of the steering sleeve 50 as the steering cable 42 is tensioned by the user . in order to move the steering sleeve 50 in the distal and proximal directions along the needle assembly 14 , a steering sleeve adjustment cable 54 is provided . the steering sleeve adjustment cable 54 may be of any appropriate material , so long as it is sufficiently rigid to push the sleeve 50 along needle assembly 14 . the currently preferred embodiment comprises a stainless steel cable on the order of 1 - 3 mm in diameter . those of skill in the art will appreciate that the needle body 20 must be sufficiently rigid to support the steering mechanism 40 , while being sufficiently flexible to permit the needle body 20 to arch or flex as a tensioning force is applied to the steering cable 42 . further , the needle body 40 must be sufficiently resilient such that it remains biased in a substantially straight position to permit its manipulation and use in successive injections if so desired . the needle assembly 14 portion of the device 12 will typically be approximately 300 - 400 mm long . a needle body 20 on the order of 20 - 25 ga . has been found to be adequately flexible , yet sufficiently rigid to permit proper functioning of the steering mechanism 40 and placement of the needle tip 22 . inasmuch as the steering mechanism 40 does not act directly upon the needle tip 22 , it is not necessary for the needle tip 22 to be as rigid as the needle body 20 . moreover , it is preferable that the needle tip 22 be of a smaller gauge in order to facilitate penetration of the needle tip 22 into body tissue and to minimize extravasation of injectate . it has been determined that a 25 - 30 ga . ( e . g ., 28 ga .) cannula is particularly appropriate . while the illustrated needle tip 40 includes a bevel sharp tip 56 , it will be appreciated that an alternate tip geometry or structure may be provided . it will be appreciated that the device 12 can be readily constructed from “ off - the - shelf ” type components so that it may be economically manufactured . thus , the manufacture is not cost prohibitive , and the device may be utilized as a single use , disposable device . during use , the elongated needle body 20 is inserted into the patient &# 39 ; s body cavity through an opening . the opening in a true percutaneous technique is the opening formed by the needle assembly 14 itself as it is inserted into the chest wall and through the ribs to the heart . under these circumstances , the opening is substantially equivalent to the diameter of the device 12 . alternately , the needle may be inserted through a small trocar . if , for example , the device 12 has a diameter of 3 mm , the trocar might have a diameter of 5 mm . the opening might also be in the form of an airtight port 56 in the chest wall as illustrated in fig5 and disclosed , for example in international patent application wo 99 / 44656 . once inserted , the needle assembly 14 is steered into the desired position using the steering mechanism 40 . that is , the physician exerts a tensile force on the proximal end 46 of the steering cable 42 , the distal end 44 of the steering cable 42 being coupled to the needle body 20 toward the body distal end 16 to steer the body distal end 16 along a flexion radius . the physician may adjust the flexion radius by locating the steering sleeve 50 at a desired position along the needle body 20 using the steering sleeve adjustment cable 52 . once appropriately positioned , the physician can pass the sharpened needle tip 22 into the heart tissue 62 , and depressing the syringe 15 thumb button 38 to advance the plunger 36 and deliver the therapeutic substance to the patient &# 39 ; s heart . according to another important aspect of the invention , the delivery device 12 is particularly useful when access to heart tissue is obscured by other tissue and cannot be readily separated . for example , in the procedure set forth in international patent application wo 99 / 44656 , the patient &# 39 ; s lung is collapsed or partially collapsed in order to provide working space in the thoracic cavity . in reoperative patients , however , the lung tissue 60 frequently adheres to the target heart tissue 62 , as illustrated in fig6 . in accordance with the invention , the needle assembly 14 may be advanced directly through the lung tissue 60 and into the heart tissue 62 . in order to facilitate this passage , the smaller diameter needle tip 22 is sufficiently elongated to allow the needle tip 22 to penetrate and advance through the lung tissue 60 and into the cardiac tissue 62 . in this regard , the needle tip 22 is preferably on the order of 1½ to 2 inches ( approximately 35 - 50 mm ) long . it will be appreciated by those of ordinary skill in the art , however , that the needle tip 22 may be shorter or longer , as conditions warrant . in order to determine when the needle tip 22 touches or penetrates the cardiac tissue 62 , an electrode 64 similar to that disclosed in international patent application wo 99 / 44656 , may be provided at the needle tip 22 , the remainder of the needle assembly 14 being insulated therefrom . alternately , the needle tip 22 itself may serve as an electrode if the needle tip 22 is made from a conductive material . electrical connection of this electrode 64 to an electrocardiograph (“ ecg ”) ( schematically illustrated as 66 ) may be made by running an electrical conductor 68 along the needle assembly 14 to the ecg 66 located outside the patient &# 39 ; s body . standard surface ecg leads 70 are likewise applied to the patient . when the electrode 64 enters the patient &# 39 ; s myocardium 62 ( see fig6 ), the event shows as a current injury . in this way , the cardiologist may ensure that the desired positioning and contact is made with the myocardium 62 prior to actuation of the solution supply device 12 . it will be appreciated that the inclusion of the electrode 64 additionally permits the cardiologist to track or electronically mark the injection sites . accordingly , the cardiologist may follow the marking to ensure that adequate therapeutic solution is applied to the target cardiac tissue to provide optimum conditions for a desired effect . additionally , such marking facilitates use of the needle assembly 14 in positions that are typically beyond the line of sight provided by way of a surface incision . it will be further appreciated that alternate marking means and methods may be utilized . for example , markers that may be detected ultrasonographically , radiographically , as , for example , by x - ray or catscan , or electrocardially are appropriate . virtual marking or mapping may likewise be utilized . such methods are disclosed , for example , in u . s . application ser . no . 09 / 393 , 873 . according to another important feature of the invention , in order to stabilize the needle assembly 14 during injection , a platform 74 is provided which contacts the surface of the lung tissue 60 or the pericardium 72 . to ensure contact of the platform 74 with the tissue and the desired stabilization , the platform 74 is moveable relative to the needle tip 22 . in the embodiment illustrated in fig5 - 8 , the movable platform 74 is in the form of a collapsible structure . the platform 74 is preferably in the form of an inflatable and deflatable , or collapsible donut - shaped balloon coupled to the periphery of the needle tip 22 . a platform 74 on the order of 4 - 6 mm in diameter when fully inflated is currently considered adequate to provide desired stabilization against tissue . during insertion into the lung or other tissue 60 obstructing access to the heart 62 , the platform is fully collapsed against the needle tip 22 . in this way , the platform 74 does not interfere with the penetration of the needle tip 22 into and through the lung 60 or other tissue . rather , the platform 74 passes through the lung 60 or other tissue . the collapsible platform 74 is particularly appropriate when the device 12 is utilized in a true percutaneous technique wherein no incision is made in the chest wall . air or other inflating gas is supplied to the platform 74 via an air line 76 . the air line 76 extends from a source of gas at its proximal end 78 , such as from a compressed gas source or a simple syringe ( not shown ), along the needle body 20 and needle tip 22 , to the platform disposed generally toward the distal end 16 of the needle assembly 14 . the deflated , or collapsed , platform 74 is shown in fig7 while the inflated platform is shown in fig8 . the platform 74 is spaced from the distal end 16 of the needle tip 22 to limit the penetration of the needle tip 22 into the cardiac tissue . during use , the collapsed platform 74 is passed through the lung or other obstructing tissue . when the needle tip 22 has penetrated the heart tissue a desired depth , the platform 74 may be inflated to stabilize the needle along the tissue . the platform 74 is preferably inflated , as shown in fig6 and 8 , at a position between the heart tissue 72 or myocardium 62 , and the lung tissue 60 . in this way , the platform 74 limits the depth to which the needle tip 22 penetrates the cardiac tissue 62 . in other words , the platform 74 is preferably spaced from the distal tip 16 of the needle tip 22 a distance equal to the desired needle penetration . it is presently anticipated that the distal surface of the platform 74 will be disposed on the order of 5 - 10 mm from the distal tip 45 , although alternate spacing may be dictated by factors such as the particular therapeutic solution utilized , or the physical characteristics of the tissue upon which the procedure is to be performed . in an alternate embodiment of the invention , the movable platform 80 is in the form of a disk which is axially slidable relative to the needle tip 22 , as shown in fig9 - 11 . in this way , the platform 80 may be moved into position against the penetrated tissue at substantially any location along the needle tip 22 in order to stabilize the needle assembly 14 relative to the tissue . in contrast to the movable platform 74 of fig5 - 8 , which moves by collapsing yet remains stationary relative to the axis of the needle tip 22 , the platform 80 of fig9 - 11 is movable relative to the axis of the needle tip 22 . further , while the collapsible platform 74 is preferably disposed directly against the heart , the platform 80 steadies the needle tip 22 by placement against the first entered tissue , e . g ., the lung tissue . the platform 80 may be of any appropriate shape or size and formed of any appropriate material . it has been determined that a platform 80 formed of stainless steel and on the order of 4 - 6 mm in diameter is particularly suitable . the platform 80 includes a central opening 82 which closely receives the needle tip 22 . in order to prevent the platform 80 from separating from the needle tip 22 , the needle tip 22 preferably includes an enlarged portion 84 . it will be appreciated that the enlarged portion 84 is slightly larger than or presents an interference with the central opening 82 of the platform 80 to prevent the platform 80 from slipping from the end of the needle tip 22 . it will further be appreciated that it is not necessary for the enlarged portion 84 to extend about the circumference of the needle tip 22 , as is shown . rather , the enlarged portion 84 need only present sufficient interference to prevent passage of the platform central opening over the enlarged portion 84 . to facilitate proper placement of the platform 80 against the penetrated tissue , a platform adjustment mechanism 86 is provided . in the illustrated embodiment , platform adjustment mechanism is in the form of an adjustment sleeve 86 , although an alternate arrangement may be provided . the sleeve 86 is slightly larger than and axially slidably disposed about the needle body 20 . in this way , the adjustment sleeve 86 may be manually advanced toward the distal end 16 of the device 12 to contact and move the platform 80 distally and into contact with the tissue . it will be appreciated that the sleeve 86 may likewise be used to position the platform 80 toward the distal end 16 of the needle tip 22 prior to penetration into the tissue . in this way , sleeve 86 moves in the proximal direction as the needle tip 22 penetrates the tissue and the platform 80 contacts the tissue and slides proximally along the needle tip 22 . alternately , the platform 80 may remain in a more proximal location along the needle tip 22 until the needle tip 22 has penetrated the tissue . the sleeve 86 may then be used to advance the platform 80 into contact with the tissue to steady the needle in the tissue . in order to permit the surgeon to utilize the steering mechanism 40 , the steering sleeve 50 preferably is disposed about the platform adjustment sleeve 86 , as may best be seen in fig9 and 10 . in this way , the steering sleeve 50 may be advanced along the body 20 to provide the desired bending of the body 20 in conjunction with a tensioning force exerted on the steering cable 42 . additionally , the adjustment sleeve 86 includes a slot 88 for receiving the steering cable 42 . thus , as the platform adjustment sleeve 86 moves axially along the needle body 20 , the slot 88 moves along the steering cable 42 such that the sleeve 86 does not interfere with the use of the steering cable 42 . it will be appreciated that the platform adjustment sleeve 86 should be fabricated from a material which is sufficiently rigid that it can be pushed axially along the needle body 20 and engage and move the platform 80 , yet sufficiently flexible that it can be readily flexed as the device 12 is steered into a desired position for injection . it has been determined that a semi - rigid elastomer or rubber is particularly suitable for this application , although it is envisioned that other materials may be utilized . in summary , the invention provides a delivery device 12 that may be easily steered into a desired position and utilized for successive injections . the flexibility of the elongated needle body and the versatility of the control mechanism permit the needle to contour the path of delivery to the cardiac and thoracic geometry , providing the cardiologist great latitude in placement of the needle , and precise delivery of the injectant from a remote distance through a relatively small incision . during use , the needle is advanced into position , and the needle tip penetrates the heart tissue , either directly or through adhering lung tissue or other obscuring tissue . an electrode on the needle indicates when the cardiac tissue has been penetrated , and injection site may be marked to ensure injections occurred to desired relative locations . the platform limits the depth of penetration and allows stabilization of the needle against the epicardial surface of the heart or the surface of the lung or other tissue . the solution then can be injected into the cardiac tissue by actuating the syringe . the device is formed of readily available materials and , accordingly , may be economically constructed . all of the references cited herein , including patents , patent applications , and publications , are hereby incorporated in their entireties by reference . while this invention has been described with an emphasis upon preferred embodiments , it will be obvious to those of ordinary skill in the art that variations of the preferred embodiments may be used and that it is intended that the invention may be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications encompassed within the spirit and scope of the invention as defined by the following claims .

0Human Necessities

in one embodiment of a melting plate candle of the present disclosure , a charge of meltable fuel melts in the vicinity of a flame disposed on a wick and forms a pool on the melting plate . the end of the wick may be held at a relatively constant height , so the flame does not move significantly downward from its initial position . as a result , a consistent flame may be maintained by the melting plate candle at a substantially defined , invariant position relative to structural features of the melting plate candle . meltable fuels contemplated include fuels such as paraffin , beeswax , montan wax , carnauba wax , microcrystalline wax , polyvinyl acetate , fatty alcohols , fatty acids , fatty esters , and gels incorporating such fuels . the charges of the meltable fuel may be shaped into forms such as pucks , donuts , chips , slivers , balls , pellets , shavings , particulates , cubes , discs , three dimensional shapes , and wafers , or in any other shape suitable to its function as candle fuel . the fuel used in the context of the present invention may also include volatile or substantially volatile materials such as , without limitation , fragrances , air fresheners , deodorizers , odor eliminators , odor counteractants , insecticides , insect repellants , miticides , herbals , medicinal substances , disinfectants , sanitizers , mood enhancers , aroma therapy compositions , and the like . the charges of the meltable fuel may be colored for the purpose of decoration and / or identification . the shape of the charge of meltable fuel may be designed to fit any given configuration of melting plate and / or wick holder assembly , including without limitation intended , those disclosed herein . for example , the sides of a charge may be shaped complementarily in order to fit the interface between the melting plate and the wick holder assembly using one or more pieces thereof . preferably , the charge of meltable fuel is a single piece that is molded or cut to fit at or near the wick holder assembly . as a general rule , the fuel used preferably has a melting temperature above ambient , but below the temperature of the fuel &# 39 ; s combustion such as that of the flame itself . in one embodiment , the melting plate candle includes a melting plate that may support one or more charges of a meltable solid and / or gel fuel and a wick holder assembly with a wick holder that is in contact with a wick . alternatively , or in addition , the melting plate may be filled with a liquid fuel . the wick holder assembly may further have heat transfer elements , such as heat fins , to improve heat transfer from a flame on the wick to both the meltable fuel and the melting plate with which the fuel is in contact , thereby heating the fuel over a relatively large surface . this , in turn , provides for more rapid melting of the meltable fuel and a more uniformly heated pool of melted fuel , which further provides efficient evaporation of the volatile materials that may be present in the fuel as well as an improved rate of fuel consumption . the melting plate and / or wick holder assembly preferably includes a heat - conductive material , such as , for example , a metal , although any material is contemplated for use . preferably , the heat conductive material is substantially nonflammable . in one embodiment , the melting plate is made of polished aluminum due to its relatively high heat conductivity , low combustibility , light weight , and aesthetically pleasing appearance . further , the melting plate may include a non - heat conductive body with a heat conductive laminate applied thereto . preferred heat conductive laminates include , without limitation , a thin layer of metal , such as foil prepared from any meltable metal , including , for example , aluminum . the melting plate and wick holder assembly therefore provide improved heat transfer from the flame on the wick to the meltable fuel . the melting plate may also be shaped so as to direct the melted or liquefied fuel to a point where fluid communication is established with the wick , such as , a capillary lobe , channel , surface , or a depression of the wick holder assembly or with which the wick holder assembly is in contact . in one embodiment , the melting plate is bowl shaped , but may be any other functionally appropriate shape including , for example , a funnel , a plate with an inclined inner surface , a plate with fluid channels therein , a plate with capillary grooves , and the like , having one or more points where a liquid can pool . the melting plate may also be shaped to control the shape and depth of the pool of fuel , which is burned at the flame that is disposed at the wick . in another embodiment , the candle includes preferably a plate , also called a melting plate or a heat - conductive plate herein , having a first surface that is at least a part of a capillary recess or a capillary pedestal included on the top of the plate . the first surface is fashioned particularly with respect to a second surface that is included in a wick holder assembly . the wick holder assembly is in contact with the plate and preferably includes a wick holder having a wick that is supported by a capillary base . the capillary base preferably includes at least a part of the second surface by which it is in contact with the plate , an internal bottom reservoir , and an external upper reservoir . the wick itself has a top region and a bottom region . the candle also includes a preferably meltable fuel that is situated within or adjacent to the wick holder assembly ; more preferably the meltable fuel is located in the bottom reservoir of the capillary base . a capillary space is preferably formed between the first surface and the second surface , wherein the capillary space has an inlet side and an outlet side and the outlet side is preferably at an edge of the second surface . the inlet side of the capillary space is preferably proximate to the fuel and the outlet side of the capillary space is preferably proximate to the bottom region of the wick . accordingly , the wick is in fluid communication with the fuel of the bottom reservoir that , upon melting , enters the inlet of the capillary space , exits the outlet thereof onto the upper reservoir , and from there preferably enters the bottom region of the wick . the plate itself optionally includes a retaining ridge that preferably serves to course the melted fuel toward the inlet side of the capillary space , or to retard the flow of the melted fuel away therefrom . the capillary base preferably fits into a corresponding structure on the plate . in the case where the capillary base has a convex bottom , the plate preferably includes a capillary recess into which the capillary base fits . alternatively , in the case where the capillary base has a concave or scooped in bottom , the plate preferably includes a capillary pedestal onto which the capillary base fits . either way , the first surface included on the plate at and / or in the capillary recess or capillary pedestal is complementary to the second surface included on the capillary base . preferably , the first surface and the second surface releasably lock together . in this embodiment , each of the first and second surfaces includes interlocking features therefor . for example , in a preferred embodiment , the first surface includes a first snap - on detent member that engages a second snap - on detent member included on the second surface . in another preferred embodiment , the first and second surfaces have complementary spiral protrusions such that the second surface screws into or onto the first surface , as appropriate . the plate preferably includes an insulating space disposed between the heat - conducting material and a support base . the insulating space can be a void or it can include heat - insulating material , such as , without limitation , ceramic , styrofoam , cellulose , and the like . by this inclusion of insulating space , the melting plate can more readily be transported and placed on any surface without concern that the heat of the candle will mar the surface . the wick holder assembly preferably includes a tube extending from a capillary base . the tube serves to hold a wick in place such that a top region of the wick extends up from the tube and the bottom region of the wick extends down toward the upper surface of the capillary base . the upper surface of the capillary base preferably has a flat or concave surface so that melted or otherwise liquefied fuel that is deposited there is able to flow into the bottom region of the wick . the fuel is thus able to flow to the top of the wick and supply a flame disposed at the top region of the wick when the wick is ignited . this upper surface of the capillary base is also referred to herein as the upper reservoir , which is consonant with the function it serves in preferably being in contact with the bottom region of the wick and so providing the wick with liquefied fuel . as further noted elsewhere , the capillary base can have a convex or a concave bottom surface , or combination thereof , depending on whether the capillary base is intended to fit ( a ) into a capillary recess ( appropriate , then , for a convex bottom surface ) or ( b ) onto a capillary pedestal ( appropriate , then , for a concave bottom surface ) or ( c ) into a capillary recess where the capillary base includes a top structure that extends laterally beyond the horizontal dimensions of the capillary recess . with respect to scenario ( c ), the contents stored within the cavity defined by the top structure ( the bottom reservoir , that is ) would first come into direct contact with the top surface of the plate outside of the capillary recess prior to entry into the inlet of the capillary space formed between the capillary base and the capillary recess . in contrast , scenario ( a ) would require that the contents of the bottom reservoir would contact the bottom of the capillary recess where the capillary space inlet would be found , and thus travel by capillary action to the upper reservoir via a wall of the capillary recess that extends up from the top surface of the plate . accordingly , the liquefied fuel is thereby delivered to the upper reservoir where it then comes into contact with the bottom region of the wick . the wick holder assembly preferably further includes a bottom reservoir for holding fuel . the bottom reservoir is defined by a cavity within the capillary base , which can have a convex bottom or a concave bottom . alternatively , the bottom reservoir is an open concavity below the upper surface of the capillary base , which is further described below . the open concavity preferably has a peg extending centrally that connects at the upper underside of the capillary base . more preferably , the peg includes a central longitudinal bore that opens at its bottom that is seated in the capillary recess and extends up to the top surface of the capillary base that defines the upper reservoir . fuel stored within the open concavity , upon melting or otherwise liquefying , will first come into contact with the top surface of the plate , enter the inlet of the capillary surface and head down to the outlet thereof at the edge of the peg . from that point , the liquid fuel heads up the bore of the peg by capillary action and is then deposited on or at the upper reservoir located on the top surface of the capillary base . the capillary base having a convex bottom includes preferably an internal void that further includes , optionally , a first aperture toward or at its bottom and / or a second aperture toward or at its top . the first aperture serves , for example , to place the contents of the bottom reservoir in fluid communication with the bottom of the capillary recess when the capillary base is seated therein . the second aperture serves , for example , to provide a direct path for the wick to extend therethrough and be in fluid communication with the contents of the bottom reservoir . where only the first aperture is in place in this embodiment , liquid fuel will first contact the bottom of the capillary recess , there enter the inlet of the capillary space and travel up to the outlet thereof , which is located at the edge of the top surface , i . e ., the upper reservoir , of the capillary . accordingly , for this embodiment , the capillary recess includes a wall that extends up from the top surface of the plate in order to define an outlet of the capillary space formed between the capillary base and the capillary recess . the outlet so defined is situated such that the liquid fuel collects on or at the upper reservoir , i . e ., the upper surface of the capillary base . where the capillary base having a convex bottom includes the second aperture and not the first aperture , then the fuel will travel to the upper region of the wick by way of the lower region of the wick directly from the bottom reservoir . any fuel in the bottom reservoir that is below the level of the bottom of the wick will not be used . if , however , the first aperture is also included , then liquid fuel in the bottom reservoir has two paths to the upper region of the wick : first , via direct entry into the wick where it extends into the bottom reservoir ; and second , via indirect entry into the wick , as set forth in the immediately preceding paragraph . the capillary base having a concave bottom is preferably designed to seat onto a capillary pedestal . the capillary base of this embodiment preferably includes at least one aperture at the bottom of the capillary base , thus placing the bottom reservoir in fluid communication with the top and / or side of the capillary pedestal , or the top surface of the plate immediately adjacent to the capillary pedestal , or any two or all of the recited locations . surrounding the capillary pedestal is preferably a wall that arises up from the top surface of the plate . the wall has a shape and dimension such that its inner surface forms part of the aforementioned first surface of the plate , and is situated so that the first surface is disposed relative to the second surface included on the capillary base to form the capillary space . the inlet of the capillary space is located at the bottom edge of the concave bottom of the capillary base where that portion of the second surface included on the capillary base forms a capillary space with the first surface included on the plate and wall thereof . from that point , the liquid fuel travels up toward the upper surface of the capillary base in similar fashion as described above with respect to the indirect entry of the liquid fuel in the capillary base having a convex bottom , as set forth above . the wick holder assembly of the present invention preferably also includes a snap fit detent on the bottom surface of the capillary base . preferably , the wick holder assembly further includes a heat fin . the heat fin transmits heat from a flame disposed on the top portion of the wick to , preferably , the plate , or , more preferably , fuel stored in the bottom reservoir , or , yet more preferably , to a charge of fuel that is located in the vicinity of the wick holder assembly . the heat fin preferably has a single surface ; more preferably , the heat fin has multiple surfaces , such as , for example , two surfaces , three surfaces , four surfaces , or more . most preferably , the heat fin includes two surfaces . the surface or surfaces of the heat fin preferably faces the upper or top region of the wick . the wick holder assembly preferably further comprises an aliquot of additional fuel that is proximate to the top region of the wick . upon igniting the top region of the wick , the first fuel to become available is the aliquot of additional fuel , which is also referred to commonly as a “ bump ”. the bump preferably provides sufficient fuel so that a sufficient amount of heat is generated and transmitted to the meltable fuel of the bottom reservoir and / or the meltable fuel adjacent to the wick holder assembly such that a sufficient amount of the meltable fuel melts , arrives at the upper reservoir , and contacts the bottom region of the wick in time to provide fuel to the flame before the bump fuel is exhausted . the aliquot of additional fuel can be a meltable solid or a gel or a liquid prior to igniting the wick ; preferably , the additional fuel is a meltable solid . turning now to the figures , fig1 and 2 illustrate one form of a broad concept of a melting plate candle 1 . in this general form , a heat conductive melting plate 2 conducts heat from a flame ( not shown ) located on a wick 3 to a meltable fuel charge 4 resting upon the surface of the melting plate . further , the wick 3 has a relatively large diameter compared to a more typical fibrous wick that commonly has a smaller diameter . the wick 3 is disposed in close proximity to the meltable fuel charge 4 but not in direct contact with the unmelted fuel . preferably the wick is held by a wick holder assembly or clip ( not shown ). the melting plate 2 is heated directly or indirectly by the flame on the wick 3 by radiation , as a result of the exposure of the inner surface 8 of the melting plate to the heat from the flame . the bowl - shaped melting plate 2 has a raised outer shoulder 18 to provide containment for a pool of fuel ( not shown ) melted by the flame on the wick 3 . in other embodiments , the melting plate 2 may have the shape of a tray , a concave plate , or any other configuration that is capable of holding the pool of fuel , and may be shaped so as to funnel and / or channel the liquefied fuel to the wick 3 . further , the melting plate 2 need not be limited to plate structures per se , but may include other non - plate shapes that can perform the same functions described herein . the melting plate 2 may constitute a container in itself , as presented herein , or may be combined with a separate container ( not shown ). the melting plate 2 rests upon a preferably non - conductive base 11 , but alternatively may use legs ( not shown ) of non - conductive and / or insulating material . the purpose of the non - conductive material is to insulate a surface 16 from heat from the melting plate , such as , for example , a table or other heat - sensitive surface upon which the melting plate candle 1 may be placed . in the embodiment illustrated in fig1 , the base 11 has contact points 12 to minimize contact between the base and the melting plate 2 and to create an insulating gap 13 between the melting plate and any surface upon which the melting plate may be placed . the non - conductive base 11 may be constructed of any non - conductive material including , for example , wood , plastic , a non - conductive metal , a polymer , glass , and other materials known to those skilled in the art . the melting plate 2 , or any embodiment thereof , is preferably made from any suitable material , the suitability of which is a function of being substantially heat conductive yet also being substantially nonflammable . more preferably , the suitable material is nonflammable . representative suitable heat conductive materials include , without limitation , brass , aluminum , steel , copper , stainless steel , silver , tin , bronze , zinc , iron , clad materials , heat conductive polymers , ceramics , glass , and / or any other suitable heat conductive material , and combinations thereof . further , the melting plate preferably includes a coating of a surface tension - modifying material applied thereto for purposes of preparing a self - cleaning and / or easily cleaned melting plate , as well as to facilitate flow of melted fuel to , for example , a capillary depression , channel , or other surface in contact with the wick . as an example of a suitable surface - tension - modifying material , a polytetrafluoroethylene coating may be applied to the melting plate surface to provide a coating that has a smooth wetting surface upon which molten wax will generally flow more easily as compared to an uncoated surface . further , the coated surface facilitates removal of residual wax from the melting plate . as shown in fig2 , the meltable fuel charge 4 is in direct contact with the surface of the melting plate 2 to facilitate melting of the fuel charge via heat transfer . in another embodiment , the melting plate 2 is preferably constructed with a non - conductive lower surface to insulate a surface 16 from heat from the flame . in this embodiment , the melting plate 2 may be partially or wholly constructed of a clad material , wherein the top surface of the plate includes a metallic clad material that is bonded to another material . preferably , the material to which the clad material is bound is non - conductive and provides protection to a heat - sensitive surface on which the melting plate may be placed . preferred combinations of materials for the melting plate include a conductive material coated on the external surface of an otherwise non - conductive material , a non - conductive material having an insert of a heat conductive material , or other suitable configurations to permit the melting plate to be easily handled , and / or placed on heat - sensitive surfaces . a wick 3 contemplated for use in the context of the present invention is preferably a conventional consumable wicking material , such as , without limitation , cotton , cellulose , nylon , paper , or the like . by capillary action , liquid fuel transfers through the wick to the flame disposed thereon . alternative preferred wicks 3 are substantially non - consumable , such as those composed of porous ceramics and / or porous metals , fiber glass , metal fiber , compressed sand , glass , metal , and / or ceramic microspheres , foamed and / or porous glass , and / or natural and / or man - made materials , such as pumice , perlite , gypsum , chalk , and the like . further , composite wicks that include consumable and non - consumable wicking materials are usefully employed in the context of the present invention . the wick 3 may be situated at any location on or near the melting plate , provided that at least some of the heat of a flame disposed on the wick is transferable to the stored fuel charge 4 . the stored fuel charge is preferably located in contact with the melting plate ; alternatively , the fuel charge can be included in a wick holder assembly ( described further below ), which , in one embodiment , is configured so that the heat of the flame is transferred thereto and the melted fuel optionally contacts the plate . the heat contained in the plate preferably serves to melt the meltable fuel and / or maintain the liquid quality of the fuel once melted until the melted fuel is transported to the flame and consumed . the heat transference is accomplished via radiation , convection , and / or conduction of the heat energy from the flame to the wick holder assembly and the plate . accordingly , the wick 3 may be centrally located in the melting plate 2 or located off - center . a plurality of wicks 3 is also envisioned in another embodiment of the present invention . in yet another embodiment , a starter bump 6 on the meltable fuel charge 4 is preferably provided in close proximity to the wick 3 to facilitate the lighting of the wick . the starter bump serves to provide a ready source of liquid fuel to the wick 3 when a match or other appropriate source of flame is employed to ignite the wick , which source of flame will melt the starter bump and thus create an initial pool of liquid fuel . in this embodiment , the starter bump 6 may be molded directly into the shape of the meltable fuel charge 4 ; alternatively , the starter bump 6 may be added after molding of the meltable fuel charge . the starter bump is also referred to herein as an aliquot of additional fuel , which , in another embodiment , serves to provide sufficient heat to melt a sufficient amount of the meltable fuel over a sufficient period of time such that the flow of melted fuel preferably reaches the flame before the additional fuel of the bump is fully consumed . in another embodiment of a melting plate candle 20 shown in fig3 and 4 , the wick 3 is provided in conjunction with a wick holder assembly 21 that , preferably , cooperatively engages a complementarily shaped capillary lobe or pedestal 26 on the melting plate 2 . the melting plate 2 is preferably bowl - shaped with a raised shoulder 18 to contain a pool of melted wax or other fuel ( not shown ) and a centrally disposed capillary pedestal 26 . the wick holder assembly 21 is preferably shaped to fit closely over the capillary pedestal 26 and to releasably engage an undercut 24 therein so as to be releasably secured thereon . the undercut 24 is intended to secure the wick holder assembly 21 to the melting plate 2 to minimize the possibility of the wick holder assembly being accidentally unseated from the capillary pedestal 26 . the wick holder assembly 21 preferably includes a wick holder 5 , the wick 3 , and a heat fin 9 . the heat fin 9 facilitates heat transfer from the flame on the wick to a meltable fuel charge 4 . the meltable fuel charge 4 preferably has a cutout portion 30 through which the wick holder assembly 21 may pass . alternatively , the meltable fuel charge 4 is preferably placed adjacent the wick holder assembly 21 on one side thereof ( not shown ). in yet another alternative , the meltable fuel charge 4 is preferably provided in multiple pieces of meltable fuel that can be placed about the wick holder assembly 21 . more preferably , the multiple pieces of the meltable fuel are appropriately shaped ( not shown ) to both fit together when placed about the wick holder assembly 21 . any configuration of the meltable fuel charge 4 is suitable so long as it places the wick 3 and the heat fin 9 each in close proximity to a top surface of the meltable fuel charge , and / or includes conductive material for transferring the flame &# 39 ; s heat to the fuel charge ; or otherwise facilitates heat transfer to the meltable fuel charge , irrespective of the number of pieces of which the fuel charge is composed . here , the meltable fuel charge 4 is shown as a wax puck having a void slot at its center ; other shapes and sizes are contemplated as described herein . fig4 shows the embodiment of fig3 in one preferred operational configuration showing the relationship of the elements in position for lighting of the wick 3 . the melting plate 2 is shown with the wick holder assembly 21 positioned on the capillary pedestal 26 ( not visible ). further , the meltable fuel charge 4 is disposed around the wick holder assembly 21 , with the heat fin 9 and the wick 3 extending through the cutout portion 30 of the meltable fuel charge . the wick holder assembly 21 may be secured in the cutout portion 30 with a small amount of wax backfill after assembly . operationally , the melted wax flows to the bottom surface of the heat - conductive melting plate , where it ultimately enters the inlet ( not shown , but is co - extensive with the undercut 24 ) to the capillary space ( also not shown ) that is formed between the concave underside of the wick holder assembly 21 ( i . e ., the underside of the capillary base 7 ) and the upper surfaces 22 , 23 of the capillary pedestal 26 upon seating the wick holder assembly 21 thereon . the melted wax then travels via capillary action to the angled upper surface 22 and then to the upper , substantially horizontal surface 23 of the capillary pedestal . the wick 3 has an upper region ( visible in the drawing of the wick holder assembly 21 ) and a lower region ( obscured by the tube 5 that is disposed between the heat fins 9 a , 9 b and upon the top surface of the capillary base 7 . the lower region of the wick 3 preferably contacts the substantially horizontal surface 23 of the capillary pedestal 26 . accordingly , the melted fuel of the fuel charge enters the wick 3 via its lower region , and is then consumed by the flame ( not shown ) disposed at the upper region of the wick 3 . in a further embodiment of a melting plate candle 100 and a wick holder assembly 102 shown in fig5 and 6 , the wick holder assembly has a convex capillary base 36 that is disposed within a centrally located capillary depression , such as a capillary recess 106 in the heat conductive melting plate 2 . in one embodiment , the convex capillary base 36 has a sloped bottom wall , such as a conical wall , having a bottom surface that forms an inverted peak that fits into the capillary recess 106 and a top surface that forms a depression . one or more snap - fit detents , such as ribs 110 , may be disposed on the surface of the melting plate 2 . in a preferred embodiment , the ribs 110 are disposed in or around an edge of the capillary recess 106 to secure the wick holder assembly 102 to the melting plate by hooking or snapping onto an end portion 112 of the capillary base 36 . the melting plate 2 is preferably disposed within a non - heat conductive , or insulating , support body 108 for placement on a surface ( not shown ). a preferred form of this embodiment includes a sealing interface 38 between the melting plate 2 and the support body 108 , such as adhesive and / or a tongue and groove fit , thereby preventing fluid flow therebetween . an insulating space 120 between the melting plate 2 and the support body 108 helps to protect the supporting surface 19 from excess heat when a flame 122 is disposed on the wick 3 . the insulating space 120 also reduces heat loss from the melting plate to the support body and supporting surface . a meltable fuel charge 104 is preferably adjacent or included within the capillary base 36 , such that the wick 3 and the heat fin 9 transfer heat thereto . the wick 3 is held within a wick holder 5 ; the wick 3 and the heat fin 9 both extend from the convex capillary base 36 upon , within , or adjacent to which the meltable fuel charge 104 resides . the meltable fuel charge 104 may be integrally molded around the wick 3 , the wick holder 5 , and the heat fin 9 on top of the convex capillary base 36 so as to make an integral unit , or the meltable fuel charge may be integrated with the wick holder assembly 102 , for example included in a cavity included in the capillary base 36 . alternatively , the meltable fuel charge can be constructed as described above with respect to fig3 and 4 ; i . e ., a single piece with a void slot 30 disposed within it or extending from one side , or multiple pieces that fit on the melting plate 2 at and about the wick holder assembly 102 . further , one or more apertures 42 may be provided through the side of the support body 108 into the insulating space 120 to provide ventilation and to help regulate the temperature therein . a bottom portion of the wick 3 preferably rests on a top surface of the convex capillary base 36 or may protrude through an aperture 136 in the convex capillary base to allow fluid communication with a bottom surface thereof . when the wick holder assembly 102 is placed within the capillary recess 106 of the melting plate candle 100 , a capillary space 40 is formed between the bottom surface of the convex capillary base 36 and the top surface 34 of the capillary recess 106 through which liquid fuel ( not shown ) may be drawn by capillary action from the melting plate 2 to the bottom portion of the wick 3 to effectively consume substantially all of the liquid fuel . alternatively , or in addition , an aperture 52 in the side of the wick holder 5 may be disposed adjacent the top surface of the convex capillary base 36 to allow liquid fuel in the depression on the top surface of the convex capillary base to supply the wick 3 . fig7 depicts a further embodiment of a wick holder assembly 200 adapted for use with a melting plate candle 600 having a capillary recess 602 , as depicted in fig8 and 9 . a wick holder 5 , which holds a wick 3 and , preferably , a heat fin 9 , is disposed atop a hollow convex capillary base 60 . an aperture 62 in the top of the hollow convex capillary base 60 allows liquid fuel , such as oil or melted wax , to fill an internal fuel reservoir 74 ( also called herein a lower reservoir ) inside the hollow convex capillary base 60 . the internal fuel reservoir 74 of the wick holder assembly 200 may be initially filled with a second meltable fuel charge ( not shown ). a bottom portion 14 of the wick 3 may protrude through an aperture ( not shown ) in a bottom surface of the wick holder 5 and / or a top surface of the hollow convex capillary base 60 into the internal fuel reservoir 74 to place the wick in fluid communication with the internal fuel reservoir . fig8 shows a further embodiment of a melting plate candle 600 having a wick holder assembly 302 ( similar to that of fig7 ) and a melting plate 2 . the wick holder assembly 302 is preferably disposed within a capillary recess 602 of the melting plate 2 . prior to use , the underside of the convex capillary base 60 preferably contains meltable , but unmelted fuel . upon use , i . e ., upon igniting the wick 3 , heat is transferred to the meltable fuel 104 in the internal fuel reservoir 74 via , in part , the heat fins 9 , of which there is one or more ( two shown in fig8 ), thus melting the fuel . melted fuel flows by gravity through one or more apertures 72 ( one shown ) that is / are located at or toward the lowest point in the convex capillary base 60 . liquefied fuel then moves upward via capillary action through the capillary space 40 that exists between the surface 64 of the capillary recess 602 and the convex capillary base 60 . the wick holder 5 is preferably attached to the heat fin 9 and is disposed above a top surface 76 of the hollow convex capillary base 60 such that a bottom portion 14 of the wick 3 extending out of the bottom end of the wick holder 5 is disposed at the top surface 76 of the convex capillary base 60 where the wick is in fluid communication with the liquefied fuel that emerges from the capillary space 40 at point a . accordingly , a steady supply of fuel is maintained to the wick 3 by being drawn by capillary forces out of the lower reservoir 74 , up through the capillary space 40 in a direction a , and over the top surface 76 of the convex capillary base 60 to the bottom portion of the wick 3 until all of the fuel in the reservoir and capillary recess is consumed . the top surface 76 of the convex capillary base 60 is also referred to herein as the upper reservoir , which is preferably flat or concave in shape . fig9 shows a variation of the wick holder assembly 302 of fig8 ( referred to as wick holder assembly 200 in fig9 ), except that the bottom portion 14 of the wick 3 passes through an aperture ( not shown ) in the top surface 76 of the convex capillary base 60 into the internal fuel reservoir 74 . in this example , liquid fuel reaches the wick 3 via the capillary space 40 as well as via the bottom portion 14 of the wick 3 , which preferably contacts the lowest level of fuel in the reservoir 74 . protrusions , such as ribs 28 within or at the upper edge of the capillary recess 602 , are preferably used to secure the wick holder assembly 200 by interacting with one or more raised protrusions 78 on the convex capillary base 60 . in one embodiment , the ribs 28 may have a snap - fit with the protrusions 78 , and in another embodiment , the ribs 28 may form a spiral pattern on the surface 64 of the capillary recess 602 , such that the protrusions 78 may be screwed into threads ( not shown ) formed between the ribs to secure the convex capillary base 60 within the capillary recess 602 . other preferred designs for securing the wick holder assembly 200 to the plate 2 include any lock and key mechanism , as long as continuity of the capillary space 40 is maintained so that the fuel flow is maintained . although a recessed shape is illustrated in fig8 and 9 for the place where the wick holder assembly 102 , 200 and 302 is seated , the bottom of the wick holder assembly and the upper surface of the melting plate 2 where the wick holder assembly is seated may each have any shape that is at least partially complementary to one another . a pair of shapes is sufficient if the plate - base structure 106 , 602 in the melting plate 2 allows proper fit with the wick holder assembly 102 , 200 , or 302 to form one or more capillary spaces 40 that allows adequate fuel supply to the wick 3 to feed a flame disposed thereon . in some embodiments , instead of a recessed plate - based structure 106 , 602 as in fig5 or 8 , a protruding plate - based structure 26 ( also referred to herein as a capillary pedestal ) can be used as in fig3 and 4 . in other embodiments ( not shown ), when the capillary recess includes a complex pattern or shape , one portion of the shape may be configured for placement of the wick holder assembly , for example , at the head of an animal - shaped depression or at a predetermined point in some other feature to provide an artistic and / or aesthetically pleasing effect . in this way , the placement of one or more wick holder assemblies may form part of a design incorporating the melting plate surface and / or one or more capillary recesses . the capillary recess and capillary base may also be shaped to have only one operative fit to facilitate proper insertion of the capillary base into the capillary recess . as shown in fig1 a - 10d , melting plates 400 , 402 , 404 , and 406 have capillary recesses 408 , 410 , 412 , and 414 , respectively , which may vary by size , depth , and / or surface feature , such as , for example , a flat bottom , a terraced bottom , a dimpled surface , and / or a ribbed surface . capillary recesses contemplated herein may also vary by peripheral shape , profile , number , and how they interface with the wick holder assembly . for example , a capillary recess when viewed from above may have other shapes ( not shown ), such as a character or symbol , as in a logo , a letter , and / or a number , for example . further , complex designs may be utilized such as animal outlines , three dimensional shapes , and / or any other artistic features . for example , fig1 a - 10d illustrate different capillary recesses 408 , 410 , 412 , and 414 that vary by depth ( measured from a bottom surface 80 of the capillary recess to an upper most portion of the capillary recess wall 82 ), width ( measured from the upper most portion of the capillary recess wall 82 on one side of the capillary recess to an opposing portion 86 on the opposite side of the capillary recess ), profile ( for example , flat , curved , pointed , or complex , such as terraced , waved , and the like ), and / or peripheral shape . converse shapes for the receiving structure of the melting plate ( generally , capillary pedestals ) for the wick assembly are contemplated as well . fig1 a - 11h illustrate several capillary recesses and capillary pedestals of various shapes that can be utilized with the various melting plates disclosed herein and variations thereof . for purposes of brevity , a capillary recess will be discussed with the understanding that complementary structure can be used for a capillary pedestal ( for example , a concave bottom surface versus a convex top surface ). each of the capillary recesses 500 and 502 of fig1 a and 11b , respectively , has an oval - shaped periphery 92 , though the bottom surface 80 of fig1 a is flat , and the bottom surface 80 of fig1 b is rounded or curved . similarly , the capillary recesses 504 , 508 , and 512 shown in fig1 c , 11 e , and 11 g have flat bottom surfaces 80 and circular , square , and triangular peripheries 92 , respectively . further , the capillary recesses 506 , 510 , and 514 of fig1 d , 11 f , and 11 h have rounded or curved bottom surfaces 80 and circular , square , and triangular peripheries 92 , respectively . other peripheral shapes ( not shown ) for the capillary recesses contemplated herein may also be used , such as symbols or irregular shapes depicting one or more caricatures , provided that the complementary convex capillary base for such capillary recess is adequately shaped to form a capillary space , for example , between a bottom of the capillary recess and the convex capillary base in question . fig1 - 14 illustrate further embodiments of a melting plate 2 having a capillary recess 106 with elevated side walls 604 divided by a furrow 606 that enables fluid communication between the melting plate and the bottom surface 80 of the capillary recess . in fig1 , the bottom surface 80 of the capillary recess is elevated above a top surface 610 of a surrounding portion of the melting plate 2 , which leaves an unconsumed amount of fuel below the bottom surface of the capillary recess 106 when the flame extinguishes . a wick holder assembly , such as those shown in fig7 - 9 , may be placed in the furrow 606 , and the elevated side walls 604 help to secure the wick holder assembly to the melting plate 2 to reduce the chance of the wick holder assembly being disrupted when the melting plate candle is jarred . the elevated side walls 604 in combination with the wick holder assembly provide a capillary space ( not shown ) by which liquid fuel may be transferred to the wick ( not shown ) in a manner similar to that already described . fig1 and 14 show a variation of the capillary recess 106 shown in fig1 , in which the bottom surface 80 of the capillary recess is depressed below the top surface 610 of a surrounding portion of the melting plate 2 such that melted fuel on the melting plate can be consumed . a pair of ridges 612 along an upper inner peripheral portion of the side walls 604 engages onto or over a convex capillary base ( for example , see the convex capillary base 200 of fig7 ) to hold the convex capillary base in an upright position within the capillary recess 106 . in yet another embodiment , illustrated in fig1 a and 15b , the wick holder assembly 700 preferably includes a peg 701 that extends from the top of the underside of the capillary base 710 to beyond a plane that is defined by the edge 707 thereof . the proximal portion of the peg 701 relative to the capillary base is located in a cavity that opens to the top side of a melting dish ( not shown ), such that the aforementioned edge 707 rests on the melting dish . the wick holder assembly includes one or more attachment sites for one or more wicks ( not shown ), as desired ; the bottom of the wick ( s ) ( not shown ) are in contact with the bottom - most portion of the top reservoir 702 . preferably , the wick assembly also includes one or more heat fins ( not shown ), a top reservoir 702 , a bottom reservoir 703 , and one or more capillary channels 704 . the capillary channels may be ridges carved into the upper surface of the capillary base 710 , or , in another embodiment , may be hollow cylinders or other - shaped hollow conduits by which melted fuel may flow to the upper reservoir . unmelted but meltable fuel is stored preferably in the bottom reservoir 703 . an amount of fuel ( unmelted but meltable ) is also placed in the top reservoir 702 . when the wick ( not shown ) is lit and a flame 705 is disposed thereupon , there is enough additional fuel present in the top reservoir for the flame to heat the wick holder assembly . at least some of the fuel located in the bottom reservoir then melts and flows out from under the edge 707 of the wick holder assembly 700 , thus engaging the edge 707 . in a preferred embodiment , the wick holder assembly 700 includes capillary channels 704 , in which case the melted fuel engages one end of the capillary channels . accordingly , the melted fuel flows up the wick assembly 700 by capillary action and collects in the top reservoir 702 . the melted fuel in the top reservoir contacts the bottom portion of the wick , travels up the wick until it is consumed by the flame 705 . melted fuel that emerges from the edge 707 of the capillary top can also flow back toward the peg 701 . the peg 701 , in one embodiment , includes a hollow longitudinal bore that extends from its distal end up to its proximal end where it connects to the underside of the capillary base 710 . further , the capillary base 710 includes an aperture at or toward the base of the upper reservoir 702 such that the hollow bore of the peg 701 is continuous with the aperture of the capillary base top surface . the distal portion of the peg 701 that extends beyond the plane defined by the capillary base edge 707 is preferably seated in a capillary recess ( not shown ), thereby forming a capillary space . operationally , the melted fuel flows toward the top of the capillary recess where the inlet for the capillary space is . the melted fuel then flows down the capillary space to the bottom surface of the capillary recess at the point of the outlet from the capillary space . the melted fuel can then do an about - face at the bottom edge of the peg 701 and flow up the longitudinal bore of the peg up to the upper reservoir . at the upper reservoir , the bottom region of the wick is preferably in contact with the melted fuel that transited through the peg bore , then up the wick to be consumed by the flame . the various melting plates and wick holder assemblies described herein can also be used with other wick assemblies and melting plates , respectively , such as those disclosed in u . s . patent application ser . no . 10 / 978 , 744 , which is hereby incorporated in its entirety by reference . in many embodiments , the candles disclosed herein may allow a candle to completely consume a wax fuel charge while maintaining the candle flame at the top of the wick holder , thereby maintaining a pre - selected height above the bottom of the melting plate . the candles may also rapidly form a large pool of melted wax or heated liquified fuel that accelerates dispersion of volatile materials contained in the fuel into the surrounding environment .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

azaazulenium salt compounds according to the invention are described hereinafter in detail . in compounds represented by formula ( i ), preferably r 1 , r 2 , r 3 , r 4 , r 5 and r 6 each represents a hydrogen atom , a halogen atom ( f , cl , br and i ), a hydroxy group , a nitro group , a carboxyl group , a sulfonic acid group , a mercapto group or a monovalent organic group having 1 to 30 carbon atoms , including a substituted or unsubstituted alkyl group ( e . g ., methyl , ehtyl , n - propyl , isopropyl , n - butyl , t - butyl , n - amyl , t - amyl , n - hexyl , n - octyl , t - octyl , 2 - ethylhexyl , cyclohexyl , 2 - methoxyethyl , 2 - phenoxyethyl and n - hexadecyl ), a substituted or unsubstituted aryl group ( e . g ., phenyl , tolyl , xylyl , ethylphenyl , methoxyphenyl , ethoxyphenyl , chlorphenyl , nitrophenyl , dimethylaminophenyl , α - naphthyl , β - naphthyl and n - dodecylphenyl ), a substituted or unsubstituted heterocyclic ring group ( e . g ., pyridyl , quinolyl , carbazolyl , furyl , thienyl , pyrazolyl , benzotriazolyl , indazolyl benzoxazolyl , benzothiazolyl , benzimidazolyl and 5 - phenylbenzothiazolyl ), a substituted or unsubstituted aralkyl group ( e . g ., benzyl , 2 - phenylethyl , 2 - phenyl - 1 - methylethyl , bromobenzyl , 2 - bromophenylethyl , methylbenzyl , methoxybenzyl , nitrobenzyl , cyanobenzyl and 4 - dodecylbenzyl ), an acyl group ( e . g ., acetyl , propionyl , butyryl , valeryl , pivaloyl , benzoyl , toluoyl , naphthoyl , phthaloyl , furoyl , trifluoroacetyl , 2 - ethyl - hexanoyl , 2 -( 2 , 4 - di - tert - aminophenoxy ) butyryl and stearoyl ), a substituted or unsubstituted amino group ( e . g ., methylamino , dimethylamino , diethylamino , dipropylamino , acetylamino , benzoylamino , stearoylamino , di ( 2 - hydroxyethyl ) amino , ethyl - 2 - methanesulfonamidoethylamino , morpholino , pyrrolidino , piperidino , methylsulfonylamino and p - dodecylbenzenesulfonylamino ), a substituted or unsubstituted styryl group ( e . g ., styryl , dimethylaminostyryl , diethylaminostyryl , dipropylaminostyryl , methoxystyryl , ethoxystyryl and methylstyryl ), a substituted or unsubstituted alkoxy group ( wherein the alkyl group has the same definition as the alkyl group above ), a substituted or unsubstituted alkylthio group ( wherein the alkyl group has the same definition as the alkyl group above ), a substituted for unsubstituted arylthio group ( wherein the aryl group has the same definition as the aryl group above ), a substituted or unsubstituted heterocyclic thio group ( e . g ., 2 - pyridylthio , 2 - quinolylthio , 2 - benzoxazolylthio , 2 - benzothiazolylthio , 1 , 3 - diethylbenzimidazole - 2 - thioyl , 5 - phenylbenzothiazole - 2 - thioyl ), 1 - phenyltetrazole - 2 - thioyl and 1 - phenylimidazole - 2 - thioyl ), a substituted or unsubstituted carbamoyl group ( e . g ., a carbamoyl group , a methylcarbamoyl group , a diethylcarbamoyl group , a phenylcarbamoyl group , a hexadecylcarbamoyl group and a 2 -( 3 - phenylureido ethylcarbamoyl group ), a substituted or unsubstituted alkoxycarbonyl group ( e . g ., an ethoxycarbonyl group , a 2 - hydroxyethoxy carbonyl group , a hexadecyloxycarbonyl group and a 2 - dodecyloxyethoxycarbonyl group ), a substituted or unsubstituted aryloxycarbonyl group ( e . g ., a phenoxycarbonyl group , a methoxyphenoxycarbonyl group , a nitrophenoxycarbonyl group , a 2 , 4 - di - tert - amylphenoxycarbonyl group and a p - dodecylphenoxycarbonyl group ) or a substituted or unsubstituted arylazo group ( e . g ., phenylazo , α - naphthylazo , β - naphthylazo , dimethylaminophenylazo , chlorophenylazo , nitrophenylazo , methoxyphenylazo , tolylazo , sulfamoylphenylazo , hexadecylphenylazo and dodecyloxycarbonylphenylazo ). preferred groups represented by r 1 include a hydrogen atom , a hydroxy group , a halogen atom ( e . g ., f , cl , br and i ), a substituted or unsubstituted alkyl group having 1 to 20 carbon atoms ( e . g ., methyl , ethyl , n - propyl , isopropyl , n - butyl , t - butyl , n - amyl , t - amyl , n - hexyl , n - octyl , t - octyl , 2 - ethylhexyl , cyclohexyl , 2 - methoxyethyl , 2 - phenoxyethyl and n - hexadecyl ), a substituted or unsubstituted alkoxy group having 1 to 10 carbon atoms ( e . g ., a methoxy group , a propoxy group , a phenoxy group and a benzyloxy group ), a substituted or unsubstituted phenyl group having 6 to 20 to carbon atoms ( e . g ., phenyl , tolyl , xylyl , ethylphenyl , methoxyphenyl , ethoxyphenyl , chlorophenyl , nitrophenyl , dimethylaminophenyl , t - amylphenyl and dodecylphenyl ), -- ocor 7 ( wherein r 7 represents a substituted or unsubstituted aryl group , a substituted or unsubstituted aryl group or a substituted or unsubstituted aralkyl group , each of which contains up to 20 carbon atoms ) and a substituted or unsubstituted amino group ( e . g ., a methylamino group , a dimethylamino group , an ethylamino group , a diethylamino group , a diphenylamino group , a morpholino group , a pyrrolidino group , a piperidino group and a methylsulfonylamino group ). particulary preferred groups represented by r 2 , r 3 , r 4 , r 5 and r 6 include a hydrogen atom , a halogen atom ( e . g ., f , cl , br and i ), a substituted or unsubstituted alkyl group having 1 to 20 carbon atoms ( e . g ., methyl , ethyl , n - propyl , isopropyl , n - butyl , t - butyl , n - amyl , t - amyl , n - hexyl , cyclohexyl , t - octyl , n - octyl , 2 - ethylhexyl , 2 - methoxyethyl , 2 - phenoxyethyl and n - hexyl - decyl ) or a substituted or unsubstituted phenyl group having 6 to 20 carbon atoms ( e . g ., phenyl , tolyl , xylyl , ethylphenyl , methoxyphenyl , ethoxyphenyl , chlorophenyl , nitrophenyl , dimethylaminophenyl , t - amylphenyl and dodecylphenyl ). examples of anionic groups represented by x ⊖ include a perchlorate , a fluoroborate , a sulfoacetate , an iodide , a chloride , a bromide , a p - toluenesulfonate , an alkylsulfonate ( e . g ., a methanesulfonate ), an alkylsulfate ( e . g ., an ethylsulfate ), an alkyldisulfonate ( e . g ., an ethanedisulfonate ), a benzenedisulfonate ( e . g ., a 1 , 3 - benzenedisulfonate ), a halosulfonate ( e . g ., a chlorosulfonate ), a picrate , a tetracyanoethylene anion , a tetracyanoquinodimethane anion , a benzotriazole - 5 - sulfonate , a 4 -( 2 - methylthiotetrazole - 1 - yl ) benzenesulfonate , an acetate , a benzoate , a sulfuric acid ion , an oxalate , a fumarate and a formate , which may form an inner salt when they are substitutents bonded to any group represented by a , r 1 , r 2 , r 3 , r 4 , r 5 , r 6 or r 7 . preferred organic groups represented by a are those represented by the following formulae ( ii ) to ( xiii ): formula ( ii ): ## str3 ## wherein r 1 to r 6 have the same meaning as defined in formula ( i ). formula ( iii ) ## str4 ## wherein r 1 to r 6 have the same meaning as defined in formula ( i ). formula ( iv ): ## str5 ## wherein r 1 to r 6 have the same meaning as defined in formula ( i ), r 10 represents a hydrogen atom , a nitro group , a cyano group , an alkyl group having 1 to 20 carbon atoms ( e . g ., methyl , ethyl , propyl and butyl ), an aryl group having 6 to 20 carbon atoms ( e . g ., phenyl , tolyl , xylyl and dodecylphenyl ) or an aralkyl group having 7 to 20 carbon atoms ( e . g ., benzyl , phenylethyl , methoxybenzyl and t - amylbenzyl ) and m is 0 , 1 or 2 . formula ( v ): ## str6 ## wherein r 1 to r 6 , x ⊖ and n have the same meaning as defined in formula ( i ). formula ( vi ): ## str7 ## wherein r 1 to r 6 , x ⊖ and n have the same meaning as defined in formula ( i ), r 1 &# 39 ; has the same meaning as r 1 , and r 2 &# 39 ; to r 6 &# 39 ; have the same meaning as r 2 to r 6 , respectively . formula ( vii ): ## str8 ## wherein z 1 represents a non - metallic atomic group necessary for the forming a 5 - or 6 - membered heterocyclic ring , r 11 represents a substituted or unsubstituted alkyl group having 1 to 20 carbon atoms , preferably 1 to 6 carbon atoms , a substituted or unsubstituted aryl group having 6 to 30 carbon atoms , preferably 6 to 16 carbon atoms , a substituted or unsubstituted aralkyl group having 6 to 30 carbon atoms , preferably 6 to 16 carbon atoms , or an allyl group , and p is 0 or 1 . of the heterocyclic rings formed by z 1 , preferred rings are nitrogen - containing heterocyclic rings such as pyridine , thiazole , benzothiazole , oxazole , benzoxazole , naphthoxazole , naphthothiazole , imidazole , benzimidazole , naphthoimidazole , 2 - quinoline , 4 - quinoline , isoquinoline , indole and indolenine ; and these nitrogen - containing heterocyclic rings may be substituted with a halogen atom ( e . g ., f , cl , br and i ), a substituted or unsubstituted alkyl group ( e . g ., a methyl group , an ethyl group , a sulfoethyl group , a sulfopropyl group , a sulfobutyl group , a hydroxyethyl group , a propynyl group , an isopropyl group , an octyl group , a hexadecyl group , a methoxyethyl group and a t - amyl group ), a substituted or unsubstituted aryl group ( e . g ., a phenyl group , a tolyl group , a xylyl group , a chlorophenyl group and a methoxyphenyl group ), a substituted or unsubstituted aralkyl group ( e . g ., a benzyl group , a 2 - phenylethyl group , a 3 - phenylpropyl group , an α - naphthylmethyl group , a methylbenzyl group , a chlorobenzyl group and a methoxybenzyl group ), a substituted or unsubstituted alkoxy group ( e . g ., a methoxy group , an ethoxy group , a 4 - sulfobutoxy group and a 3 - sulfopropyl group ), a nitro group , a hydroxy group or a carboxyl group . of these heterocyclic rings , particularly preferred are n - alkyl or n - substituted alkyl benzothiazole rings , n - alkyl or n - substituted alkyl benzimidazole rings , a 2 - or 4 - quinoline ring and an indole ring . wherein r 12 represents a substituted or unsubstituted aryl group . particularly preferred groups represented by r 12 are substituted or unsubstituted phenyl groups having 6 to 20 carbon atoms or substituted or unsubstituted naphthyl groups having 10 to 30 carbon atoms . examples of such groups include phenyl , tolyl , xylyl , biphenyl , α - naphthyl , β - naphthyl , methoxyphenyl , dimethoxyphenyl , trimethoxyphenyl , ethoxyphenyl , diethoxyphenyl , chlorophenyl , trichlorophenyl , bromophenyl , dibromophenyl , tribromophenyl , ethylphenyl , diethylphenyl , nitrophenyl , aminophenyl , dimethylaminophenyl , dibenzylaminophenyl , dipropylaminophenyl , morpholinophenyl , piperidinylphenyl , piperazinylphenyl , diphenylaminophenyl , acetylaminophenyl , benzoylaminophenyl , acetylphenyl , benzoylphenyl , cyanophenylmethanesulfonamidophenyl , di ( 2 - hydroxyethyl ) aminophenyl , n - ethyl - n -( 2 - methanesulfonamidoethyl ) aminophenyl , and 4 - dimethylamino - 2 - methylphenyl . wherein r 13 represents a monovalent group derived from a 5 - or 6 - membered heterocyclic ring . preferred heterocyclic rings represented by r 13 are pyridine , thiazole , benzothiazole , oxazole , benzoxazole , naphthothiazole , naphthoxazole , imidazole , benzimidazole , naphthoimidazole , 2 - quinoline , 4 - quinoline , isoquinoline , indole , indolenine , furan , thiophene , benzofuran , thionaphthene , dibenzofuran , carbazole , phenothiazine , phenoxazine , 1 , 3 , 4 - thiadiazole , 1 , 3 , 4 - triazole , 1 , 3 , 4 - oxadiazole and pyrazole , as well as substituted groups thereof . of these heterocyclic ring groups , particularly preferred groups are heterocyclic ring groups having up to 30 carbon atoms that may be substituted with a substituent such as a hyrdroxy group , a halogen atom ( e . g ., f , cl , br and i ), a nitro group , a carboxyl group , a sulfonic acid group , a substituted or unsubstituted alkyl group having 1 to 20 carbon atoms ( where the substituents include , for example , f , cl , br , i , a cyano group , a carboxyl group , a hydroxyl group , a sulfo group , an alkoxy group and a substituted or unsubstituted phenoxy group ), a substituted or unsubstituted phenyl group having 6 to 20 carbon atoms ( where the substituents include f , cl , br , i , a cyano group , a nitro group , a hydroxy group , a carboxyl group , a sulfo group , an alkoxy group , a sulfonamido group , a carbonamido group , a sulfamoyl group and a carbamoyl group ), a carbonamido group , a sulfonamido group , a carbamoyl group , a sulfamoyl group , a carboxylic acid ester group and a ureido group . formula ( x ): ## str9 ## wherein r 14 represents a hydrogen atom , an alkyl group or an aryl group and r 12 has the same meaning as in formula ( viii ). preferred groups represented by r 12 are the same as defined in formula ( viii ). preferred groups represented by r 14 include a hydrogen atom , an alkyl group having 1 to 20 carbon atoms ( e . g ., methyl , ethyl , propyl and butyl ), a substituted or unsubstituted aryl group having 6 to 20 carbon atoms ( e . g ., phenyl , tolyl , xylyl , biphenyl , ethylphenyl , chlorophenyl , nitrophenyl , aminophenyl , dimethylaminophenyl , α - naphthyl , β - naphthyl , anthryl and pyrenyl ). particularly preferred groups represented by r 14 include a hydrogen atom , an alkyl group having 1 to 17 carbon atoms , and a substituted or unsubstituted phenyl group having 6 to 20 carbon atoms . wherein r 12 has the same meaning as in formula ( viii ). formula ( xii ): ## str10 ## wherein z 2 represents an atomic group necessary for forming an optionally substituted pyran , thiapyran , selenapyran , benzopyran , benzothiapyran , benzoselenapyran , naphthopyran , naphthothiapyran , naphthoselenapyran , tellurapyran , benzotellurapyran or naphthotellurapyran ring ; l is 0 , 1 or 2 , r 15 and r 16 , which may be the same or different , each represents a hydrogen atom , an alkyl group , an alkoxy group , an aryl group , a styryl group , a 4 - phenyl - 1 , 3 - butadienyl group or a heterocyclic ring group that may have a substituent ; and y represents o , s or se . in formula ( xii ), z 2 preferably represents an atomic group necessary for forming a pyran ring , a thiapyran ring , a benzopyran ring or a benzothiapyran ring ; l is 1 or 2 ; y represents o or s ; and each of r 15 and r 16 independently represents a hydrogen atom ; a straight or branched chain or cyclic alkyl group having 1 to 20 carbon atoms ; a substituted or unsubstituted phenyl group having 6 to 20 carbon atoms ( where the substituents include f , cl , br , i , an alkyl group , an alkoxy group , a carbonamido group , a carbamoyl group , a sulfonamido group , a sulfamoyl group , a ureido group and a carboxylic acid ester group ); a substituted or unsubstituted styryl group having 8 to 20 carbon atoms ( e . g ., styryl , p - methylstyryl , o - chlorostyryl or p - methoxystyryl ); or a substituted or unsubstituted 5 - or 6 - membered heterocyclic ring group ( e . g ., quinolyl , pyridyl , furyl , carbazolyl , imidazolyl , thiazolyl , oxazolyl , benzimidazolyl , benzothiazolyl , benzoxazolyl , 1 , 3 , 4 - thiazolyl , 1 , 3 , 4 - oxadiazolyl and 1 , 3 , 4 - triazolyl ). formula ( xiii ): ## str11 ## wherein r 17 , r 18 , r 19 , r 20 , r 21 , r 22 and r 23 , which may be the same or different , each represents a hydrogen atom , a halogen atom , a hydroxyl group , a nitro group , a carboxyl group , a sulfonic acid group , a mercapto group , or a monovalent organic group , and q is an integer of 0 , 1 or 2 ; provided that any two of r 17 , r 18 , r 19 , r 20 , r 21 , r 22 and r 3 bonded to adjacent carbon atoms may be linked to form a substituted or unsubstituted aromatic carbocyclic or aromatic heterocyclic ring . examples of azaazulenium salt compounds used in the present invention are given below , but the present invention is not to be construed as being limited thereto . of compounds represented by formula ( i ), compounds having an a moiety represented by formula ( ii ) and ( iii ) can be produced in the similar manner as described in angewandte chemie , vol . 78 , no . 20 , page 937 ( 1966 ), by reacting an azaazulene compound with squalic acid or croconic acid in a suitable solvent . ( azaazulene compounds can be synthesized by the method described by nozoe in chemistry and industry , pages 1357 - 1358 ( 1954 ). compounds having an a moiety represented by formula ( iv ) wherein m = 0 can be obtained by using , instead of 1 - formylazulene compounds and azulene compounds described in journal of the chemical society , pages 494 - 501 ( 1960 ), the respective corresponding azaazulene compounds , and carrying out the reaction in a suitable solvent in the presence of a strong acid ; or as described in journal of the chemical society , pages 1724 - 1730 ( 1961 ), by reacting 1 - ethoxymethyleneazulenium salts and , instead of azulene compounds , the corresponding azaazulene compounds in a suitable solvent ; or as described in journal of the chemical society , page 359 ( 1961 ), by heating 2 - hydroxymethylenecyclohexanone with an azaazulene compound in a suitable solvent in the presence of a strong acid . compounds represented by formula ( iv ) wherein m = 1 and m = 2 can be produced in accordance with the description in journal of the chemical society , pages 3579 - 3592 ( 1961 ), by mixing azaazulene compounds with malondialdehydes or glutacondialdehydes in a suitable solvent in the presence of a strong acid . compounds having an a moiety represented by formula ( v ) can be readily obtained by heating azaazulene compounds with glyoxal in a suitable solvent in the presence of a strong acid in accordance with the description in journal of the chemical society , pages 3579 - 3588 ( 1961 ). compounds having an a moiety represented by formula ( vi ) can be obtained by heating 3 - diformylazulene compounds and azaazulene compounds in a suitable solvent in the presence of a strong acid in accordance with the description in journal of the chemical society , pages 494 - 501 ( 1960 ). compounds having an a moiety represented by formula ( vii ) can be obtained by heating 3 - formylazaazulene compounds and heterocyclic quaternary ammonium salt compounds having an active methylene group in a suitable solvent in accordance with the description in journal of the chemical society , pages 163 - 167 ( 1961 ). compounds having an a moiety represented by formulae ( viii ), ( ix ), ( x ) and ( xi ) can be obtained by reacting azaazulene compounds with corresponding aldehyde compounds in a suitable solvent in the presence of a strong acid in accordance with the descriptions in journal of the chemical society , pages 1110 - 1117 ( 1958 ), journal of the chemical society , pages 494 - 501 ( 1960 ) and journal of the chemical society , pages 3579 - 3593 ( 1961 ). compounds having an a moiety represented by formula ( xii ) can be obtained by reacting 3 - formylazaazulene compounds with compounds represented by formula ( xiv ) in a solvent . ## str24 ## wherein z 2 , y , r 15 , r 16 and x ⊖ and l have the same meaning as defined in formula ( xii ). solvents used in these synthesis reactions include alcohols such as ethanol , butanol and benzyl alcohol , nitriles such as acetonitrile and propionitrile , organic carboxylic acids such as acetic acid , acid anhydrides such as acetic anhydride , and cycloaliphatic ethers such as dioxane and tetrahydrofuran . a mixture of butanol or benzyl alcohol with an aromatic hydrocarbon such as benzene or toluene can also be used . the temperature during the reaction may range from room temperature to the boiling point of the solvent used . compounds having an a moiety represented by formula ( xiii ) can be obtained by reacting 1 - formylazulene compounds with azaazulene compounds in a suitable solvent in the presence of a strong acid in accordance with the description in journal of the chemical society , pages 494 - 501 ( 1960 ). an electrophotographic photoreceptor using the photoconductive composition of this invention ( hereinafter referred to as &# 34 ; electrophotographic photoreceptor &# 34 ;) has an electrophotographic photosensitive layer containing one or more of the azaazulenium salt compounds represented by formula ( i ). various forms of electrophotographic photoreceptors have been known . the electrophotographic photoreceptors of the present invention may be in any of the known forms but usually have configurations of the types described below . ( a ) electrophotographic photoreceptors comprising an electrically conductive support provided thereon with an electrophotographic photosensitive layer having an azaazulenium salt compound dispersed in a binder or an electric charge carrier transporting medium . ( b ) electrophotographic photoreceptors comprising an electrically conductive support provided thereon with an electric charge carrier generating layer mainly comprising an azaaulenium salt compound on which an electric charge carrier transporting medium layer is provided . the azaazulenium salt compounds of the present invention act as photoconductive materials . those compounds generate electric charge carriers at an extremely high efficiency upon absorption of light . the electric charge carriers thus generated can be transported through those azaazulenium salt compounds as medium . however , it is more efficient to use an electric charge carrier transporting compound as a medium for transporting the electric charge carriers . the electrophotographic photoreceptors of the type ( a ) can be prepared by dispersing particulate azaazulenium salt compound into a binder solution or a solution of an electric charge carrier transporting compound and a binder , applying the disperison onto an electrically conductive support , and then drying the coating . the thickness of the electrophotographic photosensitive layer thus prepared is generally from 3 to 30 μm , preferably from 5 to 20 μm . the electrophotographic photoreceptors of the type ( b ) can be prepared by vacuum - depositing an azaazulenium salt compound on an electrically conductive support , applying a solution of an azaazulenium salt compound in an appropriate solvent on an electrically conductive support , or applying a dispersion of particulate azaazulenium salt compound in a suitable solvent , or , if necessary , a solvent containing a binder dissolved therein on an electrically conductive support , drying the coating , and then applying a solution containing an electric charge carrier transporting compound and a binder onto the coating , which is then dried . the thickness of the azaazulenium salt compound layer as an electric charge carrier generating layer is generally 4 μm or less , and preferably 2 μm or less . the thickness of the elctric charge transporting medium layer is generally from 3 to 30 μm , preferably from 5 to 20 μm . the azaazulenium salt compounds used for the photoreceptors of the types ( a ) and ( b ) are crushed by means of a suitable dispersion mixer such as ball mill , sand mill , or vibration mill , so that the average particle diameter thereof is reduced to 5 μ or less , and preferably 2 μm or less . if the amount of the azaazulenium salt compound used in the electrophotographic photoreceptors of the type ( a ) is too small , the photosensitivity of the product is poor . on the contrary , if it is too large , the chargeability of the photosensitive layer is poor and the strength of the electrophotographic photosensitive layer is low . the content of the azaazulenium salt compound in the electrophotographic photosensitive layer is generally from 0 . 01 to 2 times by weight , and preferably from 0 . 05 to 1 time by weight , the weight of the binder . the content of the electric charge carrier transporting compound which is added to the receptors as necessary is from 0 . 1 to 2 times by weight , and preferably from 0 . 3 to 1 . 3 times by weight , the weight of the binder . if the electric charge carrier transporting compound which can be used as a binder itself is used , the added amount of the azaazulenium salt compound is preferably from 0 . 01 to 0 . 5 times by weight the weight of the binder . if an azaazulenium salt compound - containing layer is applied on a support to form an electric charge carrier generating layer in the electrophotographic photoreceptors of the type ( b ), the amount of the azaazulenium salt compound used is preferably 0 . 1 times or more by weight the weight of the binder resin . if this amount is less than the above value , a sufficient photosensitivity cannot be obtained . the content of the electric charge carrier transporting compound in the electric charge transporting medium is generally from 0 . 2 to 2 times by weight , and preferably from 0 . 2 to 1 . 3 times by weight , the weight of the binder . if a high molecular weight electric charge carrier transporting compound which itself can be used as a binder is used , other binders are not necessary . in preparation of the photoreceptors of the type ( b ), an electric charge carrier transporting compound such as hydrazone compounds and oxime compounds may be added to the electric charge generating layer as described in japanese patent application ( opi ) nos . 196767 / 85 , 254045 / 85 and 262159 / 85 . in preparation of the electrophotographic photoreceptors of the present invention , additives such as plasticizer and sensitizer may be added together with the binder . an electrically conductive support used in the electrophotographic photoreceptors of the present invention there may be employed metal plates of aluminum , copper , zinc or the like , plastic sheet or plastic film of polyester or the like having an electrically conductive material such as aluminum , indium oxide and sno 2 vacuum - deposited or disperion - coated thereon , or paper treated with an electrically conductive material . as the binder there may be preferably employed a hydrophobic , electrically insulating film forming high molecular weight polymer having a high dielectric constant . examples of such a high molecular weight polymer may include the following compounds . however , the present invention is not limited to these compounds . polycarbonate , polyester , polyester carbonate , methacrylate resin , acrylate resin , polyvinyl chloride , polyvinylidene chloride , polystyrene , polyvinyl acetate , styrene - butadiene copolymer , vinylidene chloride - acrylonitrile copolymer , vinyl chloride - vinyl acetate copolymer , vinyl chloride - vinyl acetate - maleic anhydride copolymer , silicone resin , silicone - alkyd resin , phenol - formaldehyde resin , styrene - alkyd resin , poly - n - vinyl - carbazole . these binders may be used singly or in the form of a mixture of two or more such binders . examples of the plasticizers include biphenyl , biphenyl chloride , o - terphenyl , p - terphenyl , dibutyl - phthalate , dimethylglycolphthalate , dioctylphthalate , triphenylphosphoric acid , methylnaphthalene , benzophenone , chlorinated paraffin , paraffin polypropylene , polystyrene , dilaurylthiodipropionate , 3 , 5 - dinitro - salicylic acid , fluorohydrocarbons and the like . alternatively a silicone oil or the like may be added to improve the surface characteristics of the electrophotographic photoreceptors . as the sensitizers there may be employed chloranil , tetracyanoethylene , methyl violet , rhodamine b , a cyanine dye , a merocyanine dye , a pyrylium dye , and thiapyrylium . electric charges carrier transporting compounds are classified into two types of compounds , i . e ., compounds for transporting electrons and compounds for transporting positive holes . the electrophotographic photoreceptors of the present invention may employ both the two types of compounds . examples of such electron transporting compounds include compounds having electron withdrawing groups , such as 2 , 4 , 7 - trinitro - 9 - fluorenone , 2 , 4 , 5 , 7 - tetranitro - 9 - fluorenone , 9 - dicyanomethylene - 2 , 4 , 7 - trinitrofluorenone , 9 - dicyanomethylene - 2 , 4 , 5 , 7 - tetranitrofluorenone , tetranitrocarbazolechloranile , 2 , 3 - dichloro - 5 , 6 - dicyanobenzoquinone , 2 , 4 , 7 - trinitro - 9 , 10 - phenanthrenequinone , tetrachlorophthalic anhydride , tetracyanoethylene , and tetracyanoquinodimethane . examples of the positive hole transporting compounds include compounds having electron donative groups . if such compounds are high moelcular weight compounds , examples include : ( 1 ) polyvinylcarbazoles and derivatives thereof as described in japanese patent publication no . 10966 / 59 . ( 2 ) vinyl polymers such as polyvinyl pyrene , polyvinyl anthracene , poly - 2 - vinyl - 4 -( 4 &# 39 ;- dimethylamino - phenyl ) - 5 - phenyloxazole , and poly - 3 - vinyl - n - ethylcarbazole described in japanese patent applicatin nos . 18674 / 68 and 19192 / 68 . ( 3 ) polymers such as polyacenaphthylene , polyindene , and a copolymer of acenaphthylene and styrene described in japanese patent publication no . 19193 / 68 . ( 4 ) condensaton resins such as pyrene - formaldehyde resin , bromopyrene - formaldehyde resin , and ethylcarbazole - formaldehyde resin described in japanese patent publication no . 13940 / 81 . ( 5 ) various triphenylmethane polymers as described in japanese patent appication ( opi ) nos . 90883 / 81 and 161550 / 81 . if such compounds having electron donative groups are low molecular weight compounds , examples include : ( 8 ) imidazole derivatives as described in japanese patent publication no . 16096 / 62 . ( 9 ) polyarylalkane derivatives described in u . s . pat . nos . 3 , 615 , 402 , 3 , 820 , 989 and 3 , 542 , 544 , japanese patent publication nos . 555 / 70 and 10983 / 76 , japanese patent application ( opi ) nos . 93224 / 76 , 108667 / 80 , 156953 / 80 and 36656 / 81 . ( 10 ) pyrazoline derivatives and pyrazolone derivatives as described in u . s . pat . nos . 3 , 180 , 729 and 4 , 278 , 746 , japanese patent application ( opi ) nos . 88064 / 80 , 88065 / 80 , 105537 / 74 , 51086 / 80 , 80051 / 81 , 88141 / 81 , 45545 / 82 , 112637 / 79 and 74546 / 80 . ( 11 ) phenylenediamine derivatives as described in u . s . pat . no . 3 , 615 , 404 , japanese patent publication no . 10105 / 76 , japanese patent application ( opi ) nos . 83435 / 79 , 110836 / 79 and 119925 / 79 , japanese patent publication nos . 3712 / 71 and 28336 / 72 . ( 12 ) arylamine derivatives as described in u . s . pat . no . 3 , 567 , 450 , japanese patent publication no . 35702 / 74 , west german patent ( das ) no . 1 , 110 , 518 , u . s . pat . nos . 3 , 180 , 703 , 3 , 240 , 597 , 3 , 658 , 520 , 4 , 232 , 103 , 4 , 175 , 961 and 4 , 012 , 376 , japanese patent application ( opi ) nos . 144250 / 80 and 119132 / 81 , japanese patent publication no . 27577 / 64 , japanese patent application ( opi ) no . 22437 / 81 . ( 13 ) amino - substituted chalcone derivatives as described in u . s . pat . no . 3 , 526 , 501 . ( 16 ) styrylanthracene derivatives as described in japanese patent application ( opi ) no . 46234 / 81 . ( 17 ) fluorenone derivatives as described in japanese patent application ( opi ) no . 110837 / 79 . ( 18 ) hydrazone derivatives as described in u . s . pat . no . 3 , 717 , 462 , japanese patent application ( opi ) nos . 59143 / 79 ( corresponding to u . s . pat . no . 4 , 150 , 987 ), 52063 / 80 , 52064 / 80 , 46760 / 80 , 85495 / 80 , 11350 / 82 , 148749 / 82 and 104144 / 82 . ( 19 ) benzidine derivatives as described in u . s . pat . nos . 4 , 047 , 948 , 4 , 047 , 949 , 4 , 265 , 990 , 4 , 273 , 846 4 , 299 , 897 and 4 , 306 , 008 . ( 20 ) stilbene derivatives as described in japanese patent application ( opi ) nos . 190953 / 83 , 95540 / 84 , 97148 / 84 and 195658 / 84 . however , the electric charge carrier transporting compounds of the present invention are not limited to the above compounds ( 1 ) to ( 20 ), and any known electric charge carrier transporting compound can be employed . these electric charge carrier transporting materials may optionally be used in any combination of two or more such materials . the photoreceptors thus obtained optionally may comprise an adhesive layer or a barrier layer provided interposed between the electrically conductive support and the photosensitive layer . as materials used for such an adhesive layer or barrier layer there may be employed gelatin , casein , polyvinyl alcohol , ethyl cellulose , carboxymethyl cellulose , vinylidene chloride polymer latex as described in japanese patent application ( opi ) no . 84247 / 84 , styrene - butadiene polymer latex as described in japanese patent application ( opi ) no . 114544 / 84 , and aluminum oxide besides the high molecular weight polymers used for the above binder . the thickness of the layers are preferably 1 μm or less . thus , we have discussed the electrophotographic photoreceptors of the present invention in detail . the electrophotographic photoreceptors of the present invention are generally characterized by high photosensitivity and excellent durability . the electrophotographic photoreceptors of the present invention find wide application in fields ranging from electrophotographic copying machines to printers using a laser or cathode ray tube as a light source . the photoconductive composition containing an azaazulenium salt compound of the present invention can be used as a photoconductive layer for video camera tube or a photoconductive layer for solid pickup elements having a light receiving layer provided on the entire surface of a one - dimensionally or two - dimensionally arranged semiconductor circuit for performing signal transfer or scanning . the present photoconductive composition can be also used for a photoconductive layer for solar battery as described in journal of applied physics , vol . 49 , no . 12 , page 5982 ( 1978 ), by a . k . chosh and tom feng . the azaazulenium salt compound of the present invention can be also used as a photoconductive colored particle for photoelectrophoretic system as described by r . m . schaffert , electrophotography , 2nd ed ., 1975 , p . 136 , or a colored particle for dry or wet electrophotographic developer . the azaazulenium salt compound of the present invention can be used to produce a printing plate or printed circuit , e . g ., as follows . the azaazulenium salt compound of the present invention is dispersed into an alkali - soluble resin liquid such as phenol resin together with the above electric charge carrier transporting compound such as oxadiazole derivatives and hydrazone derivatives as described in japanese patent publication no . 17162 / 62 and japanese patent application ( opi ) nos . 19063 / 80 , 161250 / 80 and 147656 / 82 . the dispersion thus obtained is applied on an electrically conductive support such as aluminum , dried , imagewise exposed , developed with a toner , and etched with an aqueous solution of alkali to produce a printing plate or printed circuit having a high resolving power , excellent durability , and high photosensitivity . the present invention is further illustrated with reference to the following synthesis examples and examples , which are for the purpose of illustration only and are not to be construed as limiting the invention . unless otherwise indicated , all parts , percents and ratios are by weight . 4 g of 4 - n , n - dimethylbenzaldehyde , 4 . 1 g of cyclohepta [ b ] pyrrole2 -( 1h )- one ( hereinafter referred to as 1 - azaazulanone ) and 4 . 14 g of sodium iodide were dissoved in 100 ml of methanol . 5 . 3 g of p - toluenesulfonic acid monohydrate was added to the solution and the mixture was heated for 1 hour with stirring . after allowing the mixture to cool to room temperature , the resulting product was filtered , and washed with 100 ml of methanol and 100 ml of acetone , followed by drying to obtain 4 . 4 of the azaazulenium salt ( yield : 37 %; melting point : over 280 ° c .). ______________________________________analysis c h n i______________________________________calc &# 39 ; d for c . sub . 18 h . sub . 17 n . sub . 2 io (%): 53 . 48 4 . 24 6 . 93 31 . 39found (%): 53 . 64 4 . 09 6 . 90 31 . 21______________________________________ 8 . 75 g of 4 - n , n - dimethylcinnamaldehyde and 7 . 25 g of 1 - azaazulanone were dissolved in 200 ml of ethanol . then , 22 . 5 g of 57 % hydriodic acid was added dropwise to the solution and after the mixture was stirred for 1 hour at room temperature , the mixture was heated for 4 hours under reflux . after allowing the mixture to cool at room temperature , the resulting product was filtered and washed with 100 ml of methanol and 100 ml of acetone , followed by drying . 9 . 35 g of the azaazulenium salt was obtained ( yield ; 45 %; melting point : over 280 ° c .). ______________________________________analysis c h n i______________________________________calc &# 39 ; d for c . sub . 20 h . sub . 19 n . sub . 2 io (%): 55 . 83 4 . 45 6 . 51 29 . 49found (%): 55 . 96 4 . 49 6 . 28 29 . 20______________________________________ 1 part of azaazulenium salt compound ( 31 ) synthesized in synthesis example 2 , 5 parts of 4 , 4 &# 39 ;- bis -( diethylamin )- 2 , 2 &# 39 ;- dimethyltriphenylmethane and 5 parts of polycarbonate of bisphenol a ( lexan 121 , a product of ge company ) were added to 95 parts of dichloromethane , and were ground and stirred in a ball mill to form a coating liquid . the coating liquid was applied onto an electroconductive transparent support ( obtained by depositing a film of indium oxide on the surface of a polyethylene terephthalate film 100 μm in thickness and with a surface resistance of 10 3 ω ) by using a wire round rod , followed by drying to prepare an electrophotographic photoreceptor having a single layer tape electrophotographic photosensitive layer of about 8 μm thickness . the resulting electrophotographic photoreceptor was charged with + 400 v by corona discharge at + 5 kv in a static manner by using an electrostatic copy paper testing apparatus ( model sp - 428 , a product of kawaguchi denki k . k . ), and the amount of exposure required for attenuating the electric potential to half , that is , the half decay exposure amount e 50 ( erg / cm 2 ) was measured . as a light source a gallium / aluminum / arsenic semiconductor laser ( oscillating wavelength : 780 nm ) was used . the result was e 50 = 10 . 2 erg / cm 2 . example 1 was repeated , with the exception that , instead of compound ( 31 ) synthesized in synthesis example 2 , the azaazulenium salt compounds shown in table 1 were used to prepare single - layered electrophotographic photoreceptors , and the half decay exposure amount e 50 was measured in the same manner as described in example 1 using positive charging . the results obtained are shown in table 1 below . table 1______________________________________ azaazulenium salt e . sub . 50example no . compound no . ( erg / cm . sup . 2 ) ______________________________________2 ( 4 ) 15 . 83 ( 10 ) 30 . 24 ( 14 ) 11 . 75 ( 22 ) 20 . 86 ( 27 ) 16 . 37 ( 44 ) 17 . 4______________________________________ 5 parts of azaazulenium salt compound ( 4 ) were dispersed in a solution of 5 parts of polyester resin ( molecular weight : about 20 , 000 ; vylon 200 , a product of toyo spinning co ., ltd .) in 50 parts of tetrahydrofuran using a ball mill for 20 hours , and the dispersion was applied onto an electroconductive support ( that was obtained by depositing an aluminum film on the surface of a polyethylene terephthalate film 75 μm in thickness and with a surface resistance of 4 × 10 2 ω ) by using a wire round rod , followed by drying to prepare a charge generating layer of 0 . 5 μm thickness . then , a solution of 3 . 6 parts of p -( diphenylamino ) benzaldehyde n &# 39 ;- methyl - n &# 39 ;- phenylhydrazone ## str25 ## 4 parts of polycarbonate of bisphenol a ( trade name : panlite k - 1300 , a product of teijin limited ) in 13 . 3 parts of dichloromethane , and 26 . 6 parts of 1 , 2 - dichloroethane was applied onto the charge generating layer by using a wire round rod , followed by drying to form a charge transporting layer of 11 μm thickness , to obtain an electrophotographic photoreceptor having an electrophotographic layer containing the two layers . the resulting electrophotographic photoreceptor was charged with corona discharge at - 6 kv for 2 seconds using an electrostatic copy paper testing apparatus ( model sp - 428 , a product of kawaguchi denki k . k .). then , the initial surface electric potential v o was measured , and , after it was allowed to stand in the dark for 30 seconds , the electric potential v s was measured . then , the electrophotographic photoreceptor was exposed to light by using a gallium / aluminum / arsenic semiconductor laser ( oscillating wavelength : 780 nm ) as a light source . in this case , the amount of exposure required for attenuating the electric potential v s ( obtained after allowing to stand in the dark for 30 seconds ) to half , that is , the half decay exposure amount e 50 ( erg / cm 2 ) was measured . the results were as follows : the same measurement was repeated 3 , 000 times . the results showed that v o , v s and e 50 varied quite little (- 610 v , - 530 v and 25 . 9 erg / cm 2 , respectively ), demonstrating that the photoreceptor had good repeating characteristics . example 8 was repeated , except that the azaazulenium salt compounds shown in table 2 were used instead of azaazulenium salt compound ( 4 ) to produce two - layered electrophotographic photoreceptors , and the half decay exposure amount e 50 was measured in the same manner as described in example 8 . the results are shown in table 2 . table 2______________________________________ bisazulenium salt e . sub . 50example no . compound no . ( erg / cm . sup . 2 ) ______________________________________ 9 ( 2 ) 12 . 510 ( 6 ) 9 . 311 ( 9 ) 8 . 812 ( 14 ) 6 . 513 ( 18 ) 12 . 014 ( 22 ) 11 . 715 ( 23 ) 13 . 516 ( 27 ) 10 . 517 ( 31 ) 5 . 818 ( 35 ) 7 . 019 ( 38 ) 8 . 820 ( 40 ) 15 . 321 ( 45 ) 7 . 5______________________________________ with respect to the electrophotographic photoreceptors , the measurement was repeated 3 , 000 times in the same manner as described in example 8 , and it was found that v o , v s and e 50 varied quite little , demonstrating that the electrophotographic photoreceptors were quite excellent in stability . 5 parts of azaazulenium salt compound ( 31 ) obtained in synthesis example 2 , 40 parts of the hydrazone compound used in example 8 and 110 parts of a copolymer of methacrylic acid with benzyl methacrylate ([ η ] 30 ° c . methyl ethyl ketone : 0 . 12 , the methacrylic acid content : 32 . 9 %) were added to 660 parts of dichloromethane , and were dispered therein by using ultrasonic wave that dispersion was applied onto an aluminum plate having a thickness of 0 . 25 mm , the surface of which had been roughened , followed by drying to prepare an electrophotographic printing plate precursor having an electrophotographic layer with a dry - film thickness of 6 μ ` m . then , after the sample was subjected to corona discharge (+ 6 kv ) in the dark so that the surface electric potential of the photosensitive layer was about + 600 v , the sample was exposed to light using a gallium / aluminum / arsenic semiconductor laser ( oscillating wavelength : 780 nm ), and the half decay exposure amount was determined to be 10 . 3 erg / cm 2 . then , after the surface electric potential of the sample was charged to about + 400 v in the dark , it was brought into firm contact with a transparent original having a positive image and was exposed to light imagewise , using a gallium / aluminum / arsenic semiconductor laser ( the oscillating wavelength : 780 nm ) as a light source . then , it was dipped into a liquid developing solution containing a toner prepared by adding 0 . 01 part of soybean lecithin and 5 parts of finely divided and dispersed polymethyl methacrylate ( toner ) into 1 , 000 parts of isoper h ( a petroleum type solvent produced by esso standard co .) to obtain a clear positive toner image . the toner image was fixed by heating at 100 ° c . for 30 seconds . the printing plate material was dipped for about 1 minute in a solution containing 70 parts of sodium metasilicate hydrate in 140 parts of glycerin , 550 parts of ethylene glycol and 150 parts of ethanol , and was washed in water stream with brushing lightly to remove the part of the electrophotographic layer where the toner did not adhere , thereby to obtain a printing plate . a similarly obtained latent electrostatic image was also subjected to magnetic brush development ( instead of the developing liquid ) using a toner for xerox 3500 ( a product of fuji xerox c ., ltd .) and was fixed by heating to 80 ° c . for 30 seconds . then , the part of the photosensitive layer where the toner did not adhere was removed using an alkaline solution , to obtain a printing plate . the printing plates thus prepared were used for ordinary printing by a hamada star 600 cd offset printing machine . as a result , 50 , 000 sheets of clear prints free of stain were obtained . while the invention has been described in detail and with reference to specific embodiments thereof , it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof .

6Physics

fig1 generally shows a peristaltic pump of the present invention with a housing generally indicated at 10 . the pump housing 10 has an inlet 12 and an outlet 14 . the pump housing 10 further has a base 16 and a center casing 18 with side wall panels 20 and 22 fixedly attached to each side of the center casing 18 by screw threaded fasteners 24 . in fig2 and 3 a drive shaft 26 is shown rotatably attached to side walls 20 and 22 and attached at end 28 to a motor ( not shown ). the drive shaft 26 is mounted within a set of bearings 30 which are preferably mounted within side walls 20 , 22 . the casing 18 and side walls 20 , 22 form an arcuate chamber 32 , and the rotor 36 is situated coaxially within arcuate chamber 32 . the rotor 36 is mounted on the drive shaft 26 and the rollers 34 are rotatably mounted by bearings 38 on shafts 40 which are fixedly attached at opposite ends of the rotor 36 . each roller 34 is rotatably attached between rotor arms 37 . an o - ring 39 is situated within relief 41 and acts as a mechanical spring , absorbing variations in manufacturing tolerances within the arcuate chamber 32 . a flexible conduit 44 having a fixed length is circumferentially spaced along the arcuate chamber wall 46 . the flexible conduit 44 has an inlet opening 48 and an outlet opening 50 corresponding to the pump inlet 12 and outlet 14 , respectively . the flexible conduit 44 transports the fluid being pumped through its interior . an adjustable band 52 is circumferentially positioned between the rollers 34 and the flexible conduit 44 . the adjustable band 52 holds the flexible conduit 44 against the chamber wall 46 . the adjustable band 52 is pivotally attached to the pump housing 10 at one end 54 and is adjustably ( and pivotally ) attached to the pump housing 10 at the other end 56 as best seen in fig3 and 4 . the end 54 is attached by a screw threaded fastener 58 to a trunnion 60 which is in turn mounted in the pump housing 10 . the screw threaded fastener 58 holds end 54 by engaging slot 62 and allows the end 54 to oscillate longitudinally within the slot 62 without any transverse movement resulting in minimization of the load on the trunnion 60 when the pump is in operation . the adjustable end 56 engages preferably a screw type adjusting clamp 64 which includes an adjusting screw 66 and a body 68 having tabs ( not shown ) for keeping the adjusting screw 66 within the body 68 . the clamp 64 is pivotally attached to the pump housing 10 and has a slot through which the adjustable end of the adjustable band 52 is received . a longitudinal section of the threads of adjusting screw 66 is received within the slot and engages grooves 70 of the adjustable end 56 . when the adjusting screw 66 is turned , the threads of the screw engage the grooves 70 and move the adjusting end 56 through the slot of the clamp 64 , the direction depending on which way the adjusting screw 66 is turned , as indicated by an arrow 71 . the screw type clamp 64 has a similar mechanical movement to a conventional hose clamp used to secure rubber hoses in an automobile . it should be understood that any conventional means that securely holds the adjusting end 56 and has the capability of allowing infinitely variable adjustments during pump operation may be used without departing from the scope of the present invention . the adjustable band 52 is comprised of a stiffening band 52a and a strengthening band 52b . the stiffening band 52a is made of a polymer having sufficient fatigue resistance and a sufficient amount of flexibility , preferably polypropylene . a creep resistant strengthening band 53b is fixedly attached to the stiffening band 52a on the side engaging the flexible conduit 44 as shown in fig2 and 3 . the strengthening band 52a is preferably made of beryllium copper alloys , beryllium nickel alloys or 400 series stainless steel alloys . however , any material having adequate fatigue resistance will suffice . materials commonly used for coiled and flat springs are most applicable because they have a high endurance limit when compared to other materials . but resiliency is not required of metal band 52b . its purpose is to prevent stretching (&# 34 ; creep &# 34 ; due to tensile forces ) of the plastic band 52a and provide strong attachments with the worm screw 66 and the pivoting arm at second pivot point 76 . &# 34 ; creep &# 34 ; is defined as permanent deformation due to an inability of a stressed member to completely recover its original shape . for example , if plastic is stressed for a prolonged period , molecular bonds will dislocate within the microstructure of the material , causing permanent deformation . creep in metals is negligible at normal levels of stress . creep in plastics is a common problem and occurs at very low stress levels . the basic purpose of the composite band 52 formed by plastic band 52a and metal band 52b is to maintain an essentially circular spiral during pump operation . it must have a stiffness that provides a gradual curvature within the circumstance of the chamber , thus avoiding excessive contact forces and highly localized tubing stresses . for a given pump geometry and a given tubing diameter , the band length and required deflection is defined ; and tubing stiffness determines the minimal band rigidity that is desirable . given a fixed length and a required deflection , the band stiffness is essentially a function of only two variables -- the elastic modulus ( a material property ) and the section modulus ( a geometric property of the cross section ). band stiffness is proportional to the product of these elements . a metal band could be constructed with the proper stiffness . however , for practical limitations of pump geometry and tubing products , the induced bending stresses exceed the endurance limit of all practical metal alternatives . hence , the preferred embodiment of the present invention uses a composite , laminated band construction formed by bands 52a and 52b . the relatively thick plastic band 52a provides a large section modulus . the low elastic modulus common to plastic materials minimizes internal stresses during flexure and polypropylene is particularly advantageous because of its exceptional fatigue strength . the polypropylene band 52a provides the necessary flexural characteristics of stiffness and fatigue life but lacks the necessary tensile requirements of strength and creep resistance . the metal band 52b provides those needs . the stiffness of the plastic band 52a keeps the radius of curvature of the composite band large during flexure . because the radius of flexure is large and the thickness of the metal band 52b is small , internal stresses in the metal component are effectively kept below the material endurance limit . at the same time , sufficient tensile strength is available for the attachments at points 56 and 76 . the plastic and metal bands 52a and 52b reinforce each other while together fulfilling the mechanical demands of pump operation . as shown in fig2 the flexible conduit 44 is situated between the arcuate chamber wall 46 and the strengthening band 52b , being held in place by retaining members 75 . the spacing between the retaining members 75 is sufficient to accept several tubing sizes . the retaining members 75 and the thickness of the plastic band 52a provide a gradual curvature of the adjustable band 52 within the arcuate chamber thereby avoiding any high localized stress to the flexible conduit . a pivoting arm 72 is pivotally attached to the pump housing 18 at first pivot point 74 at one end and to the adjustable band 52 at second pivot point 76 at the other end . the second pivot point 76 is located directly below the center of the drive shaft 26 , and first pivot point 74 is located on the side of the pump housing 10 which is toward the direction of rotation 42 of the rotor 36 as shown in fig3 . the pivoting arm 72 keeps the flexible band 52 substantially centered within the arcuate chamber 32 . several advantages and effects are realized in the combination of the pivoting arm 72 and the manner that the screw threaded fastener 58 holds end 54 to the trunnion 60 . first , any net tensile or compressive forces are avoided in the discharge half of the adjustable band 52 , defined from the second pivot point 76 to end 54 . secondly , the suction half of the adjustable band , defined from adjustable end 56 to second pivot point 76 , is always in a net positive tensile posture , ensuring that buckling of the adjustable band will not occur . the net positive tensile force in the adjustment band will also cause the band to be forced away from the flexible conduit . thirdly , any net tensile force in the pivoting arm 72 will always be positive , avoiding any buckling of the pivot arm . fourthly , the pivoting arm 72 effectively contains the adjustment of the adjustable band to the suction side of the pump between the adjusting clamp 64 and the second pivot point 76 . the function of the discharge portion of the adjustable band is only to provide a continuous roller contact , thereby maintaining a positive seal for an entire revolution of the rollers 34 . lastly , any variations in manufacturing tolerances are easily absorbed by the pivoting arm 72 and the manner of attachment of the end 54 to the trunnion 60 . the adjustable band 52 serves several purposes . the adjustable band 52 protects flexible conduit 44 from the direct contact of the rollers 34 thus avoiding abrasion , and the abrupt and highly localized tensile and shear stresses otherwise caused by direct contact with the rollers and extending the life of the flexible conduit 44 . the retaining members 75 of the flexible conduit 44 aid in extending the life of flexible conduit 44 by retaining the flexible conduit 44 within the protection of the adjustable band 52 . in addition , retaining members 75 prevent any twisting of the flexible conduit 44 which would otherwise occur if the flexible conduit 44 was allowed movement in the axial direction . the preferred combination of the metal band 52b and the polypropylene band 52a add to the life of the adjustable band 52 while also providing a sufficient buffer for protecting the flexible conduit 44 from undue flexing and abrasion caused by the continuous action of the rollers 34 . the inherent spring - back characteristic of round resilient tubing is relied upon in prior art peristaltic pumps to draw fluid into the pump and to provide a consistent volumetric displacement . the stronger the spring - back , the higher the suction draw and also the more consistent the delivery rate . however , the induced stresses that provide spring - back in round tubing are essentially the same ones causing tubing failure . the present invention accommodates the same resilient tubing used in prior art peristaltic pumps , but does not have to rely on inherent spring - back characteristics to the same extent . the adjustable band 52 and the casing bore combine to provide effective control of tubing recovery , and reduce the need for round tubing . a round conduit is not necessary fo consistent delivery and therefore high stress levels can be avoided . in such cases , fluid can be induced into the pump either mechanically ( e . g . physical attachment of the conduit to its radial boundaries ), or hydraulically ( e . g . a positive suction pressure ). the detrimental levels of tubing stress that accompany the utilization of spring - back in prior art peristaltic pumps can be avoided with the present invention . the adjustability of the adjustable band 52 provides the present invention with the capability of a variable delivery rate without replacing conduit 44 and without the need of an expensive speed motor . with the present invention , the delivery rate can be changed while the peristaltic pump is operating . fig5 shows a calibration curve of one model of the peristaltic pump of the present invention that has a round flexible conduit with a one - quarter inch inner diameter and an arcuate chamber having a five inch bore diameter . the peristaltic pump was operated at 89 . 3 revolutions per minute . the horizontal axis entitled &# 34 ; turns adjustment &# 34 ; refers to the number of turns that the adjusting screw 66 was turned from a zero point . the vertical axis entitled &# 34 ; delivery rate , cubic centimeters per minute &# 34 ; refers to the output of the particular model of the peristaltic pump of the present invention . at the zero point , the delivery rate is zero and the adjusting screw is at a point where the flexible conduit is completely flattened against the chamber wall by the adjustable band , the adjustable band being at the longest length possible within the arcuate chamber . turning the adjusting screw shortens the flexible band 52 , removing pressure from the flexible conduit 44 and increasing the volumetric capacity of conduit 44 . this results in an increased delivery rate of the peristaltic pump as shown by the data points in the calibration curve connected by lines . the capability of varying the delivery rate while the peristaltic pump is operating eliminates the need for a costly variable speed motor . further economies can be achieved by driving several pumps with the same constant speed motor , each pump having the capability of being adjusted independently during operation . also , several pumps can be driven by the same single speed motor , each pump having a flexible conduit with a different inner diameter providing a wide array of delivery rates , all delivery rates being adjustable during operation . although the present invention has been described with reference to preferred embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

fig1 shows a circuit that is contained in a silicon chip . this silicon chip is a serial memory comprising at least one matrix of memory cells constituting the main memory of the circuit . furthermore , the chip contains the standard elements of a floating - gate memory , for example row and column decoding circuits , load pumps , read and write amplifiers and a sequencing circuit . the circuit of fig1 forms part of the sequencing circuit of the memory . in order to clarify fig1 certain connections are not shown and have been replaced by the names of the signals . the circuit of fig1 comprises a first input terminal 1 receiving a signal cs , a second input terminal 2 receiving a signal di , a third input signal 3 receiving a signal sk , and a fourth input terminal 4 receiving a signal 8b . these four input terminals 1 to 4 correspond , in the preferred embodiment , to four pads of the silicon chip . the signal cs is a chip selection signal which , in our example , is active in the state &# 34 ; 1 &# 34 ;. preferably , the signal di is an input / output signal used to convey instructions , addresses and data elements between the memory and the exterior . the signal sk is a clock signal generated by a device external to the chip . the signal 8b indicates a mode of operation of the memory that corresponds to the word size of the data elements , which could be for example in 8 or 16 bits . in one example , the fourth input terminal 4 is connected definitively either to the ground or to the supply voltage at the time of the encapsulation of the silicon chip in its package ( or on the chip card ). a clock signal shaping circuit 5 possesses an input , connected to the third input terminal 3 , and an output . the clock signal shaping circuit 5 converts the signal sk into a pulse signal cp adapted to the thresholds of the different synchronous elements of the memory . a circuit ofthis kind may be formed for example by a trigger and a monostable circuit . the clock signal shaping circuit is aimed at eliminating small - amplitude parasitic pulses present on the signal sk . however , parasitic pulses of substantial amplitude may be converted into pulses on the signal cp . a shift register 6 has a series input connected to . the second input terminal 2 , a clock signal input connected to the output of the clock signal shaping circuit 5 , an enabling input and a parallel output . in the present example , the shift register 6 is an 8 - bit register , the contents of the register being permanently visible on the parallel output . the enabling input receiving the signal okc is used to indicate whether the register will shift all its bits by one position and load the bit present at the series input into the cell closest to the series input . the parallel output is connected to a bus used to load the contents of the shift register into storage flip - flop circuits used as a buffer for the matrix of memory cells of the chip . other embodiments can be envisaged for the shift register 6 . this register 6 may be a two - way register , namely it may be used for both reading and writing in the memory . if the circuit is a one - way circuit , the enabling input may also be eliminated . the register then carries out permanent shifting operations . a counter 7 has a clock signal input connected to the output of the shaping circuit 5 , an enabling input receiving the signal okc and an output giving a signal endc . the signal endc indicates that the counter 7 has just carried out a complete cycle . the validation input is used firstly to reset the counter 7 at zero when it is in a first state and secondly to permit the counting when it is in the second state . the verification circuit 8 has a clock signal input connected to the output of the shaping circuit 5 in order to receive the signal cp , an end - of - count input connected to the output of the counter 7 in order to receive the signal endc , a mode input connected to the fourth input terminal 4 in order to receive the signal 8b , a least significant bit input receiving the least significant address bit a0 and an output giving a signal finc . the verification circuit 8 is used to determine the end of the reception of the data bits ( during a writing operation ) as a function of the mode of operation , namely 8 - bit operation or 16 - bit operation . this verification circuit 8 is described more specifically further below . an address register 9 has a clock signal input connected to the output of the shaping circuit 5 in order to receive the signal cp , a series input connected to the second input terminal 2 in order to receive the signal di , an incrementation input receiving a signal incr , a mode input connected to the fourth input terminal 4 in order to receive the signal 8b , an enabling input receiving the signal val and a parallel output giving the address bits a0 to a7 on independent wires . one of the independent wires corresponding to the least significant bit a0 is connected to the least significant bit input of the verification circuit 8 . all the independent wires of the parallel output are connected to the decoding circuits of the memory ( not shown ). the signal cp is used to set the rate of the serial arrival of the bits in the address register 9 . the signal di contains the address bits to be entered into the register at a given time . the signal val indicates whether the bit present at the series input of the address register 9 has to be entered into the register 9 . the signal 8b indicates whether the address received corresponds to a memory address receiving 8 - bit data elements or 16 - bit data elements . the signal incr is used to increment least significant bit of the address register 9 corresponding to a0 when the system is in 16 - bit mode . an address register 9 of this kind is described here below . a control circuit 10 possesses a selection input connected to the first input terminal 1 in order to receive the signal cs , an instruction input connected to the second input terminal 2 in order to receive the signal di , a clock signal input connected to the output of the shaping circuit 5 in order to receive the signal cp , an end - of - count input connected to the output of the counter 7 in order to receive the signal endc , a verification input connected to the output of the verification circuit in order to receive the signal finc , a mode of operation input connected to the fourth input terminal 4 in order to receive the signal 8b , a window - closing output giving the signal rm , a window - opening output giving the signal sm , a storage output giving the signal mem , a count - enable output connected to the enable input of the shift register 6 and the enable input of the counter 7 in order to give the signal okc , an incrementation output connected to the incrementation input of the address register 9 in order to give the signal incr , and an address enable output connected to the enable input of the address register in order to give the signal val . the signal sm is used to activate the opening of a temporal window authorizing the write operation . the signal rm is used to close the temporal window authorizing the write operations . the signal mem indicates the loading of the contents of the shift register 6 into the storage flip - flop circuits used as a buffer for the matrix of memory cells of the chip . the signal okc indicates the time when the counter 7 is in operation . the signal incr indicates the incrementation of the least significant bit a0 of the address register 9 . the signal val indicates the time when the address register 9 is loaded . the control circuit 10 is actually a large sequencer which will be easier to understand by means of the timing diagrams described here below . an rs type storage flip - flop circuit 11 has a zero - setting input connected to the window - closing output of the control circuit 10 in order to receive the signal rm , a one - setting input connected to the window - opening output of the control circuit 10 in order to receive the signal sm and an output giving the signal prepro . the signal prepro is a binary signal that can take two states . arbitrarily , the state &# 34 ; 1 &# 34 ; corresponds to permission to write during a given temporal window . an inverter 12 has an input connected to the first input terminal 1 in order to receive the signal cs , and an output . this inverter 12 is used to shape the signal cs so that it can be used in write enable mode . in one example , a threshold inverter 12 is used . a logic gate 13 has a first input connected to the output of the inverter 12 , a second input connected to the output of the storage flip - flop circuit 11 in order to receive the signal prepro , and an output giving the signal pro . the signal pro activates a writing sequence set up in a standard way . it must be noted however that , depending on the organization of the memory , in the case of 16 - bit words , either two successive write operations are carried out in a memory organized in 8 bits or one write operation is carried out in two different memory arrays organized in 8 - bit words . fig2 shows the verification circuit 8 used in the preferred embodiment of the invention . this is only a possible embodiment given solely by way of an indication . this verification circuit 8 has a first inverter , a second inverter and a third inverter 14 to 16 , each having one input and one output , a delay circuit 17 having two inputs and one output , a first nand gate 18 having three inputs and one output and a second nand gate having two inputs and one output . the input of the first inverter 14 corresponds to the end - of - count input of the verification circuit 8 . a first input of the delay circuit 17 corresponds to the clock signal input of the verification circuit 8 . the input of the second inverter 15 corresponds to the mode input of the verification circuit 8 . the input of the third inverter 16 corresponds to the least significant input of the verification circuit . the second input of the delay circuit 17 is connected to the input of the first inverter 14 . the output of the first inverter 14 is connected to the first input of the second nand gate 19 . the output of the delay circuit 17 is connected to the first input of the first nand gate 18 . the output of the second inverter 15 is connected to the second input of the first nand gate 18 . the output of the third inverter 16 is connected to the third input of the first nand gate 18 . the output of the first nand gate 18 is connected to the second input of the second nand gate 19 . the output of the second nand gate corresponds to the output of the verification circuit 8 and produces the signal finc . the delay circuit 17 is used to delay the signal endc by one clock cycle . a simple d - type flip - flop circuit which receives the signal cp at its clock signal input and the signal endc at its d input is perfectly appropriate . should the signal 8b be at &# 34 ; 1 &# 34 ;, namely when the memory works in 8 - bit mode , the output of the second inverter 15 is at &# 34 ; 0 &# 34 ;. consequently , the output of the first nand gate 18 is at &# 34 ; 1 &# 34 ;. if endc is at &# 34 ; 0 &# 34 ;, then the output of the first inverter 14 is at &# 34 ; 1 &# 34 ;, hence the signal finc is at &# 34 ; 0 &# 34 ;. the signal finc is the same as the signal endc ( in discounting the periods of propagation of the different logic gates ). should the signal 8b be at &# 34 ; 0 &# 34 ;, namely when the memory works in 16 - bit mode , the output of the first nand gate 18 depends on its first and third input . if a0 is at &# 34 ; 1 &# 34 ;, the third input of the first nand gate is at &# 34 ; 0 &# 34 ; while the output of the first logic gate is necessarily at &# 34 ; 1 &# 34 ;, implying that the signal finc corresponds to the signal endc as explained here above . if , on the contrary , a0 is at &# 34 ; 0 &# 34 ; while the output of the first nand gate 18 is identical to the output of the first inverter 14 but with a delay of one clock cycle , then the signal finc will correspond to the signal endc extended by a clock period . fig3 shows the address register 9 used in the preferred embodiment of the invention . this is only a possibility of an embodiment given purely by way of an indication . the address register 9 comprises , in the example , eight storage flip - flop circuits of which only four are shown in fig3 respectively the first , second , third and eighth flip - flop circuits 20 to 23 . the first storage flip - flop circuit 20 is of the j - k type and is used to store the least significant bit of the address , the least significant bit possibly coming from the exterior or possibly being generated by the address register 9 depending on the mode of operation . the first storage flip - flop circuit has an input j , an input k , a clock signal input and an output q . the second to eighth storage flip - flop circuits 21 to 23 are identical and are d - type flip - flop circuits used to memorize the seven most significant bits of the address . each of circuits constituting the second to eighth storage flip - flop circuits 21 to 23 has a data input d , an enable input e , a clock signal input and an output q . the address register 9 furthermore has a multiplexer 24 having first and second signal inputs , a selection input and an output , first to fourth and gates 25 to 28 each having first to third inputs , some of which are inverter inputs , and one output ; a first or gate 29 having first and second inputs and one output , and a second or gate 30 having first to third inputs and one output . the clock signal input of the address register 9 is connected to the clock signal input of each of the storage flip - flop circuits 20 to 23 in order to synchronize all the storage flip - flop circuits 20 to 23 with one another . the series input of the register 9 is connected to the first input of the multiplexer 24 , the first input of the first and gate 25 and the first input which is an inverter of the second and gate 26 . the incrementation input of the address register 9 is connected to the first input of the third and gate 27 and to the first input which is an inverter of the fourth and gate 28 . the mode input of the address register 9 is connected to the selection input of the multiplexer 24 , the second inputs of the first and second and gates 25 and 26 and the second inputs , which are inverter inputs , of the third and fourth and gates 27 and 28 . the enable input of the address register 9 is connected to the third inputs of the first , second and fourth and gates 25 , 26 and 28 , the third input , which is an inverter input , of the third and gate 27 and each of the enable inputs e of the second to the eighth storage flip - flop circuits . the parallel output of the address register 9 consists of all the outputs of the first to eighth storage flip - flop circuits 20 to 23 . furthermore , the output of the first and gate 25 is connected to the first input of the first or gate 29 . the output of the second and gate 26 is connected to the first input of the second or gate 30 . the output of the third and gate 27 is connected to the second inputs of the first and second or gates 29 and 30 . the output of the fourth and gate 28 is connected to the third or gate 30 . the output of the first or gate 29 is connected to the input j of the first storage flip - flop circuit 20 . the output of the second or gate 30 is connected to the input k of the first storage flip - flop 20 . the output q of the first storage flip - flop circuit is connected to the second input of the multiplexer 24 . the output of the multiplexer 24 is connected to the data input d of the second storage flip - flop circuit 21 . the outputs q of the second to seventh storage flip - flop circuits 21 and 22 are respectively connected to the inputs d of the third to eighth storage flip - flop circuits 22 and 23 . the working of this address register 9 depends on the mode of operation chosen . if the signal 8b is at &# 34 ; 1 &# 34 ;, namely if the operation is with 8 - bit words , the multiplexer 24 sets up a connection between its second input and its output , the signal incr becomes unnecessary and all the elements consisting of the and gates 25 to 28 , the or gates 29 and 30 and the first storage flip - flop circuit 20 constitute a flip - flop circuit equivalent to one of the second to eighth storage flip - flop circuits 21 to 23 . when the signal val is active , at each clock signal leading edge , the bit present at the data input of the address register 9 is entered into the first storage flip - flop circuit 20 , the bit which was present in the first flip - flop circuit is shifted into the first flip - flop circuit , the bit present in the second flip - flop circuit is shifted into the third , and so on and so forth up to the eighth flip - flop circuit . when the signal val is inactive , the flip - flop circuits memorize their contents , leaving the bits a0 to a7 in an apparent and stable state on the parallel output wire of the register . if the signal 8b is at &# 34 ; 0 &# 34 ;, namely if the operation is with 16 bits , then the multiplexer 24 sets up a connection between its first input and its output and all the elements consisting of the and gates 25 to 28 , the or gates 29 and 30 and the first storage flip - flop circuit 20 constitute a counter by two . indeed , when the signal val is active , the first storage flip - flop circuit is positioned at &# 34 ; 0 &# 34 ; and the loading is done from the series input of the address register 9 into the second storage flip - flop circuit 21 and then into the other flip - flop circuits up to the eighth storage flip - flop circuit 23 . when the signal val is inactive , then the contents of the second to the eighth flip - flop circuits are memorized and the contents of the first storage flip - flop circuit change state if , during a clock period , the signal incr is active . other possible embodiments can be used to obtain an address register 9 with the same functions . fig4 shows timing diagrams corresponding to an 8 - bit mode of operation , the signal 8b being positioned at &# 34 ; 1 &# 34 ;. these timing diagrams provide for a clearer understanding of the working of the invention and will help in describing the control circuit 10 . the curve 31 shows the signal cp , namely the clock signal after shaping , this signal cp being normally formed by evenly spaced out identical pulses , the leading edges of this signal constituting the active moments of the signal cp . the curve 32 represents the signal di which consists of a string of bits divided into control bits 33 , address bits 34 and data bits 35 . the curve 36 represents the signal cs which consists of a leading edge 37 indicating the start of the selection of the memory followed by a trailing edge 38 which has to enable the writing after the dispatch of all the data bits 35 . the signals cp , di and cs correspond to signals produced externally to the memory . curves 39 to 43 correspond respectively to the signals val , okc , mem , sm and rm generated by the control circuit 10 . a curve 44 corresponds to the end - of - count signal endc . a curve 45 corresponds to the signal finc of the end of reception of the data bits . a curve 46 represents the signal prepro which shows the temporal window 47 authorizing a write operation . a curve 48 represents the write activation signal pro . at the starting point of the periods corresponding to the timing diagrams , the signal cs is at &# 34 ; 0 &# 34 ;. the memory is considered to be in a waiting phase and all the signals produced internally to the memory are considered to be at &# 34 ; 0 &# 34 ;. on a first clock stroke , there is a bit , for example at &# 34 ; 1 &# 34 ; which corresponds to the state that should be had by a starting bit sb during the change in state of the signal cs from &# 34 ; 0 &# 34 ; to &# 34 ; 1 &# 34 ;. since the signal cs is held at &# 34 ; 1 &# 34 ; up to the next clock signal edge , the control circuit will receive the remainder of the control bits 33 corresponding to an instruction of the memory . in the example , two bits opc1 and opc2 are used . during the reception of the second instruction bit opc2 , the control circuit positions the signal val at &# 34 ; 1 &# 34 ; for a period of eight clock cycles , as shown in the curve 39 , in order to load the address a7 to a0 into the address register 9 . the control circuit 10 in the meantime decodes the instruction designed to indicate the operation to be performed in the memory ( reading , writing , testing , etc .). hereinafter , we shall not deal with the case where the instruction code opc1 + opc2 corresponds to a write operation . when the second last address bit a1 is loaded into the address register 9 , the control circuit 10 positions the signal okc at &# 34 ; 1 &# 34 ;. this signal okc activates the counter 7 and permits the reception of the bits on the shift register 6 . at the end of eight clock cycles , the counter 7 indicates the end of count during a clock period on the signal endc . the verification circuit gives a signal finc that is identical to the signal endc . the signal endc prompts the passage to &# 34 ; 1 &# 34 ; of the signal mem which produces the loading of the contents of the shift register 6 into the storage flip - flop circuits of the write buffers . the simultaneous descent of the signals endc and finc prompts a brief pulse on the signal sm followed , at the next clock stroke , by a brief pulse on the signal rm . the pulse of the signal sm causes the signal prepro to switch over to the state &# 34 ; 1 &# 34 ; and the pulse on the signal rm causes the signal prepro to switch over to the state &# 34 ; 0 &# 34 ;. the signal prepro opens a write window 47 during a clock period immediately after the last of the data bits d0 has been received in theory . if the signal cs goes back to the state &# 34 ; 0 &# 34 ; while the signal prepro is at &# 34 ; 1 &# 34 ;, then the signal pro goes to &# 34 ; 1 &# 34 ;. if the leading edge of the signal pro does not correspond to a clock signal leading edge , then a write sequence is activated . this write sequence will consist in producing a programming voltage by load pumping and then in writing the data element present in the storage flip - flop circuits of the write buffers at the address present in the address register . if there is a big parasitic pulse in the signal cs outside the write window 47 , no data element is written . if the signal cs does not change its state during the write window 47 , then no data element is written in the memory . if the leading edge 37 of the signal comes from a parasitic pulse enabled by a value of the signal di corresponding to a starting bit , there is little likelihood that a trailing edge 38 will be present on the signal cs during the window 47 . if a major parasitic pulse creates an additional clock pulse or eliminates a clock pulse , the window 47 will be shifted with respect to the edge 38 thus preventing the write operation . should big parasitic pulses be produced on the two signals cp and cs simultaneously or offset by at least one write cycle , which is rare , it is possible in about 5 % of cases that an erroneous write operation will be produced . this considerably reduces the risks of error . fig5 shows timing diagrams corresponding to a mode of operation in 16 bits , the signal 8b being positioned at &# 34 ; 0 &# 34 ; these timing diagrams provide for a clearer understanding of the operation of the invention and will help in the making of the control circuit 10 . the curve 49 represents the signal cp , namely the clock signal after shaping . this signal cp is normally constituted by identical pulses that are evenly spaced out . the leading edges of this signal constitute the active moments of this signal cp . the curve 50 represents the signal di which is constituted by a string of bits divided into control bits 51 , address bits 52 and data bits 53 . the curve 54 represents the signal cs constituted by a leading edge 55 indicating the start of the selection of the memory followed by a trailing edge 56 that must enable the write operation after the dispatch of all the data bits 53 . the signals cp , di and cs correspond to signals produced externally to the memory . curves 57 to 62 respectively correspond to the signals val , okc , mem , incr , sm and rm , generated by the control circuit 10 . a curve 63 corresponds to the least significant bit of the address register 9 . a curve 64 corresponds to the end - of - count signal endc . a curve 65 corresponds to the signal finc for the end of reception of the data bits . a curve 66 represents the signal prepro which shows the temporal window 67 authorizing a write operation . a curve 68 represents the write activation signal pro . at the starting point of the periods corresponding to the timing diagrams , the signal cs is at &# 34 ; 0 &# 34 ;. the memory is considered to be in a waiting phase and all the signals produced internally to the memory are considered to be at &# 34 ; 0 &# 34 ;. on a first clock stroke , there is a bit , for example at &# 34 ; 1 &# 34 ; which corresponds to the state that should be had by a starting bit sb during the change in state of the signal cs from &# 34 ; 0 &# 34 ; to &# 34 ; 1 &# 34 ;. since the signal cs isheld at &# 34 ; 1 &# 34 ; up to the next clock signal edge , the control circuit will receive the remainder of the control bits 51 corresponding to an instruction of the memory . in the example , two bits opc1 and opc2 are used . during the reception of the second instruction bit opc2 , the control circuit positions the signal val at &# 34 ; 1 &# 34 ; for a period of seven clock cycles , as shown in the curve 57 , in order to load the address a7 to a1 into the address register 9 . the control circuit 10 in the meantime decodes the instruction designed to indicate the operation to be performed in the memory ( reading , writing , testing , etc .). hereinafter , we shall not deal with the case where the instruction code opc1 + opc2 corresponds to a write operation . when the second last address bit a2 is loaded into the address register 9 , the control circuit 10 positions the signal okc at &# 34 ; 1 &# 34 ;. this signal okc activates the counter 7 and authorizes the reception of the bits on the shift register 6 . at the end of eight clock cycles , the counter 7 indicates the end of a first count , during a clock period , on the signal endc . with the signal 8b being at &# 34 ; 0 &# 34 ; and the least significant bit a0 being at &# 34 ; 0 &# 34 ;, the verification circuit gives a signal finc extended by a clock period with respect to the signal endc . the signal endc prompts the passage to &# 34 ; 1 &# 34 ; of the signal mem which produces the loading of the contents of the shift register 6 into the storage flip - flop circuits of the write buffers . the simultaneous descent of the signals endc and finc prompts a pulse on the signal incr aimed at increasing a0 from &# 34 ; 0 &# 34 ; to &# 34 ; 1 &# 34 ;, thus changing the address of the next 8 - bit word received . eight clock cycles after having indicated the end of a first count , the counter 7 indicates the end of a second count , during a clock period , on the cycle enc . with the signal 8b being at &# 34 ; 0 &# 34 ; and the least significant bit a0 being at &# 34 ; 1 &# 34 ;, the verification circuit gives a signal finc identical to the signal endc . the signal endc prompts the passage to &# 34 ; 1 &# 34 ; of the signal mem which produces the loading of the contents of the shift register 6 into the storage flip - flop circuits of the write buffers . the simultaneous descent of the signals endc and finc prompts a brief pulse on the signal sm followed at the next clock stroke by a brief pulse on the signal rm . the pulse on the signal sm causes the signal prepro to switch over to the state &# 34 ; 1 &# 34 ; and the pulse on the signal fm causes the signal prepro to switch over to the state &# 34 ; 0 &# 34 ;. the signal prepro opens a write window 47 during a clock period immediately after the last of the data bits d0 has been received in theory . if the signal cs goes back to the state &# 34 ; 0 &# 34 ; while the signal prepro is at &# 34 ; 1 &# 34 ;, then the signal pro goes to &# 34 ; 1 &# 34 ;. if the leading edge of the signal pro does not correspond to a clock signal leading edge , then a write sequence is activated . this write sequence will consist in producing a programming voltage by load pumping and then in writing the data element present in the storage flip - flop circuits of the write buffers at the address present in the address register . the writing is done simultaneously or successively , depending on the physical organization of the memory . if there is a big parasitic pulse in the signal cs outside the write window 67 , no data element is written . if the signal cs does not change its state during the write window 67 , then no data element is written in the memory . if the leading edge 55 of the signal comes from a parasitic pulse enabled by a value of the signal di corresponding to a starting bit , there is little likelihood that a trailing edge 56 will be present on the signal cs during the window 67 . if a big parasitic pulse creates an additional clock pulse or eliminates a clock pulse , the window 67 will be shifted with respect to the edge 56 , thus preventing the write operation . should big parasitic pulses be produced on the two signals cp and cs simultaneously or offset by at least one write cycle , which is rare , it is possible in about 4 % of cases that an erroneous write operation will be produced . this considerably reduces the risks of error . furthermore , the writing is done only when the totality of the bits are received . it is no longer possible to have write errors due to the writing in two stages of the 16 - bit words . those skilled in the art could modify certain elements of the preferred embodiment at leisure without changing the spirit of the invention . thus , the choice of the different logic levels and consequently of the logic gates is quite arbitrary . furthermore , certain signals offer certain liberties with respect to the shape shown in the timing diagrams . these signals are for example a0 , incr , mem , finc , sm and rm . simple variants corresponding to the combination of the invention with the prior art can also be envisaged . for example , it is possible , by means of an additional instruction bit , for example opc3 , to choose whether the word to be written ( or read ) is encoded on 8 or 16 bits . in this case , the fourth input terminal will be connected to a register for the storage of the mode of operation which could very well form part of the control circuit 10 . it is also possible to have systems with fixed word sizes or with word sizes that are variable in multiples of a defined size that could be other than 8 bits . the starting bit sb is not necessary to the invention but reduce the risks , if any , of unnecessary starting sequences which may slow the memory down . the choice of the state of the bit is purely arbitrary and may even , in certain cases , be replaced by a succession of bits . it is possible for example to take account of the signal cs to enable the clock signal in order to carry an error occurring on the selection signal over into the clock signal . in this case , it is not necessary to detect the non - coincidence between the trailing edge of the selection signal cs and the clock signal cp . having thus described at least one illustrative embodiment of the invention , various alterations , modifications and improvements will readily occur to those skilled in the art . such alterations , modifications and improvements are intended to be within the spirit and scope of the invention . accordingly , the foregoing description is by way of example only and is not intended as limiting . the invention is limited only as defined in the following claims and the equivalent thereto .

6Physics

hereinafter various embodiments of the present invention will be described in detail with reference to the accompanying drawings . the figures are provided to enable those of ordinary skill in the art to make and use the present invention according to the exemplary embodiments of the present invention . throughout the disclosure , reference numerals correspond directly to the like numbered parts in the various figures and embodiments of the present invention . furthermore , ‘ connected / coupled ’ represents that one component is directly coupled to another component or indirectly coupled through another component . in this specification , a singular form may include a plural form as long as it is not specifically mentioned in a sentence . furthermore , ‘ include / comprise ’ or ‘ including / comprising ’ used in the specification represents that one or more components , steps , operations , and elements exists or are added . fig1 is a circuit diagram illustrating a current generation circuit according to an embodiment of the present invention . referring to fig1 , the current generation circuit 100 may receive a first voltage v1 , which is generated by a voltage generation circuit 200 , and generate a predetermined current ( e . g ., a reference current ) and transfer the constant current to the internal circuit 300 . the current generation circuit 100 may include a mirroring circuit 110 , a comparison circuit 120 and a current driving circuit 130 . the mirroring circuit 110 may be charged by using the first voltage v1 , which is generated from the voltage generation circuit 200 , and a power voltage vcc when the current generation circuit 100 operates in a sample mode . for example , the voltage generation circuit 200 may generate the first voltage v1 having a higher voltage level than that of the power voltage vcc . the mirroring circuit 110 may include a first switch 111 and a capacitor 112 . the first switch 111 may transfer the first voltage v1 to the first node n1 or block the first voltage v1 . the capacitor 112 may be coupled between the first node n1 and a power voltage vcc terminal and be charged by using the first voltage v1 . the first switch 111 may be turned on when the current generation circuit 100 operates in the sample mode and turned off when the current generation circuit 100 operates in a hold mode . the first switch 111 may be controlled by a control circuit ( denoted by 1200 of fig4 ). the comparison circuit 120 may include an operational amplifier 121 . the operational amplifier 121 may compare voltages applied to a first input terminal and a second input terminal 12 , and output a result of comparison to a second node n2 . for example , the voltage charged in the capacitor 112 may be applied to the first input terminal 11 of the comparison circuit 120 , and a feedback voltage may be applied to the second input terminal 12 . the feedback voltage may be substantially the same as a voltage output from the comparison circuit 120 . in this case , the operational amplifier 121 operates as a unity gain buffer , which generates an output voltage following an input voltage . the current driving circuit 130 may generate a current by forming a current path between the power voltage vcc terminal and the internal circuit 300 based on the voltage , which is applied to the second node n2 , when the current generation circuit 100 operates in the hold mode . for example , the current driving circuit 130 may include a second switch 131 and a driver 132 . the second switch 131 may be coupled to the second node n2 . in addition , the second switch 131 may be turned on when the current generation circuit 100 operates in the hold mode and turned off when the current generation circuit 100 operates in the sample mode . the driver 132 may couple the power voltage vcc terminal and the internal circuit 300 based on the voltage transferred through the second switch 131 . in other words , the driver 132 may be implemented with an nms transistor having a drain coupled to the power voltage vcc terminal and a source coupled to the internal circuit 300 , and a gate coupled to the second switch 131 . the second switch 131 may be controlled by the control circuit 1200 shown in fig4 . the internal circuit 300 may include circuits that operate when the power voltage vcc is applied thereto . the mirroring circuit 110 , the comparison circuit 120 , the current driving circuit 130 , and the internal circuit 300 may receive the power voltage vcc being supplied from the same voltage source . for example , the internal circuit 300 may include a page buffer unit . a method of operating the current generation circuit 100 is described below in detail . fig2 a and 2b are circuit views illustrating a switching operation of the current generation circuit 100 shown in fig1 . referring to fig2 a , when the current generation circuit 100 operates in a sample mode , the first switch 111 may be turned on , and the second switch 131 may be turned off . when the first switch 111 is turned on , the capacitor 112 may be charged by using the first voltage v1 generated from the voltage generation circuit 200 . in order to differentiate the first voltage v1 , which is generated by the voltage generation circuit 200 , from the voltage charged in the capacitor 112 , the voltage charged in the capacitor 112 may be defined as a second voltage v2 . when the capacitor 112 is charged with the second voltage v2 , the second voltage v2 may also be input to the first input terminal 11 of the operational amplifier 121 . during an initial operation , since the second input terminal 12 of the operational amplifier 121 is in a floating state , when the second voltage v2 , which is a positive voltage , is applied to the first input terminal the operational amplifier 121 may output a high - level voltage . however , since the second switch 131 is turned off , a gate of the driver 132 may be in a floating state . therefore , when the current generation circuit 100 operates in the sample mode , a current path may not be established between the power voltage vcc terminal of the current driving circuit 130 and the internal circuit 300 . referring to fig2 b , when the current generation circuit 100 operates in the hold mode , the first switch 111 may be turned off , and the second switch 131 may be turned on . when the first switch 11 is turned off , the first voltage v1 , which is generated by the voltage generation circuit 200 , may not be transferred to the operational amplifier 121 . therefore , the operational amplifier 121 may be affected by the second voltage v2 charged in the capacitor 112 , but not by the voltage generation circuit 200 . the second voltage v2 may be applied to the first input terminal i1 of the operational amplifier 121 , and a voltage , which is output to an output terminal of the operational amplifier 121 , may be fed back to the second input terminal 12 thereof . since the voltage , which is output from the operational amplifier 121 , has a high voltage level substantially the same as the level of the second voltage v2 , the operational amplifier 121 may keep outputting a high - level voltage . since the second switch 131 is turned on , the voltage , which is output from the operational amplifier 121 , may be applied to the gate of the driver 132 . the voltage , which is output from the operational amplifier 121 , may be defined as a third voltage v3 for convenience of illustration . since the third voltage v3 has a high voltage level ( i . e ., a positive voltage ), the driver 132 may be turned on . when the driver 132 is turned on , the driver 132 may form a current path cp . when the current path cp is formed , the internal circuit 300 may receive the output current of the current driving circuit 130 and the power voltage vcc , and perform various operations . a description is made in reference to an example in which the internal circuit 300 is a page buffer unit . the page buffer unit may include a plurality of page buffers . therefore , when the page buffers operate at the same time , a voltage level of the power voltage vcc may be temporarily reduced . the temporary reduction in power voltage level may be referred to as a voltage drop . since the mirroring circuit 110 and the current driving circuit 130 of the current generation circuit 100 receive the same power voltage vcc applied to the internal circuit 300 , when the voltage level of the power voltage vcc being applied to the internal circuit 300 is temporarily reduced , the voltage level of the power voltage vcc being applied to the mirroring circuit 110 and the current driving circuit 130 may also be temporarily reduced . when the voltage level of the power voltage vcc applied to the voltage mirroring circuit 110 is temporarily reduced , the voltage level of the second voltage v2 being applied to the first node n1 may also be temporarily reduced by coupling effect of the capacitor . when the level of the voltage , which is applied to the first input terminal i1 , is temporarily reduced to be lower than that of the voltage , which is applied to the second input terminal 12 of the operational amplifier 121 , due to the temporary reduction in the voltage level of the second voltage v2 , the third voltage v3 may also be temporarily reduced . the voltages applied to the gate and the drain of the driver 132 , which is included in the current driving circuit 130 , may be temporarily reduced at the same time since the current driving circuit 130 also receives the same power voltage vcc applied to the mirroring circuit 110 and the internal circuit 300 . in other words , when the voltage level of the power voltage vcc is temporarily reduced by operations of the internal circuit 300 , since the voltage applied to the gate of the driver 132 as well as the drain thereof is also temporarily reduced , a level difference may not occur between the gate and the drain of the driver 132 . as a result , variations in the amount of current flowing through the current path cp may be prevented . for example , when the current , which is generated by the current generation circuit 100 , is used as a reference current in the internal circuit 300 , a reference current having a constant voltage level may be generated regardless of variations in the power voltage vcc . accordingly , reliability of the current generation circuit 100 may be improved . fig3 is a timing diagram illustrating an operation of the current generation circuit 100 shown in fig1 , 2 a and 2 b . referring to fig3 , it is assumed that the current generation circuit 100 operates in the hold mode . when the current generation circuit 100 operates the hold mode , the first switch 111 of the mirroring circuit 110 may be turned off , and the second switch 131 of the current driving circuit 130 may be turned on , so that the current driving circuit 130 may form the current path cp by the second voltage v2 charged in the capacitor 112 . meanwhile , when the internal circuit 300 operates , the voltage level of the power voltage vcc , which is output from the same voltage source , may be temporarily reduced . for example , the voltage levels of the power voltage vcc being supplied to the internal circuit 300 , the power voltage vcc being supplied to the current driving circuit 130 , and the power voltage vcc being supplied to the mirroring circuit 110 may be temporarily reduced . in the mirroring circuit 110 , when the voltage level of the power voltage vcc is reduced by mirroring ( mr ), the voltage level of the second voltage v2 may be reduced by coupling effect of the capacitor . in the comparison circuit 120 , the voltage level of the third voltage v3 may be reduced . the current driving circuit 130 may operate based on the power voltage vcc and the third voltage v3 . since the voltage levels of the power voltage vcc and the third voltage v3 are temporarily reduced at the same time , a constant current may be generated by maintaining the constant current path cp formed by the driver 132 . as described above , even when the voltage level of the power voltage vcc is temporarily reduced while the internal circuit 300 is operating , the current generation circuit 100 may generate a constant current and apply the constant current to the internal circuit 300 . as a result , the reliability of various operations of the internal circuit 300 may be improved . fig4 is a block diagram of a semiconductor device including the current generation circuit 100 shown in fig1 . referring to fig4 , the semiconductor device 1000 may include a memory cell array 1100 , peripheral circuits 100 , 200 , 1300 , 1400 , 1500 and 1600 and a control circuit 1200 . the memory cell array 1100 may store data . the peripheral circuits 100 , 200 , 1300 , 1400 , 1500 and 1600 may program the memory cell array 1100 with data , or read or erase the stored data . the control circuit 1200 may control the peripheral circuits 100 , 200 , 1300 , 1400 , 1500 and 1600 . the memory cell array 1100 may include a plurality of memory blocks in which data is stored . the memory blocks may have similar configurations and include two - dimensional or three - dimensional structured cell strings . the control circuit 1200 may output operating signals pgm , read and erase , a row address radd , a column address cadd and page buffer control signals pbsig in response to a command signal cmd and an address add . the current generation circuit 100 may include a mirroring circuit and form the current path cp based on the power voltage vcc and the first voltage v1 . the constant current path cp may be formed even when the voltage level of the power voltage vcc is temporarily reduced , thereby generating a current having a constant level . the voltage generation circuit 200 may generate operating voltages vpgm , vread and v1 in response to the operating signals pgm , read and erase . for example , when a program signal pgm applied to the voltage generation circuit 200 , the voltage generation circuit 200 may generate voltages ( vpgm ) for a program operation in response to the program signal pgm . the row decoder 1300 may select one of the memory blocks , which is included in the memory cell array 110 , and may transfer operating voltages to word lines wl of a selected memory block in response to the row address radd . the page buffer unit 1400 may be coupled to the memory cell array 1100 through bit lines bl and transfer data to the memory cell array 1100 or receive the data , which are stored in the memory cell array 1100 , in response to the page buffer control signals pbsig . in addition , the page buffer unit 1400 may receive a constant current ( e . g ., reference current ), which is generated by the current generation circuit 100 , during a read or verification operation and perform a sensing operation using the constant current . the column decoder 1500 may be coupled to the page buffer unit 1400 through column lines cl and transfer data to each of the page buffers in response to a column address cadd . the input / output circuit 1600 may be coupled to the column decoder 1500 through input / output lines il and exchange input / output data iq with the column decoder 1500 . as described above , the current generation circuit 100 of the semiconductor device 1000 may generate a constant current and may transfer the constant current to the page buffer unit 1400 . however , the current generation circuit 100 may be coupled to other circuits requiring the constant current , in addition to the page buffer unit 1400 . fig5 is a block diagram illustrating a memory system including the semiconductor device shown in fig4 . referring to fig5 , the memory system 2000 may include a memory control unit 2100 , a memory interface 2200 , and a memory storage unit 2300 . the memory control unit 2100 may apply control signals consig to the memory interface 2200 through a plurality of pins in response to an external command that is input through a system bus . for example , the memory control unit 2100 may apply the control signals consig to the memory interface 2200 through address pins , a chip enable signal pin , a selection signal pin , an output enable signal pin , a reset signal pin , a write enable signal pin a write inhibit signal pin a clock signal pin , and an address effective input signal pin . in addition , the memory control unit 2100 may exchange data dq with the memory interface 2200 through data pins . the memory interface 2200 may exchange the data dq with the memory storage unit 2300 by applying interface signals ifsig including the command signal and the address to the memory storage unit 2300 in response to the control signals consig . the memory storage unit 2300 may include the semiconductor device 1000 in which data is stored . the semiconductor device 1000 may perform program , read , and erase operations in response to the interface signals ifsig . the semiconductor device 1000 may include a current generation circuit configured to generate a constant current despite temporary changes in the power voltage vcc . since the semiconductor device 1000 uses a constant current , which is generated by the current generation circuit , during a read operation or a verification operation , the reliability of the semiconductor device 1000 may be improved . therefore , the reliability of the memory storage unit 2300 having the semiconductor device 1000 with the improved reliability may also be improved , and the memory system including the memory storage unit 2300 may also be improved correspondingly . according to the embodiments of the present invention , since a current ( e . g ., reference current ) having a constant level may be generated regardless of temporary changes in power voltage , reliabilities of a semiconductor device and a memory system performing read and verification operations may be improved . in the drawings and specification , typical exemplary embodiments of the invention have been disclosed . although specific terms are employed , they are used in a generic and descriptive sense only and not for purposes of limitation . as for the scope of the invention , it is to be set forth in the following claims . therefore , it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the following claims .

6Physics

methods and systems for supply chain management with a state model are described . generally , the state model refers to a status of a transaction that is within a supply chain . the status can be affected by various trading partners that perform actions with respect to the transaction . for example , a supplier can check the availability of goods at a central warehouse responsive to a purchase order received from a retailer . in the meantime , the supplier can change the state of the purchase order from open to pending commit . satisfied that the order can be fulfilled , the supplier can change the state from pending commit to commit . the goods can be shipped from a central warehouse to a regional warehouse and updated within the supplier &# 39 ; s proprietary supply chain management system without affecting the information available to the retailer ( i . e ., no change in state ). once the shipping has occurred , the retailer can change the state from pending or commit to close . one of ordinary skill in the art will recognize that the embodiment described herein with respect to a supply chain is only exemplary and can be modified for different applications such as a package delivery system or the like . fig1 is a block diagram illustrating a system 100 for supply chain management according to one embodiment of the present invention . system 100 comprises an inter - enterprise server 101 in communication with various trading partners 102 , 104 , 106 , 108 , 110 , 112 , 114 , 116 through , for example , a data network ( e . g ., the internet ). trading partners 102 - 116 in the supply chain interact with one another in the process of developing , manufacturing , marketing and selling one or more products . a number of trading relations 120 , 122 , 124 , 126 , 128 , and 130 exist , where each trading relation involves two trading partners . for example , the trading relation 122 involves two trading partners 104 , 106 . in one embodiment , trading relations 120 - 130 affect how the state model is configured . trading partners 102 - 116 can exchange supply chain data with inter - enterprise server 101 and other trading partners 102 - 116 . trading partners 102 - 116 can comprise a computing device ( e . g ., a personal computer or server device ) operated by a company or other type of entity involved in the supply chain . trading partners 102 - 116 can have different roles relative to other trading partners 102 - 116 as transactions progress through the supply chain . the roles within system 101 can include buyers , manufacturers , suppliers , and vendors . trading partners 102 - 116 typically maintain their own enterprise supply chain management software for managing its own supply chain transaction data . however , some of the supply chain transaction data is shared with other trading partners 102 - 116 for the purpose of tracking . more specifically , trading partners 102 - 116 can change a state associated with the transaction . changes in state can result from various actions such as placing a purchase order ( po ), billing , shipping a product , remitting a payment , etc . for example , one trading partner 108 may be waiting for parts to arrive from another trading partner 110 , but would not know whether such parts were shipped from the trading partner 110 unless trading partner 110 makes such information available to trading partner 108 . in one embodiment , trading partners 102 - 116 are only able to view transactions in accordance with a state model . in another embodiment , trading partners 102 - 116 are only able to make changes to the state in accordance with the state model . inter - enterprise server 101 exchanges the supply chain data with trading partners 102 - 116 as described . inter - enterprise server 101 can be a computing device ( e . g ., a personal computer or a server device ) operated by a service provider for supply chain management . in one embodiment , inter - enterprise server 101 manages a state model associated with each transaction . when trading partners 102 - 116 access inter - enterprise server 101 to view the supply chain data and to potentially perform actions on the transactions , inter - enterprise server 101 allows viewing or changes in accordance with the state model . inter - enterprise server 101 and the state models are described in further detail below . fig2 is a block diagram of inter - enterprise server 101 according to one embodiment of the present invention . inter - enterprise server 101 comprises a web interface 201 , a transaction state module 202 , supply chain database 203 , and business logic module 204 . inter - enterprise server 101 can include additional components ( not shown ) such as a processor , a hard driver , etc . in one embodiment , web interface 201 interfaces with the trading partners by packing and unpacking the supply chain data in data packets suitable for transport across the network ( e . g ., tcp / ip packets ). web interface 201 can also provide a set of application programming interfaces , or apis , for issuing commands to transaction state module 202 . transaction state module 202 allows configuration of state models for transactions . for example , a wizard displays a set of user interfaces such as those illustrated below . transaction state module 202 stores the configurations in a memory device ( not shown ) such as hard drive or a ram device . in response to access by a trading partner 102 - 116 , transactions state module 202 refers to the state model to determine visibility configurations and outputs supply chain data from supply chain database 203 . when actions are requested against the transaction , transaction state module 202 refers to the state model to determine action configurations and can implement business logic rules from business logic module 204 . for example , business logic module can send out an e - mail to a purchasing department of an initiating trading partner once an order has been closed . methods implemented within transaction state module 202 are discussed further below . fig3 is a flow chart illustrating a method 300 for managing transaction states in during supply chain management according to one embodiment of the present invention . the method 300 can be implemented a system for supply chain management ( e . g ., system 100 ). a state model is defined 310 by , for example , an administrator of supply chain management system , a trading partner ( e . g ., one of trading partners 106 - 112 ), or a vendor ( e . g ., default state models ) using , for example , user interfaces shown in fig4 a - e . more specifically , fig4 a shows a user interface 410 for entering general information 412 about the state model such as name 414 and transaction type 416 . fig4 b shows a user interface 420 for viewing transaction visibility for each of the trading partners , and fig4 c shows a user interface 430 for selecting transaction visibility 432 . fig4 d shows a user interface 440 for selecting actions for state transitions . fig4 e shows a user interface 450 for selecting how a role of the trading partner that performs an action will affect the state . in one embodiment , the state model is pre - defined , and thus only needs to be associated with a particular transaction . additionally , default state models that are configured according to industry norms can be supplied by a vendor . the trading partner can either modify an existing state model or fully customize the state model to suit their business process . the availability of a transaction refers to which of the trading partners will be able to view , or have visibility to , the transaction . for example , a supplier may be unable to view a transaction as a public draft of a buyer until it is committed . table 1 is an example of transaction availability for a forecast transaction ; table 2 is an example of transaction availability for a create order action ; and table 3 is an example of transaction availability for an order transaction . the trading partner can initiate 320 a transaction . the transaction can be , for example , a forecast order , a purchase order ( po ), a billing , a product shipment , a payment , an invoice , a credit memo , a request for quote ( rfq ), and a return material authorization ( rma ). for example , a buyer can place an order for televisions with a manufacturer . in turn , the manufacturer can place several orders for components from its suppliers . the trading partner associates 330 the state model with the transaction . an inter - enterprise server ( e . g ., inter - enterprise server 101 ) can manage 340 the transaction by allowing access to the trading partners based on the state model , as described further in fig5 . fig5 is a flow chart illustrating a method 340 for managing the transaction by allowing access to the trading partners based on the state model according to one embodiment of the present invention . a transaction state module ( e . g ., transaction state module 202 ) receives 510 an access request from the trading partner . the access request can include a request to view a transaction , and / or a request to perform an action on the transaction . the transaction state module retrieves 520 the state model associated with the request from , for example , a supply chain database ( e . g ., supply chain database 203 ). if the trading partner has viewing access to the transaction 530 , the transaction state module allows 540 the trading partner to view . if the partner has action access to the transaction 560 , the transaction state module allows 570 the trading partner to perform an action on the transaction . depending on the action and / or the trading partner , and action can result in a new state for the transaction . table 4 illustrates example actions available to a forecast transaction , and table 5 illustrates the change in state as a result of the action . the rows of table 5 represent source states , the cells represent actions performed against the transaction , and the columns represent the destination states resulting from the action . for example , a transaction at the open state changes to the pending commit state responsive to a submit action . in addition , fig6 is a state diagram 600 that illustrates states and actions associated with table 5 . table 6 illustrates example actions available to an order transaction , and table 7 illustrates the change in state as a result of the action . table 8 illustrates the change in state as a result of the action on an order header for a buyer . table 9 illustrates the change in state as a result of the action on an order line for a buyer . table 10 illustrates the change in state as a result of the action on an order line for a supplier . the order in which the steps of the methods of the present invention are performed is purely illustrative in nature . the steps can be performed in any order or in parallel , unless otherwise indicated by the present disclosure . the methods of the present invention may be performed in hardware , firmware , software , or any combination thereof operating on a single computer or multiple computers of any type . software embodying the present invention may comprise computer instructions in any form ( e . g ., source code , object code , interpreted code , etc .) stored in any computer - readable storage medium ( e . g ., a rom , a ram , a magnetic media , a compact disc , a dvd , etc .). such software may also be in the form of an electrical data signal embodied in a carrier wave propagating on a conductive medium or in the form of light pulses that propagate through an optical fiber . while particular embodiments of the present invention have been shown and described , it will be apparent to those skilled in the art that changes and modifications may be made without departing from this invention in its broader aspect and , therefore , the appended claims are to encompass within their scope all such changes and modifications , as fall within the true spirit of this invention . in the above description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the invention . it will be apparent , however , to one skilled in the art that the invention can be practiced without these specific details . in other instances , structures and devices are shown in block diagram form in order to avoid obscuring the invention . reference in the specification to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the invention . the appearances of the phrase “ in one embodiment ” in various places in the specification are not necessarily all referring to the same embodiment . some portions of the detailed description are presented in terms of algorithms and symbolic representations of operations on data bits within a computer memory . these algorithmic descriptions and representations are the means used by those skilled in the data processing arts to most effectively convey the substance of their work to others skilled in the art . an algorithm is here , and generally , conceived to be a self - consistent sequence of steps leading to a desired result . the steps are those requiring physical manipulations of physical quantities . usually , though not necessarily , these quantities take the form of electrical or magnetic signals capable of being stored , transferred , combined , compared , and otherwise manipulated . it has proven convenient at times , principally for reasons of common usage , to refer to these signals as bits , values , elements , symbols , characters , terms , numbers , or the like . it should be borne in mind , however , that all of these and similar terms are to be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise as apparent from the discussion , it is appreciated that throughout the description , discussions utilizing terms such as “ processing ” or “ computing ” or “ calculating ” or “ determining ” or “ displaying ” or the like , refer to the action and processes of a computer system , or similar electronic computing device , that manipulates and transforms data represented as physical ( electronic ) quantities within the computer system &# 39 ; s registers and memories into other data similarly represented as physical quantities within the computer system memories or registers or other such information storage , transmission or display devices . the present invention also relates to an apparatus for performing the operations herein . this apparatus can be specially constructed for the required purposes , or it can comprise a general - purpose computer selectively activated or reconfigured by a computer program stored in the computer . such a computer program can be stored in a computer readable storage medium , such as , but is not limited to , any type of disk including floppy disks , optical disks , cd - roms , and magnetic - optical disks , read - only memories ( roms ), random access memories ( rams ), eproms , eeproms , magnetic or optical cards , or any type of media suitable for storing electronic instructions , and each coupled to a computer system bus . the algorithms and modules presented herein are not inherently related to any particular computer or other apparatus . various general - purpose systems can be used with programs in accordance with the teachings herein , or it may prove convenient to construct more specialized apparatuses to perform the method steps . the required structure for a variety of these systems will appear from the description below . in addition , the present invention is not described with reference to any particular programming language . it will be appreciated that a variety of programming languages can be used to implement the teachings of the invention as described herein . furthermore , as will be apparent to one of ordinary skill in the relevant art , the modules , features , attributes , methodologies , and other aspects of the invention can be implemented as software , hardware , firmware or any combination of the three . of course , wherever a component of the present invention is implemented as software , the component can be implemented as a standalone program , as part of a larger program , as a plurality of separate programs , as a statically or dynamically linked library , as a kernel loadable module , as a device driver , and / or in every and any other way known now or in the future to those of skill in the art of computer programming . additionally , the present invention is in no way limited to implementation in any specific operating system or environment . it will be understood by those skilled in the relevant art that the above - described implementations are merely exemplary , and many changes can be made without departing from the true spirit and scope of the present invention . therefore , it is intended by the appended claims to cover all such changes and modifications that come within the true spirit and scope of this invention .

6Physics

referring to fig1 , this shows a chassis structure as disclosed in wo2009 / 122178 et seq . the present invention is applicable to this style of chassis , and also to other forms of chassis that include at least one longitudinal section of a circular , square , rectangular or other cross - section . the chassis 10 of fig1 , by way of example , employs two pairs of longitudinal circular - section tubes which run from the front of the vehicle towards the rear , and are arranged as a left upper tube 12 , a left lower tube 14 , a right upper tube 16 and a right lower tube 18 . the tubes on each side of the vehicle are arranged generally above and below each other , with generally upright sectional elements 20 connecting them . in addition , several cross - members such as that indicated at 22 run between corresponding tubes on either side in order to complete the framework . in this example , the upright sectional elements are circular - section and the cross - members are square section , but either of these could be adapted to use other cross - sections as required . a front basket 24 is provided , attached to frontal sections of the longitudinal sections 12 , 14 , 16 , 18 in order to provide a mounting location for steering , and braking systems . a hoop 26 is provided in order to allow for roll - over protection . the framework structure of this example is provided with composite panels 28 that are bonded to the framework . these provide bracing to the framework , distributing loads across the chassis . the result is a light and rigid chassis that requires very much less material than a conventional pressed - steel chassis . the present invention is particularly beneficial when applied to a chassis of this type , but can also be applied to other chassis structures . fig2 shows a vertical section through a variant of the above - described chassis , as described in our earlier applications wo2009 / 122178 and wo2012 / 010850 . the right - hand longitudinal tubes 16 , 18 can be seen , together with their circular section . composite panels are attached to the tubes , including a lower panel 28 a that extends horizontally from the lower right tube 18 , and upper panel 28 b that extends horizontally from the upper right tube 16 , and a side panel 28 c that extends vertically between the upper right tube 16 and the lower right tube 18 . the lower and upper panels include a directional fibre reinforcement 30 a , 30 b ( respectively ) to assist in load distribution via the panels . the lower panel 28 a carries a battery 32 for powering an electric motor in the vehicle , and is attached to the lower tube 18 via a detachable fixing 34 so that the battery 32 can be removed easily for recharging or replacement . fig3 shows a view of the underside of a vehicle according to the present invention . the lower longitudinal tubes 14 , 18 can be seen , together with the lower panel 28 a , its reinforcement 30 a ( shown schematically ) and the fixings 34 . rear wheels 35 are attached to the chassis via independent rear suspension ( see wo2010 / 100412 ) and are driven by a rear - mounted engine 36 . front wheels 38 are each attached to the chassis via a front suspension 40 . in order to protect the longitudinal tubes 12 , 14 , 16 , 18 ( especially ) against a side impact , the present invention proposes the provision of crush structures 42 covering at least part of the region between the front wheels 38 and the rear wheels 34 , located laterally outside the longitudinal tubes 12 , 14 , 16 , 18 . whilst the chassis is sufficiently strong to withstand such impacts and comply with the applicable crash standards , this can involve damage to the longitudinal tubes which will be a major task to repair . thus , if this could be avoided , at least for some levels of impact , the vehicle would be more easily repairable . however , the crush structures 42 must not negate the design aims of the chassis as a whole , i . e . that of light weight with rigidity , and must therefore not be so massive as to impose an excessive weight penalty on the vehicle . this results in a crush structure that is able to absorb only very minor impacts , with a significant impact still resulting in deformation of the longitudinal tubes . according to the present invention , the crush structure is designed to work in conjunction with the remainder of the chassis , so that some of the impact is absorbed by the crush structure and some is dissipated into the chassis . this will expand the range of impacts in which the chassis tubes are not deformed and make the small additional weight of the crush structures worthwhile . fig4 shows the concept by which this is achieved . the chassis 10 carries a side crush structure 44 which is mounted to the upper longitudinal bar 12 and comprises a trapezoidal - section hollow body 46 filled with a crushable foam material 48 such as a closed rigid cell structural foam . the section 46 is mounted level with the longitudinal bar 12 and is supplemented with a bracing panel 50 that extends from an outer edge of the trapezoidal section 46 to a connection point with the lower longitudinal bar 14 . thus , in a side impact with a solid object 52 , the crush structure 46 , 48 deforms to absorb some impact energy , but the fact that at least some of the structure is level with the longitudinal bar 12 means that some of the force of the impact is transmitted through the crush structure to the bar 12 and thence into the chassis 10 as a whole . the bracing 50 serves to hold the crush structure 46 , 48 in the generally correct location during the impact , and also provides some aesthetic benefit at other times . the dimensions of the crush structure 46 , 48 and its wall thicknesses ( etc ) are tailored to provide deformation properties so that it deforms slightly before the longitudinal bars 12 , 14 , thereby limiting the forces that are transmitted to the chassis 10 as necessary . of course , there will be a degree of side impact which is high enough to result in deformation of the chassis bars 12 , 14 , 16 , 18 . such an impact would progressively deform the crush structure 44 until it had reached a limiting deformation at which higher forces would be transmitted to the chassis 10 . those higher forces will in some circumstances be sufficient to deform the chassis bars . however , the effect of the crush structure is to raise the threshold point at which chassis deformation takes place by an amount generally corresponding with the energy required to completely crush the crush structure 44 . further , by designing the crush structure 44 so that at least part of it is level with a chassis bar 12 , the two can interact during an impact so that the crush structure is not called upon to absorb all or substantially all the impact energy . this allows the crush structure to be sufficiently small and light to be incorporated into a practical lightweight chassis for a small city car . there are a number of possible designs for the crush structure . fig5 to 11 show further examples , in which like reference numerals are used to denote like parts . thus , fig5 shows a design in which a rectangular composite moulding 54 is located level with the upper bar 12 . a trapezoidal support 56 is located beneath the moulding 54 and is filled with an energy - absorbing foam 58 . mechanical fastenings such as bolts , rivets , adhesive and / or spot welds are used to attach the structure to the upper and lower bars 12 , 14 ; these can be easily reversed after an impact in order to remove the original crush structure and replace it . a further foam filling 60 is used inside the chassis to fill space around the batteries 32 to prevent them from moving during an impact ; as in our previous applications the batteries are enclosed within a sandwich structure bounded laterally by the chassis bars 12 , 14 , 16 , 18 and vertically by the upper composite panel 28 b which is bonded to the chassis bars , and the lower chassis panel 28 a which is fixed mechanically to the remainder of the chassis in order to allow removal of the batteries for replacement or renewal . fig6 shows an arrangement with a central composite crush member 62 which is held level with the upper chassis bar 12 ( as in fig5 ) but supplemented by two triangular - section structures 64 , 66 . the lower triangular structure 66 is attached mechanically to the upper and lower chassis bars 12 , 14 via mechanical fixings ( as before ). the upper triangular structure 64 extends from the upper chassis bar 12 to enclose the crush member 62 , and connects to the outermost corner of the lower triangular structure 66 to form a smooth outer surface . the interior spaces of the two triangular structures 64 , 66 are filled with an energy - absorbent foam 68 , which also assists in supporting the crush structure 62 . fig7 shows an embodiment comprising two composite mouldings 70 , 72 . an upper moulding 70 is located level with the upper chassis bar 12 and contains a high - density energy absorbent foam 74 within its otherwise hollow interior . a lower moulding 72 is located immediately beneath the upper moulding , sharing a dividing wall between the interior spaces of the two mouldings . relative to the chassis , the lower moulding sits to one side of and vertically between the chassis bars 12 , 14 . the lower moulding is fixed mechanically to the lower chassis bar 14 and the upper moulding is fixed mechanically to the upper chassis bar 12 . the otherwise - hollow interior of the lower moulding is filled with a low - density energy absorbent foam 76 . in this context , “ low density foam ” denotes a foam having a lower density than the “ high density foam ”, and vice versa . an exhaust aperture 78 is formed in the shared dividing wall between the two mouldings , so that under impact the high density foam , compressed between the impacting object and the upper chassis bar 12 , will be forced out of the upper moulding 70 and into the lower moulding 72 . that movement will be resisted but not prevented by the lower density foam . in this way , the crush resistance exhibited by the upper moulding 70 can be tailored very closely by variation of the size and shape of the aperture , and by the number and spacing of the apertures if more than one is provided . ideally , several such apertures will be provided along the length of the section , but is may also be advantageous to provide more than one aperture or row of apertures , spaced laterally . further tailoring of the crush resistance can be obtained by selection of the actual densities of the two foams . thus , increasing the density of the high - density foam will increase the crush resistance for a fixed aperture size , but this can be counteracted by reducing the density of the low - density foam as it will then present less resistance to exhaust of the high - density foam via the aperture . fig8 shows an alternative arrangement of sections which collectively form the crush structure . this embodiment is made up of three formed profiles bonded together to make the necessary sectional shape . an inner face 80 sits against the upper and lower chassis tubes 12 , 14 and is , at either end , partly conformal to the chassis tubes . an outer face 82 joins to the inner face at its upper and lower extremities and extends laterally outward between those two points to define ( with the inner face 80 ) a generally trapezoidal shape . an internal rib 84 extends within the trapezoid from the inner face 80 to the outer face 82 and divided the interior of the trapezoid , thus strengthening the structure . the two interior regions thus defined are both filled with impact - absorbing foams 86 , 88 . the sections can be of a composite material , a plastics material , or a metallic material . the complete structure is then mechanically attached to the chassis tubes 12 , 14 . fig9 shows a similar arrangement to fig8 , with an inner face 90 , an outer face 92 , an internal rib 94 , and foam fillings 96 , 98 . in this arrangement , the spatial arrangement is difference such that the outer face 92 is trapezoidal in profile , and the internal rib 94 extends from the meeting point of the inner and outer faces 90 , 92 across the interior space of the structure to the opposing corner of the outer face 92 . thus , the structure is divided into two triangular - section shapes , adding to the rigidity of the crush structure and assisting in tailoring its crush properties to those required . fig1 shows a further arrangement , also employing an inner face 100 , an outer face 102 , an internal rib 104 , and foam fillings 106 , 108 in the same general arrangement . the inner face 100 is however provided with two prominent channels corresponding to the chassis tubes 12 , 14 , which fit snugly over a correspondingly - profiled section 101 attached securely to the chassis tubes 12 , 14 . a spacing is maintained between the section 101 and the chassis tubes , to accommodate threaded fixings on the inner face of the section 101 ; corresponding holes on the inner face 100 and the overlapping outer face 102 allow bolts 103 , 105 to be inserted through the holes and engage with the threaded fixings to hold the crush structure in place . this can be repeated at intervals along the length of the crush structure . fig1 shows a different embodiment . the chassis rails 12 , 14 are again braced by chassis panels 28 a , 28 b and other structures as explained in relation to fig1 and 2 . an outer profile 110 is secured to the upper chassis rail 12 via bolts 112 which are repeated at intervals , and to the lower chassis rail 14 by adhesive bonding ; the outer profile 110 lies adjacent the two chassis rails but diverges laterally outward between them to define a rigid sill to the vehicle . an impact - absorbent foam 116 is provided behind the divergent portion of the profile 110 . an outer skin 118 is provided for cosmetic purposes , substantially conformal to the upper face of the sill shape so that a foot placed on the sill is supported , but shaped aesthetically elsewhere . the lower chassis panel 28 a is bolted to the lower chassis bar 14 at intervals via bolts 114 and also extends slightly beyond the chassis rail 14 to provide an anchor point for the outer skin 118 . this structure then presents a rigid outer surface at the level of the upper chassis rail 12 . this is filled by a door structure 120 comprising an inner skin 122 and an out skin 124 whose profiles are chosen so as to provide the desired aesthetic effect and to define an internal space for various structures such as a lock mechanism , window winders and the like . at the lower extremity of this internal space , there is a crush structure 126 that is held by the closed door structure just above the sill and substantially level with the upper chassis bar 12 . the crush structure is defined by inner and outer faces 128 , 130 ; the outer face 130 is largely flat albeit with a slight curve to match the shape of the outer door skin 124 whereas the inner face 128 is trapezoidal with flanged edges to allow attachment to the outer face 130 . the internal space thus defined is filled with an impact - absorbing foam . as above , the various sections can be of a composite material , a plastics material , or a metallic material as desired . block 132 represents standard typical euro - ncap or federal side impact test piece and thus , in a standard impact of these types will strike the door over the crush structure 126 . initially , the door skin will be deformed , followed immediately by the crush structure 126 which will be compressed between the standard impacter type block 132 and the upper chassis rail 12 . impact forces will thus be transmitted to the chassis as described above , without deforming the chassis . after an impact , the damaged door 120 can be replaced with a new door , thus replacing the crush structure 126 as well . the various embodiments all illustrate variations on the basic theme of the invention , and the variants in each specific embodiment can , if desired , be applied to the other embodiments . it will of course be understood that many variations may be made to the above - described embodiment without departing from the scope of the present invention .

1Performing Operations; Transporting

now , preferred embodiments of this invention will be described below with reference to the accompanying drawings . in the embodiment illustrated in fig1 and fig2 a furnace proper 10 is provided along the direction of conveyance of a material under treatment ( shadow mask material ) indicated by an arrow with a preheating chamber 12 , a preheating purge 14 , a heating chamber 16 , a cooling chamber 18 , and a cooling purge chamber 20 . the preheating chamber 12 is a room for preheating the material under treatment ( shadow mask material ) to a prescribed temperature . this preheating chamber 12 is adapted to introduce therein through a control valve 32 the preheated air which is produced in a preheated air generating device 30 . the heating chamber 16 has the interior thereof divided into three zones , i . e . a first heating zone 160 , a second heating zone 162 , and an igniting zone 164 . the ceiling part or floor part of the heating chamber corresponding to the first heating zone 160 and the second heating zone 162 are jointly provided with heating means using tube burners adapted to generate heat by the combustion of natural gas , for example . these heating devices are given required control by respective heat controlling devices which are not shown in the diagram . this heating chamber 16 is further adapted to admit therein through a control valve 40 a mixed gas of co 2 and co produced by a gas generating device 38 . the heating chamber 16 is further adapted to permit introduction therein through a control valve 44 the steam produced by a steam generating device 42 . the cooling chamber 18 is provided in the ceiling part or floor part thereof with a heating device 46 using a tube burner for setting room temperature conditions enough to cool to a desired temperature the material heated in the heating chamber 16 . this heating device 46 is given required control by a heat controlling device which is not shown in the diagram . this cooling chamber 18 is adapted to admit therein through a control valve 50 the air prepared in an air feeding device 48 . this cooling chamber 18 is further adapted to introduce therein through a control valve 52 a mixed gas of co 2 and co emanating from the aforementioned gas generating device 38 . the preheating purge chamber 14 and the heating chamber 16 are interconnected outside the furnace proper 10 through the medium of a pipe 54 . this connection permits the interior gas of the heating chamber 16 to be introduced into the preheating purge chamber 14 . the cooling purge chamber 20 and the cooling chamber 18 are likewise interconnected outside the furnace proper 10 through the medium of a pipe 56 . this connection permits the interior gas of the cooling chamber 18 to be introduced into the cooling purge chamber 20 . the preheating chamber 12 , the preheating purge chamber 14 , and the cooling purge chamber 20 are jointly provided with a piping such that the preheated air and the mixed gas introduced into these chambers will be discharged respectively via waste gas bypasses 58 , 60 , and 62 into a waste gas storage tank ( not shown ) installed outside . the furnace proper 10 is provided in the interior thereof with a roller conveyor 64 serving to convey a material under treatment from the inlet through the outlet of the furnace . this roller conveyor 64 is provided with independent drive systems adapted to be operated independently in the individual chambers . where this furnace is used for the formation of a black oxide film on the surface of a thin metal sheet , a plurality of materials ( shadow mask materials ) k are subjected to the treatment as held vertically spaced inside a container 66 resembling a case as illustrated in fig3 . the treatment for the formation of black oxide films on the materials k is accomplished by causing this container as mounted on the roller conveyor 64 to be passed through the component chambers of the furnace proper 10 over respectively required lengths of time . between the component chambers and at the outlet and inlet of the furnace proper 10 , there are respectively disposed first to sixth automatically operatable shutters 68 , 70 , 72 , 74 , 76 , and 78 . these shutters 68 , 70 , 72 , 74 , 76 , and 78 are each adapted to be opened when the approach of the container 66 advanced on the roller conveyor 64 is detected by a detection device ( not shown ) such as a sensor . as soon as the shutter is opened , the driving speed of the roller conveyor 64 in the relevant chamber is abruptly increased so that the container 66 will be admitted into the chamber , with the possible outflow of the interior gas of that chamber repressed as much as possible . now , the conditions which the component chambers of the furnace proper are required to fulfil in ensuring effective use of the furnace for the formation of black oxide films on the surface of thin metal sheets will be described below . the gas composition ( volumetric ratio ) of co , co 2 , and steam introduced into the heating chamber 16 is desired to fall in the following range where the materials k for treatment are thin metal sheets made of invar alloy ., where the materials k for treatment are thin metal sheets made of aluminum killed steel or rimmed steel , a mixed gas consisting of co and co 2 and not containing any steam is introduced . as the source for the co and co 2 used in the mixed gas , the gas obtained by burning natural gas or some other similar flammable gas , proves to be suitable . the heating chamber 16 tolerates the hydrogen and other gases which inevitably leak in , the nitrogen gas which inevitably leaks in when air is used for combustion , and the oxygen of air which finds its way in while the shutter is raised and lowered . in the mixed gas , the content of the nitrogen gas is not allowed to exceed 70 %, the total content of other leak gases 1 %, and the content of the oxygen 2 % respectively . the gas composition ( volumetric ratio ) of co and co 2 introduced into the cooling chamber 18 , no matter whether the thin metal sheet as the material k for treatment is made of aluminum killed steel or invar alloy , is desired to fall in the following range . as the source for the o 2 to be introduced into the cooling chamber 18 , the air proves to be suitable . where the air is used for this purpose , the amount of the air to be supplied is desired , relative to the total amount of co and co 2 , to fall in the following range . it is desirable to fix the preheating temperature of the preheating chamber 12 in the neighborhood of 200 ° c ., the temperature of the heating chamber 16 in the range of 500 ° to 650 ° c ., and the temperature of the cooling chamber 18 in the neighborhood of 200 ° c . now , the operation which is involved in the formation of black oxide films on the surface of thin metal sheets made of invar alloy or aluminum killed steel by the use of the furnace under the conditions set as described above will be explained with reference to fig4 . in this diagram , l denotes a temperature change line of a thin metal sheet made of aluminum killed steel . first , a plurality of materials k for treatment are placed in the container 66 . then , this container 66 is introduced into the furnace proper 10 from the inlet side and mounted on the roller conveyor 64 . as a result , the container 60 is conveyed in the direction of the first shutter 68 of the furnace proper 10 . when the approach of the container 66 is detected by the detection device , the first shutter 68 is opened and , at the same time , the portion of the roller conveyor 64 adjoining the entrance thereto is speed up to effect abrupt admission of the container 66 into the preheating chamber 12 . inside the preheating chamber 12 , the container 66 is advanced at a prescribed speed so as to preheat the materials k to a temperature in the neighborhood of 200 ° c . then , the second shutter 70 is opened to admit the container 66 into the preheating purge chamber 14 . subsequently , the third shutter 72 is opened to introduce the container 66 into the heating chamber 16 . the time required for the preheating treatment is about 15 minutes . where the materials k for treatment are thin metal sheets made of aluminum killed steel or rimmed steel , the container 66 is advanced at a prescribed speed inside the heating chamber 16 and , at the same time , the materials k are heated in the atmosphere of mixed gas containing co 2 and co and containing substantially no o 2 at a temperature approximately in the range of 500 ° to 650 ° c . for about 35 minutes . where the materials k for treatment are thin metal sheets made of invar alloy , they are heated in the atmosphere of a mixed gas containing co 2 , co , and steam and containing substantially no o 2 at a temperature approximately in the range of 500 ° to 650 ° c . for about 35 minutes . in this case , when the third shutter 72 and the fourth shutter 74 are opened , the heating chamber 16 inevitably admits the ambient air , though only slightly . this leakage of the ambient air , however , has virtually no effect upon the heating treatment which proceeds in the heating chamber 16 . this treatment , particularly when the materials k for treatment are thin metal sheets made of invar alloy , is aimed at preventing the thin metal sheets from undergoing yielding to abrupt surface oxidation by introducing the reducing gas of co into the atmosphere of the mixed gas containing steam thereby decreasing the amount of o 2 . in consequence of this treatment , the thermal emissivity of the produced oxide film is approximately on the order of 0 . 5 to 0 . 7 , based on the thermal emissivity of the perfect blackbody taken as unity ( 1 ). the oxide film having the thermal emissivity ( degree of blackness ) of this level has no problem from the practical point of view . the use of this furnace , therefore , permits a black oxide film of uniform thickness possessing high density and adhesiveness to be formed with high operational efficiency on the surface of a thin metal sheet made of aluminum killed steel , rimmed steel , or invar alloy . now , the method by which a black oxide film is formed by the use of this furnace on the surface of a shadow mask material made of invar alloy will be described below . first , preparatory to the treatment by the use of this furnace , numerous holes for passage of electron beams are formed by the conventional photoetching method in a thin metal sheet made of invar alloy of such composition as 36ni - fe . subsequently , this thin metal sheet is annealed and stamped to be given an outer shape of desired curvature . the shaped thin metal sheet is then cleaned for removal of adhering grease . the materials k for treatment ( shadow mask materials ) are set in the vertical stages inside the container 66 . this container 66 is then introduced into the furnace proper 10 from the inlet side and mounted on the roller conveyor 64 . the advance of the container 66 as mounted on the roller conveyor 64 through the component chambers of the furnace proper is effected in the same manner as already described . in the process for the formation of black oxide films on the materials k under treatment by the use of this furnace , the first step consists in subjecting the materials k to roughly 13 minutes &# 39 ; preheating in the preheating chamber 12 which is kept at a temperature in the range of 130 ° to 220 ° c . the next step resides in advancing the container 66 to the preheating purge chamber 14 , passing it through this preheating purge chamber 14 over a period of about 3 minutes , and delivering it into the heating chamber 16 . within this heating chamber 16 , the materials k are heated in the atmosphere of a mixed gas containing co 2 , co , and steam at a temperature approximately in the range of 550 ° to 650 ° c . for about 35 minutes . as a result , films of fe 3 o 4 having a dense texture are formed on the materials k . the black oxide films processed up to this step exhibit a thermal emissivity approximately in the range of 0 . 3 to 0 . 5 , based on the thermal emissivity of perfect blackbody taken as unity ( 1 ). at this point , the gas composition ( volumetric ratio ) of the atmosphere inside the heating chamber 16 is desired to be such that the content of co 2 is approximately in the range of 5 to 20 and that of steam in the range of 30 to 50 where the content of co is taken as 1 . to the treatment by the use of the furnace , the presence of n 2 and h 2 in the atmosphere does not matter . thereafter , the materials k are advanced to the cooling chamber 18 which is kept at a temperature approximately in the neighborhood of 200 ° c . when the materials k are brought into contact with the atmosphere of a mixed gas containing co 2 , co , and o 2 and kept at a temperature approximately in the neighborhood of 400 ° c . inside the cooling chamber 18 , black oxide films of sufficient thickness possessing an amply high thermal emissivity are formed on the materials k . in the atmosphere of this mixed gas , the materials k are cooled for about 25 minutes . the gas composition containing co and co 2 ( volumetric ratio ) of the atmosphere in the cooling chamber 18 is required to be such that the content of co 2 is approximately in the range of 5 to 10 and that of o 2 in the range of 10 to 30 where the amount of co and co 2 is taken as 1 . to the treatment under discussion , the presence of n 2 , h 2 and h 2 o in the atmosphere of the mixed gas does not matter . thereafter , the container 66 is advanced to the cooling purge chamber 20 whose inner temperature is kept about 180 ° c ., then passed through this cooling purge chamber 20 over a period of about 5 minutes , and finally taken out of the furnace proper 10 . in accordance with the method for production of a shadow mask described above , therefore , black oxide films of uniform thicknees possessing high density and adhesiveness can be formed with high efficiency on the materials k made of invar alloy . the degree of blackness of the black oxide films formed by the use of the furnace is approximately in the range of 0 . 5 to 0 . 7 , based on the thermal admissivity of the perfect blackbody taken as unity ( 1 ) and , therefore , is sufficient for impartation of the resistivity to doming , an indispensable requirement for the color tv picture tube .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

referring to fig1 there is shown a block diagram of a conventional oscillator having a feedback loop of a delay circuit . the shown oscillator comprises a two - input nand circuit 10 receiving at its one input a control or set signal si . an output of the nand circuit 10 is connected through a resistor r to one terminal of a delay circuit 12 , which is in turn connected at its other terminal to another input of the nand circuit 10 . the delay circuit 12 includes a capacitor c 1 connected at its one end to the second input of the nand circuit 10 and grounded at its other end . the one end of the capacitor c 1 is connected through an inductor l to the resistor r and one end of another capacitor c 2 , which is grounded at its other end . in addition , the output of the nand circuit 10 is connected to an input of a not circuit 14 , which operates as a wave shaping circuit generating a pulse signal p o . in the above circuit , if the set signal s i is at a logical level &# 34 ; 0 &# 34 ;, the nand circuit 10 outputs a logical level &# 34 ; 1 &# 34 ; regardless of the logical level of the second input of the nand circuit 10 connected to the delay circuit 12 . thus , the circuit shown in fig1 does not oscillate . if the set signal s i is brought to the logical level &# 34 ; 1 &# 34 ;, the nand circuit 10 operates as a not circuit which receives at its input the output of the delay circuit 12 . the output of the nand circuit 10 is fed back through the resistor r and the delay circuit 12 to the second input of the nand circuit 10 . thus , a loop constituted of the nand circuit 10 , the resistor r and the delay circuit 12 will generate an oscillation signal s o at the output of the nand circuit 10 . assuming that a total delay time given by the nand circuit 10 and the delay circuit 12 is t , the period of the oscillation signal is 2t . in the above circuit , the resistor r acts to prevent a spurious oscillation , and therefore , it is preferred to insert the resistor r in the circuit . as mentioned above , the output of the nand gate 10 is at the logical level &# 34 ; 1 &# 34 ; when the set signal s i is &# 34 ; 0 &# 34 ;. therefore , when the circuit starts oscillation , the oscillation signal s o appearing at the output of the nand circuit 10 is at an initial voltage v s2 of the logical level &# 34 ; 1 &# 34 ; ( near to a supply voltage ), as seen from the oscillation waveform diagram of the nand circuit output shown in fig2 . on the other hand , the amplitude of the oscillation signal is gradually increased by action of the resistor r . as a result , the oscillation signal s o of the nand circuit output assumes the waveform shown in fig2 . namely , a first cycle of the oscillation signal s o does not cross a threshold level v t of the not circuit 14 . as well known , the not circuit will change its output logic level when the input signal changes to cross the threshold v t of the not circuit . accordingly , as mentioned above since the first cycle of oscillation signal s o does not cross the threshold level of the not circuit 14 , the not circuit 14 does not generate a pulse corresponding to the first cycle of oscillation signal s o , as seen from the output waveform diagram of the not circuit 14 shown in fig3 . now , assume that the pulses generated by the not circuit 14 is fed to a counter ( not shown ) so that a delay signal is generated when the count value reaches a preset number . in this case , if the preset value is determined on the basis of a required delay time and the frequency of the oscillation signal s o which is generated , the delay signal will be generated at a delayed time which is longer than the required delay time , since the not circuit 14 generates no pulse corresponding to the first cycle of the oscillation signal . furthermore , the nand circuit 10 and the not circuit 14 have a temperature dependency . therefore , the speed of the amplitude increase of the oscillation signal s o when the oscillation starts will vary in dependence of the temperature . on the other hand , the threshold of the not circuit will fluctuate dependent upon the temperature . accordingly , from the moment the set signal s i is brought into the logical level &# 34 ; 1 &# 34 ; to the first pulse p o is outputted by the not circuit 14 , the length of time will vary in dependence of the temperature . this will also result in a fluctuation of the delay time defined by a delay signal which would be generated when the output pulses of the not circuit 14 are counted to the preset value . turning to fig4 there is shown a circuit diagram of one embodiment of the oscillator in accordance with the present invention . the shown circuit includes a tristate inverter 20 which receives at its control input a control or set signal s i . this tristate inverter 20 is controlled by the set signal s i in such a manner that when the set signal s i is at a logical level &# 34 ; 1 &# 34 ;. the tristate inverter 20 is put in an operable condition to function as an inverter . when the set signal s i is at a logical level &# 34 ; 0 &# 34 ;, the tristate inverter 20 is put in an inoperable condition so as to have a high output impedance regardless of the level of an input signal . the tristate inverter 20 has a signal output connected through a resistor r to one terminal 24 of a lc delay circuit 22 , which is similar to the delay circuit 12 shown in fig1 . the other terminal 26 of the delay circuit 22 is connected to a signal input of the tristate inverter 20 . thus , when the tristate inverter 20 is in the operable condition , there is established an oscillating loop consisting of the tristate inverter 20 , the resistor r and the delay circuit 22 . further , the output of the tristate inverter 20 is connected to an input of a not circuit 28 . this not circuit 28 functions as a wave shaping circuit to generate at its output a pulse signal p o , as will be explained hereinafter . in addition , the opposite terminals 24 and 26 of the delay circuit 22 are connected to the signal outputs of two tristate inverters 30 and 32 , respectively , which in turn receive the set signal s i at the respective control inputs . each of these tristate inverters 30 and 32 has a signal input directly connected to the signal output of the inverter itself . these inverters 30 and 32 are in a full feedback condition . thus , when the set signal s i is at the logical level &# 34 ; 1 &# 34 ;, each of the tristate inverters 30 and 32 is put in an inoperable condition in which it has a high output impedance and the signal output is internally isolated from the signal input . on the other hand , when the set signal s i is at the logical level &# 34 ; 0 &# 34 ;, each of the tristate inverters 30 and 32 is put in an operable condition , as an inverter . in this condition , since these inverters are in the full feedback state as mentioned above , the signal outputs of the inverters are maintained at the respective thresholds of the inverters themselves . in other words , the tristate inverters 30 and 32 will become a voltage generating circuit . therefore , the tristate inverters 30 and 32 are adjusted to have the same threshold v s1 so that the opposite terminals 24 and 26 are maintained at the same potential when the set signal s i is at the logical level &# 34 ; 0 &# 34 ;. it is also adjusted such that the threshold v s1 of the tristate inverters 30 and 32 is somewhat higher than the threshold v t of the not circuit 28 and a threshold of the tristate inverter 20 . when the set signal s i is at the logical level &# 34 ; 0 &# 34 ;, the tristate inverter 20 is put in the high output impedance condition , so that the oscillation loop is not established . on the other hand , the tristate inverters 30 and 32 are put in the operable condition to maintain the potential v s1 at the terminals 24 and 26 of the delay circuit 22 . since the tristate inverter 20 and the not circuit 28 ordinarily have a high input impedance , both the signal input and the signal output s o of the tristate inverter 20 are maintained at the potential v s1 . namely , the signal input of the not circuit 28 is held at the potential v s1 , which is higher than the threshold v t of the not circuit 28 , so that the not circuit 28 maintains the output p o at a low logical level signal . thus , the shown circuit will not oscillate . when the set signal s i is at the logical level &# 34 ; 1 &# 34 ;, the tristate inverter 20 operates as an inverter . on the other hand , the tristate inverters 30 and 32 are put in the high output impedance condition so that the opposite terminals 24 and 26 are not longer supplied with the voltage v s1 and will not be influenced from the tristate inverters 30 and 32 . therefore , the output signal s o of the tristate inverter 20 is fed back through the resistor r and the delay circuit 22 to the input of the tristate inverter 20 , so that the closed loop consisting of the tristate inverter 20 , the resistor r and the delay circuit 22 will oscillate . the resulting oscillation signal s o is converted by the not circuit 28 into a pulse signal p o . as mentioned hereinbefore , assuming that the total delay time of the tristate inverter 20 and the delay circuit 22 is t , the oscillation signal s o has the signal has the period of 2t . fig5 shows the waveform of the signal s o appearing at the output of the tristate inverter 20 when the shown circuit initiates oscillation . as will be apparent from the above explanation of the operation , when the circuit does not oscillate , the output voltage of the tristate inverter 20 is equal to the threshold v s1 at the moment the set signal s i is brought to the logical level &# 34 ; 1 &# 34 ;. this v s1 is the threshold of the tristate inverters 30 and 32 . on the other hand , because of the resistor r , the amplitude of the oscillation signal s o outputted from the tristate inverter 20 gradually becomes larger . in other words , the first cycle of the oscillation signal has only a small amplitude . in addition , the not circuit 28 will not change the condition of its signal output unless the input signal s o changes to cross the threshold v t of the not circuit 28 . furthermore , it is preferred that , when the circuit first begins to oscillate , the output voltage of the tristate inverter 20 will change to approach the threshold v t of the not circuit 28 , so that the not circuit will generate a first pulse as soon as possible after the set signal is brought to the logical level &# 34 ; 1 &# 34 ;. for this purpose , since the threshold v s1 is larger than the threshold v t of the not circuit 28 , the threshold v s1 is also required to be larger than the threshold of the tristate inverter 20 , so that the output voltage of the tristate inverter 20 will decrease toward the threshold v t of the not circuit 28 just after the set signal s i is brought to the logical level &# 34 ; 1 &# 34 ;. accordingly , as mentioned hereinafter , the threshold v s1 of the two tristate inverters 30 and 32 is set to be somewhat larger than both the threshold of the inverter 20 and the threshold v t of the not circuit 28 so that the first cycle of oscillation signal will cross the threshold v t of the not circuit 28 within a first quarter period of the same first cycle , as shown in fig5 . in other words , the threshold v s1 of the tristate inverters 30 and 32 is larger than the threshold of the tristate inverter 20 and the threshold v t of the not circuit 28 , but the threshold v s1 is sufficiently low to allow the first cycle of oscillation signal s o appearing at the output of the tristate inverter 20 to cross the threshold v t of the not circuit 28 within a first quarter period of the same first cycle . thus , the not circuit 28 generates a pulse signal p o from the first cycle of the oscillation signal s o , as illustrated in the waveform diagram of the not circuit output signal shown in fig6 . in the above mentioned oscillator circuit , the tristate inverters 20 , 30 and 32 and the not circuit 28 can be constituted of semiconductor devices . if these inverters and not circuit are formed to have basically the same circuit structure , the thresholds of all the inverters and the not circuit can have the same temperature characteristics , so that relative operation conditions between the inverters and the not circuit will be not substantially changed by variations of the temperature . therefore , the shown circuit can have a good temperature characteristics . for example , each of the tristate inverters and the not circuit can include an inverting circuit constituted by a cmos inverter of the same circuit structure . each of the tristate inverters can further include a pair of analog switches in addition to the cmos inverter . referring to fig7 and 7a , the cmos inverter can comprise a p - channel mos transistor q 1 having a gate connected to the input in of the inverter and a drain connected to the output out of the inverter , and an n - channel mos transistor q 2 having a drain connected to the output out of the inverter and a gate connected to the input in of the inverter . in the case of the not circuit 28 , as shown in fig7 a , the source of the p - channel mos transistor q 1 is connected to a drain supply voltage v dd , and the source of the n - channel mos transistor q 2 is connected to a source supply voltage v ss . in the case of the tristate inverter , as shown in fig7 an analog switch such as a second n - channel mos transistor q 3 is connected between the source of the n - channel mos transistor q 2 and the source supply voltage v ss . a gate of the transistor q 3 is connected to receive a first control signal φ corresponding to the set signal s i . further , another analog switch such as a second p - channel mos transistor q 4 is connected between the source of the first p - channel mos transistor q 1 and the drain supply voltage v dd . this p - channel mos transistor q 4 receives at its gate a second control signal φ in a phase which is opposite to the phase of the set signal s i . thus , if the set signal s i is at the logical level &# 34 ; 1 &# 34 ; ( φ = 1 and φ = 0 ), both of the transistors q 3 and q 4 are put in an on condition . therefore , the cmos inverter consisting of q 1 and q 2 can operates as an inverter . on the other hand , if the set signal s i is at the logical level &# 34 ; 0 &# 34 ; ( φ = 0 and φ = 1 ), both of the transistors q 3 and q 4 are off , so that the cmos inverter of q 1 and q 2 is isolated from the voltage v dd and v ss . thus , the output out is put in a high impedance condition . turning to fig8 there is shown another embodiment of the tristate inverter , which includes a p - channel mos transistor q 5 having its source connected to the drain supply voltage v dd and a gate connected to the input n of the inverter . a drain of the transistor q 5 is connected to the output out of the inverter through another p - channel mos transistor q 6 whose gate is connected to receive the control signal φ in opposite phase to the set signal s i . the output out of the inverter is also connected through a pair of series - connected n - channel transistors q 7 and q 8 to the source supply voltage v ss . a gate of the transistor q 7 is connected to receive the control signal φ in phase with the set signal s i . a gate of the transistor q 8 is connected to the input n of the inverter . with the above arrangement , the transistors q 5 and q 8 constitute a cmos inverter . the transistors q 6 and q 8 function as an analog switch , respectively . if the set signal s i is at the logical level &# 34 ; 1 &# 34 ; ( φ = 1 and φ = 0 ), both of the transistors q 6 and q 7 are put in on condition . therefore , the cmos inverter composed of transistors q 5 and q 8 functions as an inverter . however , if the set signal s i is at the logical level &# 34 ; 0 &# 34 ; ( φ = 0 and φ = 1 ), both of the transistors q 6 and q 7 are put in off condition . as a result , the output out of the inverter is put in a floating condition . the output out has a high impedance . referring to fig9 a and 9b , the tristate inverters shown in fig7 and 8 are represented by a block 40 . if a control signal input φ of the tristate inverter 40 is connected through an inverter 42 to another control signal input φ as shown in fig9 a , there can be easily realized a tristate inverter which can be used as the tristate inverter 20 shown in fig4 . on the other hand , as shown in fig9 b , if the control signal input φ of the tristate inverter 40 is connected through an inverter 44 to the control signal input φ and the input in is directly connected to the output out , a tristate inverter which can be used as the tristate inverters 30 and 32 shown in fig4 . again referring to fig4 the signal input and the signal output of the tristate inverter 20 are connected through the resistor r and the inductor l . therefore , even if one of the tristate inverters 30 and 32 is omitted , both the signal input and the signal output of the tristate inverter 20 will be returned to an appropriate initiating voltage v s1 when a sufficient time has elapsed after set signal s i is brought to the logical level &# 34 ; 0 &# 34 ;. therefore , it is possible to omit either the tristate inverter 30 or 32 . if one of the tristate inverters 30 and 32 is omitted , the remaining tristate inverter will supply the voltage v s1 through the delay circuit 22 to the terminal of the delay circuit 22 from which the tristate inverter voltage source has been removed . therefore , a substantial time is required from when the oscillation stops to when the initiating voltage v s1 is restored at the delay circuit terminal from which the tristate inverter voltage source has been removed . if the interval of time between oscillation and stop is short . it is preferable to couple the tristate inverter voltage sources 30 and 32 to the opposite terminals 24 and 26 of the delay circuit 22 , respectively , as shown in fig4 . in addition , if the delay circuit 22 is constituted of a circuit which isolates , in a dc mode , between the opposite terminals 24 and 26 , it is necessary to provide both of the tristate inverters 30 and 32 . the above mentioned embodiment is such that the output signal p o is maintained at a low level when it is out of oscillation . a positive - going pulse signal is generated at the output p o when the oscillation occurs . however , the oscillator can be such that the output signal p o is held at a high level when it is out of oscillation . a negative - going pulse signal is generated from the output p o in the oscillation condition . for this purpose , a pair of series - connected not circuits can be located in place of the not circuit 28 . alternatively , the threshold v s1 of the tristate inverters 30 and 32 is adjusted to be somewhat smaller than the threshold of the tristate inverter 20 and the threshold v t of the not circuit 28 . in this case , it is also preferred for the thresholds of the tristate inverters 30 and 32 to be smaller than the threshold of the tristate inverter 20 and the threshold of the not circuit 28 , but is high enough to enable a first cycle of the oscillation signal outputted by the tristate inverter 20 to cross the threshold of the not circuit 28 within a first quarter period of the first cycle of oscillation signal . as seen from the above description , when the oscillation starts , the initiating voltage of the oscillation loop is forcedly set at an appropriate potential by a controlled voltage generating means such as full - feedbacked tristate inverter . therefore , a pulse signal is surely generated at a first cycle of the oscillation signal after application of the set signal . the invention has thus been shown and described with reference to specific embodiments . however , it should be noted that the invention is in no way limited to the details of the illustrated structures but changes and modifications may be made within the scope of the appended claims .

7Electricity

the following examples of some embodiments of the invention are provided without limiting the invention to only those embodiments described herein . generation of stably transfected cho - k1 cells using vectors containing either the hcmv promoter or the gpcmv promoter the plasmids constructs were generated as follows . the ampicillin resistance gene was isolated from pbluescript ® ( stratagene ) by pcr incorporating nrui sites within each end of the primer ( 5 ′- tgtcgcgagtctgacagttaccaat gcttaatc 3 ′ ( seq id no : 5 ), 5 ′- catcgcgagcacttttcggggaaatgtgtgcgc - 3 ′ ( seq id no : 6 ). the pcr product was inserted into the pvuii site of pmaeii ( nucleic acids research 2001 29 : e26 ) to generate pca1 . the following oligonucleotides 1 . 5 ′- tcgaagtttaaacatttaaatctagaag ( seq id no : 7 ) cttat - 3 ′ 2 . 5 ′- ccggtatcgataagcttctagatttaaat ( seq id no : 8 ) gtttaaact - 3 ′ 3 . 5 ′- cgataccggtggcgcgccaattgttaatt ( seq id no : 9 ) aagatctgg - 3 ′ 4 . 5 ′- cccattgggccagatcttaattaacaatt ( seq id no : 10 ) ggcgcgcca - 3 ′ 5 . 5 ′- cccaatgggccgtacgaattccttaggct ( seq id no : 11 ) cgag - 3 ′ 6 . 5 ′- ggccctcgagcctaaggaattcgtacgg - ( seq id no : 12 ) 3 ′ were annealed ( 1 with 2 ; 3 with 4 ; 5 with 6 ; and then the three dimers were annealed together ) and used to replace the multicloning site of pca1 between the xhoi and noti sites destroying these sites during the construction . this generated pca1mcs . the agei site was deleted from the pgk promoter within ppgk - puro - bgh pa by agei restriction digestion followed by blunting with t4 dna polymerise and re - ligation . the pgk - puromycin pa cassette was removed from this vector as an ecori - xhoi fragment and ligated into pca1mcs that had similarly been digested with ecori and xhoi . this vector was designated pcia - puro ( cet 1000 ). the bghpa in pcia - puro was then replaced with the hsv tkpa . the hsv - tk polya was removed from pegfp - n1 as a bstbi - eco1091 fragment , blunted with t4 dna polymerase , and ligated into pcia - puro that had been digested with saci and blunted with t4 dna polymerase . this vector was designated cet 1005 . to construct pcet1005 1 . 5 kb - gpcmv - egfp , the 1 . 5 kb hnrnp ucoe fragment was excised from pcet20 ( described previously ) using bsmbi , blunt - ended using t4 polymerase and then cloned into the blunted xhoi site of pegfp - n1 ( clontech , palo alto , calif ., usa ) generating pegfp - n1 1 . 5 kb - egfp . the 2 . 4 kb “ hnrnp - egfp ” cassette was then excised from this plasmid using nhei ( blunt - ended )/ noti and subcloned into the backbone of pcet1005 - egfp that had been digested with swai / noti to give pcet1005 1 . 5 kb - egfp . the gpcmv promoter was then excised from ppcrscript gpcmv ( synthesized by geneart , regensburg , germany ) with nhei and ecori , blunt - ended and subcloned into the blunted bamhi of this plasmid to yield pcet1005 1 . 5 kb - gpcmv - egfp . excising the 1 . 5 kb hnrnp ucoe using pmei / saci , blunt - ending and religating the backbone generated the plasmid pcet1005 gpcmv - egfp . to construct pcet1015 8 kb - gpcmv - egfp , the 5 . 3 kb saci ( blunt )/ paci fragment of pcet1005 1 . 5 kb - gpcmv - egfp was subcloned into the asci ( blunt )/ paci - digested backbone of pcet1015 . the plasmid pcet1005 1 . 5 kb - hcmv - egfp was constructed by subcloning the blunted 1 . 5 kb hnrnp bsmbi fragment from pcet20 into the blunted clai site of pcet1005 - egfp . cho - k1 cells were maintained in f12 ( ham ) nutrient mixture ( gibco , uk ) supplemented with 10 % foetal calf serum ( invitrogen , uk ) and 5 u / ml penicillin and streptomycin mix ( sigma , uk ). for stable transfection of cho - k1 , plasmids were linearised with pcii , extracted in phenol : chloroform : isoamyl alcohol and chloroform , precipitated in ethanol and resuspended at a concentration of 0 . 25 μg / μl in sterile water . in a sterile electroporation cuvette , equivalent molar quantities of linearised plasmids were diluted to 25 μl in sterile water ( 1 . 39 μg pcet1005 - egfp , 1 . 78 μg pcet1005 1 . 5 kb - hcmv - egfp , 1 . 45 μg pcet1005 gpcmv - egfp or 1 . 85 μg pcet1005 1 . 5 kb - gpcmv - egfp ) and mixed with 5 × 10 6 cho - k1 cells in 250 μl growth medium . after incubation on ice for 15 minutes , the cells were electroporated at 250v / 975 μf ( biorad gene pulser ii ™) and incubated at room temperature for a further 10 minutes . cells were then transferred into 10 ml of growth media , harvested by centrifugation and transferred into a 225 cm 2 tissue culture flask in a total of 50ml of growth medium . cells were incubated for 24 hours at 37 ° c . in a 5 % co 2 incubator before addition of puromycin ( sigma , uk ) to a concentration of 12 . 5 μg / ml . cells were cultured for 8 days ( replacing selective media after 4 days ) before the stable transfectants were harvested , subcultured in 6 - well tissue culture dishes ( maintaining selection ) and analysed by fluorescence activated cell sorting using the fl1 channel to view egfp . fig2 clearly shows that the two gpcmv containing constructs pcet1005 - gpcmv - egfp ( fig3 ) and pcet1005 - 1 . 5 kb - gpcmv - egfp ( fig5 ) generate pools which express the transgene to a higher level than the corresponding constructs which use the hcmv promoter , pcet1005 - egfp and pcet1005 - 1 . 5 kb - hcmv - egfp respectively . hek293 cells were maintained in dulbecco &# 39 ; s modified eagle medium ( dmem ; sigma , uk ) supplemented with 10 % foetal calf serum and 5 u / ml penicillin and streptomycin mix . for stable transfection , hek293 cells were seeded into 6 - well dishes at a density of 1 × 10 6 cells / well and cultured for 24 hours at 37 ° c . in a 5 % co 2 incubator . cells were then transfected with 4 μg of the indicated plasmid ( pcet1005 - egfp or pcet1005 - gpcmv - egfp )( linearised with pcii ) using 10 μl lipofectamine 2000 ( invitrogen , uk ). the dna and lipofectamine 2000 were diluted separately in 250 μl optimem i ( gibco , uk ) and , after incubation at room temperature for 5 minutes , mixed together and incubated for a further 20 minutes . growth media on the cells was replaced with 1 ml of optimem i supplemented with 15 % fcs and the dna / lipofectamine 2000 mixture was then added . cells were incubated at 37 ° c . in a 5 % co 2 incubator for 5 hours before 3 . 5 ml of optimem i supplemented with 10 % fcs was added . cells were then incubated at 37 ° c . in a 5 % co 2 incubator for 24 hours before being harvested and transferred to a 225 cm 2 tissue culture flask in a total of 50 ml of dmem growth medium , supplemented with 0 . 5 μg / ml puromycin . cells were grown for approximately 14 days ( replacing the selective media every 3 - 4 days ) before the stable transfectants were harvested by centrifugation , subcultured in 6 - well tissue culture dishes ( maintaining selection ) and analysed by fluorescence activated cell sorting using the fl1 channel to view egfp . fig6 shows that the pools generated with the gpcmv construct give egfp expression levels three to four fold higher than those generated with the hcmv construct . cho - k1 cells were cultured as described for example 1 . 1 . 5 × 10 5 cho - k1 cells were seeded 24 hrs before transfection into 12 - wells . 24 hrs later , cells were transfected with 1 ug luciferase reporter plasmid ( phcmv - luc or pgpcmv - luc ) using 1 . 5 ul fugene ( roche , uk ). for this , fugene and dna were both diluted separately in opti - mem i ( invitrogen ), mixed together and incubated for 30 min at rt before added to the cells . luciferase expression was analysed 24 hrs later using a berthold luminometer ( berthold , wildbad , germany ). generally , cell lysis and luciferase reporter assay were performed as described earlier ( lipinski et al ., gene therapy , 2001 ( 8 ): 274 - 281 ). transfections were done in triplicate and the mean and standard deviation of one representative experiment are shown ( fig7 ). clearly the gpcmv vector was at least two - fold more active luciferase than the hcmv plasmid . the plasmid hcmv - luc has been described earlier ( lipinski et al ., gene therapy ( 2001 ) 8 : 274 - 281 ). the plasmid gpcmv - luc was generated by preparing a ndei / ecori fragment from pcrscript / gpcmv ( customer gene synthesis company : geneart , regensburg , germany ) and cloning this gpcmv promoter fragment into the blunted xhoi site of pgl3basic ( promega ). while the present invention has been particularly shown and described with reference to the foregoing preferred and alternative embodiments , it should be understood by those skilled in the art that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention without departing from the spirit and scope of the invention as defined in the following claims . this description of the invention should be understood to include all novel and non - obvious combinations of elements described herein , and claims may be presented in this or a later application to any novel and non - obvious combination of these elements . the foregoing embodiments are illustrative , and no single feature or element is essential to all possible combinations that may be claimed in this or a later application . where the claims recite “ a ” or “ a first ” element of the equivalent thereof , such claims should be understood to include incorporation of one or more such elements , neither requiring nor excluding two or more such elements . it is intended that the following claims define the scope of the invention and that the systems , methods , and compositions within the scope of these claims and their equivalents be covered thereby .

2Chemistry; Metallurgy