Datasets:

max-lue

/

FW_EDU_SUBSET_500k_docs

like 0

Nike uses leather and rubber to make its shoes. The company states as of 2014 that it is committed to using materials that reduce environmental impact. The company works with suppliers to find environmentally friendly materials that meet Nike's manufacturing needs.Know More To manage costs and continue to make products more environmentally friendly, Nike works to reduce the number of materials used in products. Reduction of materials also simplifies the design phase and supply chain for products. As of 2014, Nike ranks in the top three climate-friendly companies globally. It has received praise for its Trash Talk shoe, which uses recycled and synthetic leather taken from factory floors. The company also has a Reuse-A-Shoe program that collects old athletic shoes for recycling. The recycled materials are used in sports facilities, including running tracks and playgrounds. Nike Inc. designs, manufactures and markets clothing, shoes, equipment and services. The company's headquarters is near Portland, Ore. It is one of the largest suppliers of athletic wear in the world, and it is a top maker of sports equipment. The company's revenues exceeded $24 billion in 2012, and it employs more than 44,000 people globally. The Nike name comes from the Greek goddess of victory. Nike has been the subject of controversy at times, as of 2014, for contracting with factories in Asia and Mexico known to have poor working conditions.

<urn:uuid:36410a6a-5e3d-4e31-bef3-00c45b8a4e85>

CC-MAIN-2014-52

http://www.ask.com/beauty-fashion/materials-used-make-nike-shoes-ed3243e8c66589de

s3://commoncrawl/crawl-data/CC-MAIN-2014-52/segments/1418802766267.61/warc/CC-MAIN-20141217075246-00020-ip-10-231-17-201.ec2.internal.warc.gz

en

Fracking – will the public accept it? Gas is gaining favour within the power generation community, as it is cleaner than coal and less geopolitical than oil The drilling process Steel pipes are inserted, surrounded by cement and perforated The fracking phase: pumping and injecting The fracking phase: back-flushing and gas flow IEA chief economist Faith Birol explains the seven rules that are required to secure a golden age of gas The expected emergence of unconventional gas as a prime energy fuel will depend on public acceptance of hydraulic fracturing. Back in the early 1970s the world consumed four times as much oil as it did gas. Today that gap has more than halved and the appetite for gas continues to grow. Over the next 20 years gas is expected to continue to develop, but most of that growth is on the back of unconventional or shale gases. However, the production of unconventional gases – shale gas, coal-bed methane and tight gas – comes with major environmental reservations, and unless these can be overcome its future will be uncertain. In an effort to improve the image of unconventional resources the International Energy Agency (IEA) last month launched its 'seven rules for unconventional gas' – a blueprint for governments and regulators. The main reason for the potentially more serious environmental impact of unconventional gas operations is the nature of the resources themselves: unconventional resources are less concentrated and do not give themselves up easily. In contrast to conventional gas reservoirs shale gas reservoirs have very low permeability, which means that gas does not flow easily out of the rock and low porosities. There are, therefore, relatively few spaces for the gas to be stored. This results in low recovery rates because the gas can be trapped in disconnected spaces within the rock due to the fine-grained nature of the original sediments. The answer is more wells and the controversial technology of hydraulic fracturing (fracking). One feature of the greater scales of operations required to extract unconventional gas is the need for more wells. Whereas onshore conventional wells usually require one well per 10km2, unconventional fields might need a well every 1km2. Shale rocks themselves are geological rock formations rich in clays, typically derived from fine sediments, deposited in fairly quiet environments at the bottoms of seas or lakes, having then been buried over the course of millions of years. When a significant amount of organic matter has been deposited with the sediments, the rock can contain organic solid material called kerogen. If the rock has been heated up to a sufficient temperature during its burial part of this will turn into gas or oil. According to the IEA's World Energy Outlook, gas will supply one-third of the world's incremental energy needs. "Gas is the lucky fuel," Maria van der Hoeven, executive director of the IEA says. "It may not be the ideal choice of policymakers, society or media: that first choice is often renewable energy, domestic coal or nuclear, depending on the political context. Indeed, gas is rarely the cheapest, cleanest or most secure energy source – but its key advantage is that it is a good combination of compromises." The reasons are apparent – gas is cleaner than coal, less geopolitical than oil. That it is gaining favour within the power generation community is well documented. But, despite that seemingly rosy outlook, there are some serious challenges ahead for gas. Conventional gas production in North America and Europe is in terminal decline and with production concentrated in the former Soviet Bloc and the Middle East; security concerns blighted the potential for gas. That, though, was before the advent of unconventional gas, which has laid the foundation for what commentators have dubbed the 'Golden Age of Gas'. "Unconventional gas has in some ways been an unexpected arrival on the energy scene," van der Hoeven says. "These resources have been known [about] for decades, but have been largely untouched as they have been widely considered to be too difficult and too expensive to develop. But now technology is unlocking these reserves, both visibly in North America where the surge in shale gas production over the past decade has had dramatic consequences for the energy markets, [and also] around the world." According to the IEA's Medium-Term Gas Market report, demand for natural gas will increase at around 2.7 per cent a year for the next five years. "We think that conventional gas will grow in the next 25 years, but the main growth will come from unconventional gas," IEA chief economist Fatih Birol explains. "Global demand is predicted to grow by 55 per cent, with about two-thirds of this increase coming from unconventional gas. So if there is to be a golden age of gas it will be reliant on a substantial growth in the unconventional gas market. This, we believe, will depend on the industry following the rules that we have laid out." However the future for unconventional gas is far from certain, clouded as it is in a fog of public concern about its environmental credentials and safety aspects of fracking. The way that unconventional gas is produced has much in common with conventional gas, but more wells are usually required to produce the same amount of gas and techniques such as hydraulic fracturing are often needed. These gas resources are often located in areas that have no recent history of large-scale oil or gas production. This is one of the key attractions because it means in many cases there is the possibility of developing a local resource with positive implications for energy security and the domestic economy. But it is also a source of concern as it can mean the arrival of a new industry in areas that may not have expected it and frankly where the regulatory framework may not be ready for it. Now countries all over the world are looking to emulate the experience of North America with unconventional gas. China and Australia are leading the way, but there is also interest from other parts of the world – including Europe, Latin America and elsewhere. "We see that this boost to gas supply could bring a number of important benefits: greater energy diversity, more secure supply in countries that rely on imports to meet their gas needs as well as global benefits in the form of reduced energy costs," van der Hoeven says. "But let's be honest, alongside these potential economic and energy security benefits there are also legitimate public concerns." These concerns centre around the potential social and environmental impact of unconventional gas production – these include the implications on the water resource, land use and disruption to local communities and they also include the potential serious hazards of water contamination, air pollution and greenhouse gas emissions. The technology and knowhow already exists for unconventional gas to be produced in an environmentally acceptable way, but if the social and environmental impacts are not addressed properly there is a very real possibility that public opposition to drilling for shale gas and other types of unconventional gas will halt the unconventional gas revolution in its tracks. "It's up to industry to win public confidence by demonstrating exemplary performance and it's up to governments because they must ensure that appropriate policies and regulatory regimes are in place," van der Hoeven says. "We have set out in our report a number of golden rules. These are principles that can help governments, industry and other stakeholders to address the social and environmental issues. "Natural gas does have some advantages from the perspective of emissions and local air quality when it replaces other more carbon intensive fossil fuels. Natural gas, including unconventional gas can play an important role, but on its own natural gas does not provide the answer to the challenge of climate change. "Governments around the world need to introduce much stronger policies and measures than they currently envisage driving forward investment in efficient low-carbon technologies to make energy supply more secure and prevent potentially catastrophic climate change." Seven steps to a golden future IEA chief economist Fatih Birol explains the seven rules that are required to secure a golden age of gas 1 Measure, Disclose and Engage Much of the public concern is related to the fact that the public and local communities do not have access to information about the activities surrounding the production of shale gas. Our suggestion is that before starting operations companies measure the quality of the water and air to create a baseline. Then at regular intervals during their operations they repeat the measurements, compare this to the baseline and make this information available. One thing that we feel very strongly about is that the chemicals that are used during the racking process need to be fully disclosed to the public both in terms of content and quantity. 2 Watch where you drill It is very important that companies, governments and regulators make a careful choice of the drilling sites. The geological and seismic surveys of the drilling site are very important and any change in the seismic activity needs to be monitored and reported. 3 Isolate well and prevent leaks We need robust rules for well design, construction and cementing. There is a need for of all these as well as integrity testing to become part of the best practice standards. We also think that depending on the location there it is important to consider the minimum depth requirements. 4 Treat water responsibly To produce shale gas requires greater volumes of water than conventional gas, so sound management of the water resources is crucial both by using the best available technologies to minimise the water use and re-using the waste water. It is also important to minimise the use of chemical additives and use additives that are benign to minimise the risk of contamination. 5 Eliminate venting, flaring & emissions Limiting Methane emissions is very important to limit climate change. It is important therefore that we limit venting and flaring. We would like to target zero venting and minimal flaring. Authorities and regulators need to impose strict limits on venting and flaring. This can be achieved without major investment. 6 Be ready to think big Before any regions considers these operations they should not think of one well. The production and size can grow significantly and consideration should be given as to how the growing scale of production will affect local communities. Instead of bringing water to the site in trucks it might be advantageous to plan in a water pipeline system; this may incur some significant investment but the returns both financially and for impact on local communities may make it worthwhile. 7 Ensure a consistently high level of environmental performance We have to make sure that robust and appropriate regulatory regimes are in place. Government needs to find the balance between regulations and production performance. Since shale gas production practices change from region to region, and even site to site, we need to set targets but leave the choice to individual companies on how they achieve these targets. |To start a discussion topic about this article, please log in or register.| "Our summer watersports special: surfing artificial waves, racing yachts for sport, superyachts for pleasure and much more besides" - Japan sweetens high-speed rail offer to Indonesia - Automakers sued over 'dangerous' keyless ignitions - Smart 3D printed micro-fish could improve detoxification - Self-healing polymer could protect future spacecraft against meteorites - Key component of Hubble successor arrives for assembly - Girls as young as seven put off engineering

<urn:uuid:9cb7be1e-a83b-44b2-a85c-f74b5d40fe33>

CC-MAIN-2015-35

http://eandt.theiet.org/magazine/2012/08/gas-rush.cfm

s3://commoncrawl/crawl-data/CC-MAIN-2015-35/segments/1440644062327.4/warc/CC-MAIN-20150827025422-00141-ip-10-171-96-226.ec2.internal.warc.gz

en

California dairies are bristling under regulations that limit the amount of yucky coliform bacteria allowed in raw milk. The new health standards set a maximum of 10 coliforms per milliliter, which upsets Mark McAfee, the founder of California’s largest raw milk dairy. According to McAfee, “There’s quite a ruckus right now.” Let’s see how he frames the issue. “This is a huge issue and it goes directly to consumer choice. Consumers are fed up with the government being in their kitchens and they want to be able to make their independent choices about food they want to eat.” Consumer choice is good, right? But doesn’t raw milk make people sick? The helpful folks at BarfBlog point out: “before widespread adoption of milk pasteurization, an estimated 25 per cent of all foodborne and waterborne outbreaks of disease were associated with milk.” What does California, that kitchen-occupier of a state, have to say for itself? “We found that coliform count is indicative of a healthy and clean and wholesome production process for raw milk,” said Steve Lyle, spokesman for the California Department of Food and Agriculture. Raw milk may contain salmonella, E. coli, campylobacter and listeria. If you want to guzzle a tall fresh glass of bacteria, go for it, proud American. But please offer pasteurized milk to your kids.

<urn:uuid:a2315de8-f376-49f1-a863-55b7dbd26064>

CC-MAIN-2015-11

http://consumerist.com/2007/12/27/californias-raw-milk-suppliers-soured-by-tough-bacteria-standards/

s3://commoncrawl/crawl-data/CC-MAIN-2015-11/segments/1424936461332.16/warc/CC-MAIN-20150226074101-00058-ip-10-28-5-156.ec2.internal.warc.gz

en

These 12 colorful cards feature animals and creatures that evolved and lived during the Mesozoic Era. 9 of the cards features dinosaurs, 2 feature swimming reptiles, and 1 features a flying reptile. Each card is double sided with a realistic photo and basic information on one side and an interesting mini-article on the back. To review there is a "Who Was I" riddle worksheet. These cards are easy to add to a unit study or independent box or to use during your classroom Paleontology or Dinosaur Unit Study. You can present them in front of the class, break students into groups, have students present to each other, or pass them out one at a time. There are many options for how to use this resource in your classroom or homeschool. PDF format. Buy as a Bundle: Paleontology Unit Study Information Cards Bundle Paleontology Unit Study Bundle Creatures of the Cenozoic Era Information Cards Evidence-Based Opinion Writing Dinosaur Extinction Dinosaur Classification Mats- Dinosaur Taxonomy Lesson Check out more amazing products at Simplyschoolgirl.com

<urn:uuid:c2852c64-2ace-4546-a1c2-f319b373cf25>

CC-MAIN-2018-13

https://www.teacherspayteachers.com/Product/Paleontology-Unit-Study-Creatures-of-the-Mesozoic-Era-Information-Cards-3649915

s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257647003.0/warc/CC-MAIN-20180319155754-20180319175754-00076.warc.gz

en

ampulla, plural Ampullae, a small narrow-necked, round-bodied vase for holding liquids, especially oil and perfumes. It was used in the ancient Mediterranean for toilet purposes and for anointing the bodies of the dead, being then buried with them. In early medieval times in Europe, ampullae were used in anointing kings. Both the name and the function of the ampulla have survived in Western Christianity, where it still designates the vessel containing the oil (chrism) consecrated by the bishop for ritual uses, especially in the sacraments of confirmation, orders, and extreme unction. It is used in the British coronation ceremony and is cited repeatedly by name in the coronation service; the ampulla of the regalia of the United Kingdom takes the form of a golden eagle with outspread wings. Perhaps the most celebrated ampulla in history was that known as la sainte ampoule (“the holy ampulla”), at Reims, from which the kings of France were anointed (legend said that it was brought from heaven by a dove for the coronation of Clovis); this ampulla was destroyed during the French Revolution.

<urn:uuid:bc8cee17-8a6e-4dde-b1b9-8448983fca89>

CC-MAIN-2014-41

http://www.britannica.com/print/topic/21759

s3://commoncrawl/crawl-data/CC-MAIN-2014-41/segments/1410657128337.85/warc/CC-MAIN-20140914011208-00240-ip-10-196-40-205.us-west-1.compute.internal.warc.gz

en

The COVID-19 pandemic tremendously impacted the plastics manufacturing market in 2020. The plastics industry has played a significant role in contributing to global economic development and the growth of various key sectors such as automotive, healthcare, electronics, construction, textiles, and FMCG. Globally, the production of plastics is expected to grow from 370 million metric tons in 2020, to 590 million metric tons by 2050. The COVID-19 pandemic tremendously impacted the plastics manufacturing market in 2020. Governments worldwide imposed strict lockdown measures to contain the spread of the virus. This lockdown resulted in manufacturing activities coming to a standstill for an extended period, resulting in trade restrictions globally. This, in turn, affected the global supply chain, resulting in further decline in consumption and impacted businesses negatively worldwide. Additionally, the growth of the packaging industry also impacted the plastics manufacturing industry. As per a McKinsey report, the pandemic resulted in a significant decline in demand for plastics for certain types of packaging including food services, cosmetic make-up products and apparel. On the other hand, it accelerated growth for others such as packaging for healthcare products and grocery. Global production decline due to Covid-19 Plastic output has been reported to have fallen only twice since the Second World War – during the 1973 oil crisis and the 2008 financial crisis. The industry federation PlasticsEurope pegs that the worldwide output slipped from 368 million tons in 2019 to 367 million tons in 2020. One of the impacts of the fall in oil prices due to a decline in demand during the pandemic is the resultant lower costs for plastic resin production for the plastics industry. Its production in the US saw an annual growth of 0.9% in 2020, as against 1.2% in 2019. The decline in plastic production affected other industries using plastic materials in their production as well. PlasticEurope further states that the automobile sector, one of the industry’s biggest customers, saw its plastics consumption nosedive by 18% in Europe alone in 2020. This also resulted in the automotive industry facing challenges such as limited supply of vehicle parts, decline in new vehicle sales, closing production facilities, and decline in working capital. Thus, volatile raw material prices, lack of skilled labor, the complexity of the global supply chain, and shifting geopolitical dynamics contributed to the decline in the industry last year. Post-recovery industry outlook However, the industry outlook remains positive, and manufacturing is expected to bounce back as the world moves towards the post-pandemic recovery phase. Demand for plastics currently is understood to be driven by two megatrends: global population growth and the expanding middle class. Nearly two-thirds of the increase is projected to be in the Asia-Pacific region. As per market estimates, India and China are expected to reach middle-class populations of more than one billion by 2040, driving demand for packaging and polyethylene (PE), in particular. According to an industry report, the engineering plastics market in Asia-Pacific is expected to achieve a growth rate at a CAGR of 5.7% over the forecast period of 2018-2023. The study further estimates that polyethylene terephthalate (PET) resins are projected to stand out in the segment, with a 51% share in the engineering plastics’ product share and a growth of 6.6% over the next five years. Plastics will be the fastest-growing part of the chemical industry through 2030 while considering factors such as economic recovery, the end of the pandemic and other variables. Demand for plastic, in part, could also be attributed to public perception of it as being COVID-19 repellant. The reason may be that masks, gloves and other protective equipment are made from plastics. Even products like delivery packages and soda bottles. According to Indian Brand Equity Foundation (IBEF), the plastic industry in India deals with more than 2,000 exporters. As of March 2021, India exported plastics raw material worth USD 280.38 million, while the total export for the financial period April 2020 to March 2021 stood at USD 3.29 billion. IIoT adoption can streamline production challenges With the emergence of Industrial IoT (IIoT), the plastic industry can drive effectiveness and productivity in the process of manufacturing plastic. Countries like Germany, France and China have also made significant progress in terms of IIoT adoption in plastic manufacturing. Industry 4.0 and IoT transform industrial production and create new opportunities in the PE value chain. Industry 4.0 comprises the emergence of new technologies that include additive manufacturing, IoT, cloud computing, big data, and CPS. IIoT is also helping to ensure traceability from production to the final product being placed on the retail shelf, improving efficiency on the shop floor and output capacity. These technologies can enable one to gain control of operations and workflow, thus enabling real-time adaptation and flexibility to meet the demands. The significant benefit these emerging technologies provide is towards creating an environment of intelligent systems, which offer better energy consumption efficiency at the factory level. A study also points to how this has a positive impact on the environment. IIoT can thus enable plastic manufacturers to analyze equipment effectiveness with the help of metrics like downtime and production time in real-time. Manufacturers can also gather data about the operational parameters of equipment such as machine reset signal without physically accessing it. It can therefore drive significant operational efficiencies across various functions to improve productivity and detect critical issues faster. Simply put, IIoT can not only help solve machine performance data issues in real-time, but also help present the analytics via mobile applications or online to enable faster resolution. Visit our website to know more : https://www.mobil.co.in/en-in/business This is a partnered post written by Mr. Ankush Khanna, Director – Commercial Brand Marketing (South Asia Pacific), ExxonMobil Lubricants Pvt. Ltd.

<urn:uuid:1026f12c-7466-4a10-8c5b-0146141f7cc1>

CC-MAIN-2021-49

https://www.currencytimes.co.in/iiot-promises-to-improve-equipment-effectiveness-in-the-plastic-industry-business-news-firstpost/

s3://commoncrawl/crawl-data/CC-MAIN-2021-49/segments/1637964358786.67/warc/CC-MAIN-20211129164711-20211129194711-00138.warc.gz

en

We all live in a watershed. Watersheds are areas of land where runoff from rain and snow drains into a lake, stream, river or wetland. Water constantly travels over the land’s surfaces that include farmland, lawns and city streets, on its course to a waterway. When it rains, water runs over the surface picking up any pollutants that are on the way. Small amounts of motor oil, pet waste, pesticides or litter are multiplied along the journey to the nearest waterway. These watersheds are full of life. They provide habitat for fish, birds and wildlife. They are also a source of drinking water for homes and businesses. No matter where you live, work or play, you are always in a watershed. What we all do to the land makes a difference in the quality of water in our rivers and streams. Because of this, and because our work brings us into daily contact with local water resources and watersheds, we spend a lot of our time and efforts protecting our water resources. Eight Simple Steps to Protect Your Watershed The right decisions can help protect these important water resources. Here are a few ways you can help preserve the source of our drinking water and our wildlife habitat. 1. Plan the landscaping around your home or business with more permeable surfaces that allow water to soak into the ground. Try to limit concrete and asphalt, as they contribute to increased levels of storm water runoff. Help prevent soil erosion by preserving existing trees and planting new trees and shrubs. 2. Use native plants that require minimal fertilizer, herbicides and watering. Do not over-apply chemicals and avoid application immediately before it rains. 3. Keep litter, pet waste and yard waste out of streets and storm drains. Pet waste contains bacteria that can find its way into waterways through runoff. 4. Select non-toxic or less toxic alternatives to typical household products, such as cleaning agents. 5. Use pharmaceutical disposal programs offered by local police departments or other agencies that can help you dispose of unneeded medicines safely. 6. Find an opportunity for a rain garden. Rain gardens use native plants and grasses to capture and absorb rainwater from rooftops and roads. These planned gardens help simplify lawn maintenance, control erosion and reduce runoff into streams and storm water systems. 7. Get involved in community activities to clean up waterways and monitor water quality. 8. Use hazardous waste collection sites and services for disposal of household wastes such as chemicals, paints, motor oil and batteries. Be sure to check the list of approved items accepted by the collection agency. Credit: Illinois Amerian Water

<urn:uuid:6c219854-8f5b-4e63-bcd2-ca23b12089d3>

CC-MAIN-2021-17

https://www.usagroundwater.com/watershade

s3://commoncrawl/crawl-data/CC-MAIN-2021-17/segments/1618039603582.93/warc/CC-MAIN-20210422100106-20210422130106-00222.warc.gz

en

Early in the morning, at the tomb where Hero supposedly lies buried, Claudio carries out the first part of the punishment that Leonato has ordered him to perform. Claudio has written an epitaph, or death poem, celebrating Hero’s innocence and grieving the slander that (he believes) led to her death. He reads the epitaph out loud and hangs it upon the tomb. He solemnly promises that he will come and read it here at this time every year. Everyone then goes off to prepare for Claudio’s wedding to Leonato’s niece, the supposed Hero look-alike, which is to occur that very day.Read a translation of Act V, scene iii → Meanwhile, in the church, Leonato, Antonio, Beatrice, Benedick, Hero, Margaret, Ursula, and the friar prepare for the second wedding of Claudio and Hero. We learn from their conversation that Margaret has been interrogated, and that she is innocent of conspiring with Borachio and Don John—she never realized that she was taking part in Don John’s treachery. Benedick is also very relieved that Don John’s trick has come to light, for now he does not need to fight his friend Claudio. Quietly, Benedick also takes Leonato aside and asks him for his permission to marry Beatrice. Don Pedro and Claudio enter, and Antonio goes off to fetch the masked women. While they are waiting, Don Pedro and Claudio tease Benedick about his love for Beatrice and about the fact that he will soon be married, although they do not know that he actually does plan to be married that very day. Hero, Beatrice, and the waiting women enter, all wearing masks. Claudio vows to marry the masked woman by his side, whom he believes to be Leonato’s mysterious niece. But when Hero takes off her mask, the shocked Claudio realizes that it really is Hero. Leonato and Hero tell him that now that Hero’s name has been cleared, she can figuratively come back to life and be his wife, as she should have been before. The party prepares to go to the chapel to finish the ceremony, but Benedick stops everybody. He asks Beatrice, out loud and in public, whether she loves him. Beatrice denies it, and Benedick, in turn, denies loving her. They both agree that they are good friends, but not in love. But, laughingly, Claudio and Hero tell them that they know that isn’t the truth—and both whip out scribbled, half-finished love poems that they have found in their friends’ rooms and pockets, written from Benedick to Beatrice and from Beatrice to Benedick. Benedick and Beatrice realize that they have been caught red-handed and, giving in, finally agree to marry. Benedick silences Beatrice, for the first time, by kissing her. Claudio and Don Pedro begin to tease Benedick again, but Benedick laughingly says that he does not care—he remains determined to be married, and nothing he has ever said against marriage in the past makes any difference to him now. He and Claudio assert their friendship again, and Benedick calls for a dance before the double wedding. Suddenly, a messenger rushes in to inform the company that Leonato’s men have arrested Don John in his flight from Mes-sina. They have brought him back to Messina a prisoner. Benedick instructs Don Pedro to put off thinking about the villain until tomorrow, when Benedick will invent fine tortures for him. In the meantime, Benedick insists that all must dance joyfully in celebrating the marriages, and he commands the pipers to strike up the music.Read a translation of Act V, scene iv → This final scene brings the play to a joyous conclusion, drawing it away from the tragedy toward which it had begun to move and letting everyone wind up safe and sound. Claudio and Hero are about to be happily married, as are Benedick and Beatrice. The deception has been revealed, and Don John has been caught and brought to justice. Everybody has made friends again, and the final dance symbolizes the restoration of order and happiness in a world that has been thrown into chaos by Don John’s accusation and Don Pedro and Claudio’s rash action. But in order for the play to reach this point, Hero must go through a symbolic death and rebirth, washing away the taint of the accusation of her supposed sin. Claudio’s writing and reading of an epitaph at her tomb seems to create a sense of closure, in relation to his false accusation of Hero and her supposed death. He acknowledges his error in having accused Hero: “Done to death by slanderous tongues / Was the Hero that here lies” (V.iii.3–4). The song similarly pleads, “Pardon, goddess of the night, / Those that slew thy virgin knight” (V.iii.12–13). When dawn arrives at the end of the scene, and Don Pedro says, “Good morrow, masters, put your torches out,” we can literally see the plot emerging from darkness (V.iii.24). It is now time to attend the wedding meant to release Claudio from his guilt for Hero’s death. From darkness and pain, the story now returns to daylight and happiness. The emotional dynamics of the masked wedding must be complicated, and many readers wonder why Hero still loves Claudio after what he has done to her. The story can be read as one of real love that has been tainted by misunderstanding, paranoia, and fear but that has miraculously ended happily. Hero does seem to love Claudio still, and they are joyful at being reunited. Claudio’s amazement, awe, and wonder at finding Hero still alive may serve to wipe out any last traces of resentment or anger on either side.

<urn:uuid:f0ca5b38-c971-4ff2-8d90-35a75bb1f56d>

CC-MAIN-2021-25

https://www.sparknotes.com/shakespeare/muchado/section10/

s3://commoncrawl/crawl-data/CC-MAIN-2021-25/segments/1623487608702.10/warc/CC-MAIN-20210613100830-20210613130830-00009.warc.gz

en

Maitreya Buddha is regarded as the Buddha to be born in the future, hence the name Future Buddha, of this fortunate aeon. It is said that his birth will take place in city of Ketumati (Banares ?) ruled by Cakravarti king Sankha. At that time the human beings will live for 80,000 years. It is said that Shakyamuni Buddha before leaving Tusita heaven announced that Maitreya would be his successor. It is also said that Asanga, the renowned sage of the Mahayana, went to Tusita heaven to meet Maitreya and he was initiated into five doctrines or works viz: l. Uttaratantra Sastra 3. Mahayana Sutralamkara 4. Madhyanta Vibhaga Sastram 5. Dharma Dharmata Vibhaga Sastram Maitreya as a Bodhisattva was quite popular in Theravada countries. Maitreya Bodhisattva images can be found in Sri Lanka, Burma and Thailand. His images can also be seen in China and Tibet. Maitreya is yellow in color. He holds in his right hand the flower of Nagakeshar and with the left the mendicant bowl. When he is represented in Buddha posture, his hands show dharmacakra mudra with his legs down on the lotus.

<urn:uuid:1fc4951b-bc01-4634-a02e-c35d8d0c4fce>

CC-MAIN-2017-13

http://www.himalayanmart.com/maitreya_bodhisattva.php

s3://commoncrawl/crawl-data/CC-MAIN-2017-13/segments/1490218205046.28/warc/CC-MAIN-20170322213005-00611-ip-10-233-31-227.ec2.internal.warc.gz

en

The quantum laws governing atoms and other tiny objects seem to defy common sense, and information encoded in quantum systems has weird properties that baffle our feeble human minds. John Preskill will explain why he loves quantum entanglement, the elusive feature making quantum information fundamentally different from information in the macroscopic world. By exploiting quantum entanglement, quantum computers should be able to solve otherwise intractable problems, with far-reaching applications to cryptology, materials, and fundamental physical science. Preskill is less weird than a quantum computer, and easier to understand. About the Speaker John Preskill is the Richard P. Feynman Professor of Theoretical Physics at California Institute of Technology and the director of the Institute for Quantum Information and Matter at Caltech. Preskill received his Ph.D. in physics in 1980 from Harvard University. He joined the Caltech faculty in 1983. Preskill began his career in particle physics and cosmology, but in the 1990s he got excited about the possibility of solving otherwise intractable computational problems by exploiting quantum physics. He is especially intrigued by the ways our deepening understanding of quantum information and quantum computing can be applied to other fundamental issues in physics, such as the quantum structure of space and time. You can follow Preskill on Twitter @preskill. The lecture is preceded by an exhibit about the life and work of David Ritz Finkelstein. The exhibit will be on display at Clough Commons Atrium on April 8-25, 2019. About the Bold Ideas In Physics Lecture Series and Exhibit The lecture series celebrates the life and work of David Ritz Finkelstein, the late School of Physics professor who was unafraid to challenge orthodoxy. The exhibit introduces Professor Finkelstein's life, his work on gravitational fields, space-time, quantum relativity, and quantum computations, as well as research by Georgia Tech faculty and students that continues some of his bold ideas. For more information, visit www.davidritzfinkelstein.com.

<urn:uuid:e1a2956f-e8ec-40b2-9437-cc04fccc687f>

CC-MAIN-2019-22

https://cos.gatech.edu/hg/item/617842

s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232257845.26/warc/CC-MAIN-20190525004721-20190525030721-00038.warc.gz

en

The Daily Almanac : Start each day the smart way! Jump start every day with Slim Goodbody's Daily Almanac. It's the 365 day educational series that builds character, recalls historic events, finds the world's science extremes, teaches a word a day and provides tips for healthier living for you and the planet! Recommended for grade levels K-5. Slim Goodbody's Daily Almanac is loaded with high-interest information presented in a lively format that combines music, archival visuals, original artwork, photos and animation. Each daily program relates to the current day and runs approximately five minutes divided into unique curriculum related segments: |Episode Segments||Theme Subject| This Day in History |Civics and Character| We the People

<urn:uuid:24b002e8-40b4-40ca-81e2-13bb8781376f>

CC-MAIN-2016-44

http://www.dailyalmanac365.com/series_overview/

s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988721278.88/warc/CC-MAIN-20161020183841-00260-ip-10-171-6-4.ec2.internal.warc.gz

en

In 2016, 28 armed conflicts were waged in 26 countries. No new conflicts were added to this year’s report, and one conflict was removed. The conflict between the Communist Party of the Philippines (CPP) and the Philippines was removed as each of the preceding two years produced fewer than 25 deaths. However, the conflict between Muslim separatist groups in the Mindanao islands region of the Philippines persisted, with more than 500 deaths in 2016. The regional distribution of armed conflict was basically the same for the last two years. Africa and Asia continued to have the most conflicts (12 and nine, respectively), with India still hosting three separate, internal conflicts. The Middle East continued to host five armed conflicts, while Europe and the Americas had the fewest conflicts (two and one, respectively). Syria continued remained the world’s top source country for refugees. By mid-2016, 4.8-million Syrians had fled the country as refugees and more than 6.1-million people were internally displaced. By the end of the year, the total death toll had risen to more than 400,000. In fall 2016, a historic peace deal was negotiated to end the civil war in Colombia – the only remaining conflict of its kind in the Western hemisphere. After 52 years of conflict, the Revolutionary Armed Forces of Colombia (FARC) reached a comprehensive peace agreement with the Government of Colombia in which they promised to abandon armed struggle and become a legal political party. In an October referendum, Colombian citizens rejected the proposed peace accord by less than half a percentage point, but the two parties signed a revised deal on November 24 that Congress approved on November 30. Project Ploughshares has reported annually on armed conflict since 1987. (covering the period January 1, 2016 to December 31, 2016)

<urn:uuid:d2f4de30-9c43-4d86-b825-510cd920d519>

CC-MAIN-2018-05

http://ploughshares.ca/pl_publications/armed-conflicts-report-2017-summary/

s3://commoncrawl/crawl-data/CC-MAIN-2018-05/segments/1516084886895.18/warc/CC-MAIN-20180117102533-20180117122533-00295.warc.gz

en

A cellular automaton (CA) is a discrete model that consists of a cell-grid, where each cell is in one of a number of well-defined states. The grid can be in any finite number of dimensions, though the mostly studied CAs have one or two dimensions. The time in the model is discrete and the state of each cell C at time t depends only on the cell-states within some well-defined neighbourhood of C at time t-1. The update function (also called the update rule) is a table that defines the state for each cell at time t as a function of the state of the neighbourhood of C at time t-1. Although a wide range of CAs have been studied, a model called “The Game of Life†developed by John Conway has become particularly well known. - Wikipedia, Cellular Automaton, http://en.wikipedia.org/w/index.php?title=Cellular_automaton&oldid=135515254 (as of June 3, 2007). - Wolfram MathWorld, Cellular Automaton (by Eric W. Weisstein), http://mathworld.wolfram.com/CellularAutomaton.html (as of June 3, 2007).

<urn:uuid:9ac49581-d36c-4588-9c2e-c24568452c03>

CC-MAIN-2014-49

http://vlab.infotech.monash.edu.au/simulations/cellular-automata/

s3://commoncrawl/crawl-data/CC-MAIN-2014-49/segments/1416400379083.43/warc/CC-MAIN-20141119123259-00054-ip-10-235-23-156.ec2.internal.warc.gz

en

Girls First | Surat, India PROGRAM RESULTS +1,800 adolescent girls in over 20 slums in Surat have participated Independent evaluations have confirmed measurable improvement in many key metrics Mental and behavioral health, social skills, and academic indicators all positively improved “What I liked so much was that I was able to solve my own problem.” Girls First Participant | Surat, India Background + Situation | Surat, India Surat is a city of 6 million people located in the state of Gujarat, India. While boasting a lucrative diamond cutting and textile manufacturing industries, 35% to 45% of the city’s population lives in slums. Slums are overcrowded, with no running water, few if any toilets, no sanitation or drainage system, and few permanent structures. Many are located near Surat’s canals, which flood with toxic refuse during the monsoon season, at times reaching heights of 6-10 feet. Gender discrimination and violence is common in the slums, where women often face physical, sexual, and emotional abuse . Many girls are forced into arranged marriages at the age of 14-16 years. CorStone Response | Put Girls First! Girls First | Surat empowers girls with training in personal resilience. The program uses a low cost facilitated peer-support model that covers topics in character strength development, social-emotional skills, problem-solving and conflict resolution, as well as topics in nutrition, reproductive and sexual health, safe water, HIV/AIDS, malaria prevention and similar. Girls attend sessions in groups of 12 for two hours per week over six months. Working in partnership with the Slum Women Federation of Surat, local women are trained and certified through CorStone’s ‘train the trainer’ program, thus earning a living wage and building their own resilience as they lead the groups. Girl attendees are 12-16 years old, likely to be the first generation in their family to attend school; are at high risk for child marriage; and have few, if any, positive employment prospects beyond menial odd jobs or sex work. All girls in the program are Dalits (so-called “untouchables”) or from other low castes, putting them at an even higher risk for abuse, discrimination, and school dropout. Over 1,800 adolescent girls in over 20 slums in Surat have attended Girls First since its launch in 2011. Independent evaluations have confirmed measurable improvements across a range of mental and behavioral health, social skills, and academic indicators.

<urn:uuid:3bc79ada-7319-4c49-a6eb-bdf944c8313e>

CC-MAIN-2017-26

http://corstone.org/girls-first-surat-india/

s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128320869.68/warc/CC-MAIN-20170626221252-20170627001252-00094.warc.gz

en

Solon (sōˈlən) [key], c.639–c.559 B.C., Athenian statesman, lawgiver, and reformer. He was also a poet, and some of his patriotic verse in the Ionic dialect is extant. At some time (perhaps c.600 B.C.) he led the Athenians in the recapture of Salamis from the Megarians. He was elected chief archon in 594 at a time of social, economic, and political stress in Athens. With most of the land and political power in the hands of the nobles, the peasants were rapidly losing not only their land but their freedom as well. Solon annulled all mortgages and debts, limited the amount of land anyone might add to his holdings, and outlawed all borrowing in which a person's liberty might be pledged. This last reform put an end to serfdom in Attica. Other economic reforms included a ban on the export of all agricultural products except olive oil and the granting of citizenship to immigrant artisans. Solon also made important constitutional changes. The assembly was opened to all freemen, the Areopagus was continued with new powers, and the Council of Four Hundred was created to represent the propertied classes and to prepare the agenda for the popular assembly. Although there was opposition to Solon's reforms, they subsequently became the basis of the Athenian state. He also introduced a more humane law code to replace the code of Draco. The Columbia Electronic Encyclopedia, 6th ed. Copyright © 2012, Columbia University Press. All rights reserved.

<urn:uuid:de0ae4c2-1dd6-48c0-8d9d-709b2fc8cb8a>

CC-MAIN-2016-36

http://www.factmonster.com/encyclopedia/people/solon-athenian-statesman.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-36/segments/1471983553659.85/warc/CC-MAIN-20160823201913-00121-ip-10-153-172-175.ec2.internal.warc.gz

en

Built Up Roof Membrane A built-up roof (Smooth Built-Up, Ballasted Built-Up, or Tar and Gravel) is a class of low-slope roof that consist of laying down several layers of tar and water resistant materials and then covered with gravel. Many old buildings with low slope or flat roofs are topped with built-up roofing made from layers of asphalt-coated roofing felt. The top layer is usually covered with rock or gravel, which serves as a ballast to hold the roofing material down and protect it from UV damage. Built-Up Roofs with gravel surfacing are also known as Tar and Gravel roofs. The typical life span of a built-up roof is 10 to 20 years depending on weather conditions. Types of Built-Up Roofing There are several types of built-up roofing alternatives.Built-up roofs are smooth Asphalt built up (Hot or Cold), and Ballasted Asphalt built up. The bitumen material commonly used in built-up roofing systems is asphalt, coal tar or cold-applied adhesive. The surfacing and materials used on built up roofing are so wide that it all depends on the project and costs of your project. Ballasted asphalt is being used more regularly than before, because it can provide an excellent finish surface and its material is a better fire retardant agent. Gravel or slag surfacing are probably the most popular. The next most popular surfacing are probably the granule-surfaced cap sheets, commonly called 90 pound because they used to weigh approximately that much per square. Now they weigh around 72 pounds per square. Then come the emulsions which can be spray, brush, or roller applied.Built-up roofs can be installed over just about any type of roof deck as long as the proper substrate is used. BUR’s can’t be mopped to a wood roof deck. In this case a rosin sheet and base sheet are needed first. With steel roof decks, the thickness of the deck should be a minimum of 22 gauge and some type of approved insulation should be mechanically-attached to the deck to provide a substrate. How Long Do Built-Up Roofs Last? The service life of a roof is dependent on many factors: geographical location & weather conditions, foot traffic, materials used, conditions under which the roof was installed, slope of roof, type of surfacing material, etc. Under ideal conditions, a 3-ply built-up roof should last at least fifteen years, a 4-ply should last at least 20 years, and a 5-ply should last at least 25 years. This author has seen ten year old 4-ply roof that needed to be replaced and twenty year old 3-ply roofs that were still functioning.

<urn:uuid:cab92eda-0de8-4f2e-851f-3c301b7b09df>

CC-MAIN-2018-30

http://angletonroofing.com/built-up-roofhot-tar-roof-angleton-texas/

s3://commoncrawl/crawl-data/CC-MAIN-2018-30/segments/1531676590493.28/warc/CC-MAIN-20180719031742-20180719051742-00458.warc.gz

en

- A new bird flu variation has caused 11 deaths in China - The H7N9 flu strain is responsible for 44 human cases - Experts are concerned by some of the virus mutations found A new variation of bird flu that the WHO says has caused at least 11 deaths in China has genetic characteristics that make it well-adapted to infect people. In a report published late Thursday in the New England Journal of Medicine, samples from three patients -- all of whom died -- had mutations that have previously been shown to increase transmissibility, and to help the virus grow in a mammal's respiratory tract. The analysis comes amid a modest but steady stream of human cases since the end of March. Saturday, China reported a 7-year-old Beijing girl is the latest person to become infected with the H7N9 flu strain, bringing the total to 44. The strain is normally found in birds, and until last month was never known to infect people. "The H7N9 situation is evolving very quickly," said Nancy Cox, director of the Influenza Division at the U.S. Centers for Disease Control and Prevention. "One thing of concern is the pace at which we are seeing the identification of cases." On a more reassuring note, investigators have found no evidence that the virus has passed directly from person to person. More than a thousand "close contacts" of the patients are being monitored by Chinese health officials, according to the World Health Organization. One concerning mutation, known as "Substitution Q226L," was found in two of the first three victims. Past experiments have shown it to make viruses -- including the H5N1 bird flu virus -- more likely to infect ferrets, which are commonly used in flu research. The same mutation was also found in the viruses that caused the 1957 and 1968 flu pandemics. A second mutation, known as "PB2 E627K," was found in all three virus samples. According to Dr. Ron Fouchier, a Dutch virologist, this mutation allows the virus to reproduce at much lower temperatures than a standard avian influenza virus. The change lets it grow in a human respiratory tract, which is cooler than the virus' natural home: a bird's gastrointestinal tract. In mice, Fouchier said, the mutation makes the infection as much as 1,000 times more virulent. A number of other mutations were found as well, including changes that are characteristic of viruses found in mammals. "Known normal bird viruses have to adapt substantially to infect people, but not these," said Fouchier, who said the changes are enough that he would no longer call the H7N9 strain "bird flu." The first three patients to be identified are an 87-year-old man and a 27-year-old man from Shanghai, and a 35-year-old housewife from Anhui. The woman had visited a chicken market about a week before falling ill. The younger man was a butcher who worked in a market where live birds were sold, although he did not butcher any birds. The 87-year-old had no known exposure to live birds. All three died after suffering severe respiratory symptoms, including acute respiratory distress syndrome and eventually septic shock and multiple organ failure. In a commentary that ran with the article, Cox and Dr. Tim Uyeki, a physician with the CDC, noted that patients were not given antiviral medication until their illness became severe. Oseltamivir (Tamiflu) or zanamivir (Relenza) should be administered as soon as possible to patients with a suspected or confirmed H7N9 infection, the two wrote. Cox said it remains unclear whether the severe illnesses are typical of H7N9 infection or simply the tip of a large iceberg in which a large number of mild cases are going unnoticed. "As surveillance has expanded, we're also seeing individuals with milder cases," said Cox. "We're still seeing very severe disease in some cases, but overall I think it's somewhat reassuring." The CDC is in the final steps of refining a diagnostic test to identify H7N9 in patients, and Cox said it should be available for distribution in a matter of days. A widely available diagnostic test would allow faster identification of patients who actually have the infection, and would also help disease detectives zero in on how people are being exposed. Work has begun on a vaccine, although Cox and others said that even if it is eventually needed, a vaccine likely won't be available for several months. While the overall picture is concerning, flu experts urged calm. "I wouldn't say a pandemic is more likely than it was a year ago," Fouchier said. "The only thing we can do as virologists right now is to point out the interesting characteristics of the virus, try to get to the bottom of this story and try to stop further infections."

<urn:uuid:e9120672-1b01-46a5-a00a-5765be1feb4c>

CC-MAIN-2015-48

http://www.cnn.com/2013/04/12/health/bird-flu/index.html

s3://commoncrawl/crawl-data/CC-MAIN-2015-48/segments/1448398447769.81/warc/CC-MAIN-20151124205407-00192-ip-10-71-132-137.ec2.internal.warc.gz

en

Drawing material from the Imperial War Museum's extensive aural archive, Joshua Levine brings together voices from both sides of the Blitz and the Battle of Britain to give us a unique, complete and compelling picture of this turbulent time. In June 1940, British citizens prepared for an imminent German onslaught. Hitler's troops had overrun Holland, Belgium and France in quick succession, and the British people anticipated an invasion would soon be upon them. From July to October, they watched the Battle of Britain play out in the skies above them, aware that the result would decide their fate. Over the next nine months, the Blitz killed more than 43,000 civilians. For a year, the citizens of Britain were effectively front-line soldiers in a battle which united the country against a hated enemy. We hear from the soldiers, airmen, fire-fighters, air-raid wardens and civilians, people in the air and on the ground, on both sides of the battle, giving us a thrilling account of Britain under siege. With first-hand testimonies from those involved in Dunkirk and the Battle of Britain, Black Saturday on 7th September 1940 when the Luftwaffe began the Blitz, to its climax on the 10th May 1941, this is the definitive oral history of a period when Britain came closer to being overwhelmed by the enemy than at any other time in modern history. Publisher: Ebury Publishing Number of pages: 496 Weight: 333 g Dimensions: 198 x 126 x 31 mm "Terrifically moving stuff" -- Dominic Sandbrook * Daily Telegraph * "Anyone who wishes to learn about human courage, and human endurance, should read this account. It is more powerful than any drama, more convincing than any fiction" -- Peter Ackroyd "the stories range from the humdrum to the heroic and all of them are full of pathos" * BBC Who Do You Think You Are Magazine * "vividly and compellingly recalls a time when the nation stood as one" * Choice * "With the rawness and immediacy that only this kind of oral history can provide." * Sunday Times *

<urn:uuid:df5b7284-96b3-41bb-bfe5-f0e72029a79c>

CC-MAIN-2019-26

https://www.waterstones.com/book/forgotten-voices-of-the-blitz-and-the-battle-for-britain/joshua-levine/9780091910044

s3://commoncrawl/crawl-data/CC-MAIN-2019-26/segments/1560628000306.84/warc/CC-MAIN-20190626114215-20190626140215-00275.warc.gz

en

The iPad is an incredibly popular gadget, selling more than 15 million last quarter. It turns out that the millions of iPads in our hands can put a strain on our shoulders, necks and backs — in addition to your wallet. In a recent study by Microsoft and the US Department of Environmental Health, researchers found that tablet users have a higher potential for “neck and shoulder discomfort” versus using a notebook or a desktop computer. Yes, iPad Shoulder is a real medical problem. The study found that iPad users experienced greater head and neck flexion angles than using a traditional computer. The study found that the worst way to use your iPad is on your lap. Wether you are watching a movie or typing, keeping your iPad on your lap places greater strain on your neck and shoulders, which can result in pain and potentially greater posture issues in the long run. While the study focused on slate tablets in general, the iPad is at the top of the list. Later this year we expect a number of Windows 8 tablets that are in a similar form factor as well as the Lenovo IdeaPad Yoga, which can convert from a notebook to a slate tablet. While you wait for this tablet to help you find ergonomic angles, let me share some ways to use your iPad or similar Android Tablet in an ergonomic manner. Using mobile devices like the iPad with poor posture could lead to arthritis or other health issues earlier in life. How to Hold the iPad Steve Jobs famously told users of the iPhone 4 that they were holding it wrong. Jobs was talking about the antenna issues, but as it turns out there is a wrong way to hold the iPad. According to the ergonomic study, the best way to hold or use your iPad is on a table or other surface that raises the height of the tablet. In this method the tablet user was closes to a neutral position. A neutral position is one that places the least amount of stress on your muscles and body, which in this case will help prevent neck, back and shoulder pain while using the iPad. The easiest way to hold your iPad without breaking your neck is to keep it off your lap. This means holding it in your hands while using it on the couch or placing it on a TV stand or table when possible. Keep in mind the same angles that are good for your neck, shoulders and back could be hazardous to your hands, so if you are using your iPad as a notebook, you might want to invest in a case that can double as a keyboard. Ergonomic iPad Accessories Some of our favorite iPad cases, stands and accessories can help you achieve good iPad posture If you want to go with an Apple standard case, the Smart Cover can be used to get your iPad into a better ergonomic position on a table or desk. This is a bare minimum, but you can find it at any Apple retailer. I picked up the ZeroChroma iPad 2 case at CES this year and I have been very impressed with the functionality and sturdiness of this stand. A collapsible leg folds out and rotates allowing you to place the iPad on a table in either landscape or portrait orientation at pretty much any angle. Look for a full review soon, but the ZeroChroma iPad 2 case is impressive and sure to help you keep your neck and shoulders in a neutral position. Joby GorillaMobile Ori The GorillaMobile Ori iPad 2 case is lightweight and offers a different take on collapsible cases. This case earns an inclusion in our roundup of ergonomic iPad cases because it lifts your iPad high off the table, allowing you to stay in a neutral posture position while you use your iPad. We gave the iOMounts iPad stand a Best of CES award thanks to the ease of use and ergonomic placement of the iPad when used at a desk. This tablet stand allows you to mount any tablet to a magnetic stand that lifts your iPad up to eye level for extended use. The stand has a sturdy metal base and feels great. Ergotron Universal Tablet Cradle Ergotron makes some of my favorite ergonomic accessories. From mounts to standing desks they have ergonomics mastered, which is why I was excited to see the Universal Tablet Cradle which allows you to mount your iPad to an Ergotron mount or to mount it next to your monitor for use while at your desk. iPad 2 Keyboard Case If you plan to type on your iPad a lot and want to do it in an ergonomic manner you should look for a keyboard case. I love this $30 iPad keyboard case that acts as a protective front cover, stand and Bluetooth keyboard. There are a number of solutions out there, but for the price it’s hard to beat this case. With this case you get the iPad up in an ergonomic position and you can keep your hands at a lower position to avoid stress from tapping on the iPad for long periods. Read: 30 Amazing Pad 2 Cases iPad Ergonomics Tips As with any activity, staying in one position for extended periods is not ideal. Here are a few basic ergonomics tips to make your iPad and tablet use healthier. Breaks – Take breaks often. Look around the room, stand up and move a bit. Stretches – Here’s a collection of general office stretches to keep yourself limber. I suggest working one or two of these into your iPad use if you are a heavy user. New Positions – You have a very portable device, so find new positions to use the iPad in. Wether you are switching from laying down to sitting up or leaning back to standing, a little change will do you good. How do you stay ergonomic while using your iPad or working mobile? Full Text of the iPad Ergonomic Study. This article may contain affiliate links. Click here for more details.

<urn:uuid:d445cbf7-998a-4d88-9686-f4dd7874b9a7>

CC-MAIN-2021-10

https://www.gottabemobile.com/eveything-you-need-to-know-about-ipad-ergonomics/

s3://commoncrawl/crawl-data/CC-MAIN-2021-10/segments/1614178385378.96/warc/CC-MAIN-20210308143535-20210308173535-00570.warc.gz

en

Osteoporosis is a silent, progressive disease characterized by decreased bone density and increased bone fragility—leading to high susceptibility to fractures. Anyone can develop osteoporosis, but it is common in older women. According to studies, 25% of men and 50 % of women over the age of 50 will break a bone due to osteoporosis. Specialists who treat osteoporosis: - Rheumatologist – physicians who diagnose (detect), treat and medically manage patients who suffer from arthritis and other rheumatic diseases. - Endocrinologists – physician who specializes in the diagnosis and treatment of conditions affecting the endocrine system. - Orthopedic Surgeon – physicians who manage special problems of the musculoskeletal system. Orthopedic surgeons diagnosis your injury or disorder, provide treatment with medication, exercise, surgery or other treatment plans, encourage rehabilitation by recommending exercises or physical therapy to restore movement, strength and function. Orthopedic surgeons prepare patients for surgery as advanced stages of osteoporosis requires surgical correction. - Physical Medicine & Rehabilitation – is a medical specialty concerned with diagnosis, evaluation, and management of persons of all ages with physical and/or cognitive impairment and disability. - Pain Medicine – the field of medicine that is concerned with the prevention of pain, and the evaluation, treatment, and rehabilitation of persons in pain. - Physical Therapist - health care professionals who can help patients reduce pain and improve or restore mobility through developing fitness and wellness programs for healthier and more active lifestyles. Osteoporosis symptoms may include: - A gradual loss of height and an accompanying stooped posture. - Fractures of the spine, wrist, or hip. Risk Factors & Prevention Women Are at Risk for Osteoporosis Men and women lose bone strength as they grow older, but women have higher risk for osteoporosis because they frequently have smaller, thinner frames. The risk for women increases greatly following menopause, with the decrease in bone-protecting estrogen. One in two women over the age of 50 has osteoporosis, yet nearly 80 percent remain undiagnosed because symptoms do not occur until much bone strength is lost. Risk factors for osteoporosis may include: - Advanced age. - History of bone fractures. - Small, thin frame. - Family history of osteoporosis. - Early menopause. - Low calcium diet. - Lack of exercise. - History of eating disorders. - Use of certain medicines (such as steroids or anticonvulsants). - Alcohol and tobacco use. Reduce the onset of osteoporosis by: - Adequate amounts of calcium. - Adequate amounts of vitamin D. - Regular exercise.

<urn:uuid:1baf71c9-c2d1-4fd4-8241-6dffe8a2ecd9>

CC-MAIN-2015-11

http://memorialcare.org/services/glossary/o/osteoporosis

s3://commoncrawl/crawl-data/CC-MAIN-2015-11/segments/1424936463165.18/warc/CC-MAIN-20150226074103-00056-ip-10-28-5-156.ec2.internal.warc.gz

en

In 2002, a catastrophic wildfire that burned 138,000 acres of forest made Denver’s drinking water supply run black with ash and soil. Cleanup of infrastructure damage, debris and erosion cost more than $25 million, while the fire-ravaged landscape caused increased flooding that wreaked havoc on water infrastructure and roads for years. This catastrophe pushed Colorado’s biggest city to examine new ways to protect its drinking water, looking beyond the water utility and into the forested watersheds where the water supply originates. To lessen wildfire risks, Denver Water and the U.S. Forest Service (USFS) started a watershed investment program to improve management of source water forests, together dedicating a total of $32 million to forest restoration over five years. Starting in 2011, Denver Water has invested in forest restoration and improved forest management to reduce the risk of wildfires, and USFS shares costs and implements those restoration activities. Four other Colorado cities -- Aurora, Colorado Springs, Pueblo and Fort Collins – saw the partnership’s potential. These cities now also invest in watershed protection to safeguard their water infrastructure and supplies and potentially reduce costs of water treatment. By investing in forest protection, these cities’ utilities also help the communities they serve with benefits including recreational opportunities, job creation and carbon sequestration. Colorado is not alone in facing drinking water supply risks from watershed degradation. A 2008 study found that the water supply for over half the municipal water supplies in the United States – serving more than 10,000 cities -- originates in forested watersheds. These areas are increasingly at risk due to deforestation, poor forest management, pest infestations and climate change. Despite these risks, only an estimated 40 or 50 watershed investment programs focused on improving drinking water through forest management exist. 10 Factors to Guide Watershed Investment Why are so few communities making this sensible investment to protect their drinking water? Many have been unable to build upon others’ experience to design programs that bring together multiple stakeholders, attract investors and generate results. To help change that, WRI conducted a three-year in-depth comparative analysis of 13 U.S. watershed investment programs. The goal was to gather intelligence from existing programs, along with tangible examples to be applied to different localities, as a one-stop resource on this critical topic. WRI’s analysis, presented in a new report, found 10 factors that can guide the successful development of watershed investment programs: - Identify risks (e.g., wildfire, drought) and seize opportunities to rally support - Build partnerships to fill essential roles and responsibilities - Articulate a clear vision of success - Cultivate champions and advocates to build support (e.g., from water utilities, local government, NGOs, landowners) Designing the program - Develop a scientifically informed watershed plan - Evaluate the business case for investment - Identify investors (e.g., water utilities, companies, foundations) and financing mechanisms for initial and long-term funding Implementing the action plan - Engage landowners and public managers to conserve, restore, and sustainably manage natural infrastructure - Define roles and plans for program administration - Monitor and evaluate performance (e.g., acres of forestland protected, acres treated for fire risk reduction, pounds of sediment avoided from filling waterways) Already, funders are starting to use these lessons to help them determine whether programs are ready for investment. The U.S. EPA and U.S. Endowment for Forestry and Communities’ Healthy Watersheds Consortium Grant Program adopted these lessons as selection criteria in a seed-funding grant program for watershed investment programs. Grant applicants are now judged and selected based on, among other factors, how well they address 10 factors for success that WRI’s study identified. Because EPA is influential in national land and water management, its adoption of these success factors as grant-making selection criteria sets a new standard for evaluating watershed investment programs’ readiness for investment. Other seed funders are already indicating that they will use these success factors to guide watershed investments, and that trend is likely to grow over the coming year. This report can be used to guide the planning, implementation and financing of watershed investment programs nationwide. In the process, they can save lives, human health, infrastructure costs and the drinking water that communities need to sustain their citizens and businesses. For a broader discussion on protecting drinking water, tune into the WRI Podcast, where WRI Vice President for Communications Lawrence MacDonald sits down with Todd Gartner, a WRI Senior Associate with the Water team and co-author of a new paper on watershed protection, and Jasmine Qin, a Research Analyst and driving force behind Global Forest Watch – Water. Together, Todd and Jasmine lay out the importance of natural infrastructure like forests and wetlands in preserving and protecting the watersheds that provide our communities with water.

<urn:uuid:4a457522-1494-4207-b314-fa35280903f3>

CC-MAIN-2019-09

https://www.wri.org/blog/2016/10/us-cities-go-source-protect-drinking-water

s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550249490870.89/warc/CC-MAIN-20190223061816-20190223083816-00307.warc.gz

en

Poster Topical Area: Maternal, Perinatal and Pediatric Nutrition Location: Hall D Poster Board Number: 295 To determine parents' attitudes, beliefs, barriers, and facilitators related to controlling children's portion sizes. Brief questionnaires were completed by 185 English- and Spanish-speaking parents of children 6- to 11-years-old from 3 states (FL, WV, NJ) and 36 participated in portion control themed focus groups<./p> Survey completers indicated that they let children decide how much to eat most the time, but not always. Content analysis of focus group data revealed an overarching attitude of parents feeling it was not important for them to exert control over amounts food children ate because kids were very physically active and kids' relied on internal hunger cues to regulate intake. However, if children had health or weight problems or a potential to be sick from overconsumption, parents sought professional advice and relied on past experience to determine amounts to serve children. Parents agreed that their own portion control behaviors affect amounts children eat, as did siblings and media. Changes from preschool to elementary-school that facilitated portion control included kids being more aware of how much and what they should eat and having more structured mealtime routines. However, busy schedules that interrupted routines and kids' exposure to and desire for unhealthy snacks hindered keeping serving sizes healthy. Other barriers to controlling kids' portion sizes named by English-speaking parents included children snacking often and not being hungry for meals, or lacking interest in eating when meals were served. A barrier among Spanish-speaking parents was lack of knowledge regarding age-appropriate portion sizes for children. Strategies parents used to overcome barriers were portioning food ahead of time, talking with kids about appropriate amounts of food, using resources (e.g., plates, utensils) to guide serving sizes, and restricting free access to snack foods. Strategies for serving healthy amounts to picky eaters were accepting that kids may not like certain foods and offering other food options. Nutrition education efforts that enhance parent knowledge of and value placed on portion control and that provide strategies for effective, healthful portion control could help parents help prevent childhood obesity. United States Department of Agriculture, National Institute of Food and Agriculture, Grant Number 2017-680001-26351 New Brunswick, New Jersey

<urn:uuid:04a4e10b-13c2-4fb7-95a0-1a78d93aada3>

CC-MAIN-2019-43

https://www.eventscribe.com/2018/Nutrition2018/ajaxcalls/PosterInfo.asp?efp=UlhTRFpZVVI0ODYw&PosterID=145928&rnd=0.5809791

s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570986669057.0/warc/CC-MAIN-20191016163146-20191016190646-00492.warc.gz

en

The tale of Amelia Earhart’s mysterious disappearance on July 2, 1937 during her attempt to circumnavigate the globe is a familiar one. For years, many believed that Earhart and her navigator Fred Noonan crashed into the Pacific Ocean after running out of fuel near Howland Island, their intended destination. However, a recently identified piece of aluminum, named Artifact 2-2-V-1, disproves this theory and offers insight into what really happened. Artifact 2-2-V-1, nicknamed “The Miami Patch,” was first recovered in 1991 from an uninhabited island, Nikumaroro, located between Hawaii and Australia. Since its discovery, the International Group for Historic Aircraft Recovery (TIGHAR) has been investigating its connection to Earhart’s aircraft, a twin-engined Lockheed Electra. During her eight-day stay in Miami, the fourth stop on the expedition, Earhart installed a piece of metal on the Electra, which replaced a navigational window. An infamous picture published in The Miami Herald shows the Electra on Tuesday, June 1, 1939 with this shiny new piece of metal. TIGHAR has examined this metal and compared the dimensions of it to the structural components of a restored Lockheed Electra. The pieces matched. “The Miami Patch was an expedient field repair,” the executive director of TIGHAR, Ric Gillespie, told Discovery News. “Its complex fingerprint of dimensions, proportions, materials and rivet patterns was as unique to Earhart’s Electra as a fingerprint is to an individual,” he added. This recent discovery presents a new possibility for what really happened to Earhart and Noonan. Instead of crashing into the Pacific Ocean, they may have actually made a forced landing onto the coral reefs of Nikumaroro Island. Gillespie and his team have also discovered evidence of a castaway presence on the island, thus suggesting that Earhart and Noonan lived and died there. “Earhart sent radio distress calls for at least five nights before the Electra was washed into the ocean by rising tides and surf,” Gillespie said. Three months after Earhart’s disappearance, a photo showing the island’s Western shoreline with an object sticking out of the water was taken. The object’s shape and dimensions mimic the landing gear of a Lockheed Electra. During TIGHAR’s last expedition, an anomaly was also detected through sonar imagery. This anomaly could, in fact, be a part of the aircraft washed into the ocean. These clues will hopefully be stitched together in June of 2015 when TIGHAR returns to Nikumaroro on a 24-day expedition. These findings could finally solve the mystery of what really happened to one of America’s legends and heroines, Amelia Earhart. [Sources: Discovery.com; Simpson Street Free Press Archives]

<urn:uuid:9d0bd554-f445-4a6d-ba9f-3f58a3c28ffb>

CC-MAIN-2019-22

http://simpsonstreetfreepress.org/news/amelia-earhart-discovery

s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232260358.69/warc/CC-MAIN-20190527005538-20190527031538-00145.warc.gz

en

Information Update - Fall 2010 Zaner-Bloser Collection Donated to Library - The Weinberg Memorial Library is the new home for the Zaner-Bloser Penmanship Collection. The company was founded in 1888 by Charles P. Zaner as the Zanerian School of Penmanship. Elmer W. Bloser purchased a share of the company in 1891, and in 1895 the school changed its name to the Zaner-Bloser Company. Zaner-Bloser, a subsidiary of Highlights for Children since 1972, continues to be a leader in the field of penmanship instruction. Originally, the school prepared students for careers as penmen. Penmen often worked in business, preparing ledgers, writing correspondence and creating documents before the invention of the typewriter. Zaner-Bloser also taught students to become teachers of penmanship, illustrators, engravers and engrossers. Engrossers employ the type of ornamental writing used for diplomas and certificates. - The company began publishing its own penmanship manuals. As the company history states: "In 1904, Zaner-Bloser published The Zaner Method of Arm Movement, a landmark text that taught the simplified style of writing learned by students at the Zanerian to children in elementary schools all over the United States. This book also applied the findings of psychologists who had discovered that young children completed manual tasks more easily if allowed to use the large arm movements that were natural to them at their early stage of motor skills development." - The collection has numerous components from professional journals published for the practitioners of handwriting instruction and engrossing to rare hand writing manuals to instructional material for children and photographs of children learning to write. The collection contains more than 20 scrapbooks containing examples of ornamental penmanship done by renowned master penmen. There are also original engrossings that were engraved for publication as well as the engraved printing blocks. - The collection came to The University as a result of a 2009 Hope Horn Gallery exhibit about Scranton-based engrosser P.W. Costello, curated by Thomas Costello and Darlene Miller Lanning. P.W. Costello was an acclaimed penman whose work was published in Zaner-Bloser publications, which were borrowed for the exhibit. The company was looking for a home for its historical collections and expressed interest in The University. Special Collections Librarian Michael Knies visited Zaner-Bloser in January to survey the collection and discuss arrangements. - Although many of the published handwriting manuals from the 19th century exist in other libraries and there are some small collections of master penman examples, there does not appear to be a collection of this scale in the United States or England.

<urn:uuid:9858493d-a06a-405c-8a1d-967c5f61e140>

CC-MAIN-2017-30

http://www.scranton.edu/academics/wml/newsletters/archived/fall-2010/features/fall10s-6.shtml

s3://commoncrawl/crawl-data/CC-MAIN-2017-30/segments/1500549423842.79/warc/CC-MAIN-20170722022441-20170722042441-00065.warc.gz

en

The Invention of Ctrl + Alt + Del – Phrasal Verbs and Technology Activity Discover, practice and master phrasal verbs connected to technology with a video about the invention of Ctrl + Alt + Del. In this 90-minute Phrasal Verbs lesson plan, students discover, practice and master various phrasal verbs connected to technology. The lesson is based on a video you can find here. It discusses the invention of Ctrl + Alt + Del with its creator. In the lesson plan you will find a warm up activity where students look at 3 pictures of a frustrated man in front of a computer. What is the issue he is having? There are 2 vocabulary exercises. 2 grammar exercises explore the difference between separable and inseparable phrasal verbs. Finally, a speaking activity for pairs where students solve some basic IT problems together using some of their new vocabulary. They may even take home some useful tips! Click on Download All to get 2 files: the student and the teacher version. Looking for more? Check out all our Phrasal Verbs Activities. It takes a team of 13 to create and produce this material. In order for that to continue, please think about purchasing your own subscription to ESL Expertz and encourage your colleagues to do the same. We appreciate your confidence and support!

<urn:uuid:b7bbac7c-0c03-4f4c-b53a-15462fcdf9b7>

CC-MAIN-2023-50

https://eslexpertz.com/product/phrasal-verbs-and-technology/

s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100800.25/warc/CC-MAIN-20231209040008-20231209070008-00548.warc.gz

en

What is now Jefferson County was included in Lewis County, created by the Oregon Provisional Government on December 19, 1845. Lewis County included all of the Oregon Country north of the Columbia River, west of the Cowlitz River and the Cascade Mountains, and north to Latitude 54 degrees to -40', the southern boundary of the Russian claims in Alaska. Oregon Territory was created by the U.S. Congress in 1848. The Oregon Territorial Legislature created Jefferson County (including modern day Clallam County) in 1852 and appointed Henry C. Wilson as the first Sheriff in 1853. In 1854 Jefferson County assumed its current boundaries when the Oregon Territorial Legislature removed the northern half to create Clallam County.

<urn:uuid:a222b334-8cfb-45d9-9def-e3c0a1ec69e8>

CC-MAIN-2018-22

http://www.co.jefferson.wa.us/287/History

s3://commoncrawl/crawl-data/CC-MAIN-2018-22/segments/1526794868132.80/warc/CC-MAIN-20180527072151-20180527092151-00555.warc.gz

en

About Sierra De Grazalema The National Park of Grazalema is 100km from Malaga airport and takes roughly 1.5 hrs to get there. Designated a Unesco Biosphere Reserve in 1977 and then a Spanish National park in 1984, it was the first national park in Andalucia. The National park of Grazalema is full of spectacular limestone and dolomite gorges and crags that rise up dramatically, with the most spectacular being the Garganta Verde, 'Green Throat'. Which has one of Europe's largest population of Griffon Vultures. It has an exceptionally rich bird life, particularly raptors. Mammals include roe deer, Egyptian mongoose, badger, fox and Spanish ibex. As well as the rivers having a healthy otter population. The trees consist of large cork oaks, holm oak, olive trees and the magnificent and well preserved forest of the rare Spanish fir. The region is also know as the wettest in Spain, but the weather is very seasonal and only helps the scenery to be the greenest in Andalucia. This area also has an extraordinary array of plant life with a recorded 1300 species. Many of them endemic and some flourish in this environment. Around the Grazalema national park are some beautiful small white villages with some great accommodation, which we link together on our self guided walking itineraries and on our Grazalema Special Walk. There is a large Área de Reserve, with the most fragile ecosystems, Spanish fir forests and black vulture colnies. This part of the park are controlled in terms of dates and numbers. At times when fire risks are greater (July to September) walks to this area are closed. High rainfall and a limestone landscape mean that the water courses and springs are plentiful. The principal rivers are the Guadalete, Guadiaro, Tavizna and Ubrique. Map Of Sierra De Grazalema Ronda is one of the oldest cities of Spain. Its origin, according to archaelogical findings in the old city space belongs to the Neolithic age. Despite of this, the presence of the human being in this land can be explained at a previous time. A proof of this are the sites found at caves, being the most important the one found at the Pileta's Cave, which is one of the best cave's paintings examples of all the Paleolithic age in Andalusia. During the recent Prehistory a lot of human settlements are founded. This fact is proofed by the existance and conservation through the time of archaeological rests that can still be admired nowadays, being represented by some of its most relevant and monumental artistic examples, like the megalithic Necropolis: Dolmen of El Chopo and Encinas Borrachas among others. It will be also at that time when the most important human settlements of the region will be well defined: Acinipo and Ronda, but its rise and important time will arrive later. The time of Acinipo will be at the Roman Empire Age and the Ronda time will be at the Middle Age. From the Roman conquest time of the Iberian Peninsula still remain at our region a lot of rests, being important the ones found in the same city of Ronda. But, without any kind of doubts, the most important archaeological site of the region is the Roman city of Acinipo, because of its conservation's state and also because of some of its elements belonging to a Classic Roman city, like for example, the Theater. Once that Acinipo dissapeared, and after the convulsive period which reason is the Fall of the Roman Empire, the attention was paid now to the city of Ronda. That city, although being a small settlement even during the first time of the Middle Age, became since then the main place where all the important historic events happened. Among these historic events, and because of its importance and its cultural legacy, still alive at the common life (town planning, gastronomy,traditions, farming systems, etc.) has to be considered the Arab Age as the most important. At that time, Ronda appears to be as one of the leading cities, arriving to the category of main city of one of the Kuras (Provinces) of Al-Andalus (the province of Ronda was named of Takurunna). Ronda even achieved to be independent as an independent Kingdom (called at that age the Taifas Kingdom) after the fall of the Cordoba Kingdom. The most important character played by Ronda, and the reason for being well known, arrives with the Nazari Kingdom of Granada, because of its closeness to the territories conquered by the Catholics coming from Castilla. That leads to the city of Ronda, as well to its region, to be a very important border zone. After the conquest of the city by the Catholic Monarchs(1485) deep economic and cultural changes happened, which can be still seen at the structure of the city: Opening of squares not existing before, streets made broader, etc. The 18th century, and the arrival of the Modern age, will be for Ronda the time when it will get its definitive role inside the land of Andalusia. At that time, the most relevant and known monuments of the city where built, as signs of the former aristocracy and the present Ronda: The New Bridge and the Bullring. Since that time and during the 19th century, the romantic image of the city grows, as well as the legend of its Serrania (mountains), generating the world of the bandits and the art of bullfighting a deep impression between lots of important travellers. Both aspects have been converted since then into symbols of our culture and tradition. Despite of this, the cultural and traditional richness of Ronda is much wider and diverse that the one offered by this image, cliched although being nice. This diversity is the current attraction of Ronda and its Serrania. The Sierras around ronda have some of the best bird wildlife in Spain, if not Europe. Bonellis Eagle and Griffon Vulture have some of their highest density here in all of Europe. There are a great deal of raptor here as well as some very interesting smaller birds. The Roman villa of Lacidulia, situated in an estate near to the present village has been traditionally considered the ancestor of Grazalema. During Muslim rule in the 8th century, these lands were populated by people of Berber origin and from them, the area acquired the name of Raisa lami Suli, “town of the Banu al-Salim”, place which passed to Ben-salama, “Son of Zulema and later Grand Zulema”. During this period, its economy was organised around forestry, agriculture, farming and textile manufacture. With the Christian conquest in 1485, Zagrazalema, as it was called at the time, became part of the lands of the Ponce de León. It became economically important as of the 17th century thanks to the drapery industry which produced the famous shawls of Grazalema. In the first years of the 19th century, during the War of Independence, Grazalema suffered attacks and sieges from the Napoleonic troops who partially destroyed the village Traditionally, the economy of the village was generated by small-scale agriculture, sheep herding, cork harvesting, and handicrafts, like hand-weaving lambswool cloth and furniture-making. These activities are now quite limited and under-resourced. Due to the location of Grazalema in the middle of the Sierra de Grazalema Natural Park and the fact that the town is one of the pueblos blancos, the so-called White Towns of Andalusia, tourism now plays a major role in sustaining the village and its people. The mountainous area around Grazalema is popular with climbers and hikers, and local people make money by providing accommodations and hospitality to visitor.

<urn:uuid:5f4a2e1e-ac2e-4abf-8031-3b928f6e229a>

CC-MAIN-2017-26

https://ibextrex.com/walking-holiday/grazalema/

s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128320368.57/warc/CC-MAIN-20170624235551-20170625015551-00543.warc.gz

en

[This post has been cross posted from Joseph Smith’s Polygamy.] On October 22, 2014, LDS.ORG posted three essays dealing with the practice of plural marriage by members of The Church of Jesus Christ of Latter-day Saints between the 1830s and 1904. Perhaps the most controversial essay is the one dealing with the earliest period, which discusses Joseph Smith’s practices and teachings as he introduced plurality to fellow Church members. It appears that some readers’ expectations were not met by this essay. It is true readers did not receive: A theological examination of plural marriage An apology for polygamy. An explanation for why polygamy was not discussed openly in the past. A defense of polygamy. A 1500-page or 350-page or 20-page treatise on plural marriage. A declaration labelling plural marriage as adultery. A portrayal of Joseph Smith as a hypocrite or libertine. A statement that D&C 132 was not a true revelation. A declaration that polygamy was an historical mistake. A lengthy discussion of Emma’s trials because of the practice. A list of injustices suffered by Joseph’s plural wives and an exhaustive detailing of their pain and suffering. What did readers receive? A concise and accurate history (according to available documents) of the introduction of plural marriage by Joseph Smith. A brief discussion of all major controversies dealing with this subject. Permission to discuss these topics in Church meetings without being viewed as an intellectual or apostate. Another evidence of the transparency the Church is striving to achieve regarding its history. The omissions in the essay have elicited scathing criticism. However, as authors who have researched this topic exhaustively, we might offer a few observations of our own for those who criticize: (1) Many critics seemed to have little grasp of the historical record of the period. Therefore, it is not uncommon or surprising that glaring historical errors are promoted in their assessments. To some degree, this undermines the usefulness of the discussions. (2) Many criticisms seem more focused upon the practice of polygamy than upon the essay itself. It might be said the essay has opened the pressure-release valve for venting about the practice. (3) Observers who are complimentary to the essay are often labelled as “apologists,” perhaps implying their assessments could not be accurate. This argumentum ad hominem is one of the most overused logical fallacies and undermines the ability to carry on reasonable, articulate discussions. (4) Joseph Smith’s theological teachings regarding plural marriage are universally ignored. Several major controversies have been generated in conjunction with the introduction of plural marriage in Nauvoo in the early 1840s. All of these are briefly discussed in the introductory essay, which contains 35 paragraphs and 55 endnotes: Polyandry (paragraphs 20–23, endnotes 29–30). The essay acknowledges that “Joseph Smith was sealed to a number of women who were already married,” estimating the number of these sealings at 12–14 (endnote 29). Several possible explanations for this curious practice are provided including that the sealings were “for eternity alone” or that the “sealings may have provided a way to create an eternal bond or link between Joseph’s family and other families within the Church.” Another option was that the “women may have believed a sealing to Joseph Smith would give them blessings they might not otherwise receive in the next life.” For those troubled about the possibility that Joseph practiced polyandry, it provides a plausible line of reasoning that he did not. The essay states, “Polyandry, the marriage of one woman to more than one man, typically involves shared financial, residential, and sexual resources, and children are often raised communally. There is no evidence that Joseph Smith’s sealings functioned in this way, and much evidence works against that view” (endnote 30). Fanny Alger (paragraph 9). The discussion of Fanny Alger is limited to one paragraph, reflecting the thin historical record regarding the union. “Fragmentary evidence suggests that Joseph Smith acted on the angel’s first command by marrying a plural wife, Fanny Alger, in Kirtland, Ohio, in the mid-1830s. Several Latter-day Saints who had lived in Kirtland reported decades later that Joseph Smith had married Alger, who lived and worked in the Smith household, after he had obtained her consent and that of her parents.10 Little is known about this marriage, and nothing is known about the conversations between Joseph and Emma regarding Alger. After the marriage with Alger ended in separation, Joseph seems to have set the subject of plural marriage aside until after the Church moved to Nauvoo, Illinois.” Sexuality (paragraphs 12, 17–18). Despite controversy surrounding religious discussions of sexuality, the essay recognizes: “Sealings for time and eternity included commitments and relationships during this life, generally including the possibility of sexual relations. Eternity-only sealings indicated relationships in the next life alone. Evidence indicates that Joseph Smith participated in both types of sealings.” “The procreation of children and perpetuation of families,” the essay explains, “would continue into the eternities.” Children with plural wives (endnote 25). Acknowledging the possibility of children, the essay states: “Despite claims that Joseph Smith fathered children within plural marriage, genetic testing has so far been negative, though it is possible he fathered two or three children with plural wives.” Those not satisfied with phrase “possibility of sexual relations” in the discussion of sexuality in time-and-eternity sealings can be placated by the admission of the possibility of children, which would require sexual relations. Number of plural wives (paragraph 18, endnote 24). The number of women possibly sealed to Joseph is briefly mentioned: “The exact number of women to whom he was sealed in his lifetime is unknown because the evidence is fragmentary.” However, the estimate of the number of wives was relegated to an endnote: “Careful estimates put the number between 30 and 40.” Emma Smith’s involvement (paragraphs 25–28). The essay explains that plural marriage was “an excruciating ordeal” for Emma. It also taught: “Joseph and Emma loved and respected each other deeply … Emma approved, at least for a time, of four of Joseph Smith’s plural marriages in Nauvoo. … In the summer of 1843, Joseph Smith dictated the revelation on marriage, a lengthy and complex text containing both glorious promises and stern warnings, some directed at Emma.” Young wives (paragraph 19). Exposing itself to criticism, the essay euphemistically refers to Helen Mar Kimball’s sealing as occurring “several months before her 15th birthday” rather than at age 14. But it frankly acknowledges: “Marriage at such an age, inappropriate by today’s standards, was legal in that era, and some women married in their mid-teens.” Denials (paragraph 16, endnote 23). Public denials, reflecting special verbal gymnastics, is conceded: “The rumors [of seductions] prompted members and leaders to issue carefully worded denials that denounced spiritual wifery and polygamy but were silent about what Joseph Smith and others saw as divinely mandated “celestial” plural marriage.22 The statements emphasized that the Church practiced no marital law other than monogamy while implicitly leaving open the possibility that individuals, under direction of God’s living prophet, might do so.” George A. Smith is also quoted: “Any one who will read carefully the denials, as they are termed, of plurality of wives in connection with the circumstances will see clearly that they denounce adultery, fornication, brutal lust and the teaching of plurality of wives by those who were not commanded to do so.” In lauding the Church’s effort to explain this difficult topic, some may assume that in defending the essay we are in fact defending polygamy. We are not. On earth, polygamy expands a man’s sexual and emotional opportunities as a husband as it simultaneously fragments a woman’s sexual and emotional opportunities as a wife. The practice is difficult to defend as anything but unfair and at times emotionally cruel. However, within the context of Joseph Smith’s teachings, a few eternal polygamists are needed. This reality is routinely ignored by almost all critics who often declare or imply that libido drove the process. That is, they allege the implementation of plural marriage occurred because Joseph wanted to expand his sexual opportunities. Those authors seem confident that any of the Prophet’s associated teachings were simply a cover up, so there was no need to take them seriously and it seems none of the critics of the essay do either. Yet, this may be the greatest weakness of most of the critics’ arguments—they are simply incomplete. Joseph Smith taught that couples who are sealed in eternal marriage, not plural marriage, “shall inherit thrones, kingdoms, principalities, and powers, dominions, all heights and depths … and they shall pass by the angels, and the gods, which are set there, to their exaltation and glory in all things, as hath been sealed upon their heads, which glory shall be a fulness and a continuation of the seeds forever and ever. Then shall they be gods” (D&C 132:19–20). A plurality of wives allows all worthy women to be sealed to a husband on earth and become eligible for these blessings in heaven. Any woman who is not sealed will: “remain separately and singly, without exaltation, in their saved condition, to all eternity; and from henceforth are not gods, but are angels of God forever and ever” (v. 17). It is easy to denounce polygamy on earth, but for believers, the discussions should also include the importance of plurality in eternity. As described in section 132, it allows all of God’s children to receive His promised blessings by making eternal marriage available to everyone who seeks it. As the essay explains: “Joseph Smith’s revelation on marriage declared the “continuation of the seeds forever and ever” helped to fulfill God’s purposes for His children. This promise was given to all couples who were married by priesthood authority and were faithful to their covenants” (paragraph 12). It appears that readers of the essay may only be able to appreciate its value if they are able to appreciate Joseph Smith’s teachings about eternal marriage. Without that understanding, they will see only an unjust earthly practice that is easily condemned. The fact that the eternal contributions of plurality have not been addressed by virtually any critic suggests that additional study on the topic might result in different critiques of this watershed essay. One of Joseph’s plural wives, Helen Mar Kimball, remembered: “The Prophet said that the practice of this principle would be the hardest trial the Saints would ever have to test their faith.” Ironically, simply trusting that God commanded them to do so in the past is a test of faith for some Saints today.

<urn:uuid:e79e42db-822a-4e0c-84b8-221f8a6f4dfc>

CC-MAIN-2019-13

https://www.fairmormon.org/blog/2014/11/10/lds-org-essay-on-nauvoo-polygamy-what-did-readers-expect

s3://commoncrawl/crawl-data/CC-MAIN-2019-13/segments/1552912202572.7/warc/CC-MAIN-20190321213516-20190321235516-00236.warc.gz

en

Here's the second section of the lesson on the Bible and Politics in the 20th century. I'll post a final section in the next couple of days on moves in recent politics. 2. Further Divide: The Civil Rights Movement and the Rise of the Religious Right The next great outpouring of biblical language in American political discourse came in the decades of the 1950s, 60s, and 70s. The Civil Rights Movement was at the forefront of efforts to engage political structures with a biblical message, but the Religious Right was not far behind. Both movements began at the grassroots as church-based organizations for social change; both also emerged from the grassroots to have significant voices in national and state governments; and both used the bible extensively to make their political points. Nevertheless, each group used the Bible in distinct ways and for distinct ends. The Civil Rights Movement: MLK and followers Martin Luther King’s speeches and activities were heavily informed by the Bible. King claimed Matthew 5:47—‘love your enemies’—as the basis of his refusal to use violence, and much of his rhetoric was explicitly pulled from the Bible. For example, the famous ‘I have a dream’ speech, delivered on the steps of the Lincoln Memorial, draws on Amos 5:24 (‘let justice roll like a river…’) and Isaiah 40:4-5 (‘every valley shall be exalted…’) for its rhetorical punch-lines. Similarly, King’s last speech, ‘I’ve been to the mountaintop,’ uses numerous biblical references as it implores preachers to speak out for justice in a time comparable to the Exodus. The fruits of King’s biblical politics are varied. During his lifetime, he propelled the initial dismantling of segregation laws and the passage of the Voting Rights Act of 1965 (removing poll taxes that kept poor blacks from voting); he later began to openly protest the Vietnam War. King also opened the door for many religious figures to enter the realm of politics. The most famous of these figures are, of course, Reverends Jesse Jackson and Al Sharpton, both of whom staged unsuccessful presidential campaigns. Lesser known, perhaps, are activist John Perkins and Congressman John Lewis. In addition, King’s legacy has fueled a number of theological and church-based political movements. Among these we can count certain streams of black liberation theology, the progressive evangelical movements that started in the early 1970s (e.g., Evangelicals for Social Action and Sojourners), and several denominational justice programs. Like King, many of these followers use highly biblical rhetoric in their political advocacy. The Religious Right Although evangelicals and fundamentalists had mostly avoided the American political forum since the Great Reversal of the early 20th century, the conservative Christian political voice exploded onto the scene in the early 1970s. During the preceding decades, a series of legislation had begun to curtail Christian influence in education and politics, and the tide of dissent began to be ride. But it was the decision of Roe vs. Wade in 1973 that galvanized the then-disparate opposition into the movement we know as the Religious Right. Specifically, Jerry Falwell and others organized a grassroots network that eventually wielded enough power to play a significant role in national electoral politics. Falwell’s Moral Majority (founded in 1979) helped stage President Reagan’s first victory, and Reagan responded with speeches that included Christian and biblical language. (For instance, Reagan quoted Isaiah 40:29, 31 to explain God’s blessing on the war on communism.) Later, Pat Robertson organized the Christian Coalition to help stage his own unsuccessful presidential bids, but also to oppose the influences of the liberal Questions: 1. Take a minute to read Isaiah 40 (http://bible.oremus.org/). How do you feel about the way King used it? About how Reagan used it? 2. Reflecting on section 1 of this lesson, do you think the different ways the Civil Rights Movement and the Religious Right use the Bible are influenced by the earlier fundamentalist-modernist controversy? 1. Take a minute to read Isaiah 40 (http://bible.oremus.org/). How do you feel about the way King used it? About how Reagan used it? 2. Reflecting on section 1 of this lesson, do you think the different ways the Civil Rights Movement and the Religious Right use the Bible are influenced by the earlier fundamentalist-modernist controversy? Mark A. Noll, A History of Christianity in the www.cc.org (website of the Christian Coalition) www.stanford.edu/group/King/ (source for King’s speeches)

<urn:uuid:21f60dae-2bb5-46ca-8945-98b3df4007b3>

CC-MAIN-2015-32

http://faithfulagitation.blogspot.com/2006/07/bible-and-politics-pt-32.html

s3://commoncrawl/crawl-data/CC-MAIN-2015-32/segments/1438042989507.42/warc/CC-MAIN-20150728002309-00228-ip-10-236-191-2.ec2.internal.warc.gz

en

Ultrasound is a non-invasive procedure that produces images of soft tissue and organs in the body through the use of sound waves that reflect back and are displayed as a real-time image. Ultrasound can detect diseased or damaged tissues, locate abnormal growths and identify a wide variety of conditions, enabling your radiologist to make a quick and accurate diagnosis. Ultrasound uses a transducer. This is the same principal used to track weather patterns and to guide air traffic. Ultrasound does not use ionizing radiation making it a safe alternative for imaging for pregnant women. The Iowa Clinic Medical Imaging Department offers a wide array of ultrasounds including but not limited to pelvic, breast, thyroid and testicular. Obstetric ultrasounds are offered at our Women's Center. How Should I Prepare? Please arrive 15 minutes prior to your exam. We suggest that you utilize our pre-visit registration process, located in an email you should receive prior to your exam. The preparations for an ultrasound vary depending on the specific area of your body that is being scanned. Upper Abdominal Organ If you are having an ultrasound of any Upper Abdominal Organ — Gall Bladder, Pancreas, Liver, Spleen, Kidney(s) and/or Aorta — eat an early low-fat dinner the night before your exam. Do not eat or drink for eight hours prior to your exam. You may however, take prescription medication with small sips of water the morning of your exam as needed. If you are having an ultrasound of your Pelvis you will need to have a full bladder for this exam. Please drink 10 eight ounces glasses of liquid. Finish drinking this liquid one hour prior to your exam. Do not empty your bladder before the exam. All Other Body Parts There is no preparation if you are having an ultrasound of your breast, extremity or other body parts (i.e., Thyroid). What Should I Expect? After a brief medical history is taken you will be asked to lie down. Ultrasound examinations are performed by a sonographer. The sonographer will apply a hypoallergenic, water-soluble gel to prevent air from getting between your skin and the transducer. The sonographer then gently passes the transducer over the skin of the area being examined, producing a painless sensation of light pressure. If circumstances dictate, a transvaginal approach may be used. After the exam, the gel is gently wiped off and you may resume normal activities.

<urn:uuid:2c123f36-81de-4d23-9750-e249876b9eaa>

CC-MAIN-2018-39

https://www.iowaclinic.com/treatments-and-conditions/ultrasound/

s3://commoncrawl/crawl-data/CC-MAIN-2018-39/segments/1537267160145.76/warc/CC-MAIN-20180924050917-20180924071317-00496.warc.gz

en

Naches Ranger District Fire Management Fire Managament and Ecology | Fire employment information on the Naches Ranger District Firefighters and Fire Ecology Being a modern wildland firefighter takes more than just bravery and a desire for excitement. The firefighters, fire technicians, and professional fire management personnel of the Forest Service are at the cutting edge of a complex and important field. Over 300 million acres of Federal lands are at risk from fire, along with more than 700 million non-Federal acres. Managing wildland fires is an important job. Uncontrolled wildland fires threaten human life, homes, communities, and livelihoods, as well as trees, wildlife, and natural systems. Our job is to prevent human-caused wildland fires, as well as to suppress them. Permanent and temporary Forest Service employees accomplish all of this with teamwork, professionalism, and a constant emphasis on safety. Fire is a fact of life Since the beginning of time, nature and humans have caused wildland fires to rage across our forested continent. It’s a fact that wildland fire is a part of our natural environment. For more than a century, organized efforts to prevent and suppress wildland fires have, ironically, contributed to an unhealthy forest situation. Today, we are faced with overcrowded forests littered with small growth and fallen timber. These conditions cause larger, more intense and dangerous fires than those of the past. Facing this reality, we have to understand the facts of nature and pursue intelligent, scientific approaches to wildland fire management. Fire is a friend Because fire is a natural cleansing agent that removes dead and unwanted materials, Forest Service wildland fire specialists apply a range of fire prevention and fire utilization strategies year round. These Strategies include: Suppressing conditions that can lead to wildland fires getting out of control. Using prescribed fire, a fire ignited by fire managers under controlled conditions, to reduce hazardous buildup of live and dead vegetation in the forest. Informing and educating the public about fire prevention, suppression, fire ecology, and the role of fire as a disturbance element. Educating the public about fireproofing their homes. Naches RD fuel type Fire is a Force When a natural or human caused wildland fire threatens to spread out of control, USDA Forest Service fire crews swing into action. Assignments vary, and crews normally involve people from other Federal or State agencies. Crews may also be part of a larger engine, smokejumper, hotshot, helitack, helicopter, or hand crew. It can be tough and dirty work, but the rewards are many. The USDA Forest Service protects life, property, and some of the most valuable natural lands in the Nation. Our major responsibilities in dealing with wildland fires are to: Prevent, fight, and suppress uncontrolled wildland fires that are the result of natural causes. Prevent and suppress human-caused fires on Federal lands, and assist communities in suppressing fires on non-Federal lands. Watch for outbreaks of fire by using lookouts and aerial observation. Monitor naturally caused fires and, if they become a threat, determine when, where, and how to control the spread of the fire. Launch coordinated, strategic, and tactical ground-based and aviation-supported fire suppression missions, ensuring that all activities are managed in a safe manner. Training is a part of all fire-related positions. Skills development and progressive Assignments build fire credentials and eligibility to compete for more senior positions. Fire Employment on the Naches Ranger District Fire Suppression (Hand Crew) Crewmembers or leaders build firelines using Pulaskis, shovels, and chainsaws to control spreading wildland fire. They patrol areas of controlled fires and perform mop-up by searching out and extinguishing any remaining burning material. They also observe, collect, and preserve evidence of the cause of fires. Fire Suppression (E ngine) Fire engine drivers/operators drive fire engines to fire locations, frequently over unimproved roads. They place vehicles for safety and optimal use of water, foam, and water-handling equipment. Engine crewmembers work with specialized firefighting equipment and perform many strenuous activities, including constructing firelines with hand tools or hose lays, conducting burnout operations, and mopping up hotspots near the fire’s edge. Fire prevention crews establish contact with forest users, visitors, and local residents. They inform the public about fire danger, advise precautions to prevent the occurrence of destructive fires, and explain pertinent laws and regulations. Wildland firefighters usually sign on as temporary seasonal employees, training at entry-level positions and gaining valuable firefighting experience. Some positions, including aviation positions, require specific qualifications, education, experience, and credentials appropriate for the occupation. If you want to be a wildland firefighter, you must be at least 18 years old and a U.S. citizen. You must also pass our physical exam and work capacity test. With the exception of some lookouts and dispatchers, you must also be able to work under conditions that are often arduous and stressful. The ability to travel and be away from home for extended periods of time is essential because crews often travel to other States and, occasionally, to foreign countries. Everyone is expected to display professionalism, responsibility, and safety consciousness. Temporary and permanent employees generally work 8-hour days, 5 days a week. Extended shifts of 12 hours or more are common, with overtime available during the fire season. Hazard pay and evening or weekend pay rates can also significantly increase take-home pay for most firefighters Benefits for temporary and permanent employees include: Paid holidays, vacation, and sick leave Flexible work schedules in some locations Wellness and personal counseling programs in many locations Training programs for safety and to enhance firefighting skills for career development Opportunities for personal growth Benefits for permanent employees include: Health and life insurance Federal retirement plan Paid moving expenses (for moves after initial appointment) Firefighting involves working under very hazardous conditions for long periods of time and firefighting crews are expected to accept difficult tasks. Firefighters often endure hot, smoky, dirty, dusty working conditions with little sleep and poor food. Sleep deprivation is the norm and working with sharp tools, in the dark, on a steep hillside, under hazardous conditions is a common occurrence. Firefighters are frequently required to work for days at a time with only the 40 pounds of equipment carried in a fire pack. The work performed is extremely physically demanding and can be emotionally taxing. Together for 24 hours a day, 7 days a week for 4 months, the crew eats, works, travels, and rests as a unit. Under these conditions, compatibility, camaraderie, understanding, and crew pride are an absolute necessity. Firefighters will be expected to conduct themselves in a responsible, professional manner, and to project a positive personal image as an employee of the U.S. Forest Service. The concept of rapid mobility requires firefighters to be in a state of physical and mental readiness at all times, and prepared for extended fire assignments. Employees will be required to abide by and support the U.S. Forest Service rules regarding conduct and ethics for fire assignments. Naches Ranger Station Work Dates (tour of duty) and Pay Each season, the Naches Fire Mgt seeks quality employees to fill crewmember positions for duty as wildland firefighters. Crew members are hired either as temporary employees who work 1039 hours in a 1-year basis or as Permanent Seasonal Employees (PSE) where the hours worked per year depend upon the length of the fire season and the workload. The average fire season begins in spring and ends in late fall. Naches fire management believes that education is important and supports this by making arrangements for late start dates and early ending dates for people who wish to attend an educational institution and work during the summer break from June through August. Temporary employees are hired as Forestry Aids and Technicians with a pay scale grade of GS-462-03 to GS-462-05, which translates into an hourly base pay of $9.42 - $11.84. PSE’s are hired as Forestry Technicians and Supervisory Forestry Technicians at the GS-462-05 to GS-462-07 level, which translates as $11.84 – $14.66 base pay per hour or $24,701 to $30,597 base pay annually. Firefighters can be on call for an incident dispatch 24 hours a day, 7 days a week during the fire season. Each member of the crew is expected to be available, day or night, for every dispatch. During duty hours, the crew is required to be en route to the incident within 2 minutes, and for off-duty hour dispatches, the crew will be assembled and traveling to the incident within a designated amount time. These guidelines require a high level of personal responsibility and commitment from crewmembers to the crew. Travel is another important aspect of being a firefighter. A typical fire season requires the crew to be away from the duty station for the majority of the four-month period. Long drives in crowded conditions must be endured and travel by airplane and helicopter often occurs. The U.S. Department of Agriculture (USDA) prohibits discrimination in all its programs and activities on the basis of race, color, national origin, sex, religion, age, disability, political beliefs, sexual orientation, or marital or family status. (Not all prohibited bases apply to all programs.) Persons with disabilities who require alternative means for communication of program information (Braille, large print, audiotape, etc.) should contact USDA’s TARGET Center at (202) 720-2600 (voice and TDD).

<urn:uuid:aaca38d5-377c-46b4-8de7-1ae64e3747bc>

CC-MAIN-2014-23

http://www.fs.usda.gov/detail/okawen/alerts-notices/?cid=fsbdev3_053617

s3://commoncrawl/crawl-data/CC-MAIN-2014-23/segments/1406510272584.13/warc/CC-MAIN-20140728011752-00363-ip-10-146-231-18.ec2.internal.warc.gz

en

1D Modelling of river flows Orador: Dr. Sébastien Proust (CEMAGREF-Lyon) 18:00 – 19:00, Terça-Feira, 15 de Setembro de 2009 Pequeno Auditório, LNEC, Avenida do Brasil, 101, Lisboa A Comissão Especializada em Hidráulica Fluvial da APRH convidou do Dr. Sébastien Proust para apresentar e dinamizar uma sessão técnica sobre a modelação de cheias em rios, tema com muito interesse prático e científico, e no qual aquele Engenheiro e Investigador tem desenvolvido trabalho de investigação aplicada com reconhecimento a nível mundial. Rivers have generally a compound channel configuration constituted by a main channel in the middle and floodplains on the lateral sides. For natural floods, the flow often inundates the adjacent plains, overflowing the main channel banks and invading the floodplains. Therefore, the study of such flows is important when seeking to identify flooded areas from predicted discharges, to perform flood routing in real time, or to estimate the impact of mitigation measures. In this technical session the relevance of various hypotheses/simplifications necessary for 1Dmodels to compute such flows will be discussed. The analysis relies on a comparison between various numerical models (e.g. HEC-RAS and other more complex 1D models) with experimental data for: flows in straight compound channel, in converging and diverging geometries. The objective is to allow practitioners and researchers to perform a physically based interpretation of the results obtained with 1D models. The outline of the session is as follows: - Interest and scope of the topic. - Physics of compound channel flows. - The coupling of water level and discharge distribution in 1D modelling (link between errors in water level and discharge in the floodplains). - Validity of calibrating Manning roughness coefficient (examples of different geometries, water levels and numerical codes). - The important issues in 1D modelling. - An alternative approach based on the separated computation of water level for each subsection. - Open discussion.

<urn:uuid:91a51292-5556-4229-9c17-250d0d2e1d7e>

CC-MAIN-2023-23

https://www.aprh.pt/pt/eventos/organizados-pela-aprh/passados-2009/1d-modelling-of-river-flows/

s3://commoncrawl/crawl-data/CC-MAIN-2023-23/segments/1685224649193.79/warc/CC-MAIN-20230603101032-20230603131032-00170.warc.gz

en

The Saharan silver ant has special adaptations that enable it to face the heat of the desert. The most amazing is its full metal jacket of silver hair. This small ant is called Cataglyphis bombycina but is known as the Saharan silver ant because of its impressive appearance. They can be easily spotted in the sunlight, due to their silver coating. However, this is not only a very beautiful accessory, but also an impressive defense mechanism that keeps them safe from the excruciating heat of the Saharan desert. In fact, their ability to survive in the sun when no other living creature can is actually the center of their existence, because this amazing trait is the baseline of how and what they eat and how they keep safe from predators. The Saharan silver ants stay hidden in their nests during nighttime and all throughout the morning. Only when midday comes and the temperature reaches its highest limit, the small little ant go out in groups. Their aim is to find their prey during the 10 minutes that they can last alive in the sun that often reaches temperatures of 53 degrees Celsius or even more. These ants are scavengers and they get their food fresh and almost roasted. They eat the insects that die do to the insanely hot temperatures of the desert. As soon as they leave their nests, they have to keep track of their movements and always bare in mind that within those 10 minutes they will have to make the return journey as well. Furthermore, they often feed on insects that are their size or larger, much larger. And therefore the return journey is always much harder. They will look for their pray in every possible direction from their nests and if they do not find anything in time, they return empty handed. But most of the time they get lucky and stumble upon some poor insect that did not last in the scorching sun of the day. Every once in while the insect is not even dead just yet, and it is taken by the group of silver ants to their nest. The other main reason why going out when the sun is at its strongest is the best option for the Saharan silver ants is that during that time, even their predators abandon their posts in the sun and retreat to shady places. These predators are usually a large collection of lizards and various reptiles that walk in the hot desert sand. The most interesting aspects about the Saharan silver ant are the obviously the defense mechanisms that it uses to keep its body temperature at a the rate of survival. Firstly, the ant has abnormally long legs for an ant because this way it is able to stand higher from the sand. Secondly, it has a series of heat shock proteins that enable it to lower its temperature. And thirdly and most importantly, it has its sparky silver hair. For a long time, scientists have liked this silver hair that they have to their ability to withstand extremely high temperatures, but the process had never been described. This week however, Science Magazine published a brand new study conducted by the a team of researchers at Columbia University lead by physicist Nanfang Yu that has shed light on the mysterious process. They have used electron microscopy to study the silver hairs very closely. It appears that they have a triangular shape that is able to reflect the light away from the ant’s body surface. But there is more to their full metal jacket than that. “There are two effects – first in the shorter wavelengths of the solar radiation spectrum, secondly in the longer wavelength range of the thermal radiative spectrum. (…) If you combine these two effects, you have the best combination – it will block incoming sunlight and dissipate thermal energy when heated up,” says Dr. Nanfang Yu. The wavelength of thermal radiation is actually linger than a cross-section through the silver hair of the ant is. Therefore, the waves are absorbed instead of being reflected. Afterwords they are reflected around the internal structure of the hair. And this process actually plays an important role in the ants’ ability to keep their temperature down. In order to demonstrate that the silver hairs were the ones who played the decisive role in the ant defense mechanism from the heat, they used specialized technology to shave the hair form a few ants and they sent them into the hot midday sun. It seems that they were absolutely right, because the shaved ants did not survive the heat. This new discovery bares great importance to both the natural world, but also for the technological world, because this new found mechanism could inspire scientists to build newer and better technology that is able to withstand the highest temperatures on Earth. Image Source: nosabesnada.com

<urn:uuid:b9e464b4-9495-4851-b27a-15f7b6242b30>

CC-MAIN-2020-40

https://www.wallstreethedge.com/the-saharan-silver-ant/24182/

s3://commoncrawl/crawl-data/CC-MAIN-2020-40/segments/1600400221980.49/warc/CC-MAIN-20200925021647-20200925051647-00402.warc.gz

en

A new research study published in Clinical Infectious Diseases has demonstrated that the MMR vaccine (measles, mumps and rubella) was more effective in teenagers who received their first dose of the two dose series at 15 months rather than at 12 months. The study was based on a more than 750 cases in 2011 of measles were reported in Quebec, Canada. Those individuals had received the routine 2-dose measles immunization schedule which is given at 12 and 18 months of age, which had been in effect in Quebec since 1996. This study assessed the effectiveness of this schedule during this outbreak that occurred during high school. The authors determined that the risk of measles in 2-dose recipients was 3-4X higher when vaccine was first administered at 12 months of age compared with ≥15 months of age. They considered the data statistically significant. However, an recent editorial commentary has argued that it was a “rare event”, and this is just one geographic area. We could even argue that it’s just one batch or batches of vaccine involved, 15 years ago. In fact, with such a small group, it may be difficult to make a really solid conclusion. According to The Canadian Press, Dr. Gaston De Serres of Quebec’s provincial public health agency, who was lead author of the article, does not think that the Canadian government will be adjust the dosage schedule on the basis of the study. Dr. De Serres stated that, “For Canada I would probably say that at this time we will not change the schedule. We need to follow up with more studies.” I’m personally a bit skeptical that this study warrants a reconsideration of changes in vaccine scheduling, until more studies are provided. I think it qualifies as “intriguing” more than conclusive. But that’s how science based medicine works, you build up evidence until a compelling argument can be made to change medical practice. Right now, the evidence still says the MMR vaccine prevents measles. Even in this study, fully vaccinated students were “attacked” (their words, not mine) by measles at a 4.8% rate. Non vaccinated students, 82%. That’s a huge difference by any statistical measure. And if you think measles is some innocuous disease, then think again: Even in previously healthy children, measles can be a serious illness requiring hospitalization. As many as 1 out of every 20 children with measles gets pneumonia, and about 1 child in every 1,000 who get measles will develop encephalitis. (This is an inflammation of the brain that can lead to convulsions, and can leave the child deaf or mentally retarded.) For every 1,000 children who get measles, 1 or 2 will die from it. Measles also can make a pregnant woman have a miscarriage, give birth prematurely, or have a low-birth-weight baby. I think this story bears watching. Maybe in the next few years there will be a change in the MMR vaccine schedule, to better protect children from measles. Vaccines Save Lives. Please add your comments to my article

<urn:uuid:99519dca-a70b-46e6-8043-d7abcb87b12d>

CC-MAIN-2014-10

http://www.skepticalraptor.com/skepticalraptorblog.php/measles-vaccine-effective-administered-later/

s3://commoncrawl/crawl-data/CC-MAIN-2014-10/segments/1394010851505/warc/CC-MAIN-20140305091411-00083-ip-10-183-142-35.ec2.internal.warc.gz

en

Tarantula Mimic Moth Common Name: Tarantula Mimic Moth Order Name: Lepidoptera Family Name: Noctuidae While many moths have a reputation for being hairy beasts, this one takes the prize. This group has adapted to mimic the four forward facing legs of a fearsome tarantula. There are far more moths than butterflies with varied forms and coloration that rivals their butterfly relatives. Moths have often been associated with insanity for their habit of flying into flames at night. This unfortunate event is related to the moth confusing the light of a stationary flame to that of the moon which it uses in navigation during the night.

<urn:uuid:e0e5320c-159f-4539-b4cc-ed3bf1beb69a>

CC-MAIN-2019-04

https://www.insects.orkin.com/entophiles/lepidoptera/tarantula-mimic-moth/

s3://commoncrawl/crawl-data/CC-MAIN-2019-04/segments/1547583705091.62/warc/CC-MAIN-20190120082608-20190120104608-00013.warc.gz

en

Paint is one of the oldest mediums for sealing, protecting and decorating wood. It is cost-effective and requires few tools or special skills. Painting wood that’s previously been painted or sealed can make the job a bit more difficult, as old materials can impede the new paint’s adhesion. Stripping off the old finish removes that problem, but it’s not always the best solution. Many paint strippers are hazardous to breathe and very messy and time-consuming to use. Painting wood without stripping it first requires careful preparation and high-quality primer to help the new paint bond. Put on a pair of protective eye goggles or safety glasses and a dust mask. Scrape off any old finish that is chipped or flaking off the wood with a paint scraper. Sand the rough edges of the paint or finish, if you scraped off any, with fine-grit sandpaper. This leaves a less-pronounced ring around the scraped area. If you are painting a very large area, such as house siding, sanding is usually not recommended due to the extensive amount of time and effort involved. Clean the item with a degreaser and a rag. Rinse off the cleaner with a rag dampened with plain water, then let the wood dry. Stir the can of oil-based paint primer with a stir stick. Fill a paint pan with primer if you are painting a large area. If you are painting a small area, you can paint with a fine-bristle paintbrush and leave the primer in the can. If you are using a brush, choose one that is appropriate for the surface. A 3-inch brush covers wider spaces more evenly than a small brush, but a 1-inch brush is more appropriate for items with lots of details or small spaces. Apply one coat of primer. The coat should be generous but not thick enough to run or drip. Let the primer coat dry until it is no longer tacky, or as long as the primer manufacturer recommends. Stir the can of paint with a stir stick. Fill a paint pan or leave the paint in the can, depending on the size of the project. Apply one coat of paint, using overlapping roller passes or paintbrush strokes to ensure even coverage. As with the primer, apply a generous amount of paint but not enough to run or drip. Let the paint dry, then apply at least two more coats. Things You Will Need - Eye goggles or safety glasses - Dust mask - Paint scraper - Sandpaper, fine-grit - Paint primer, oil-based - Paint stir sticks - Paint pan - Paint roller or fine-bristle, synthetic or natural paintbrush - Paint, oil- or water-based - If you are certain that the old paint or finish is water-based, you can use water-based paint primer. Oil-based primer is the best choice when you are unsure, as it bonds with practically anything. - If the old finish was applied before 1978, it might contain lead. Scraping and sanding lead paint can release inhalable lead particles. - Hemera Technologies/AbleStock.com/Getty Images

<urn:uuid:3e95a2d3-c2e1-45d4-91ba-c47a79a62c53>

CC-MAIN-2017-26

http://homeguides.sfgate.com/paint-wood-stripping-28371.html

s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128329344.98/warc/CC-MAIN-20170629135715-20170629155715-00607.warc.gz

en

Integrating Sacred Knowledge for Conservation: Cultures and Landscapes in Southwest China Jianchu Xu, Kunming Institute of Botany, Chinese Academy of Sciences Erzi T Ma, Liangshan Nationality Institute Duojie Tashi, Snowland Greatrivers Environmental Protection Association Yongshou Fu, Yunnan College of Art Zhi Lu, Conservation International David Melick, Kunming Institute of Botany, Chinese Academy of Sciences Full Text: HTML China is undergoing economic growth and expansion to a free market economy at a scale and pace that are unprecedented in human history. This is placing great pressure on the country’s environment and cultural diversity. This paper examines a number of case histories in China, focusing on the culturally varied and ecologically diverse southwest region of the country. We show how developments in recent Chinese history have devalued and in some cases eliminated indigenous knowledge and practices in the quest to strengthen the centralized state. Despite these changes, more than 30 ethnic minorities live in southwest China. For generations these peoples have maintained landscapes through traditional land use and cultural practices. This indigenous knowledge places a high value on protecting forests, landscapes, and water catchments while preserving biodiversity. These values are maintained through religious beliefs, hunting taboos, and the protection of sacred sites. We advocate a conservation policy for China that includes the indigenous knowledge and values needed to maintain the environment and the traditional cultures themselves. There are seminal signs that the government is beginning to support indigenous cultures in China. The Organic Law of 1998 granted villages the legal right to self-government and gave indigenous communities greater responsibility for land and resource use. Traditional and indigenous cultural products have also developed a market and an economic value within a growing tourism industry. In many cases, however, indigenous people remain isolated from major land-use and conservation decisions that are the result of centrally planned policy. Meanwhile, frequent oscillations in forest policy and land tenure insecurity since the 1950s have led to the erosion of many local institutions and the loss of indigenous knowledge. We suggest that the long-term viability of the environment requires an interactive approach that involves local people as well as governments in the creation of environmental policy. We also suggest that enlightened self-interest can help economic development coexist with the needs of traditional cultures. biodiversity; economic development; environmental degradation; ethnic minorities; indigenous knowledge; sacred knowledge; China Copyright © 2005 by the author(s). Published here under license by The Resilience Alliance. This article is under a Creative Commons Attribution-NonCommercial 4.0 International License. You may share and adapt the work for noncommercial purposes provided the original author and source are credited, you indicate whether any changes were made, and you include a link to the license.

<urn:uuid:98cf78f7-cbd2-47ac-b14c-bd3dac019f7d>

CC-MAIN-2019-30

https://www.ecologyandsociety.org/issues/article.php/1413

s3://commoncrawl/crawl-data/CC-MAIN-2019-30/segments/1563195525974.74/warc/CC-MAIN-20190719032721-20190719054721-00288.warc.gz

en

[retrieved from www.the74million.org] As they attempt to plan for anticipated student learning losses next year, teachers and school administrators need to prepare for an additional pandemic-related challenge: Students in individual classrooms are likely to show up with a dizzyingly wide range of academic abilities. Before pandemic-related school closures, a single classroom could have students working at up to seven grade levels. New research conducted by the nonprofit assessment organization NWEA predicts that teachers are likely to see an even broader array of achievement gaps when schools reopen. Although the researchers can’t project how many grade levels might be represented in the average classroom at the start of the next academic year, they say the number of students at the extremes is likely to grow. The lowest-achieving kids may fall two more years behind. The researchers, working in conjunction with Texas A&M, Johns Hopkins and Duke universities and the University of Wisconsin-Whitewater, arrived at the prediction using data from schools in the 10 states with the highest participation in NWEA’s MAP assessment, formerly known as the Measures of Academic Progress. Of 375,000 fifth-graders in those states in 2016, one-third scored at or below third grade in math, one-third at fourth grade, one-fourth at fifth and 10 percent above grade level, according to Karen Rambo-Hernandez, an associate professor at Texas A&M’s College of Education and Human Development. Assessment data on incoming fifth-graders in 10 states shows that, on average, student achievement spans seven grade levels. (Graphic by The 74; research by Rambo-Hernandez, Makel, Peters, & Plucker ) In reading, at the beginning of fifth grade, just 14 percent of students performed at grade level. One-third were reading beyond grade level and half below. Third grade is the lowest threshold the researchers can measure, so it’s possible some students may be even more grades behind. “All of this is in a typical year,” notes Rambo-Hernandez. “Next year is not going to look like a typical year.” In April, NWEA’s Collaborative for Student Growth Research Center released research suggesting that on average, students next fall are likely to retain about 70 percent of this year’s gains in reading and less than 50 percent in math. Losses are likely to be more pronounced in the early grades, when students normally acquire many basic skills, and among those already facing steep inequities. Given the data on learning losses, Rambo-Hernandez says it’s possible the array of abilities in a classroom in a normal year will widen by two or more grades in the fall. Children who have been historically underserved are at high risk of falling further behind, while high-achieving kids, allowed to work at their own pace with lots of resources, may rocket ahead. Effectively reaching all students with such varied learning needs — including children in special education and English learners — in a single classroom is a huge challenge under any circumstances. But now, especially without spring exams to guide them, schools will have no idea on day one of the 2020-21 school year what the array of needs in each class is. Is it possible to teach such a varied group of students, either physically in a classroom or online? Yes, but it’s no mean feat, says Julia Kaufman, a senior policy researcher at the RAND Corp. Differentiation, the process of tailoring instruction for children with varying levels of achievement, was already a major challenge for teachers who had to modify curricula that didn’t meet their students’ needs. In surveys conducted in February 2015, teachers told RAND that their top need was training on differentiation. According to a 2019 RAND survey, the vast majority of teachers modify lessons at least once a week. Depending on the subject and type of student need, Kaufman says, 20 percent to 30 percent modify what they teach nearly every lesson. Add to this the possibility that teachers will be attempting to address a broader array of needs in a remote setting. “Differentiation when you’re in the classroom physically is one thing,” says Kaufman. “I don’t know how you do it looking at faces on Zoom.” A professional development specialist with NWEA, Fenesha Hubbard counsels a combination of determination and careful planning, ideally with high-quality data and in teams. “In addition to self-care, teachers need to get clear on where they stand,” she says. “Students can pick up on whether educators are not fully invested. Do you actually believe that your students are all going to show up and be successful in this environment?” And as uncomfortable as it is, especially when teachers are being asked to stretch in ways previously unimagined, it’s time to ask why students are arriving with such a diverse array of past learning, she says. Solid data about the specific concepts each student does or doesn’t understand will be crucial. Teachers know how to check for understanding when physically present in the classroom but are going to need new strategies next year, she says: “How do you get that data from students in a virtual environment?” Some online platforms incorporate tools that allow teachers to gather responses, for example. Or perhaps students can text their answers. Teachers should figure out what data their colleagues are collecting and how. Whether teachers collaborate online or in person, planning meetings now need to have data and formal agendas to outline the data’s use, she says. “The way we use minutes in school is changing,” says Hubbard. “You’re probably not going to be with your students for six hours in a virtual room. This is an opportunity for teachers to carve out time to work with individual students.”

<urn:uuid:17cd42ee-f154-4e84-bfb7-7be02c31baf1>

CC-MAIN-2021-31

https://www.mycarver.org/post/new-research-predicts-steep-covid-learning-losses-will-widen-already-dramatic-achievement-gaps

s3://commoncrawl/crawl-data/CC-MAIN-2021-31/segments/1627046156141.29/warc/CC-MAIN-20210805161906-20210805191906-00360.warc.gz

en

Here are some tips to help you obtain proper nutrition. Take a multi-vitamin each day to ensure that you are getting all the nutrients that your new healthy diet.This helps you the foundation for the minerals that you need during the course of in your food. A regular digestive system is very important to achieve and maintain weight loss and good health.Drink lots of water and make sure you can each day. Eat a wide variety of colored foods. Fruits and vegetables that are very brightly colored give you lots of health benefits without having lots of calories.Try to eat one of a brightly colored fruit or vegetable. If the fruit or vegetable has an edible skin, make sure to eat those too, because many nutrients are contained in the skin. This will reduce the fat and calories. People who study nutrition will stay away from milled grains. Is it wise to do this while buying fiber additives or wheat germ to make up for the nutrients thrown away in order to restore benefits that you can get from natural whole grain? You should always encourage water daily. Drinking too much milk or juice all day spoils your child’s appetite. One fantastic tip that can help with your nutrition is to use of artificial sweetener. Consuming too much sugar has detrimental health effects, such as serious heart problems. You will not even be able to tell the difference. It is not always easy to maintain good nutrition in balance while dieting. The truth is that once you start to eat healthier foods, the more you will find fattening foods less desirable. You will then be eating for the sake of good nutrition in mind and not because it makes you want to feel better emotionally. A good nutrition suggestion is to try abstaining from eating grains for a while. Throughout history, humans have eaten fruits, veggies, meats, beans, and meat. Grains appeared in our food chain later and have not been around that long. You may notice that you are feeling better once you have eliminated grains at all. Try eating baked foods to your diet in place of fried ones. Baked foods contain less oils and have fewer calories than their fried counterparts. Eating healthy baked foods everyday will also provide your body with more energy. Get restful sleep and don’t drink too much alcohol. These factors can actually make your face oilier and make your face oils. Larger pores means more dirty infections and can cause infection. Get a good night’s sleep and consume no more than one drink per day. Using this system will help you stick with it and avoid junk food. Having a good variety in your meal choices will prevent you from becoming bored and reaching for something unhealthy. Avoid adding salt when boiling water. You should use fresh fruit instead of processed fruit juice. There are even some fruit juices that actually have more sugar added to it than some sodas do. Fresh fruit offers valuable vitamins, vitamins and essential minerals that work to prevent strokes, and vitamins that can provide support against certain chronic conditions like cardiovascular issues. Broccoli makes a wonderful addition to your diet. It has phytochemicals that fight cancer, fiber, and phytochemicals that prevent cancer. Steaming or microwaving it a little will cook it without causing nutrient loss. Broccoli that is overcooked has no good. Make sure you understand the different nutritional aspects of dairy products wisely. While certain dairy products have calcium, potassium, protein and vitamin D, you should choose low-fat or fat-free products. Drink low fat or skim milk, since this reduces calories but not the nutrients. If you cannot tolerate lactose, drink soy milk or lactose-free milk. Do not have too many cheat days! Do not admonish yourself if you make a mistake.If you make yourself feel worse about it, that is when bad habits start coming back. Just accept it as a cheat day and start strong the next morning. Getting down on yourself will not helpful at all. Not recognizing how essential good nutrition is can be the downfall for many when it comes to health. Being more nutritious can make a person live healthier and longer. Lots of folks want to understand the subject of https://www.mgm99bet.com/ but don’t know where to begin. You have found the information you require to get going, right here in this article. Apply the data that you take in from this article to real life.

<urn:uuid:7e82c8f4-6ec4-43c4-b6dd-086e62ac69ea>

CC-MAIN-2021-25

https://www.bestnhljerseystosale.com/2020/10/18/ensure-a-healthy-body-with-this-excellent-nutrition-advice/

s3://commoncrawl/crawl-data/CC-MAIN-2021-25/segments/1623487626465.55/warc/CC-MAIN-20210617011001-20210617041001-00374.warc.gz

en

|Title of Invention|| WATER PURIFICATION COMPOSITION |Abstract||The invention relates to a water purification composition. The invention particularly relates to a water purification composition that is especially useful for removal of trace quantities of harmful contaminant like Arsenic in addition to removal of microorganisms like virus, bacteria and cyst to make the water suitable for human consumption.| |Full Text||FORM - 2 THE PATENTS ACT, 1970 (39 of 1970) The Patents Rules, 2006 (See Section 10 and Rule 13) WATER PURIFICATION COMPOSITION HINDUSTAN LEVER LIMITED, a company incorporated under the Indian Companies Act, 1913 and having its registered office at Hindustan Lever House, 165/166, Backbay Reclamation, Mumbai -400 020, Maharashtra, India The following specification describes the invention - 1 - FIELD OF THE INVENTION The invention relates to a water purification composition. The invention particularly relates to a water purification composition that is especially useful for removal of trace 5 quantities of harmful contaminant like Arsenic in addition to removal of microorganisms like virus, bacteria and cyst to make the water suitable for human consumption. BACKGROUND AND PRIOR ART 10 A large population of people in the world live in developing and under-developed countries where there is a severe shortage of hygienic potable water. A high percentage of these people live in rural areas where there are no water purification systems like the ones provided by urban municipal drinking water treatment plants. Many people have to depend directly on ground and/or underground water sources like wells, tube-wells, 15 ponds and rivers. Often these water sources are contaminated by sewage, industrial and agricultural wastes. The various types of water purification systems available like those that utilize UV radiation, halogenated resins, reverse osmosis etc are not very convenient to use in 20 these rural areas since they either require running water and / or electricity or are too expensive for the consumers. Hence many people in the rural areas resort to boiling of water to kill the pathogenic microorganisms in their drinking water. This is also often not feasible since boiling requires large amount of fuel which is increasing becoming scarce. Further there are many areas in the world which are naturally contaminated with high 25 amounts of inorganic impurities like Arsenic. Arsenic is an extremely harmful contaminant. People continue to ingest water with these high levels of microorganisms and impurties like Arsenic which are responsible for the high mortality and morbidity in these areas. 30 Arsenic is one of the most toxic contaminants found in the environment. Arsenic is found in soils, rocks, natural waters and organisms. Arsenic is the twentieth most abundant - 2 - element in earth's crust. The most common oxidation states of arsenic are +3 and +5. Among all the arsenic compounds present in the environment, of particular interest is arsenite (which is arsenic in the As (III) form, which is 25-50 times more toxic than arsenate (which is arsenic in As (V) form) and 70 times more toxic than the methylated 5 species, dimethylarsinate (DMA) and monomethylarsonate(MMA). These facts indicate why it would be of priority interest to develop technologies for the removal of As (III), from drinking water. Inorganic arsenic is identified as a group-l carcinogen for humans. More than 100 million people are affected worldwide due to arsenic contaminated drinking water. Drinking water 10 in many of these areas have arsenic content as high as 300 parts per billion (ppb). The WHO and USEPA recommended MCL (maximum contaminant limit) of arsenic in drinking water is 10 ppb. Available arsenic removal technologies are membrane separation, ion exchange and adsorption. These technologies either require expensive equipments which are not affordable in many parts of the world or are not successful in removing 15 arsenic, especially arsenic in the As (III) to the WHO recommended specification. Further, boiling of water, which many people resort to for purification of water, does not remove arsenic. Thus, one of the major challenges in this field is poor removal of arsenic (III). Additionally, while arsenic in the purified water has to meet these stringent requirements, the technology should also ensure removal of harmful micro organisms like cysts, 20 bacteria and virus to a level which is safe for people to consume. According to EPA, water from any unknown origin can be rendered microbiologically safe to drink if removal of log 6 of bacteria, log 4 of virus and log 3 of cysts is attained. Thus a generally accepted removal criteria for bacteria, virus and cysts are log 6, log 4 and log 3 removal respectively. A large number of chemical methods of purifying water have been known and used at municipal, local and domestic levels. The chemicals include coagulants and flocculants to precipitate the suspended and dissolved impurities and biocides for killing microorganisms. WO02/00557 (Proctor and Gamble) describes a water purification composition along with a nutrient additive as apart from purifying and clarifying drinking water, a need was felt in - 3 - many parts of the world to improve standards of nutrition and health. The composition disclosed comprises essentially a primary coagulant, a bridging flocculent and a coagulant aid. Although this publication claims to remove arsenic, the present inventors have found that further improvement in the technology is required to meet the stringent 5 WHO standards for safe drinking water. Titanium dioxide has been used for removal of Arsenic from water. US6919029 (2005) by Stevens Institute of Technology teaches use of specific form of titanium dioxide for improved Arsenic removal. The present inventors have found that mere use of titanium 10 dioxide alone does not provide for the near complete removal of arsenic. JP2005058987 discloses compositions for waste water purification containing nine components viz. calcium sulphate, aluminium sulphate, silica, soda, polymeric flocculant, talc, zeolite, activated carbon and titanium oxide. This patent application describes 15 detoxification of waste sludge water using titanium oxide as a photocatalyst. The present inventors have found that this composition is not suitable for purification of raw water to meet the criteria for potable water set by WHO and other health agencies. The present inventors have worked diligently on solving this problem. They found that 20 use of adsorbents like titanium dioxide in a flocculation formulation, although provides improvement in the removal of Arsenic (V) compounds from water, this prior art composition is not able to meet the removal requirement of the more toxic and more difficult to remove Arsenic (III) compounds. They then worked on several fronts to solve this problem and found that use of certain selective biocides solve the problem of removal 25 of all arsenic compounds to meet the stringent WHO standards. In addition, the selective biocides ensure sufficient removal of microorganisms. It is thus an object of the present invention to provide for a water purification composition that solves most of the problems encountered when using compositions reported in the 30 past. It is another object of the present invention to provide for a water purification composition that provides purified water with low Arsenic content that meets the WHO standards of less than 10 ppb, especially Arsenic (III) compounds. It is yet another object - 4 - of the present invention to provide for a water purification composition that also meets the high microbiological removal standards of 6 log bacteria, 4 log virus and 3 log cysts. SUMMARY OF THE INVENTION 5 According to one aspect of the present invention there is provided a water purification composition comprising (a) a coagulating agent which is a water soluble inorganic metal salt having (b) a flocculating agent which is a high molecular weight water soluble polymer; 10 (c) an adsorbent which is a water insoluble oxide, hydroxide or oxo-hydroxides of titanium, zirconium, iron, copper or zinc; and (d) a biocide which is a halogen compound. It is particularly preferred that the absorbent is titanium dioxide or iron oxo-hydroxide. According to a preferred aspect of the invention there is provided a water purification composition comprising two portions which are spatially separated wherein the first portion comprises the biocide and the second portion comprises the flocculating agent and the coagulating agent. DETAILED DESCRIPTION OF THE INVENTION All parts herein are by weight unless otherwise specified. The water purification composition of the present invention comprises a coagulating agent, a flocculating agent, a selective adsorbent and a selective biocide. The coagulating agent is a compound which is a water-soluble inorganic metal salt having trivalent cation. Suitable trivalent cations are Al3+ and Fe3+. The coagulant is generally free from carbon atoms. Examples of coagulating agents are ferric sulfate, aluminium sulfate and polyaluminium chloride. Without being limited by theory, it is believed that 30 these coagulating agents when added to water form gelatinous hydroxide compounds at - 5 - pH greater than or equal to 6. The mechanism of coagulation via the formation of gelatinous hydroxide is optimum when pH is adjusted between 6 and 8.5. The gelatinous precipitate entrains fine suspended particles and microbes as it settles or coagulates. The coagulating agent is preferably present in an amount in the range of from 5 to 50%, 5 more preferably from 15 to 40% by weight of the composition. The flocculating agent as per this invention is a compound which is a high molecular weight water soluble polymer. Examples of flocculating agents are polysaccharides (dextane celluloses), proteins, modified celluloses (hydroxyethyl/hydroxypropyl or 10 carboxymethyl), and polyacrylamides preferably high molecular weight polyacrylamide. It is especially preferred that the polyacrylamide is either anionic or non-ionically modified, more preferably anionically modified. Suitable molecular weights of these polyacrylamides are in the range of 105 to 107. Preferred flocculating agent is Superfloc (from Cytec). Preferred amounts of the flocculating agent is from 0.5 to 15%, more 15 preferably from 1 to 10% and most preferably from 2 to 8% by weight of the composition. The water purification composition of the invention comprises an adsorbent uniquely selected to give the desired properties. The adsorbent is a water insoluble oxide, hydroxide or oxo-hydroxide of titanium, zirconium, iron, copper or zinc. Especially 20 preferred adsorbents are water insoluble oxide, hydroxie or oxo-hydroxide of titanium, and iron. Suitable adsorbents are titanium dioxide, zirconium oxide, iron oxide, copper oxide, zinc oxide, iron oxo-hydroxides, titanium oxo-hydroxides, zirconium oxo-hydroxides or combinations of these adsorbents. The more preferred adsorbents are titanium di oxide, titanium oxo-hydroxide, iron oxide, iron hydroxide or iron oxo-hydroxide, most 25 preferred adsorbent being titanium dioxide and iron oxo-hydroxide. Preferred amounts of adsorbent is in the range of 5 to 70%, more preferably 10 to 50%, most preferably 15 to 30% by weight of the composition. The composition of the invention comprises a biocide which is a halogen compound. 30 More preferred halogens compounds are those of chlorine or iodine, more preferably those of chlorine. Suitable chlorine compounds are inorganic compounds like sodium hypochlorite, calcium hypochlorites, chlorine dioxide, or chloramines, or organic chlorine - 6 - compounds like sodium dichloro-isocyanurates, or trichloroisocyanuric acid. The biocide is preferably present in an amount in the range of from 1 to 20%, more preferably from about 2 to 12% by weight of the composition. Most preferred biocide is calcium hypochlorite. The present inventors have found that not all biocides are effective in 5 meeting the objects of the present invention. Several conventional biocides like quarternary ammonium compounds, triazine, glutaraldehyde, isothiazoline, organo tin compounds, carbamates, methylene thio cyanate were used and although they were useful for microbiological removal they had poor efficacy with respect to meeting arsenic removal. Thus the invention is especially suitable for removal of Arsenic, especially when 10 the water is heavily contaminated with arsenic compounds which are in the As(lll) form, which has always been difficult to achieve using prior art methods. The water purification composition works best when it is packed to have a moisture content of not more than 5%, more preferably not more than 3%, and most preferably not 15 more than 2% by weight of the composition. The purification action of the composition of the invention can be attained at the pH of the raw water available. As a preferred aspect, the pH of the composition may be adjusted to the desired range by including a buffering agent in the composition. Suitable buffering 20 agents are calcium oxide, sodium carbonate or sodium bicarbonate. The buffering agent when present is included in an amount in the range of 0.5 to 10% by weight of the composition. The water purification composition may optionally comprise a co-adsorbent. The co- 25 adsorbent is preferably a material which is capable of adsorbing high levels of water and organic or inorganic compounds. Suitable co-adsorbent is a clay. Examples of clay include Montmorillonite clay (dioctheydral smectite clay), Laponite, Hectorite, Nontronite, Saponite, Volkonsite, Sauconite, Beidellite, Allevarlite, lllite, Halloysite, Attapulgite, Mordenite, Kaolines, and Bentonite. A highly preferred clay as per this invention is 30 Bentonite clay. When included, co-adsorbents are present in an amount in the range of 5 to 75%, more preferably from about 10 to 60% by weight of the composition. - 7 - According to a preferred aspect of the invention the water purification composition is delivered as a two-component system. The two-component system comprises a first portion and a second portion which are kept spatially separated. The first portion comprises the biocide and the second portion comprises the flocculating agent and the 5 coagulating agent. A further preferred aspect has the adsorbent present in the second portion of the two-component system. When delivered as a two-component system, it is preferred that the first portion comprises less than 5 % moisture by weight of said first portion. In the two component system, the co-adsorbent, if present, may be included in both the first portion and the second portion or may be present in any one of the portions. A further preferred aspect of the invention provides for the second portion to comprise a biocide quencher which is capable of reacting with the biocide to render it safe and aesthetically acceptable for human consumption. Suitable quenchers are sodium thiosulphate and ascorbic acid. The quencher is preferably present in an amount in the 15 range of 1 to 20% by weight of the second portion, more preferably from about 2 to 12% by weight of the second portion. The solid form is the most suitable form of the composition of the invention. Suitable solid forms Include the powder, granule and tablet forms, most preferred form being the 20 powder form. When delivered as a two-component system, the most preferred form is the powder form in both the first portion and the second portion. The water purification composition of the invention is preferably delivered in amounts in the range of 0.5 to 10 grams more preferably in the range of 1 to 5 grams. These are 25 usually added to 5 to 20 litres of water. When delivered as a two component system, suitable weight of the first portion is 0.01 to 5 grams, more preferably 0.1 to 1 gram and suitable weights of the second portion is 0.5 to 10 grams. The water purification composition of the invention may be delivered to the consumer in 30 any known suitable packaging form. When formed as tablets, the packaging may be metallised laminate or blister packing. When formed as powders, suitable packaging is - 8 - metallised laminate. However the metallised laminate packaging has to be such that the halogenated compounds that usually react with metals are kept separated from the metal part of the laminate by use of suitable polymeric layers on the metal layer. 5 According to another aspect of the invention there is provided a process for purifying water comprising the steps of (i) mixing the composition of the invention with the water to be purified and (ii) separating the flocculated mass from the mixture. When the product is configured as two component system, a suitable process comprises 10 the sequential steps of mixing the composition of the first portion with the water to be purified; followed by the step of mixing the composition of the second portion and then separating the flocculated mass from the mixture. The first portion is usually mixed for a period of time from 0.5 to 5 minutes and the water is then allowed to stand for a time period of 2 to 10 mins, after which the second portion is added. The mixture is then 15 mixed for a period of time from 0.5 to 5 minutes and again allowed to stand for 2 to 10 mins. The flocculated mass is then allowed to settle down and then separated from the mixture usually by filtration or decantation. A simple cloth may be used for filtration. The process of the invention is especially suited for purifying water which contains 20 arsenic. In contaminated areas, average arsenic concentration in raw water is around 300 ppb by weight. By using the process of the invention, it is possible to get purified water having an arsenic content as low as less than 10 ppb by weight of the purified water. 25 The invention will now be illustrated by the following non-limiting examples. Preparation of test water: 10 litres of R. O water (reverse osmosis purified water) was taken and 15 g of sea salt, 0.025 g humic acid and 1.5 g fine dust (Arizona test dust) was 30 added to it. Total dissolved salts was less than 50 ppm. Arsenic compounds either - 9 - sodium arsenate (Na2HAs04.7H20) in which arsenic is in the As (V) form or Sodium arsenite (NaAs02) in which arsenic is in the As (III) state was added to the test water, as desired. Determination of arsenic content 5 Inductively coupled plasma-optical emission spectroscopy (ICP-OES) (Varian-Vista-PRO) was used to measure total arsenic concentration (>50 ppb) in the solution. The total arsenic concentrations lower than 50 ppb were analyzed by inductively coupled plasma-mass spectrometry (ICP-MS) (Eldrin 9000). In both the analytical methods the samples were injected in the machines without any pre-concentration or pre-dilution and the total 10 arsenic concentrations were measured. Comparative Example - A A test water containing 300 ppb of arsenic from sodium arsenate (Arsenic (V) form) was used . The process of purification was as follows: 15 Purification process: 10 litres of test water was taken in a bucket and the composition as shown in Table-1 was added to the test water and stirred for one minute after which the water was left to stay for five minutes. The flocculated mass was then filtered through a layered cloth. The arsenic content of the purified water was measured and the result is summarized in Table - 1. Comparative Example - B A test water containing 300 ppb of arsenic from sodium arsenite (Arsenic (III) form) was used. The process of purification was as used for Comparative Example - A. The arsenic content of the purified water was measured and the result is summarized in A water purification composition as shown in Table-1 was used for purification of water. The composition was a two component system with the first component having calcium - 10 - hypochlorite and the second component having polyaluminium chloride, polyacrylamide and titanium dioxide. The process of purification was as follows. Purification process: 10 litres of the test water was taken in a bucket and the composition 5 as shown in Table-1 was added to the test water and stirred for one minute after which the water was left to stay for five minutes. After this the second component was added and stirred for one minute after which it was allowed to stay for five minutes. The flocculated mass was then filtered through a layered cloth. The arsenic content of the purified water was measured and the result is summarized in Table - 1. Example - 2 A composition as per Example-1 was used. The test water was similar to that used in Example -1 except that the test water contained 150 ppb of sodium arsenite and 150 ppb of sodium arsenate which is generally encountered in ground water contaminated with 15 arsenic. The arsenic content of the purified water was measured and the result is summarized in Table - 1. Example - 3 A water purification composition similar to Example-1 was used, as shown in Table-1, except that iron oxide was used instead of titanium dioxide. The composition was 20 prepared as a two component system. - 11 - Example Comparative Example - A Comparative Example - B Example-1 Example- 2 Example-3 Calcium hypochlorite, g - - 0.15 0.15 0.15 Polyaluminium chloride, g 0.60 0.60 0.60 0.60 0.60 Polyacrylamide,g 0.08 0.08 0.08 0.08 0.08 Adsorbent Ti02 Ti02 Ti02 Ti02 Iron oxo-hydroxide Adsorbent, g 0.50 0.50 0.50 0.50 0.50 Form of arsenic in test water As(V) As(lll) As(lll) As(lll) + As(V) in 1:1 wtratio As(lll) ppb arsenic in purified water 5 100 5 5 10 The data in Table- 1 indicates that using composition as per prior art (Comparative 5 Example A), the standards of removal of As (V) can be achieved but it is not possible to meet the purification standard for As (III) (Comparative Example - B). However using the compositions as per the present invention (Examples 1 - 3), it is possible to ensure removal of Arsenic in the As (III) form alone or as a mixture of As (III) and As (V) forms. 10 A test water as used for Example -1 was prepared and in addition micro-organisms viz. cyst, bacteria and virus at the concentration as shown in Table-2 was added to it. The test water was purified as per the process used for Example -1. The amount of microorganisms in the purified water was determined and the result is summarized in Table-2. The method used to measure the amount of the various microorganisms in water is 15 described in detail in the publication "Tropical Medicine and International Health, volume 11 no 9 pp 1399-1405 September 2006, in article titled "'Microbiological performance of a water treatment unit designed for household use in developing countries", by Thomas Clasen, Suresh Nadakatti and Shashikala Menon. Microbes Input Cone. Output Cone. Log reduction Bacteria (E-coli) 7x10b/100mL Polio Virus 104.10 pfu / 100 Cysts (irradiated) 5x104/L 50/L 3.00 The data indicates that the composition as per the invention is capable of purifying water which contains harmful microorganisms to a high degree of purification required for maintenance of good health in people consuming the water viz. the composition ensures at least 6 log removal of bacteria, 4 log removal of virus and 3 log removal of cyst. 10 Several prior art compositions (Comparative Examples C to F) and compositions outside the scope of the invention (Comparative Example G) were tried as shown in Table - 3. The test water was as used for Example - 1. The water purification composition as shown in Table-3 was prepared as a one 15 component system and the process as per Comparative Example - A was used for purifying the test water. Comparative Example- D The composition as shown in Table-3 as a two component system was prepared. The test water was purified as per the process used in Example-1. - 13 - Comparative Example -E A composition as shown in Table-3 was prepared as a one component system and a process as per comparative Example - A was used for purifying the test water. Comparative Example - F 5 A composition as shown in Table-3 was prepared as a one component system. The test water was purified as per the process used in Comparative Example - A. Comparative Example - G The composition as shown in Table-3 as a two component system was prepared. The test water was purified as per the process used in Example-1. 10 The results of the experiments (Comparative Examples C to G) in terms of the Arsenic content in the purified water are summarized in Table - 3. Example Comp Ex-C Comp Ex-D Comp Ex-E Comp Ex-F Comp Ex-G Biocide CaHypo CaHypo CaHypo CaHypo CPB Biocide, g - 0.15 - - 0.15 Polyaluminium chloride, g 0.60 0.60 - 0.60 0.60 Polyacrylamide,g 0.08 0.08 - 0.08 0.08 Adsorbent - - Ti02 Fe203 Ti02 Adsorbent, g - - 0.50 0.50 0.50 ppb arsenic in purified water 150 50 150 120 100 CaHypo: Calcium hypochlorite CPB: Cetyl pyridinium bromide - 14 - The data in Table-3 indicates that compositions as per the prior art (Comparative Examples C to F) is not able to meet the removal criterion of arsenic. Further use of any conventional biocide (Comparative Example - G) alone is not sufficient to meet the removal criterion of arsenic. 5 Comparative Examples- H to K Experiments were conducted using compositions as shown in Table-4, where various other commonly known adsorbents were used. The process used was similar to that used for Example-1. The result on the Arsenic content in the purified water is shown in Table-4. The result of Example-1 is reproduced for comparison. Example Ex-1 Comparative Example - H Comparative Example -1 Comparative Example- J Comparative Example- K Calcium hypochlorite, g 0.15 0.15 0.15 0.15 0.15 Polyaluminium chloride, g 0.60 0.60 0.60 0.60 0.60 Polyacrylamide, g 0.08 0.08 0.08 0.08 0.08 Adsorbent Titanium di oxide Bentonite Activated Carbon Talc Zeolite Adsorbent, g 0.50 0.50 0.50 0.50 0.50 ppb arsenic in purified water 5 50 50 50 50 - 15 - The data in table-4 indicates that only use of a selective adsorbent in the composition of the invention provides for the synergistic benefit in arsenic removal while use of conventional adsorbents do not provide this benefit. 5 Dated this 1st day of February 2007. |Indian Patent Application Number||186/MUM/2007| |PG Journal Number||19/2012| |Date of Filing||01-Feb-2007| |Name of Patentee||HINDUSTAN UNILEVER LIMITED| |Applicant Address||UNILEVER HOUSE, B.D. SAWANT MARG, CHAKALA, ANDHERI EAST, MUMBAI-400 099| |PCT International Classification Number||C02F1/52, C02F1/28, C02F1/56| |PCT International Application Number||N/A| |PCT International Filing date|

<urn:uuid:3e378c34-0ff6-49cc-a509-3537d88343f6>

CC-MAIN-2018-13

http://www.allindianpatents.com/patents/252294-water-purification-composition

s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257649961.11/warc/CC-MAIN-20180324073738-20180324093738-00526.warc.gz

en

Here are some examples of shares at different points in the season. Remember that farming is inherently unpredictable and that shares will vary due to weather, pests and other factors that affect our production. A spring share in March or April might include several kinds of greenhouse-grown baby greens, as well as root vegetables (such as carrots and potatoes) and apples stored over the winter. A spring share in May or June might include greenhouse-grown baby greens, field grown greens such as swiss chard, lettuce, and bok choy, greenhouse grown cucumbers, edible flowers, apples stored over the winter, and more. A vegetable share in June might include arugula, beets, chinese cabbage, carrots, pickling cucmber, garlic scapes, lettuce, radishes, scallions, kousa squash, hakurei turnip, and chives. A fruit share in June might include a couple pints of strawberries and a couple pounds of apples stored over the winter. A share in July might include beans, carrots, corn, cucumber, daikon radish, endive, kohlrabi, lettuce, zucchini, kousa squash, summer squash, and basil. A fruit share in July might include blueberries, apricots, peaches, and possibly apples stored over the winter. A share in August might include carrots, chard, corn, cucumber, lettuce, eggplant, sweet peppers, hot peppers, potatoes, kousa squash, zucchini, summer squash, heirloom tomatoes, slicing tomatoes, basil, and dill. A fruit share in August might include peaches, blueberries, raspberries, nectarines, watermelons, cantaloupe. A share in September might include cabbage, carrots, corn, lettuce, onions, sweet peppers, hot peppers, potatoes, radishes, cherry tomatoes, slicing tomatoes, cilantro, and basil. A fruit share in September might include watermelon, peaches, nectarines, plums, and apples. A share in October might include beets, carrots, garlic, kale, lettuce, potato, radicchio, radish, winter squash, purple top turnips, and parsley. A fruit share in October might include several varieties of apples and pears. A late fall share in November or December might include carrots, potatoes, onions, sweet potatoes, winter squash, broccoli, spinach, lettuce, apples, pears, cranberries, and radishes.

<urn:uuid:62b67c36-fc81-4681-a91b-861343469310>

CC-MAIN-2017-04

http://www.farmerdaves.net/faq/what-might-i-receive-in-my-csa-share-at-different-points-in-the-season

s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281574.78/warc/CC-MAIN-20170116095121-00328-ip-10-171-10-70.ec2.internal.warc.gz

en

Tired of rising gas prices? How does filling your car’s fuel tank with tap water and a pound of salt sound to you? It sounds ludicrous right now, but one day it might be reality. Pennsylvania cancer researcher John Kanzius discovered a process to burn salt water using a radio frequency generator. According to some scientists, his discovery could potentially be the most important discovery in the field of water science in more than 100 years. Kanzius accidentally discovered the process for burning saltwater when he tried to desalinate water using a radio frequency generator in his lab. The radio frequencies weaken the bond between the elements that comprise salt water, releasing flammable hydrogen. The hydrogen will burn as long as the exposure to radio frequencies continues to release more hydrogen from the water. The process sounds simple, but I am sure there is a lot more to it than that! Researchers are not sure if this will be a feasible fuel source for cars or other large machines. But, one thing is certain. If this process is refined to the point of practical use, our world will not hurt for resources – salt water is the most abundant resource on earth! Kanzius is currently trying to get research funding from the Department of Energy and the Department of Defense. Can you imagine just pulling over to the side of the road and pumping salt water into your car every time you need a fill up? Or better yet, waiting until you get home and using the hose in your front yard? This discovery could revolutionize the way humans utilize combustion engines and other forms of power. This is a very interesting and exciting discovery.

<urn:uuid:32f4e045-a0ba-455b-9275-849ea9ed3de7>

CC-MAIN-2015-11

http://cashmoneylife.com/will-water-replace-oil-as-the-fuel-of-the-future/

s3://commoncrawl/crawl-data/CC-MAIN-2015-11/segments/1424936463956.95/warc/CC-MAIN-20150226074103-00118-ip-10-28-5-156.ec2.internal.warc.gz

en

Did you know ... More interesting facts on Landslide - the 1979 Abbotsford landslip was the biggest landslide ever in an urban area in New Zealand? - the largest landslide ever recorded in Canada was 1965's Hope Slide? - the largest landslide triggered by the 1949 Khait earthquake, the Yasman valley flowslide, had a volume of 245 Mm3 and killed about 4,000 people? - the 1970 Ancash earthquake and the landslide that followed killed at least 47,194 people and was the worst natural disaster ever recorded in the history of Peru? - over 120,000 cubic yards of asbestos-containing sediment from an active, slow moving landslide is deposited into Swift Creek, Washington each year? - Les Éboulements is located in the centre of the Charlevoix crater in Quebec, and was named after a large landslide that occurred in 1663? - Seacliff Lunatic Asylum (pictured) in New Zealand was plagued by landslips, a fatal fire in a locked psychiatric ward and allegations of abuse before reverting to a forest reserve? - Heart Mountain (pictured) in Wyoming, USA, was transported to its current location by the largest landslide ever discovered, approximately 50 million years ago? Include this on your site/blog: Top rankings for Landslide

<urn:uuid:42d2a4be-6762-4abd-8ff8-26831aece84c>

CC-MAIN-2015-18

http://quiz.thefullwiki.org/Landslide

s3://commoncrawl/crawl-data/CC-MAIN-2015-18/segments/1429246659319.74/warc/CC-MAIN-20150417045739-00033-ip-10-235-10-82.ec2.internal.warc.gz

en

Parents & Caregivers Parents and caregivers are often the first to notice or think that their child might need help. Mental health, also referred to as emotional or behavioral health, should be considered in the same way as other health issues in your child’s life. In this section, we provide some general information that parents and caregivers can use to help navigate the sometimes confusing and complex world of child mental health. We provide resources and information on common mental health disorders, symptoms and warning signs, as well as information on the best treatment. This website includes, questions to ask when meeting with your pediatrician or mental health care provider, information on best and evidence-based practices as well as links to other valuable resources in our state and across our nation. Many questions you may have are likely to be answered in our 25 Frequently Asked Questions (FAQs) section. Please click on the links to the right for more information.

<urn:uuid:7508473e-179d-43c5-803f-bbc2295362ef>

CC-MAIN-2017-17

http://www.kidsmentalhealthinfo.com/parents-caregivers/

s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917123549.87/warc/CC-MAIN-20170423031203-00211-ip-10-145-167-34.ec2.internal.warc.gz

en

Keywords:embodied understanding, kinaesthetic orientation, sensory-based question-action-observation-processes, political potentiality The word understanding indicates a bodily connection to being upright. The prefix here under does not have the common meaning of beneath but derives from the old English meaning between or among. The old English word understandan could be transcribed as standing in the midst of and shows enactive relationality: how we are and how we bring ourselves in relation to our environment creates our understanding and forms our experiences and conceptions of the world. It is an active, sensory-motor-process borrowed in the act of understanding that carries action-potentialities. From the encounters of many individual action-potentialities rises a cultural and political potentiality in which we form our social reality. This potentiality makes it necessary for us to be able to practice conscious, responsible decision-making. The range and the freedom of choices demand to take responsibility for actions and their consequences, which means that where we have the choice we have to make a choice. In social spaces we are making our choices always in collective structures which involve us and others. Within these collective structures our choices show impact in many directions. To build conductive conditions for individual and collective unfolding, the social space requires a compassionate, appreciative way of understanding which leads beyond the cognitive aspect of understanding. Compassion creates a wider space which not only depends on cognitive understanding. The awareness for the always already shared space allows to develop self-care into community-care.

<urn:uuid:44371d44-16d4-458d-95c9-3ce5c35c42bf>

CC-MAIN-2022-33

https://feldenkraisresearchjournal.org/index.php/journal/article/view/16

s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571847.45/warc/CC-MAIN-20220812230927-20220813020927-00762.warc.gz

en

Question: What happened to Nathaniel Thomas Brown after he served in Brigham Young’s Vanguard Company in 1847? Answer: Nathaniel Thomas Brown was born about 1823. Previous research has been unable to determine the exact date or place of his birth. The names of his father and mother are not known. In the rebaptism record in Salt Lake City on August 8, 1847, he gave his name as “Nathan.” Other records refer to him as “Thomas.” Nathaniel joined The Church of Jesus Christ of Latter-day Saints and lived in Nauvoo. After the Saints were driven out of Nauvoo in 1846, Nathaniel made his way to Winter Quarters. In 1847, at Winter Quarters, Nathaniel was asked to be a member of Brigham Young’s Vanguard Company. Everyone gathered to a place about 20 miles from Winter Quarters on the banks of the Platte River. There they worked repairing wagons, organizing supplies, and chopping firewood. It wasn’t until the 16th of April that the company was officially organized into the hundreds, fifties, and tens, with captains appointed and they started on their way. Nathaniel was part of the 10th Company of Ten, led by Appleton M. Harmon. Once organized, this Vanguard Pioneer Company consisted of 142 men, 3 women, 2 children, and 72 wagons. They traveled 1031 miles before reaching their destination. Some members of the company traveled ahead and arrived in the Salt Lake Valley as early as the July 21, 1847. By the 24th of July, the entire company had arrived. On this trek, Nathaniel associated with Porter Rockwell in hunting, and in searching after lost animals. Nathaniel returned to Winter Quarters in the fall of 1847. After returning, he was accidentally shot and killed at Council Bluffs, Pottawattamie, Iowa, in February 1848, by an unidentified man. Nathaniel was planning to return to the Salt Lake Valley in the spring. Nathaniel was only 25 years of age at the time. Greatly distressed by the accident, Brigham Young was said to have remarked, “Brown’s old shoes were worth more than the whole body of the man who killed him.” Source: Membership Records of The Church of Jesus Christ of Latter-day Saints; LDS Pioneer and Handcart Companies, 1847-1856; “Nathaniel Thomas Brown’ in the Sons of Utah Pioneers – Card Index, 1847-1850; FindAGrave.com; Deseret News, Church News, “Biographies of the original 1847 pioneer company,’ October 2009.

<urn:uuid:eb2015d6-0b33-41ec-bf84-192bb37eaacc>

CC-MAIN-2023-06

https://latterdaylight.com/nathaniel-thomas-brown/

s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764500255.78/warc/CC-MAIN-20230205130241-20230205160241-00817.warc.gz

en

At present, the size of Indian economy has grown more than $ 2 trillion and tagged as the highest growing economy in the world. The richest Indian state is Maharashtra, whose State Gross Domestic Product (SGDP) is $ 380 billion which is equal to Norway’s economy. The second richest Indian state is Tamil Nadu whose SGDP is $ 208 billion which is followed by Karnataka (SGDP $ 190 billion). In the recent elections held in the State of Uttar Pradesh, the BJP has gained mammoth victory with a clear majority to form the government in the State. Uttar Pradesh has largest population of state. In this article, we will be elaborating upon the chief Ministers of the Uttar Pradesh from the time of its being United Province till the recent elections India is known as the “union of states”. Every state has its own distinct climate, art & culture, clothing and food habits. This is the reason that every Indian state has its symbols for its identity. In this article we have covered the name of different Trees and flowers of all the Indian state. India is known as the “union of states”. Every state has its own distinct climate, art & culture, clothing and food habits. This is the reason that every Indian state has its symbols for its identity. In this article we have covered the name of different animals and birds of all the Indian state. Fairs and Festivals are integral part of culture and history of Bihar. It is famous for its tourist places, fair and festivals which are grouped under Buddhism, Jainism, Hindu, Sikh, Sufi etc. Here, we are giving the complete study material related to the ‘Summary on the Fairs and Festivals of Bihar’ for the aspirants who are preparing for the competitive examinations like BPSC and other state level examinations. The nicknames of the cities or regions are associated with the unique characteristics such as unique geographical position, natural beauty, natural formations like lakes, type of industry, large and quality production of particular agriculture products etc. Here, we are giving the list of Indian Cities and their Nicknames which will be very helpful for the preparation of different competitive examinations. India i.e. Bharat, shall be Union of 29 States and 7 Union Territories rather than Federation of the states and UTs. Every Indian states and union territories have their symbols like state animal, state bird, state flower etc. Here, we are giving the list of Indian states and their Symbol with their common name and scientific name. The Geographical Structure of Bihar is embedded with younger geological structure in the North by Dharwarian rocks and older in the South by quaternary rocks. Here, we are giving brief outline of Geographical and Physiological Structure of Bihar which will be helpful for the aspirants as revision capsule to those who are preparing for the competitive examinations like BPSC and other state level examinations. The Government of Bihar State gives awards and honours to distinguished persons of different fields on the occasion of 26th January, 15th August or other special occasions. The awardees are given citation, cash prizes and shawl. Here, we are giving brief outline of the important awards and honours, and also list of academy that involves in awards and honour giving which will help the aspirants who are preparing for the State PSC Examinations like BPSC. Medieval History of Bihar is commemorated with the foreign invasion and dynasty that ruined the glory Bihar. Bihar was ruled directly or indirectly by Slave Dynasty, Khilji Dynasty, Tughlaq Dynasty, Noohani Dynasty, Cher Dynasty, Bhojpur’s Ujjaini Dynasty, Sur Dynasty and Mughal Dynasty. Bihar is a land of many extraordinary people whose work and contributions have strongly influenced the course of events of the history of Bihar. Nationalist, writers, poets, artists, musicians, theatre artist, all have their fair share of contribution to the land. Here, we are briefly outline the major contribution of some great personalities which will help the aspirants who are preparing for the State PSC Examinations like BPSC. Bihar is located in the eastern part of the country. The state enjoys a continental monsoon type of climate. Great distance from sea, adjoining Himalayan Mountains and changes in the upper air circulation affects its climate. Distribution of soils here has bearing of climate, parent material and topography. Here, we are giving the complete study material related to the ‘Climate and Soil Profile of Bihar’ for the aspirants who are preparing for the competitive examinations like BPSC and other state level examinations. The Ancient History of Bihar extends to the very dawn of human civilization and also associated with the advent of earliest myths and legends of Sanatana Dharma. Here, we are giving the complete study material of ‘Ancient Bihar History’ that will be ease the journey of aspirants to crack the competitive examinations like BPSC and other state level examinations. The Rivers of Bihar flow through alluvial deposits where slope is very small, forming wide flood plains but the catchment area of the these rivers are large. Here, we are sharing the list of major rivers in Bihar that enhance the general knowledge of Bihar which is used by the students who are preparing for BPSC and other state level examinations as a reference study material. Bihar is endowed with a number of beautiful natural spots varying from waterfalls and hot springs that contributes the idyllic setting of the state. Here we are giving waterfalls in Bihar and list of hot springs which will be helpful in the preparation of State PSC exam especially Bihar PSC or BPSC. Bihar is known for the centre of power, learning, and culture in India for 1000 years during classical Indian History. Most of the powerful kingdoms of Ancient India rise in the region. Here, we are giving the ‘Summary on the important Buddhist Pilgrimage sites in Bihar’ which is helpful for those students who are preparing not only for Bihar PSC Exam but also other State-PSC Exams. Bihar is situated on the one of the fertile regions of the world which is drained by river Ganga. It was famous for its cotton, textile, saltpetre and indigo. This makes reason of enticing for European to open trade factories and centre for trade. Here, we are sharing “Modern History of Bihar” which is helpful for those students who are preparing for Bihar PSC Exam. The Tribal Revolts of Bihar were mostly unorganised, localised and periodic which were mainly against Britishers exploitative relation with tribes and tribal land and also transfer of land to outsiders. Here, we are giving the list of ‘Tribal Revolt of Bihar’ along with date, people who were associated with the revolt and nature & objective as well. India has very diverse multi party political system. There are three types of political parties in India i.e. National Parties (6), state recognized parties (48) and unrecognized parties (1706). All the political parties which wish to contest local, state or national elections are required to be registered by the Election Commission of India (ECI). India is a union of 29 states and 7 union territories. As per census 2011, population of India was 1.2 billion. India occupies 2.4 percent of the world's land surface area and is home to 17.5 percent of the world's population. Uttar Pradesh is the most populous state of India. It has 16.50% population of whole India. A person aged seven or above, who can both read and write with understanding in any language is termed as the literate. Sex ratio is defined as the number of females /1000 males. As per census 2011 India has the literacy of 74.04 and sex ratio at the 934females/1000 males. As per census 2011, Nagaland is the only Indian state which has negative growth rate of -0.58% in census 2011while Indian population grown at the rate of 17.69% from 2001 to 2011. The records of population density 2011 of India state that the density 2011 has increased from a figure of 324 to that of 382 per square kilometer. Bihar is the most thickly populated state (1106 persons/sq km.) followed by west bengal-1028 and Kerala 860. Population density increased at the rate of 17.54 from 2001 to 2011. In the census 2011, a person aged seven and above, who can both read and write with understanding in any language is treated as literate. A person, who can only read but can’t write, is not literate. India's literacy rate is at 74.04%.Kerala is the most literate state in India, with 93.91% literacy. Bihar is the least literate state in India, with a literacy of 63.82%. Sex ratio is used to describe the number of females per 1000 of males. In the Population Census of 2011 it was revealed that the population ratio in India 2011 is 943 females per 1000 of males. Haryana has the lowest sex ratio (877) in Indian states while in union territory Daman & Diu has lowest sex ratio of 618. Kerala has the highest sex ratio of 1084 in the all Indian states. The Indian Census is the most credible source of information on Demography (Population characterstics), Economic Activity, Literacy and Education, Housing & Household Amenities, Urbanisation, Fertility and Mortality etc. Census 2011 was the 15th National Census of the Country. This census was conducted under the guidance of Registrar General and Census Commissioners, India Mr. C. Chandramouli. Karnataka is a state in south western region of India. It was formed on 1 November 1956, with the passage of the States Reorganisation Act. Originally known as the State of Mysore, it was renamed Karnataka in 1973. The capital and largest city is Bengalore/ Bengaluru is known as the silicon valley of India. The state covers an area of 191,976 square kilometres (74,122 sq mi), or 5.83 per cent of the total geographical area of India. It is the seventh largest Indian state by area. Kerala historically known as Keralam, is a state in South India on the Malabar coast. It was formed on 1 November 1956 following the States Reorganisation Act by combining various Malayalam-speaking regions. Spread over 38,863 km2 (15,005 sq mi), it is bordered by Karnataka to the north and north east, Tamil Nadu to the east. With 33,387,677 inhabitants as per the 2011 census, Kerala is the thirteenth largest state by population and a highly literate state in the country. Jharkhand is a state in eastern India carved out of the southern part of Bihar on 15 November 2000.The state shares its border with the states of Bihar to the north, Uttar Pradesh and Chhattisgarh to the west, Odisha to the south, and West Bengal to the east. It has an area of 79,710 km2 (30,778 sq mi). The city of Ranchi is its capital while the industrial city of Jamshedpur is the largest in the state. It is the top producer of iron ore, copper ore, kainite, mica and uranium (Jaduguda mines, Narwa Pahar). Puducherry, formerly known as Pondicherry literally New Town in Tamil is a Union Territory of India. It was formed out of four exclaves of former French India namely Puducherry, Karaikal, Yanam and Mahe. It is named after the largest district Puducherry. Historically known as Pondicherry, the territory changed its official name to Puducherry (Putuccēri) on 20 September 2006.

<urn:uuid:f589b179-95d7-46cd-bf39-4952bef07e9c>

CC-MAIN-2017-17

http://www.jagranjosh.com/general-knowledge-states-of-india-1291983195-1

s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917122933.39/warc/CC-MAIN-20170423031202-00159-ip-10-145-167-34.ec2.internal.warc.gz

en

Authors: Keeley Fischer, Lauryn Johnson, Alli Nickel, Dana Pflugradt Overdose Lifeline has recognized that most people requesting naloxone, an opioid overdose reversal medication, are white. Other programs have also found that the medication is more often given to white people than black, African American, Latino, or Hispanic individuals (Kinnard et al., 2021). Opioid use and overdose have a profound impact on individuals, communities, and populations and their abilities to participate in daily activities. Naloxone promotes and advocates for increased life involvement and inclusivity within marginalized communities. When stripped of access to naloxone, a person is stripped of basic needs, roles, routines, opportunities, resources, and social participation. To stop this from happening at a racially disproportionate level, we need to engage in our communities and learn about racism, its impacts, and how to combat it. After acknowledging racial injustices, Overdose Lifeline has collaborated with occupational therapy students from Indiana University to evaluate ways to create equitable access to naloxone and a more just community. Occupational therapy can assist in regaining meaningful daily activities for individuals, groups, and populations, and an occupational therapy lens was utilized throughout this collaboration. The ongoing goal is to allow all individuals to participate in meaningful life activities throughout Indiana. By providing naloxone to anyone, Indiana can reduce the rate of deaths caused by opioid overdose. This change starts with you learning about the systemic racism that occurs in our country. Inequalities in Criminal Justice More black and Hispanic individuals are imprisoned for drug charges when compared to the overall US population [see chart in handout] (Carson, 2015; United States Census Bureau, 2020). Black men specifically are twice as likely to be given a mandatory minimum sentence, further demonstrating the inequalities (Starr & Rehavi, 2013). Racism is ingrained in United States’ history, from legalized slavery and segregation to higher rates of incarceration in communities of color. One period to note was between 1986 and 2010 when there was significantly different sentencing for crack cocaine versus powder cocaine. The sentencing disparity is often called the 100:1 ratio since holding 5 grams of crack had a 5-year minimum sentence, and 500 grams of powder led to the same punishment (The Sentencing Project, 2010). Most individuals on trial for crack possession were black or African American, while most convicted for powder possession were white. Additionally, crack is no more addictive than cocaine, the two drugs are chemically identical, and they have similar effects on the body, all of which demonstrate that there is no justifiable reason for the difference in sentencing (The Sentencing Project, 2010). Black or African American individuals were serving, and continue to serve, much longer sentences than white individuals even though they were convicted for using an almost identical drug. In 2010, the Fair Sentencing Act was passed, which reduced the ratio from 100:1 to 18:1 (Lynch, 2021). However, there is hope. A bill, called Eliminating a Quantifiably Unjust Application of the Law, may soon be passed to end the disparities (Lynch, 2021). Inequalities in Healthcare Inequalities in healthcare exist regarding the treatment of different races. These disparities were exacerbated by the pandemic, given that there was a 9.7% increase in emergency room visits after overdose, with the majority of individuals identifying as black or African American (Patel et al., 2021). Even though most of those seeking help were black, they were also more likely to die from an overdose, possibly because of the faults in the patient-provider relationship (Maina et. al, 2018; Patel et al., 2021). This literature supports the power of understanding the attitudes and perceptions of race that surrounds healthcare access. The injustices mentioned rightfully amplify the mistrust that communities of color have in institutions dominated by white individuals. This is why we would like you to take a closer look at yourselves, who you support, and take any action you can to make a difference. We have provided a list of starting points and especially encourage you to take the Implicit Association Test. This test will allow you to look at what biases you may have. Knowing your prejudices will help you be more aware of how you treat others, and together, we can take steps to move toward a more just and equal society. Instructions for taking the Implicit Association Test: - Follow this link: https://implicit.harvard.edu/implicit/takeatest.html - Click “I wish to proceed” - Select “Race IAT” (it’s the seventh blue button from the top) - Select continue - Read the questions and respond as honestly as possible. Carson, E. A. (2015, September). Prisoners in 2014 – Bureau of Justice Statistics (Report No. NCJ 248955). Bureau of Justice Statistics. https://bjs.ojp.gov/content/pub/pdf/p14.pdf Drug Policy Alliance (2015, June). The Drug War, Mass Incarceration, and Race [White paper].United Nations Office on Drugs and Crime. https://www.unodc.org/documents/ungass2016/Contributions/Civil/DrugPolicyAlliance/DPA_Fact_Sheet_Drug_War_Mass_Incarceration_and_Race_June2015.pdf Kinnard, E. N., Bluthenthal, R. N., Kral, A. H., Wenger, L. D., & Lambdin, B. H. (2021, 2021/08/01/). The naloxone delivery cascade: Identifying disparities in access to naloxone among people who inject drugs in Los Angeles and San Francisco, CA. Drug and Alcohol Dependence, 225, 108759. https://doi.org/https://doi.org/10.1016/j.drugalcdep.2021.108759 Lynch, S. N. (2021, September 28). U.S. House passes bill to end disparities in crack cocaine sentences. Reuters. https://www.reuters.com/world/us/us-house-passes-bill-end-disparities-crack-cocaine-sentences-2021-09-28/ Maina, I. W., Belton, T. D., Ginzberg, S., Singh, A. & T. J. Johnson. (2018). A decade of studying implicit racial/ethnic bias in healthcare providers using the implicit association test. Social Science & Medicine, 199, 219-229. https://doi.org/10.1016/j.socscimed.2017.05.009 Patel, I., Walter, L. A., & Li, L. (2021). Opioid overdose crises during the COVID-19 pandemic: implication of health disparities. Harm Reduction Journal, 18(1), 1–5. https://doi-org.proxy.ulib.uits.iu.edu/10.1186/s12954-021-00534-z The Sentencing Project (2010). Federal crack cocaine sentencing [White paper]. https://www.sentencingproject.org/publications/federal-crack-cocaine-sentencing/ Starr, S. B. & Rehavi, M. M. (2013). Mandatory sentencing and racial disparity: Assessing the role of prosecutors and the effects of Booker. The Yale Law Journal, 123(1). https://www.yalelawjournal.org/article/mandatory-sentencing-and-racial-disparity-assessing-the-role-of-prosecutors-and-the-effects-of-booker United States Census Bureau (2020). Quick facts: United States. https://www.census.gov/quickfacts/fact/table/US/PST045219#qf-headnote-a

<urn:uuid:0b14b9fa-8832-4f77-a85e-e669ce86b7aa>

CC-MAIN-2023-14

https://www.overdoselifeline.org/news/overdose-lifeline-for-equity-and-justice/

s3://commoncrawl/crawl-data/CC-MAIN-2023-14/segments/1679296945472.93/warc/CC-MAIN-20230326111045-20230326141045-00510.warc.gz

en

Characteristics species diversity, in isolated geographic regions, is maintained by barriers like large rivers, seas, oceans, mountains, and deserts. Ships and airplanes now import or export species, from one continent to other on a time scale of days. Alien species affect native species’ composition and distribution. Invasive species are generally hardy, long-lived, and voracious with high rapid reproduction rate, high dispersal ability, and phenotypic plasticity. In absence of natural enemies, they control the ecosystem, and compete with native species for survival. The scourge of Invasive Alien Species (IAS) is probably the second important threat to biodiversity, after habitat destruction. Introduction of Nile perch resulted in the extinction of more than 200 other fish species. The continuous release of the mosquito fish is a remarkable example of biological invasion. IAS presently are a focus of international conservation concern. The Invasive Species Specialist Group (ISSG) , a specialist group of the Species Survival Commission (SSC) of the World Conservation Union (IUCN) listed “100 of the World’s Worst Invasive Alien Species” into 12 groups like microorganism, macro fungi, aquatic plant, land plant, aquatic invertebrate, land invertebrate, amphibian, fish, bird, reptile ,and mammal. Brief description of IAS like Crazy Ant (Anoplolepis gracilipes ), Brown Tree Snake( Boiga irregularis), Caulerpa Seaweed( Caulerpa taxifolia), Avian Malaria ( Plasmodium relictum ),Feral pig( Sus scrofa), Strawberry Guava( Psidium cattleianum ), Miconia( Miconia calvescens ), Western Mosquito fish( Gambusia affinis), Small Indian Mongoose( Herpestes javanicus auropunctatus ), Rosy Wolfsnail( Euglandina rosea), Water Hyacinth( Eichhornia crassipes ), Nile Perch ( Lates niloticus ) and a complete list 100 IAS are available in "100 of the World's Worst Invasive Alien Species

<urn:uuid:58819cb5-b65f-422d-b8c0-86e0b4b878ad>

CC-MAIN-2017-04

http://www.digitaljournal.com/article/301076

s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280730.27/warc/CC-MAIN-20170116095120-00277-ip-10-171-10-70.ec2.internal.warc.gz

en

T H E W I L D L I L Y I N S T I T U T E Post-modernism is a school of thought or a tendency in contemporary culture which rejects modernism. It is characterized by the rejection of objective truth and global cultural narrative. It emphasizes the role of language, power relations, and motivations. It attacks the use of sharp classifications such as male versus female, straight versus gay, white versus black, and imperial versus colonial. It has been described by Fredric Jameson as the "dominant cultural logic of late capitalism". Although the term 'post-modernism' was first used around the 1870s in various areas, as a general theory of an historical movement the term was first used in 1939 by the historian Arnold J. Toynbee: "Our own Post-Modern Age has been inaugurated by the general war of 1914- 1918". Later in 1949, the term was used to describe dissatisfaction with modern architecture, which led to the post-modern architecture movement that is marked by the re-emergence of surface ornament, reference to surrounding buildings in urban architecture, historical reference in decorative forms, and non-orthogonal angles. Subsequently, the term 'post-modernism' was applied to a whole host of movements that reacted against modernism many in art, music, and literature and are typically marked by revival of traditional elements and techniques. In critical theory, post-modernism is used to refer to a point of departure for works of literature, drama, architecture, cinema, journalism, and design, as well as in marketing and business and in the interpretation of law, culture, and religion in the late 20th and early 21st centuries. These days, a new term 'post-modernity' is being used to describe post-modernist ideas in philosophy and the analysis of culture and society including re-evaluation of the entire Western value system (love, marriage, popular culture, shift from industrial to service economy, etc.) that took place since the 1950s, with a peak in the Social Revolution of 1968. Since post-modernism refers to an opinion or movement, something being 'post-modernist' would make it part of the movement. On the other hand, something being 'post-modern' would place it in the period of time since the 1950s, making it a part of contemporary history. Post-modernist thought is an intentional departure from 'modern' scientific mentality developed during the Enlightenment. For postmodernists, 'modernism' began in the seventeenth century and ended sometime between 1945 and the present. Modernism was characterized by the ascendancy of science and reason as means for both understanding and explaining the world. It was often associated with identity, unity, authority, and certainty, while post-modernism is often associated with difference, separation, textuality, and scepticism. On the other hand, if one associates modernity with the rise and globalization of capitalism, and accepts that this phenomenon is itself a form of cultural and economic imperialism, then post-modernism can be represented as having radical potential in the attempt to formulate a defense of difference. Post-modernist writers respond to perceived failures of rational and scientific approaches to economics, politics, society, and morality to ensure progress. They especially cite failures of theories like Marxism, utilitarianism, and Freudianism. Post-modernism is open to the charges both of relativism and conservatism. Relativism, because, if all that we have access to are local knowledge’s, practices, and so on, we can have no justifiable reason to judge other localities and their practices. Conservatism, because if we cannot judge even our own localities (institutions, practices, societies, etc.) in the light of standards or principles external to them, it is unclear what justification we could ever have for changing them. Post-modernism has influenced many cultural fields, including literary criticism, linguistics, architecture, visual arts, and music. The movement of post-modernism began with architecture, as a response to the perceived blandness, hostility, and utopianism of the modern movement. Modernism was criticised for being focused on the pursuit of a perceived ideal perfection, and an attempted harmony of form and function. The critics of modernism argued that the attributes of perfection and minimalism themselves were subjective, and pointed out anachronisms in modern thought. Definitive post-modern architecture such as the work of Michael Graves rejects the notion of a 'pure' form or 'perfect' architectonic detail. Instead it conspicuously draws from all methods, materials, forms and colours available to architects. Post-modernist architecture favours personal preferences and variety over objective, ultimate truths or principles. In fact, it is this atmosphere of criticism, scepticism, and emphasis on difference over and against unity that distinguishes many post-modernisms. Literary post-modernism officially began in the United States with the first issue of boundary 2, subtitled "Journal of Postmodern Literature and Culture", which appeared in 1972. The integral figures in the intellectual and artistic exposition of post-modernism at the time were David Antin, Charles Olson, John Cage, and the Black Mountain College school of poetry and arts. Even today, boundary 2 remains an influential journal in post-modernist circles. Some other significant contributions to post-modern culture from literary figures include Jorge Luis Borges, William S. Burroughs, and Samuel Beckett. Jorge Luis Borges experimented in metafiction and magical realism, while William S. Burroughs wrote the prototypical post-modern novel Naked Lunch and developed the cut up method (similar to Tristan Tzara's "How to Make a Dadaist Poem") to create other novels such as Nova Express. Samuel Beckett attempted to escape the shadow of James Joyce by focusing on the failure of language, schizophrenia, and humanity's inability to overcome its condition, themes later to be explored in such works as Waiting for Godot. Although the term had been used by many others like Charles Olson earlier, the Arab-American theorist Ihab Hassan was one of the first to use the term in its present form in his book The Dismemberment of Orpheus: Toward a Postmodern Literature (1971). In the book, Hassan traces the development of what he called 'literature of silence' through Marquis de Sade, Franz Kafka, Ernest Hemingway, Beckett, and many others, including developments such as the Theatre of the Absurd and the nouveali roman. Later on, Jean-Francois Lyotard wrote a short but influential work The Postmodern Condition: A report on knowledge (1979) and Richard Rorty wrote Philosophy and the Mirror of Nature (1979). Jean Baudrillard, Michel Foucault, and Roland Barthes are other influential writers in the 1970s post-modern theory. In classical music, the advent of musical minimalism in the 1970s paved way for the post-modern impulse. Composers such as Terry Riley, John Adams, Steve Reich, Phillip Glass, and Lou Harrison produced music with simple textures and relatively consonant harmonies. While some composers have been influenced by popular music and world ethnic musical traditions, not all post-modern composers have eschewed the experimentalist or academic tenets of modernism. The works of Dutch composer Louis Andriessen, for example, exhibit experimentalist preoccupation that is decidedly anti-romantic. The hallmarks of the postmodern influence in musical composition are eclecticism and freedom of expression, in reaction to the rigidity and aesthetic limitations of modernism.

<urn:uuid:f3343af8-2039-41dc-b1f7-dd9072aa6ec9>

CC-MAIN-2022-05

https://emilyisaacsoninstitute.com/postmodernism

s3://commoncrawl/crawl-data/CC-MAIN-2022-05/segments/1642320304309.5/warc/CC-MAIN-20220123172206-20220123202206-00598.warc.gz

en

We frequently hear from homeowners seeking answers to repair and maintenance problems. Many of these questions and answers are compiled in our Home Improvement Library. Here is a recent question. What is the recommended range for relative humidity inside the house? And where can I buy a humidity gauge and what is the best way to use it? We recommend a range of 30% to 50% of indoor relative humidity for comfort and health. Below 30% relative humidity begins to dry out our nasal passages and sinuses which can lead to more colds and flu susceptibility. If you have any sort of respiratory issues, your physician may have a more appropriate range for unique health and comfort. Too dry can also cause problems to the structure of your home, including cracking drywall and plaster, shrinking hardwood floors, separating trim, and cracking wood furniture and cabinetry joints. When indoor relative humidity goes above 50%, dust mites and other insects begin to thrive. High humidity also promotes mold and mildew growth which can adversely affect your health. Like our bodies, a house has its own range for optimal comfort and performance. Fortunately, it is in the same 30-50% range. Finding & Using a Humidity Gauge Radio Shack is a good source for battery-powered digital thermometers with a humidity read-out. Set the thermometer in various rooms of the house, and at various heights. For example, place it on the floor, a table top and about 6’ above the floor for a few minutes each to get a reading. This gives you an average of how well the supply and return ductwork is providing an even heat or cooling in each room and its relative humidity. If you find a room with unusually low humidity, you may have your explanation for static electricity and sinus problems. If you find a room with unusually high humidity, look for sticking doors or a leak or condensation along the ceiling line or exterior walls. At Mosby Building Arts, we use an infra-red thermal sensing camera for a quick condensation check. It senses temperature differences along walls which indicate insulation voids and the probable presence of moisture. This is a routine part of our home energy audits. Please feel free to contact us for help with monitoring and correcting indoor relative humidity problems. Call the Mosby office at 314.909.1800 or contact us here.

<urn:uuid:30814b85-586a-4d58-b757-93ce4943ced2>

CC-MAIN-2015-48

http://www.mosbybuildingarts.com/blog/2012/08/22/best-relative-humidity-in-your-home/

s3://commoncrawl/crawl-data/CC-MAIN-2015-48/segments/1448399455473.15/warc/CC-MAIN-20151124211055-00023-ip-10-71-132-137.ec2.internal.warc.gz

en

International Mother Language Day is Feb. 21st. This day brings to mind Nelson Mandela’s quote: "If you talk to a man in a language he understands, that goes to his head. If you talk to him in his language, that goes to his heart." As an African American, I speak two languages: standard English and African American Vernacular English (AAVE or Ebonics). I speak both, fluently. As a former educator, I can recall having students come to me with a variety of languages. I have had the pleasure of teaching students whose first language was Spanish, French, and even Lebanese. All were provided some type of learning accommodation and/or assistance so that we could communicate with each other. AAVE accommodations, on the other hand, were not offered to me, (despite the fact I would not need it) or my colleagues. Mostly, because AAVE is not recognized as a valid language. As a teacher it was my responsibility to create a classroom where care and concern were priority. I would even venture to say that care and concern are equally important, if not more so, than knowing one’s curriculum. Students need to feel accepted and included in class – not tolerated. Genuine inclusion and understanding of a student, all of what makes them who they are, is needed for students to learn. Students will not take the time to listen and learn from me if I did not take the time to affirm them. For more information on AAVE and how students come to classrooms with different languages, check out this video on World Languages and the African Diaspora. Also, stay tuned for more world language content.

<urn:uuid:53f77725-c450-4c54-9e7d-5fbd44059a67>

CC-MAIN-2022-40

https://www.scetv.org/stories/2021/language-love-celebrating-international-mother-language-day

s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030335276.85/warc/CC-MAIN-20220928180732-20220928210732-00086.warc.gz

en

I'm very sory for asking another question, but I'm just preparing a final exam, which means that i solve something like 20 Problems a day, so I get confused from time to time(Worried) The Sphere S intersects the plane P in a circle. Find the radius of the circle. Given are: Sphere S: x^2+y^2+z^2-2y-22z-103=0 Point C, centre of the circle of intersection: 6/7/8 and the plane P 2x+2y-z-18=0 My idea was first to find one direction vector of the plane, so for instance (1,-1,0) (one vector which lies on the plane) Then I invented the line l, which goes from C farther on the plane an eventually hits the spehere. To find where it hits the plane, I inserted the line in the equation of the sphere As result, I get t^2=(70)^1/2 This value inserted for t and than substracted the beginning point C, the radius of my circle gets (140)^1/2 which is the wrong solution. The result must be 12 (so (144)^1/2). As many times as I perform the calculation, I get the wrong solution, where is the flaw of my approach??

<urn:uuid:bc7fbad0-ed6a-4c40-9a52-e549cb2f244e>

CC-MAIN-2014-23

http://mathhelpforum.com/trigonometry/136953-spheres-print.html

s3://commoncrawl/crawl-data/CC-MAIN-2014-23/segments/1404776440271.67/warc/CC-MAIN-20140707234040-00026-ip-10-180-212-248.ec2.internal.warc.gz

en

Lack of adequate housing on Native American tribal lands has become so critical that tribes have been acquiring mobile homes from the Federal Emergency Management Agency. The shelters, meant to be utilized during disasters, are being converted into living quarters for Native American families. When FEMA announced that it would give tribes 1,000 mobile homes unused after the response to Hurricane Katrina in 2005, applications from tribal governments poured in despite ominous news reports suggesting that the housing units might contain sickening levels of formaldehyde. R. David Paulison, FEMA administrator from 2005 to 2009, told the National Congress of American Indians that 110 tribes requested more than 5,500 mobile homes. They turned out to be different from the post-Katrina "travel trailers," the kind that are typically hooked to vehicles for vacation trips and that tests had shown emitted excessive formaldehyde, causing respiratory problems in some occupants. Through 2009, 1,300 mobile homes were given to 88 tribes, which had to pay transportation and hookup costs, FEMA officials said in an email. Still, even more demand existed in Indian country for such impermanent housing, which most Americans would consider a last resort. The US Department of Housing and Urban Development (HUD), which announced in February the availability of another 500 mobile homes, is transferring 549 from FEMA's unused inventory. Ninety-five tribes had requested more than 3,000. "There's so much unmet housing need in Indian country, any assistance with housing is always appreciated," says Mellor Willie, a Navajo who is executive director of the National American Indian Housing Council. "The 500 homes alone could just barely meet the needs of one of our larger tribes." On tribal lands, where about 40 percent of Native Americans live, the shortage of decent housing is worse than in impoverished inner cities. The most recent estimates, from 1996 and 2003, indicate that between 90,000 and 200,000 units are needed to house Native Americans who are homeless or live in overcrowded or substandard dwellings. Forty percent of housing on reservations is considered inadequate, compared with 6 percent nationwide. Because the 565 federally recognized tribes ceded their ancestral territory to the United States, the federal government holds tribal lands in trust and provides nearly all housing on reservations, primarily through targeted HUD programs. In 2003, the US Commission on Civil Rights described housing situations there as "a quiet crisis" and called for increased federal funding for Native American housing. Instead, when inflation is taken into account, the spending power of that annual funding has continued to decline, as was happening at the time of the commission’s report. HUD funding for Native American housing has hovered around $700 million a year for more than a decade, except for an additional $500 million in stimulus funds in fiscal 2009. Asked why the funding decline has persisted despite urgent needs, Willie says, "The American government and American people take a blind eye to the nation’s first Americans." Sen. Tim Johnson (D-South Dakota), saw photos of thousands of FEMA's unused mobile homes stored near the airport at Hope, Arkansas, and sponsored legislation in 2006 that authorized giving surplus units to tribal governments. "It was a good effort to provide housing in places where there's a desperate need for housing options," says Perry Plumart, a spokesman for Johnson. "That housing need still exists." FEMA had purchased 144,000 mobile homes, travel trailers and hybrid "park models" for its disaster response to Katrina, but the agency's regulations and local rules prohibited using them in flood zones, which cover most of southeastern Louisiana. Johnson initially said 2,000 of the new, furnished three-bedroom homes with a life span of 30 years would be available to tribes. FEMA later reduced that number to 1,000, the agency's estimate of how many were ready to be transported in 2007. News reports of high formaldehyde levels in what media vaguely called "trailer" homes led Johnson to seek assurances from FEMA that the mobile homes he had requested were safe. Congressional hearings and federal officials clarified that the homes had to meet HUD safety standards for formaldehyde, which is used to pressure-treat wood products, while the "travel trailers" and "park models" bought by FEMA did not. Between 2007 and 2009, 1,300 of the mobile homes were transferred to Native American tribes, which paid several thousand dollars to transport each unit, hook it to utilities and prepare a home site. Tribal governments were allowed to use HUD block grants to cover those costs. Recipients include the Mescalero Apache in New Mexico, Standing Rock Sioux in North and South Dakota, Oglala Sioux in South Dakota and Cherokee in Oklahoma. "They've been working out great. I haven't heard of any real problems," says Alvin Benally, executive director of the Mescalero Apache Housing Authority, which received at least 21 mobile homes from FEMA and another four in April from HUD. Some northern tribes have experienced a problem that FEMA had cautioned about—most of the mobile homes are not designed for cold, snowy winters. "They're not insulated well enough for the North and South Dakota weather," says Johnelle Leingang, an emergency coordinator for the Standing Rock Sioux. "Other than that, we're grateful for them." Leingang says residents of the 26 mobile homes—who had been flooded out of their previous residences—have faced high electricity bills for heating, and some have experienced frozen and bursting pipes. While some residents fault the federal government, she said the Standing Rock government should have paid more attention to climate-related design issues. "We needed them, and the last thing on our mind was, 'Are they insulated?' " Leingang says. The Standing Rock Sioux received 26 mobile homes and the Mescalero Apache at least 25. The Oglala Sioux and Cherokee each received 12. The Oglala had requested 300 for their Pine Ridge Reservation. To help address the broader housing shortage, the National American Indian Housing Council has asked Congress to increase funding next year to $845 million, enough to compensate for inflation's effects. The request runs counter to the push by conservative House Republicans to cut such discretionary spending programs. But Willie also hopes to attract private investment to build new housing on tribal land. Traditionally, banks have been reluctant to make mortgages on reservations because the borrowers cannot own the land on which the home would sit. A potential homeowner can lease a home site, but the US Department of the Interior secretary must approve every lease. That process can take from two months to two years, Willie says, longer than banks are usually willing to keep financing available. Legislation pending in Congress would eliminate the bottleneck by authorizing each tribal government to grant leases on its reservation after the Interior secretary has approved its review procedures. The Navajo Nation already has that authority under a 2000 federal law that applies only to that tribe, whose reservation straddling Arizona, New Mexico and Utah is the nation’s largest. Tribes could lease land for residential and commercial properties, possibly stimulating creation of a real estate market that does not exist today. "This fix could change the face of how economic development is done on tribal trust land," Willie says.

<urn:uuid:6b77ad51-59a9-4e17-b830-5e345a2b1bd4>

CC-MAIN-2014-15

http://truth-out.org/opinion/item/947

s3://commoncrawl/crawl-data/CC-MAIN-2014-15/segments/1397609523429.20/warc/CC-MAIN-20140416005203-00011-ip-10-147-4-33.ec2.internal.warc.gz

en

What is market share? Market share is the percentage of total sales in an industry that is generated by a particular company. It represents the portion of the market that is controlled by that company. Understanding a company’s market share is useful because it indicates the size of a company in relation to its competitors. The company with the largest market share is referred to as the market leader. How to calculate market share Market share is calculated by dividing the total number of sales from a company by the total number of sales in the industry over the same time period. Here’s a quick breakdown of the market share formula: Total sales by a company / Total sales in an industry * 100 = Company’s % market share To calculate market share, follow these steps: Choose the time period you’d like to analyze. This can be a fiscal quarter, one year or several years. Determine the company’s total sales over that time period. Find out the industry’s total sales over that time period. (Here, you’ll want to focus on a specific country, such as the US or India.) Divide the company’s total sales by the industry’s total sales. The resulting number will be the percentage of that company’s market share within the specified country. For example, let’s say a particular company sold $200 million worth of cars in the US last year. You can calculate that company’s market share by determining the total amount of car sales in the US over the same time period. If the total amount of car sales was $400 million, then that company’s US market share last year was $200 million divided by $400 million, or 50%. You may also be interested in: Why is market share important? There are a few reasons companies can benefit from tracking their market share. Any increases or decreases in market share point to how successful a company’s products are in relation to its competitors. A company that is growing its revenue at the same rate as the total market maintains a consistent market share. On the other hand, one that grows its revenue faster than the total market increases its market share, thereby gaining an edge over the competition. Analysts closely monitor market share in order to help a company make smart business decisions. If a company has a relatively low market share, it may need to adopt new strategies in order to increase its sales. These can include lowering its prices, introducing new products, or improving its marketing efforts. On the flip side, a company that has a relatively high market share may choose to scale its operations. Market share is also an important metric for investors. Gains or losses in market shares indicate how well a company is performing in the industry, and can significantly impact its stock performance. How can companies increase market share? There are several strategies companies can use to increase their market share. These include: Improving marketing campaigns: If a company isn’t making enough sales, they may need to rethink their marketing strategies. This can include strengthening their content, expanding their advertising efforts, targeting different demographics, or reframing their messaging and branding, Hiring talented employees: Attracting highly skilled employees is another way to increase market share. Dedicated, experienced employees can come up with new ideas to help the company grow its revenue. Companies should also aim to reduce employee turnover, which helps reduce expenses related to hiring and training. They can do this by offering employees high salaries, benefits, and perks such as flexible work schedules. Creating innovative products: Companies can further increase their market share by being the first in their industry to come up with new, innovative technologies. This allows them to stay ahead of their competitors, and may persuade customers to switch over to their brand. Strengthening customer retention: Building customer loyalty is an effective way to ensure that people will consistently choose one company over another. When companies build a loyal community around their brand, customers are more likely to stick with their products rather than switching over to a competitor. In addition, loyal customers are a great source of word of mouth marketing, since they can recommend these products to their friends. Acquiring a competitor: This strategy eliminates some of the competition, helping companies increase their market share as a result. It also allows companies to reach the acquired firm’s existing customer base. Examples of market share Let’s take a look at some real-world examples of market share in relation to actual marketing strategies: Tesla is a company in the automotive industry that produces electric cars. This company is hugely successful in its field, with a market share of 79% in the electric vehicles industry in the US. It’s important to note that within the US automobile industry, Tesla’s market share hovers around just 2% - after all, only a very small proportion of the automobile industry is electric. This is an example of why it’s important to analyze your market share in relation to your direct competitors. Another company with a high market share is Google. Google is widely used throughout most countries, making its market share worldwide. Within the global search market, Google has a market share of almost 90%. Its competitor Bing, on the other hand, has a market share of just 6.7%. These numbers are a powerful indicator of Google’s dominance in relation to other search engines.

<urn:uuid:f1ca9f84-154d-437d-b34e-3e0cc441b9e3>

CC-MAIN-2023-06

https://www.wix.com/encyclopedia/definition/market-share

s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764494974.98/warc/CC-MAIN-20230127065356-20230127095356-00040.warc.gz

en

FREE SHIPPING on orders of $85 or more An excerpt from www.HouseOfNames.com archives copyright © 2000 - 2015 Origins Available: English, Scottish Where did the English Preston family come from? What is the English Preston family crest and coat of arms? When did the Preston family first arrive in the United States? Where did the various branches of the family go? What is the Preston family history?Preston is a name that was carried to England in the great wave of migration from Normandy following the Norman Conquest of 1066. The Preston family lived Lincolnshire, at Preston, from where they derived their name. The name Preston comes from the Old English words preost, meaning priest, and tun, meaning enclosure or settlement. Before English spelling was standardized a few hundred years ago, spelling variations of names were a common occurrence. Elements of Latin, Norman French and other languages became incorporated into English throughout the Middle Ages, and name spellings changed even among the literate. The variations of the surname Preston include Prestone, Preston, Presson and others. First found in Lincolnshire, where they were granted estates after the Norman Conquest. This web page shows only a small excerpt of our Preston research. Another 187 words(13 lines of text) covering the years 1086, 1332, 1421, 1453, 1503, 1585, 1655, 1753, 1807 and are included under the topic Early Preston History in all our PDF Extended History products. Another 127 words(9 lines of text) are included under the topic Early Preston Notables in all our PDF Extended History products. Some of the Preston family moved to Ireland, but this topic is not covered in this excerpt. Another 165 words(12 lines of text) about their life in Ireland is included in all our PDF Extended History products. In England at this time, the uncertainty of the political and religious environment of the time caused many families to board ships for distant British colonies in the hopes of finding land and opportunity, and escaping persecution. The voyages were expensive, crowded, and difficult, though, and many arrived in North America sick, starved, and destitute. Those who did make it, however, were greeted with greater opportunities and freedoms that they could have experienced at home. Many of those families went on to make important contributions to the young nations in which they settled. Early immigration records have shown some of the first Prestons to arrive on North American shores: Preston Settlers in United States in the 17th Century Preston Settlers in United States in the 18th Century Preston Settlers in United States in the 19th Century Preston Settlers in Australia in the 19th Century Preston Settlers in New Zealand in the 19th Century The motto was originally a war cry or slogan. Mottoes first began to be shown with arms in the 14th and 15th centuries, but were not in general use until the 17th century. Thus the oldest coats of arms generally do not include a motto. Mottoes seldom form part of the grant of arms: Under most heraldic authorities, a motto is an optional component of the coat of arms, and can be added to or changed at will; many families have chosen not to display a motto. Motto: Si Dieu Veult Motto Translation: If God wills it. The Preston Family Crest was acquired from the Houseofnames.com archives. The Preston Family Crest was drawn according to heraldic standards based on published blazons. We generally include the oldest published family crest once associated with each surname. This page was last modified on 29 April 2015 at 02:15.

<urn:uuid:479b2b53-72bd-447f-a50d-f5640130f95c>

CC-MAIN-2015-22

https://www.houseofnames.com/preston-family-crest

s3://commoncrawl/crawl-data/CC-MAIN-2015-22/segments/1432207926964.7/warc/CC-MAIN-20150521113206-00241-ip-10-180-206-219.ec2.internal.warc.gz

en

Zinc is an abundant and essential element, non-toxic and safe for use, yet few people and even less engineers appreciate it as a truly magic metal that offers a multitude of applications and versatility. For people in the corrosion world, who seek to extend the life of atmospherically exposed steel, zinc is best known in terms of corrosion control. Yet how many architects, designers and consulting engineers truly realise the magic that zinc quietly does all around us – protecting railways, bridges, concrete, power pylons and mining structures from catastrophic failure due to corrosion? Zinc is used extensively to coat steel for the prevention of corrosion. Zinc-oxide is a unique and very useful material in modern civilisation. It is widely used in the manufacture of paints, rubber products, cosmetics, pharmaceuticals, floor coverings, plastics, printing inks, soap, storage batteries, textiles, electrical equipment and other products. Zinc-sulphide is used for making luminous dials, X-ray and television screens and fluorescent lights. Zinc has an extraordinary capacity to protect uncoated steel structures against premature corrosion. If zinc is alloyed with aluminium to form Zincalume, and this is coated onto a thin steel sheet (continuous galvanising) and receives a resilient organic coating, then it becomes long-lasting as roof sheeting or cladding for buildings. Where zinc really comes into its own, is in the hot-dip galvanising of steel items, wire, poles, steel structures and reinforcing steel for concrete systems. Once the hot-dip galvanised item is exposed to the atmosphere and a corrosive environment, the zinc that is metallurgically bonded to the steel starts to perform its magic. Hot-dip galvanising of steel takes place in a galvanising kettle. Once the steel is removed from the molten zinc in the kettle, it is ready either to be painted with an organic coating system to give even more corrosion protection to the steel, or it can be left unpainted and used as is and exposed to the atmosphere. When the steel is immersed in the molten zinc in the kettle and removed for cooling, the result is a metallurgically magic system that protects the underlying steel, although in fact with time the zinc is being sacrificed to protect the steel. So, when you are next out and about, take time to see if you can spot a galvanised steel structure. You will be amazed at the prevalence of galvanised steel! Knowledge is power! Sign up for our newsletter: https://www.buildinganddecor.co.za/ Subscribe to our free magazine on https://www.freemagazines.co.za/ or join other discussions on http://www.facebook.com/buildinganddecor, http://www.twitter.com/buildingdecor and https://www.linkedin.com/showcase/10172797/

<urn:uuid:f50b6e3b-e593-4ff6-b800-17a7372b54c0>

CC-MAIN-2021-25

https://www.buildinganddecor.co.za/the-magic-of-zinc-in-corrosion-control/

s3://commoncrawl/crawl-data/CC-MAIN-2021-25/segments/1623487586465.3/warc/CC-MAIN-20210612222407-20210613012407-00053.warc.gz

en

“Depression is the sign of weak faith (Iman)” or “a strong Muslim is never depressed” are refrains we have most likely all heard. In this article – the first in a series – we explore this issue and look at why it is affected by flawed thinking of both the Islamic conception of sadness and grief, as well as being out of step with modern science. But is this really the case, and is the matter really as simple as some Muslims may make it out to be? Many Muslims mistakenly believe that depression is a sign of weak Iman. The argument goes as follows: Having a strong Iman means having belief in qadr and in Allah’s mercy, and the fact that everything goes according to Allah’s plans. It also entails having hope in Allah. On the other hand, being depressed is a sign of hopelessness, losing faith in qadr and in Allah’s mercy, and therefore it is a sign of weak Iman. In other words, only those who have weak iman will ever get depressed, and no true Muslim will therefore suffer from depression. What is depression? Depression is a psychological disorder and understanding about its physical and chemical reality have advanced greatly in the last few decades. Yet some myths about it persist. Depression is a real illness with real symptoms, and it’s not a sign of weakness or something you can “snap out of” by “pulling yourself together”.’ It’s not just a persistent feeling of sadness and hopelessness; there are also physical effects of depression. It affects the very structure and function of your brain, and affects your neurotransmitters – key chemical signals that are sent to your brain that impact your mood, function and other such elements of your body. Some of the physical symptoms include feeling constantly tired, sleeping badly, having no appetite or sex drive, and complaining of various aches and pains; for women, it also disrupts menstrual cycles. Making anyone feel guilty, then, for going through such a condition is a bad idea without first understanding it well. How depression can develop There are many causes and triggers of depression. While many of these are still being studied or understood, we do know enough to be able to meaningfully say something about the physiological causes of this pernicious disease. Some triggers include: - Genetic predisposition towards depression - Traumatic and genuinely difficult life events - Certain sorts of injuries and illnesses such as hypothyroidism and head injury - Birth of a child triggering a wave of chemical reactions and bodily impacts (postpartum depression) that have only begun to be properly understood in the last 3 decades - Alcohol and drugs, with their ability to impact on the function of the body - A lonely lifestyle, which studies are increasingly linking to impacts that lead eventually to depression. As you can see, most of these causes are outside human control. Many are biological or chemical. It raises the obvious question: How can a biologically triggered illnesses be the symptom of spiritual weakness? Is depression a sign of weak iman? As hinted at above, depression is a complex disease whose roots are often hard to define. But researchers say that it is to an extent genetic – if you have a relative with clinical depression, you’re five times more at risk. And it is often triggered by a traumatic experience, such as the death of a parent or marital abuse. How can a disease that has genetic and environmental causes – things that only Allah can control – be a sign of weak faith? Psychiatrists can often completely cure depression only using antidepressants – pills that tweak with your neurotransmitters, mainly serotonin. But when you stop taking the medicines, depression comes back. That sounds like taking insulin injections for diabetes – a physical disorder. Further, plenty of non-Muslims have never had long-standing clinical depression in their life. Others who have recover from severe clinical depression through medicine and therapy – without accepting Islam. While it goes without saying that Islam gives us the tools to be spiritually content in a way that nothing else does, to say that depression – a largely physiological condition – is down to a lack of iman is a problematic assertion. An incredible story from the Qur’an The famous story of Ya’qub (AS) is an interesting one to explore in this context. Prophet Ya’qub lost his beloved son Yusuf (AS) when the latter was just a boy. Years later, he lost another son, Benyamin, in the exact same way, which not just added to his sorrow, but also triggered the old pain of losing Yusuf as well. Reflect on what Ya’qub must have felt when he said the following: وَتَوَلَّىٰ عَنْهُمْ وَقَالَ يَا أَسَفَىٰ عَلَىٰ يُوسُفَ وَابْيَضَّتْ عَيْنَاهُ مِنَ الْحُزْنِ فَهُوَ كَظِيمٌ And he turned away from them and said, ‘Oh, my sorrow over Joseph,’ and his eyes became white from grief, for he was [of that] a suppressor. [12:84] “Ya Asafa” is a lament, a heart-wringing cry for Yusuf. And we learn in this surah that Ya’qub (AS) became blind from grief! If we were to hold the assertion that depression and “going overboard” in sadness are a sign of “weak iman”, it would be hard to square with this story. How can one dare to accuse a prophet of Allah of having weak iman? Then how come he became so miserable that he lost his eyesight? His sons then told him: قَالُوا تَاللَّهِ تَفْتَأُ تَذْكُرُ يُوسُفَ حَتَّىٰ تَكُونَ حَرَضًا أَوْ تَكُونَ مِنَ الْهَالِكِينَ They said, ‘By Allah , you will not cease remembering Joseph until you become fatally ill or become of those who perish.’ [12:85] His reply is the ultimate proof of his tawakkul, his belief in Allah and the strength of his iman: قَالَ إِنَّمَا أَشْكُو بَثِّي وَحُزْنِي إِلَى اللَّهِ وَأَعْلَمُ مِنَ اللَّهِ مَا لَا تَعْلَمُونَ He said, ‘I only complain of my suffering and my grief to Allah , and I know from Allah that which you do not know. O my sons, go and find out about Joseph and his brother and despair not of relief from Allah . Indeed, no one despairs of relief from Allah except the disbelieving people.’ [12:86-87] We learn from this surah that even deep, prolonged sadness (that manifests itself in physical effects, no less!) is not contradictory to rock-solid iman in Allah. And when we combine this with an understanding of such parables from the Qur’an, it becomes abundantly clear that sadness, feeling down, etc can often be the results of very difficult circumstances, and are not a sign that a person does not have strong belief in Allah. We will continue to explore these themes in subsequent articles on our website, and look forward to bringing them to you, insha Allah! The MWA is also here to support the community in these challenging times. Please get in touch with us via email@example.com or 02 9750 6916.

<urn:uuid:42ecf646-78ff-4d90-a8a4-f29aaae9df76>

CC-MAIN-2022-40

https://mwa.org.au/latest-articles/is-depression-a-sign-of-weak-iman/

s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030335058.80/warc/CC-MAIN-20220927194248-20220927224248-00757.warc.gz

en

Singapore's record-breaking smog is so bad, birds are falling from the sky Not the best time to go to Singapore if you have lungs...Some places in Singapore will close to the public if the local air pollution index reaches 100, which is the threshold for "unhealthy". Anything above 200 is "very unhealthy", 300 is considered to be downright "hazardous". What's the latest peak measurement? 371, a new record for the city-state. Now's probably a good time to remind ourselves that air pollution kills more people than AIDS and malaria combined. Check out what Pittsburgh looked like in the 1940s before air quality regulations... The concentration of PM2.5, fine particulates that pose the greatest health risks because they can enter the bloodstream, was in a range between 232 and 291 micrograms per cubic meter, according to a 24-hour NEA reading as at 12 p.m. WHO recommends exposure to concentrations of no more than 25. A lot of these forest fires are started by palm oil planters who illegally clear virgin forest in neighboring Indonesia, so not only do they destroy large portions of very fertile ecosystems, releasing carbon into the atmosphere, killing animals and plants and destroying habitats, but they also cause a lot of air pollution. No wonder the palm oil industry has been scrutinized this much. Even birds are apparently falling out of the sky because of the intense smog: Birds are falling out of the sky in Singapore's Punggol area due to the smog Expecting to see me casualty reports pic.twitter.com/XlnKBzt8KB— Zap-It Zeph (@Zeph_Ng) June 20, 2013 There are some photos and a cool graph from Reuters here.

<urn:uuid:b903fe9b-e81f-44eb-923f-088bf0c985d2>

CC-MAIN-2014-15

http://www.treehugger.com/environmental-policy/singapore-smog-breaks-records-indonesian-forest-fires-partly-blame.html

s3://commoncrawl/crawl-data/CC-MAIN-2014-15/segments/1398223210034.18/warc/CC-MAIN-20140423032010-00278-ip-10-147-4-33.ec2.internal.warc.gz

en

Whistleblowing: A Western and Shari’ah Perspective Keywords:Whistleblower protection, hisbah, public interest, Public Interest Disclosure Act 1998 The concept of whistleblowing law in Islam is unique and differs from the West as it derives from the elements of Tawhid and Shari’ah. The concept is essentially dynamic and relevant since it was initially introduced during the Islamic ruling era until the present time. The practice of whistleblowing in Islam maintains the public interest (maslahah ‘ammah) which aims in fulfilling the five objectives of Maqasid Shari’ah. On the other hand, the western whistleblowing law was developed in response to tragedies in assuring good governance and protecting the public interest, in which the ideas of good and bad are determined by social norms and not based on the scriptures. In the present time, notably, the role of whistleblower is significant to response to corruption as a global issue plaguing many nations, which causes substantial destruction to social, economic and political aspect. In this regard, the purpose of this paper is to explore and compare the concept and scope of disclosure of whistleblowing law from Shari’ah perspective and its western counterpart and how its principled conviction, upholding public interest disclosure could deal with the current phenomenon plaguing many nations, corruption. With that, the methodology employed in this paper reflected the descriptive, analytic, and prescriptive approaches by analyzing the existing laws, decided cases and literature pertaining to the conceptual and the legal frameworks of whistleblowing under the Western and Islamic jurisprudences. How to Cite - Consent to publish: The Author(s) undertakes that the article named above is original and consents that the IIUM Press publishes it. - Previous publication: The Author(s) guarantees that the article named above has not been published before in any form, that it is not concurrently submitted to another publication, and that it does not infringe anyone’s copyright. The Author(s) holds the IIUM Press and Editors of IIUM Law Journal harmless against all copyright claims. - Transfer of copyright: The Author(s) hereby transfers the copyright of the article to the IIUM Press, which shall have the exclusive and unlimited right to publish the article in any form, including on electronic media. The Journal in turn grants the Author(s) the right to reproduce the article for educational and scientific purposes, provided the written consent of the Publisher is obtained.

<urn:uuid:657936e3-fbd5-498b-b4e2-a117021992ac>

CC-MAIN-2022-27

https://journals.iium.edu.my/iiumlj/index.php/iiumlj/article/view/362

s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656103037649.11/warc/CC-MAIN-20220626071255-20220626101255-00546.warc.gz

en

Easman - what does Easman surname mean? This most interesting surname is of Anglo-Saxon origin, and is a topographical name for `a dweller in the brushwood`, derived from the Olde English pre 7th century elements `haess`, brushwood, and `mann`, man; hence `man from the brushwood`. The surname may also have originated from the medieval given name `Hay`, from the Olde English nickname `Heah`, meaning tall, with `mann`, which in this case means `servant of`, or `Heah`s man`. The Olde English `haes`, is also found in the placenames Hayes (Kent and Middlesex), Hays (Sussex), Heaseland, and Heasewood Farm (Sussex). Topographical surnames were among the earliest created, since both natural and man-made features in the landscape provided easily recognisable distinguishing names in the small communities of the Middle Ages. Variants of the surname in the modern idiom include Heaseman, Hayesman, Easman and Atheis. Hayesman and Easeman are both found in Kent. Hugh de la Heise is recorded in 1197, in the Eynsham Cartulary (Oxford). William son of Henery and Ann Heasman, was christened on April 20th, 1698 at St. Paul`s, Convent Garden, Westminster, London. The first recorded spelling of the family name is shown to be that of Simon le Heysman, which was dated 1275, in the `Hundred Rolls of Norfolk`, during the reign of King Edward 1, known as `The Hammer of the Scots`, 1272 - 1307. Surnames became necessary when governments introduced personal taxation. In England this was known as Poll Tax. Throughout the centuries, surnames in every country have continued to `develop` often leading to astonishing variants of the original spelling. Get the Easman surname meaning widget for your website! Select and copy the text below in your website's code.

<urn:uuid:5bcb57c8-eb4e-46e3-a358-348c1a3938d8>

CC-MAIN-2016-18

http://mysurna.me/surname.php?s=Easman

s3://commoncrawl/crawl-data/CC-MAIN-2016-18/segments/1461860111809.10/warc/CC-MAIN-20160428161511-00218-ip-10-239-7-51.ec2.internal.warc.gz

en

Are you a windows user and own a laptop or notebook? Yes? Then you must have often encountered the low battery sign and notification that pops up when battery levels are critically low after a rough and tiring day at work or school. So there are a set of 2 notifications that appear simultaneously. The first one usually appears when the battery is at 10% and a yellow exclamation mark also appears giving the battery warning on the taskbar. Sounds familiar? The second warning appears at 5%. This is the serious one and means you should immediately plug in a charger or save your work progress so that it’s not lost if the computer shuts down. At this point, you will see a red cross on the battery sign on the taskbar. But did you know you could change the low battery percentage on your windows laptop easily? It will make life so much easier for you. Increasing the low battery percentage will give you a safe time window to properly save your work and shut down all applications. Here’s how you can do it: How to change low battery warning percentage? The same steps can be done on Windows 7, 8 and 8.1 - Click Start -> Control Panel -> Power Options - Click Change Plan Settings - Change Advanced Power Settings - Click Battery menu - Under Low Battery Level, change the low battery warning which is for showing the first warning notification (I set it for 20%) - Under Critical Battery Level, change the value. This is for showing the second warning notification. (I set it for 15%, enough time for me to save the work that I am doing and close all applications before shutting it down properly or get a recharge to continue working.

<urn:uuid:e5354f9d-ea61-41e7-b019-2705ddf911c1>

CC-MAIN-2024-10

https://www.latesttechblogs.com/increasing-low-battery-percentage-windows-os-laptop/

s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474573.20/warc/CC-MAIN-20240225003942-20240225033942-00377.warc.gz

en

If you feel that your skin is dull and dry then it says something about the state of what we are eating, because the state of our skin reflects on what we are eating. To help us achieve healthier, younger-looking skin we need to eat food rich in antioxidant, vitamin C and E, and essential fatty acids. “The skin is the largest body part of the body and one of the most vital ones. Aside from using skincare products, you can take better care of your skin by eating food that are beneficial for the skin such as salmon, berries, and green tea. In addition to eating right, healthy skin can be achieved through regular exercise and adequate sleep,” says MediCard president and CEO Dr. Nicky Montoya. Here are some of the best food for glowing, healthy skin: Green tea. “Green tea has numerous health benefits, especially for the skin. According to studies, drinking green tea also helps prevent skin cancer. We suggest drinking at least one cup of green tea daily to efficiently reap its benefits,” Dr. Montoya says. Drinking green tea also helps lessen facial redness. In addition to antioxidants, enzymes and amino acids, green tea also has anti-inflammatory properties that may help delay skin aging. It also flushes out toxins from the body, giving you clear and supple skin. Also, green tea improves blood circulation, which is essential for healthy skin. Sunflower seeds. Rich in vitamin E and beta carotene, sunflower seeds keep the skin young and healthy. It protects the skin from free radical damage, helps diminish appearance of scars, combats UV rays, and delays onset of wrinkles. Sunflowers are packed with essential fatty acids that increase production of collagen and elastin, essential components for a smooth and soft skin. Salmon. This superfood is rich in protein and omega-3 fatty acids which help the skin maintain its elasticity. Eating salmon also increases the skin’s ability to protect itself against the sun’s damaging rays. It also reduces inflammation and helps prevent skin cancer. Dr. Montoya recommends eating salmon three times a week for radiant skin. Berries. Berries not only help keep you healthy, but they do wonders for the skin too. They are packed with antioxidants and anti-inflammatory properties, vitamins, minerals, and flavonoids. “Opt for berries rich in colors like red, blue and black as these contain the highest level of antioxidants, protects your skin from aging and keeps your skin supple and hydrated,” says Dr. Montoya. Greek yogurt. Full of essential nutrients and vitamins, Greek yogurt is not only good for the digestive tract but for the skin as well. It is an anti-aging food as protein from dairy is known to help skin become firmer. Eating Greek yogurt also nurtures vital cells, breaks down harmful cells and bacteria in the body, thus preventing wrinkles and giving you flawless, glowing skin. Furthermore, yogurt also increases good bacteria in the body, which help fight acne-causing bacteria. Learn more on how to take care of your skin. MediCard has numerous free-standing clinics located in key cities nationwide that offer consultations, tests and vaccinations. Visit a MediCard clinic near you or check out www.medicardphils.com for more information. 397 total views, 2 views today

<urn:uuid:5246a1cd-aa66-403b-951c-93a563972330>

CC-MAIN-2018-26

http://www.thebaginvestigator.com/eating-the-right-way-to-a-healthy-looking-skin/

s3://commoncrawl/crawl-data/CC-MAIN-2018-26/segments/1529267863206.9/warc/CC-MAIN-20180619212507-20180619232507-00308.warc.gz

en

Credit has been around America since the 1800’s, and it won’t be going away anytime soon. Credit is a measure of a person’s ability to repay a certain debt for a good or service that was provided to them before full payment. Credit is important because almost every financial decision you make will involve your credit. If you need to rent an apartment, chances are you will have your credit checked. Looking to get a car loan? A lender will need to still check your credit. Why is Credit Important? Credit is important because of your access to certain goods such as an apartment rental or a car loan will be dependant on your ability to repay, which is measured by your credit. Almost anytime money is loaned out or a service is provided before payment, your credit will become an important factor for a business or lender to consider. Credit is important because it gives a business or landlord the ability to tell how “trustworthy” you are of receiving a certain good or service prior to payment being made. This applies to credit cards, loans, apartment rentals, cell phone plans, and much more. What is Credit? Your credit is composed of two separate yet important pieces of information: Your credit report and your credit score. A credit report is a history log of all your credit-related activities, past and current debts, addresses, aliases, and much more. Credit reports are multiple pages in length and will have data from the last 10 years present. This data is collected by the three major credit bureaus. A credit score is a three-digit number rating from 300 to 850, from lowest score to the highest possible credit score respectively. FICO, the largest credit scoring model, takes the information directly from your credit report, plugs it into a “proprietary algorithm,” and produces a three digit number that summarizes your credit report. Essentially, a credit score is a quick way for a lender to evaluate your “credit worthiness”. The more negative entries on your credit report (such as late or missed payments), the lower your credit score will be. The lower the credit score you have, the less likely you are to qualify for a line of credit or loan. Consumers should know the importance of credit and the role it plays in today’s society. Understanding why credit is important can help you qualify for the loan or credit card you need. If you have less than perfect credit and don’t know where to go, CrediReady can help. Our trusted network of credit repair experts can boost your score and help you qualify for the credit you need. Take a moment to fill out our free no-obligation credit repair inquiry form and start fixing your credit today!

<urn:uuid:b614e48e-a742-4ff7-a5c0-683bd092260e>

CC-MAIN-2019-43

https://crediready.com/blog/why-is-credit-important/

s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570987826436.88/warc/CC-MAIN-20191022232751-20191023020251-00156.warc.gz

en

The line runs through the deserted town, splitting trees and scarring buildings. At first glance, the photographs of it resemble those of New York City artist Eve Mosher's "High Water Line," which marked how much of the city could be flooded due to climate change. But these images don't warn against a future disaster; they are evidence of one that's already happened. Spanish photographer Palíndromo Mészáros took the eerie images in his series "The Line" in western Hungary, where a retaining wall around a reservoir holding an aluminum company's toxic waste burst in October 2010, sending a million cubic meters of deadly sludge into surrounding towns and countryside. "The Line," which is currently being exhibited in the Festival des Promenades Photographiques in Vendôme, France (h/t designboom), documents trees, buildings, roads, and fields stained rust-red by the heavy-metal-laden waste spill, which reached two meters high. The environmental disaster killed nine people, forced the abandonment of numerous villages, and did tens of millions of dollars in damage. The head of the company whose containment reservoir burst was arrested for criminal negligence shortly thereafter; as of the disaster's one-year anniversary, 15 former or present employees of the aluminum firm were suspected of negligence in connection with the spill. Mészáros describes his photographs as taken six months after the incident, "when ... silence takes the place of the headlines and just The Line is left."

<urn:uuid:8199fd57-28dc-4a09-910a-83f625015ead>

CC-MAIN-2020-16

https://www.treehugger.com/culture/haunting-photos-hungarian-town-toxic-sludge-spill-painted-red-2010.html

s3://commoncrawl/crawl-data/CC-MAIN-2020-16/segments/1585371609067.62/warc/CC-MAIN-20200405181743-20200405212243-00414.warc.gz

en

How to Use a Bidet: The Wonders of This Efficient Personal Hygiene Tool Bidets are an essential household commodity in certain parts of the world. Estimates show that bidets are used in about 80 percent of bathrooms in Europe, South America, the Middle East, and Japan. But how does a bidet work, and why do many people consider it crucial for their personal hygiene? The Hygiene Miracle That Is the Bidet The bidet originated in France in the early 1700s. The word “bidet” comes from the French stout pony by the same name. Sitting astride a bidet is similar to the position you would use when riding a horse. The bidet’s primary purpose is to provide and promote cleanliness. It allows you to wash yourself thoroughly without contaminating your hands. It uses water and is gentle on your skin. A bidet can also pay for itself in the long run with the money you save on toilet paper. Plus, using one is good for the environment, as it eliminates the need for toilet paper and reduces waste. The first bidets were actually a bowl full of water, from which you could splash water using your hands. It received a transformation in 1750 when a hand pump was added so that water could be sprayed upward. This eliminated the need to use your hands when washing. Unfortunately, the vast majority of Americans have yet to adopt this form of personal cleansing. Theories Why Americans Don’t Use Bidets as Much Many Americans still choose to use toilet paper to wipe off urine or fecal matter, and associate the bidet with “immoral” and “unsanitary” practices. Here are some possible reasons why - In the 18th century, the British had a disdain for French aristocracy, which were some of the first users of bidets. When the early colonists came to America, they may have instilled the sentiment among the locals. - During World War II, bidets were commonly used in French brothels (and probably nowhere else). This may have given US soldiers the idea that bidets were “dirty” or “immoral.” - When first introduced to the public, bidets required the use of your hand to cleanse your genitals directly. Americans have traditionally been conservative in this regard and probably preferred toilet paper to “shield” their hands from waste matter. Why Toilet Paper Is a Waste Using toilet paper may help prevent soiling your hands with urine and fecal matter, but it increases your risk of skin irritations like dermatitis as it allows germs to spread to your genital area. Dry toilet paper may aggravate bowel conditions like hemorrhoids, constipation, or even diarrhea, and lead to itching, pain, and, in rare cases, bleeding. Toilet paper with dyes and perfumes is even worse, as it exposes you to harsh and potentially toxic chemicals that can further irritate your skin. In addition to the unnecessary discomfort, here are a few more reasons why you should give toilet paper the boot: - It promotes environmental degradation – Americans use up to 8 million tons of toilet paper every year, and to cater to this demand, forests are cut down - Its production leads to wasted resources – Aside from the pulped trees, toilet paper production uses over 400 billion gallons of water on an annual basis. - It increases your exposure to toxic chemicals – Manufacturers bleach toilet paper using chlorine and its derivatives, such as chlorine dioxide, leading to the creation of cancer-causing chemicals, like dioxins, trihalomethane, and furans. - It pollutes the environment – Various estimates state that the amount of toilet paper tossed into US dumps and landfills can reach up to 35 to 40 percent of total landfill mass. Moreover, chlorine byproducts can transfer to the air, waterways, soil, and eventually, the food chain. Before the invention of toilet paper, people around the world used common, practical items found in the environment to clean up. Some environmentally conscious families use an item called “family cloths” in lieu of toilet paper. These “reusable wipes,” which include soft cloths, flannel, or even an old t-shirt, eliminate the need for toilet paper and work better when paired with a bidet. How to Use a Bidet Bidets today are smaller and more compact, each built with features, such as hand pumps, temperature controls, air dryers, and even motion-activated lids. Some models can even be installed without a plumber. Some view them as an upgrade for the toilet and even a high-luxury item. Even though it sounds complicated, learning how to use a bidet is quite straightforward. Unless you’re using the European-style or porcelain bidet – which requires you to transfer to a different unit – other bidets won’t require you to move from the toilet. Examples of these are the bidet seat or bidet toilet (bidets with wands under the toilet seat), which are mounted or attached to the toilet. Another model is the handheld bidet, which is similar to a shower wand and allows you to control the direction of the water. Of course, when you use a bidet, you will still need to dry yourself. I advise going without toilet paper and using a towel or a reusable cloth. Bidets Have Health Benefits, Too For people suffering from bowel conditions, such as Crohn’s disease, ulcerative colitis, constipation, hemorrhoids, and diarrhea, a bidet can potentially offer some relief. Toilet paper, on the other hand, can irritate your skin and cause more unnecessary problems. There is also a theory that using a bidet may help prevent urinary tract infections due to its ability to cleanse thoroughly. That said, the bidet is very popular among the elderly as using one allows them to quickly practice good hygiene without excessive assistance. The same is true for people suffering from temporary injuries, permanent handicaps, or people who’ve recently undergone surgery around their genital area. Women can take advantage of the bidet’s gentle nature during their monthly period or after childbirth. A Quality Bidet Should Have the Following Features You don’t need to get a luxury bidet just to experience its superior cleansing ability. There are products below $100 that are just as efficient. Here are some questions you should ask yourself when looking for a bidet: - Does it use external power? Some manufacturers, including those who produce “toilet” bidets, require electricity to operate. - Is it within your budget? Some “toilet” seat bidets cost over $500, and a separate European-style bidet can cost even more. - Is it easy to operate? Consider this because if it’s hard to use, you or any member of your household might not use it at all. - Is the unit easy to clean? Not all bidets have a self-cleaning function. Look for one that has this feature so you can save time and effort. - What are its features? If you’re only after the cleansing benefit of the bidet, you certainly don’t need one with a dryer or heater. Instead, look for a model that has features you can use, like a double nozzle that can support dual cleansing. - Does it rust? Review the product’s materials. Not all are durable and come with rust-resistant components. - Is the unit easily removed from your toilet? This one is a bonus. Separate bidets, once installed, are pretty much permanent and cannot be easily removed. - Does it come with a warranty? Not all manufacturers provide a comprehensive warranty and guarantee. Review the fine print. Fortunately, you don’t have to look far. Here’s a product I recommend and personally use… Introducing the Mercola Soft Spray Bidet The Mercola Soft Spray Bidet is built to provide thorough cleanliness and immediate refreshment, and help you avoid using toilet paper to clean yourself after urinating or defecating. You won’t need any help to learn how to use it. It’s built with an adjustable nozzle that can wash your genital areas with ease. The entire installation process is less than an hour but basically, all you need to do is attach it to your toilet seat. Plus, this product is made with durable ABS resin material that won’t rust. The Mercola Soft Spray Bidet is reasonably priced and won’t put a big dent in your wallet. It is backed by the manufacturer’s 1-year warranty and is covered by a 30-day Satisfaction Guarantee. All in all, if you’re really serious about your bathroom hygiene, drop the toilet paper and switch to the cleaner, more refreshing, and more hygienic choice. Whichever kind of bidet you pick – a high-end or economic model – you’ll definitely do your health and the environment a great favor. We’re sorry for any inconvenience, but the Soft Spray Bidet has been discontinued. However, I’m proud to offer my Stop-N-Go Stool as a solution to help you maintain good bowel health. The Stop-N-Go Stool allows for a natural squatting position on your existing toilet, which aids in elimination from the bowels and facilitates a healthy posture. This inexpensive solution to help with bowel and digestive issues is available in two types to complement your bathroom décor: bamboo and BPA-free white plastic. Discover More About the Stop-N-Go Stool

<urn:uuid:70f3484a-ace0-4f30-a73e-54e7319976d6>

CC-MAIN-2016-44

http://products.mercola.com/bidet-use/

s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988718987.23/warc/CC-MAIN-20161020183838-00111-ip-10-171-6-4.ec2.internal.warc.gz

en

High irradiances of low-level laser therapy (LLLT) should not be used over melanomas. Researchers writing in the open access journal BMC Cancer studied the pain relieving, anti-inflammatory 'cold laser', finding that it caused increased tumour growth in a mouse model of skin cancer. Jan M. Bjordal from Bergen University College, Norway worked with a team of Brazilian researchers to carry out the in vitro and in vivo experiments. He said, "LLLT has gained increasing popularity as a treatment for soft tissue injuries and joint conditions. However, there is a shortage of evidence, especially in vivo evidence, about the effects of LLLT in malignant conditions such as melanoma". Bjordal and his colleagues applied LLLT to cancer cultures and to mice injected with melanoma cells. Although the treatment did not cause any significant changes in the cell cultures, direct irradiation of the tumor with high-dose LLLT caused a significant increase in tumor mass volume and considerable histological alterations, indicating a worsening of the cancer, in the mice. The researchers write, "A high irradiance (2.5W/cm2) combined with high dose of 1050 J/cm2, can stimulate melanoma tumor growth with distinct histological features in vivo". "It is important that this contraindication is implemented into clinical practice so that LLLT can remain a safe treatment", says Bjordal. LLLT was pioneered in the 1970s, when it was discovered that light from low-intensity lasers causes cells to proliferate more rapidly. It is marketed as a treatment for hair-loss, pain management, sports medicine and skin care - among many other things. Home-treatment sets are available online for unsupervised use. Notes to Editors: 1. The effect of low-level laser irradiation (Ga-Al-AsP - 660nm) on in vitro and in vivo melanoma Lucio Frigo, Juliana SS Luppi, Giovani M Favero, Durvanei A Maria, Socrates C Penna, Jan M Bjordal, Rene J Bensadoun and Rodrigo Alvaro Lopes Martins BMC Cancer (in press) During embargo, article available here: http://www.biomedcentral.com/imedia/1951910396243250_article.pdf?random=389799 After the embargo, article available at journal website: http://www.biomedcentral.com/bmccancer/ Please name the journal in any story you write. If you are writing for the web, please link to the article. All articles are available free of charge, according to BioMed Central's open access policy. Article citation and URL available on request at firstname.lastname@example.org on the day of publication 2. BMC Cancer is an open access journal publishing original peer-reviewed research articles in all aspects of cancer research, including the pathophysiology, prevention, diagnosis and treatment of cancers. The journal welcomes submissions concerning molecular and cellular biology, genetics, epidemiology, and clinical trials. BMC Cancer (ISSN 1471-2407) is indexed/tracked/covered by PubMed, MEDLINE, CAS, EMBASE, Scopus, Current Contents, Thomson Reuters (ISI) and Google Scholar. 3. BioMed Central (http://www.biomedcentral.com/) is an STM (Science, Technology and Medicine) publisher which has pioneered the open access publishing model. All peer-reviewed research articles published by BioMed Central are made immediately and freely accessible online, and are licensed to allow redistribution and reuse. BioMed Central is part of Springer Science+Business Media, a leading global publisher in the STM sector. AAAS and EurekAlert! are not responsible for the accuracy of news releases posted to EurekAlert! by contributing institutions or for the use of any information through the EurekAlert! system.

<urn:uuid:ca69e39d-bda8-482a-8d0a-63d00f8fbc7f>

CC-MAIN-2014-52

http://www.eurekalert.org/pub_releases/2009-11/bc-ltc111809.php

s3://commoncrawl/crawl-data/CC-MAIN-2014-52/segments/1418802767453.104/warc/CC-MAIN-20141217075247-00134-ip-10-231-17-201.ec2.internal.warc.gz

en

The korban Pesah is unique among the sacrifices in a number of ways, some of which are discussed on our daf. For example, our Gemara discusses the case of a korban Pesah that was not sacrificed at the appropriate time – the afternoon of the 14th of Nisan – but rather on some other day during the year. In any other situation, the sacrifice would simply be invalid. There is, however, a special rule with regard to the korban Pesah: it can be changed from a korban Pesah and sacrificed as a Shelamim. There are a series of discussions in the Gemara that revolve around the question of how the Pesah can be changed to a Shelamim – if the very fact that the Pesah is not being carried out properly switches it to a Shelamim, of if it is necessary to consciously substitute one intention for the other. The possibility of changing the korban to a Shelamim may be connected with the fact that, unlike most other sacrifices, the Shelamim is almost never brought because one is commanded to do so; rather it is a korban that is given freely as a toda – thanksgiving offering – or a nedava – a voluntary offering (see 7:11-12, 16). There is a difference of opinion among the rishonim regarding the meaning of the name shelamim. Rashi (Vayikra 3:1) cites two opinions: a. that this korban spreads peace in the world; b. that they bring peace to the altar, to the priests, and to the owners (i.e. that all three parties to the sacrifice benefit from the eating of the sacrifice). Another rule unique to the korban Pesah is the need to participate in it as a formal member of a group; one must “sign up” before the holiday in order to join (see Shmot 12:4). When the korban itself is eaten – that is to say, during the Pesah as it was practiced during Temple times – a person was not allowed to leave his or her group and join another, unless he/she joined another group before the sacrifice was slaughtered.

<urn:uuid:9aba6f86-5f81-46de-9f49-23cd95a14da1>

CC-MAIN-2020-45

https://steinsaltz.org/daf/pesahim60/

s3://commoncrawl/crawl-data/CC-MAIN-2020-45/segments/1603107893402.83/warc/CC-MAIN-20201027052750-20201027082750-00560.warc.gz

en

Skip to 0 minutes and 14 seconds Although we have a clear definition of energy transition policies, the more difficult question to answer is how to define the optimal contents of such a policy. Any policy measure affecting the decisions which energy consumers and producers make may result in an energy transition. But not every energy transition contributes to welfare. In the previous sessions, we have learned that government policies intervening in the decisions of economic agents may only have a welfare-improving effect if the market fails to give the correct signals. This implies that the first and fundamental issue to be analysed before implementing any energy transition policy is the existence of market failures. Skip to 1 minute and 3 seconds Without significant evidence of the occurrence of market failures, policy measures face the risk of creating more damage for welfare than benefits. If a market failure exists, the next step is to think of effective and efficient measures. By “effective,” we mean that a measure must have an impact on the decisions of consumers and producers. Defining “effective” measures is much more complex than may be expected. Earlier in this course, we have seen that the price elasticity of demand determines how effective any price measure can be. If consumers are not sensitive to the price of energy, that means the price elasticity is low. Policy measures raising the price of energy do not have an effect on actual behaviour. Skip to 1 minute and 57 seconds The effectiveness of policy measures also depends on indirect effects, such as the rebound effect and the waterbed effect, which will be discussed later on. Policy measures not only need to be effective. They should also be efficient. By “efficiency,” we mean that the cost of implementing a measure should be lower than the benefits realised by this measure. The costs of a measure include both the transaction costs for governments and economic agents and the costs of change in the decisions made by these agents. Take, for instance, a subsidy for consumers to implement energy-saving measures. The transaction costs of these measures refer to all the costs of designing the subsidy, informing the public, and administrative costs for consumers. Skip to 2 minutes and 50 seconds On top of these costs, the subsidy creates additional costs since it induces consumers to take energy-saving measures which will be too costly to them without the subsidy. These costs should be weighed against the benefit of having a lower energy consumption by consumers. If the policy objective of this measure is to reduce the environmental burden of energy consumption, this benefit can be expressed in monetary values by using so-called shadow prices for the environmental effects, such as a reduction in the emissions of NOx or CO2. Economic criteria to develop optimal policies How can we define the optimal contents of energy transition policies? Again you need the concept of market failures to determine whether policy measures are welfare improving. In this video also the economic concepts of effectiveness and efficiency are discussed, which will assist you in defining the optimal energy transition policy. © University of Groningen

<urn:uuid:5f67390a-b552-42bf-83a5-0c7e1f04b194>

CC-MAIN-2020-40

https://www.futurelearn.com/courses/energy-transition/0/steps/10222

s3://commoncrawl/crawl-data/CC-MAIN-2020-40/segments/1600400202007.15/warc/CC-MAIN-20200921175057-20200921205057-00574.warc.gz

en

Evolutionary relationships of the old world fruit bats (Chiroptera, Pteropodidae): Another star phylogeny? © Almeida et al; licensee BioMed Central Ltd. 2011 Received: 19 May 2011 Accepted: 30 September 2011 Published: 30 September 2011 The family Pteropodidae comprises bats commonly known as megabats or Old World fruit bats. Molecular phylogenetic studies of pteropodids have provided considerable insight into intrafamilial relationships, but these studies have included only a fraction of the extant diversity (a maximum of 26 out of the 46 currently recognized genera) and have failed to resolve deep relationships among internal clades. Here we readdress the systematics of pteropodids by applying a strategy to try to resolve ancient relationships within Pteropodidae, while providing further insight into subgroup membership, by 1) increasing the taxonomic sample to 42 genera; 2) increasing the number of characters (to >8,000 bp) and nuclear genomic representation; 3) minimizing missing data; 4) controlling for sequence bias; and 5) using appropriate data partitioning and models of sequence evolution. Our analyses recovered six principal clades and one additional independent lineage (consisting of a single genus) within Pteropodidae. Reciprocal monophyly of these groups was highly supported and generally congruent among the different methods and datasets used. Likewise, most relationships within these principal clades were well resolved and statistically supported. Relationships among the 7 principal groups, however, were poorly supported in all analyses. This result could not be explained by any detectable systematic bias in the data or incongruence among loci. The SOWH test confirmed that basal branches' lengths were not different from zero, which points to closely-spaced cladogenesis as the most likely explanation for the poor resolution of the deep pteropodid relationships. Simulations suggest that an increase in the amount of sequence data is likely to solve this problem. The phylogenetic hypothesis generated here provides a robust framework for a revised cladistic classification of Pteropodidae into subfamilies and tribes and will greatly contribute to the understanding of character evolution and biogeography of pteropodids. The inability of our data to resolve the deepest relationships of the major pteropodid lineages suggests an explosive diversification soon after origin of the crown pteropodids. Several characteristics of pteropodids are consistent with this conclusion, including high species diversity, great morphological diversity, and presence of key innovations in relation to their sister group. The family Pteropodidae comprises 186 currently recognized species commonly known as Old World fruit bats or megabats, and as such constitutes one of the largest families of the order Chiroptera (Mammalia) . The name "megabats" is an abbreviation for Megachiroptera, and was coined in recognition of the large body size of some pteropodid species, which can reach over 1 kilogram in weight and have a wingspan of over 1.5 meters . Pteropodids are almost exclusively phytophagous, feeding mostly on fruits, although some species are specialized for nectar feeding. As a group, pteropodids are primary dispersers of pollen and seeds in the Old World tropics . They have a widespread distribution in Africa, the tropics of Asia, and Australia as well as occurring on many islands from the Indian Ocean to the Western Pacific Ocean, where some species are highly endangered and in risk of extinction [1, 3]. Unlike other bat families, members of Pteropodidae do not use laryngeal echolocation, instead relying primarily on vision and olfaction to avoid obstacles and locate food sources. Phylogenetic relationships of Pteropodidae have been the source of considerable debate. In the 1990s a controversy developed over whether or not Chiroptera was monophyletic or instead composed of two different evolutionary lineages (Megachiroptera and Microchiroptera) that achieved powered flight independently from origins within different parts of the mammalian family tree (see , and references cited therein). Comprehensive analyses of morphological and molecular data refuted this hypothesis and confirmed bat monophyly [5–8] but analyses of DNA sequence data revealed a surprise - some "microbats" were in fact more closely related to Pteropodidae than to the remaining Microchiroptera families [9, 10]. This led to a revision of higher-level bat taxonomy that saw Megachiroptera and Microchiroptera discarded and two new groups recognized, Yinpterochiroptera (for Pteropodidae and its close relatives, echolocating bats of the superfamily Rhinolophoidea) and Yangochiroptera (for the remaining echolocating bats) . Bergmans (1997) classification of Family Pteropodidae Pteropus, Acerodon, Pteralopex, Styloctenium, Neopteryx Rousettus, Eonycteris, Eidolon Epomophorus, Micropteropus, Hypsignathus, Epomops, Nanonycteris Myonycteris, Lissonycteris, Megaloglossus Cynopterus, Ptenochirus, Megaerops, Dyacopterus, Balionycteris, Chironax, Thoopterus, Sphaerias, Aethalops, Penthetor, Latidens, Alionycteris, Otopteropus, Haplonycteris Lack of resolution along the backbone of a phylogenetic tree can result from sampling bias (or stochastic bias), systematic bias, or a combination of both . Sampling bias occurs when a data set does not contain enough information to allow full resolution of taxon relationships, either due to inadequate taxonomic sampling or lack of phylogenetic signal in the sampled loci [23–26]. Both factors could have influenced previous phylogenetic analyses of megabats, which were based mostly on mitochondrial loci that may be saturated with substitutions at the tribal/subfamily level . Incompleteness of taxonomic sampling, which may contribute to poor phylogenetic results particularly at higher taxonomic levels, clearly could have played a role in pteropodid analyses, as only 26 out of the 46 pteropodid genera currently recognized (57%) were represented in the largest, previous molecular studies. Another type of bias, known as systematic bias, is caused by non-phylogenetic noise in the sequences such as differences in base composition (causing unrelated taxa with similar base composition to erroneously cluster together) and/or substitution rate (causing long-branch attraction) (e.g. [28, 29]). Because these types of variation violate the assumptions of most reconstruction methods, they are also potential causes for inaccuracy and poor resolution in phylogenetic trees [22, 30, 31]. Moreover, sampling bias and systematic bias may synergistically interact, compounding their effects on the outcome of phylogenetic inference . None of these potential sources of systematic bias have been addressed in previous phylogenetic studies on megabats. An alternative explanation for low resolution of relationships on a phylogenetic tree is that, instead of being a consequence of bias or methodological artifacts, it reflects the true evolutionary history of the group. Rapid diversification of a clade over a short period of time may cause such a phylogenetic pattern, as has been claimed for the origin of the mammalian [32, 33] and avian orders [34, 35]. If diversification took place quickly and long time ago, there may be little phylogenetic signal because slowly-evolving genes may not have accrued many changes (due to the short time span) while faster-evolving genes may have initially picked up changes, but these were then overwritten by subsequent sequence evolution. Also, short time interval between cladogenetic events may hinder complete lineage sorting, confounding relationships within that time frame . Such trees, with very short internal branches connected to the root, are also known as star phylogenies (e.g. [37, 38]). Here we present a comprehensive study of the phylogenetic relationships among megabat genera based on a large DNA-sequence dataset. Our focus was on resolving tribal membership and relationships among subfamilies. We attempted to address potential sources of bias in the phylogenetic reconstruction of this group, including low number of informative characters, missing data, poor taxonomic sampling, and sequence bias. This was accomplished by obtaining new sequences for four nuclear loci, thus significantly increasing taxonomic sampling, and by filling in gaps in sequence data from mitochondrial loci that had been previously sequenced in megabats by collecting new data from the additional taxa available to us. The inclusion of additional taxa not only adds important information on variation but can also help break up long branches, thus improving phylogenetic accuracy and helping resolve clades that may remain ambiguous with smaller taxon samples [23, 39–41]. The simultaneous analysis of several genes has the obvious advantage of increasing the number of phylogenetically informative characters and balancing stochastic errors [42–48], but can also reduce the effects of systematic bias that may affect individual gene partitions, especially when locus-specific substitution models are employed in a probabilistic framework [31, 49–51]. To minimize the effects of various potential sources of error in our analyses, detailed phylogenetic analyses were conducted using tests for systematic sequence bias, different reconstruction methods, optimal data partitioning in maximum likelihood analyses, and topology comparisons based on data simulations. Our results defined 7 well-supported groups for a new, cladistic classification of pteropodids, in several points different from the last formal classification by Bergmans . The most basal relationships within Pteropodidae, however, could not be fully resolved despite the increase in the amount of data and the use of careful phylogenetic analyses. This result could not be explained by any source of measurable sequence bias, pointing to a biological cause for the observed pattern. Sequence data statistics Sequence statistics and maximum parsimony scores per gene and in the combined dataset 1 Despite differences among genes and codon positions, we found relative homogeneity in GC content among pteropodid taxa (Additional file 2). The χ2 test failed to detect significant differences in either entire genes or individual codon positions. We also checked for similarities and differences in GC content among the principal clades of Pteropodidae that could bias the resolution of the relationships among them (Additional file 2). Except for the 3rd codon position of the Cytb locus, GC content showed little among clade variation. Rates of nucleotide substitution were also relatively homogeneous, with only 7 pairwise taxa comparisons showing significant differences. All these comparisons involved an outgroup taxon compared with an ingroup taxon; no significant rate differences could be detected within the ingroup (Pteropodidae). Borderline p values were found in some comparisons involving Balionycteris maculata, but not in other pairwise comparisons. This result suggests the long-branch attraction is not likely to have a major effect in our phylogenetic results. Phylogenetic analyses of individual genes MP and ML analyses were run for each locus separately (ML trees are available in the Additional file 3). Most topological differences among resulting trees were seen in basal relationships, but none was supported by > 60% bootstrap, which suggests absence of incongruent phylogenetic signal among genes . In a parsimony framework, the pairwise ILD tests did not detect significant pairwise incongruence. The same result was obtained with the likelihood based hierarchical test . Maximum parsimony analyses of the combined dataset ML analyses using optimal partition schemes Partition schemes used in ML analyses of combined dataset 1 RAG1, RAG2, vWF, each codon position for each coding The principal Pteropodidae clades were well defined and supported by all the different phylogenetic analyses we conducted. However, there was considerable disagreement among analyses concerning relationships among these clades. To decide whether one particular arrangement could be justifiably preferred to others, we carried out a series of topology comparison tests. On a MP framework, we found the optimal ML tree (tree length = 15670) to be significantly worse than the MP tree (tree length = 15636) by both the KH (p = 0.007) and the TN (p = 0.006) tests. On the other side, neither test distinguished the MP tree from ML topology B (tree length = 15647). We did the same comparisons in a ML framework using the SH and the AU tests, but no significant likelihood differences were found among the different hypotheses. Tests for zero-length branches Results of tests for zero-length branches on gene trees 0.197 - 12.408 0.054 - 14.313 0.893 - 13.801 0.773 - 9.641 0.043 - 5.656 The position of additional genera The objective of our biogeographic analyses was to infer ancestral areas for the main pteropodid clades that appeared consistently across analyses. Because of missing taxa, a thorough analysis of the biogeographic history of pteropodids would not be accurate. Thus, we used DIVA to infer ancestral areas for the clade containing all the pteropodids plus the six principal clades. These results were plotted on the ML tree obtained for dataset 2 (Figure 5). New Guinea and Melanesia Islands (area H) appear as a possible ancestral area for most internal clades, with the only exception being cynopterines. The results for the Cynopterinae subfamily agree with our previous analyses, indicating that this clade had its origins most likely in the Sundaic region . Another interesting result is the origin of the clade formed by African genera, Rousettus, and Eonycteris. Although different area combinations have similar probabilities of being the ancestral area of that group, the African continent does appear as one of them, while all other alternatives are area combinations that include Africa. Phylogenetic relationships and systematics of pteropodids Here we present the most complete ever analysis of the evolutionary relationships of pteropodid bats using a number of reconstruction and statistical approaches. The phylogenetic trees presented here, independently of the reconstruction method employed or the partition analyzed (from individual genes to combined data), almost unanimously recovered six principal clades and one independent lineage (Eidolon), variously joined by versions of a poorly supported backbone. By contrast, relationships of genera within each of those principal clades were generally consistent and in agreement across the different analyses performed. Some of the principal pteropodid clades recovered in our trees are congruent with previously proposed subfamilies, such as Cynopterinae , Harpyionycterinae , and Nyctimeninae . The other three main clades, represented by Macroglossini, Epomophorinae + Rousettini, and Pteropodini + Melonycteris (all groups sensu Bergmans ), were in disagreement with previous classifications into subfamilies. Some of these discrepancies had already been observed in previous studies, such as the clustering of Epomophorinae + Rousettini . The phylogeny of the subfamily Cynopterinae was recently addressed by Almeida et al. . The two major cynopterine clades recovered in that study also appeared as supported groups in all topologies recovered in our analyses, suggesting that these groupings are stable to varying taxonomic sampling and character data representation. Similarly, a recently recognized and expanded group of megabats, Harpyionycterinae (see [20, 21]), was also recovered in this study. This heterogeneous group is formed by two clades, the dobsoniine or bare-backed bats (Dobsonia and Aproteles) and the harpy bats from the Philippines and Sulawesi. Boneia bidens, a bat formerly included as a subgenus of Rousettus (e.g., [1, 14]) joined this clade as sister to Harpyionycteris as previously reported . The Pteropodini and Macroglossini tribes were also recovered as major clades in our study, but not as sister taxa or close relatives (Figure 4) in a monophyletic subfamily Pteropodinae, as proposed by Bergmans . In this study, Pteropodinae was recovered as a clade composed of one nectarivorous genus (Melonycteris) associated to flying foxes and related megabats (Acerodon, Desmalopex, Mirimiri, Pteralopex, Pteropus, and Styloctenium). The exclusion of two genera (Mirimiri and Neopteryx) and the lack of statistical support for some internal relationships claim for a more detailed study of the pteropodines. One major clade, including rousettines (excluding Boneia as discussed earlier) and all African megabats (excluding Eidolon as discussed earlier) was recovered consistently and with high support across all analyses in this study. Versions of this clade, although differing somewhat in taxonomic sampling, have been consistently recovered since Hollar and Springer first investigated pteropodid relationships using molecular methods [16, 18, 19]. This clade was originally highly controversial because the molecular data joined taxa from disparate traditionally recognized taxonomic groupings: rousettines (Eonycteris, Rousettus, and Stenonycteris) and epomophorines (the remainder of the African, except for Eidolon) sensu Bergmans . Giannini and Simmons , however, demonstrated morphological support for this now expanded "African clade". It is noteworthy that two other African genera, Scotonycteris and Casinycteris, included in the Epomophorinae subfamily by Bergmans and here for the first time sampled in a molecular phylogenetic study, appeared as sister to that clade in our analyses. This finding has important biogeographic implications, pointing to an African origin of this group as shown in the results of the biogeographic analysis. Eidolon is an unusual taxon that was the single megabat genus not linked to any other genera in a major clade. To some extent, this is a somewhat unsurprising result as affinities of Eidolon have always been contentious; however, it is remarkable that the observed placement of Eidolon does not seem to be an artifact from primary data since no significant codon bias nor differences in evolutionary rates could explain this result. Morphology tends to support an association of Eidolon and other large megabats in the pteropodine clade . A clade formed by Eidolon + Pteropodini, however, was not represented in any of the trees obtained with the combined dataset. This result suggests that the non-overlapping distribution of Eidolon versus pteropodines in continental Africa may have ecological and biogeographic rather than phylogenetic origin. Eidolon was included in the Rousettinae subfamily by Bergmans , but our results strongly suggest it should be in a separate subfamily by itself. It is possible that the Melanesian genus Notopteris represents another case of independent lineage, as suggested by the lack of statistical support for its relationship with other pteropodid genera. As only mitochondrial sequences were available for this genus, additional data will be required to resolve the affinities of Notopteris. Despite general lack of agreement among partitions and methods of analysis and statistical support for the relationships of the principal pteropodid clades, two groupings seem to be slightly favored. These two groupings received more than 50% bootstrap support in the optimal ML tree and appeared in a few other recovered trees. One is the clustering of Macroglossini and Harpyionycterinae as sister clades also obtained in MP tree and several of the suboptimal ML trees (Figure 4), with maximum bootstrap support of 73%. The other is the clade formed by Nyctimeninae and Pteropodini, which received 64% bootstrap support in the optimal ML tree and was also recovered in other ML trees (ML topologies B, C, D - Additional file 5), but did not appear in the MP tree. Evolutionary relationships that cannot be resolved in a phylogenetic analysis may represent a soft or a hard polytomy. A soft polytomy is the result of analytical bias, while a hard polytomy illustrates biological phenomena such as an explosive radiation. Hard polytomies are so called because can only be broken with a large amount of data and careful analyses. Before indentifying a hard polytomy it is necessary first to eliminate possible bias that could cause a soft polytomy. We were able to assemble a matrix with a wide genera representation and relatively little missing data. The concatenated matrix of six loci showed no signs of substitution saturation, and contained enough phylogenetic signal to resolve a strongly supported monophyletic Pteropodidae, the superfamily Rhinolophoidea sensu Teeling et al. , and most ingroup relationships (37 out of 49) with bootstrap > 96% (43 with bootstrap > 70%). Detailed characterization of the data did not uncover important systematic sequence bias that could blur phylogenetic signal -- megabats were shown to be relatively homogeneous in nucleotide composition at most partitions and in evolutionary rates, and no significant conflicting phylogenetic signal was detected among the different loci used. Moreover, phylogenetic analyses under the ML framework using specific substitution models for different partitions of the data most likely accounted for any minor sequence bias that could have affected the analyses [31, 50, 51, 54, 59]. Instead of having conflicting signal, the different loci used in this study agreed in a general lack of resolution at the base of the pteropodid tree. The results of the SOWH test support that at least some of the basal (inter subfamilies) relationships have zero-length branches in one or more gene partitions, some of which occurring across all partitions. As expected, an increase in the amount of data (i.e. the combined dataset) decreased the number of basal branches that could be simultaneously collapsed without affecting likelihood scores. Simulations of larger datasets suggest that the addition of about 6 kb to the Pteropodidae combined matrix used here would probably allow to resolve all basal relationships of the family. This result is similar to that obtained in the analyses of the relationships among bird orders. After being shown to represent a hard polytomy , the intraordinal relationships of Neoaves could finally be resolved with a 32 kb dataset . Because the radiation of Neoaves is much older than that of Pteropodidae, it is expected that that group require more data for phylogenetic resolution. As previously suggested, the older the radiation, the greater the effect of rapid diversification on phylogenetic resolution . Explosive radiation of megabats? Lack of phylogenetic resolution (hard polytomy) even when a considerable amount of data is used has been interpreted as evidence of closely spaced cladogenetic events [32, 33, 35, 60, 61]. Pteropodidae has apparently been distinct from other bat lineages since at least the early Eocene [10, 62] but the crown group is believed to be of more recent origin. Estimates for the beginning of crown group divergence range between 31 and 20 million years (My) [10, 27]. Using an estimate of 26 My for the pteropodid radiation and the substitution rates obtained with our combined dataset, the first three cladogenetic events of Pteropodidae are estimated to have occurred within approximately 0.5 My. The results of our phylogenetic analysis, therefore, suggest that pteropodids experienced an explosive radiation that generated all main lineages representing its extant diversity. Although a more focused analysis would be necessary to fully evaluate this hypothesis, some characteristics of the family Pteropodidae are consistent with the idea that it experienced an explosive radiation. Explosive radiations are usually associated with high taxonomic diversity and Pteropodidae is in fact one of the most diverse bat families. Among the 20 bat families currently recognized, Pteropodidae ranks second in both genus and species diversity with over 45 genera and over 180 species [1, 64]. Explosive radiations can be caused by demographic factors, intrinsic evolutionary rates, ecological adaptation, or a combination of any or all of these factors . When an explosive radiation is accompanied by ecological adaptation (adaptive radiation), it often involves the evolution of novel characters (key innovation) [63, 65, 66]. Pteropodidae exhibits numerous innovations when compared to their closest relatives (Rhinolophoidea and Yangochiroptera), including primary phytophagy and predominance of visual over acoustic orientation (for an extensive list of differences between megabats and microbats see ). Also in accordance with ecological adaptation as a drive to diversification is the marked morphological diversity of megabats, such as the high variance in body size, as compared to the other bat families and the independent evolution of nectarivorous habits and associated morphological adaptations in several of the pteropodid clades. Among the demographic causes of explosive radiations are small population sizes (favoring differentiation through genetic drift) and/or the existence of isolated peripheral populations. Given the flight power of megabats and their geographic distribution on (often isolated) islands, colonization of underpopulated areas and the existence isolated peripheral populations could both have contributed for an explosive radiation of megabats. Our phylogenetic analyses identified six principal clades and one additional independent lineage within Pteropodidae. This result points to the need for a new formal classification of the family based on monophyletic units. The trees presented here are the most complete ever for the family in terms of genera representation, and are robust in terms of providing statistical support for pteropodid relationships. They thus provide a sound phylogenetic framework for the study of the morphologic, ecologic, and behavioral evolution within this highly diverse and divergent bat family. In contrast with the high statistical support obtained for the major pteropodid groups and subordinate clades, relationships among the seven principal clades were largely unresolved. Congruence in this aspect among different gene trees and the results of simulations and the SOWH test suggest that crown pteropodids experienced an explosive radiation soon after their origin. To further evaluate the hypothesis of an explosive radiation of megabats and determine the potential processes involved will require a number of additional analyses including estimates of divergence times, estimates of diversification rates, and comparisons with other mammalian families with similar divergence times. A complete genus-level taxonomic sampling along with complete locus representation will be important in these future analyses. The effect of missing data on phylogenetic estimation is still a matter of controversy [52, 69–72]. Our preliminary analyses using data partitions of the concatenated gene matrix and maximum likelihood searches showed reconstruction problems when whole partitions were missing for certain taxa. Accordingly, in order to minimize any possible effects of missing data, we generated two different data matrices for phylogenetic analyses. In the first matrix (combined dataset 1), our goal was to minimize missing data while including as much as possible of the generic diversity of Pteropodidae. This matrix included 51 pteropodid species, representing 37 of the 46 pteropodid genera (Additional file 8). Among these 51 ingroup samples, 50 had all sequences determined experimentally by us from tissue samples donated by several institutions and individuals. Sequences of the remaining species were obtained from the Genbank (NCBI-NIH). In this first matrix, 44 of the ingroup taxa were represented by all eight genes used in the analyses, four taxa had one missing gene, and one taxon had two missing genes. Some of the sequences obtained by us have already been published [20, 21, 27, 73]. A second matrix (dataset 2) was built to include five additional pteropodid genera for which only a few sequences are available (Additional file 8). These genera were mostly represented by two mitochondrial genes, usually the ribosomal genes 12S and 16S. Most of these sequences were obtained from the Genbank, except for those of the genus Latidens, which we sequenced ourselves. Dataset 2 included all currently recognized pteropodid genera except four taxa for which no DNA sequence is available (Paranyctimene, Mirimiri, Neopteryx, and Plerotes) [1, 74]. As outgroups, we used sequences from Genbank of five non-pteropodid bats. Four of these, Rhinopoma hardwickii, Hipposideros commersoni, Megaderma lyra, and Rhinolophus creaghi, belong to the yinpterochiropteran superfamily Rhinolophoidea, which is widely accepted as the sister group of Pteropodidae [9, 10]. The fifth outgroup species, Artibeus jamaicensis, represents the other chiropteran suborder, Yangochiroptera. Eight genes were sequenced for this study, including both nuclear and mitochondrial loci. The four nuclear gene regions included the exon 28 of the von Willebrand Factor gene (vWF, 1230 bp), partial Recombination Activating Gene 1 (RAG1, 1084 bp), partial Recombination Activating Gene 2 (RAG2, 760 bp), and partial Breast Cancer 1 gene (BRCA1, about 1370 bp). These genes have been used to reconstruct the phylogeny of the Chiroptera families and were able to resolve most interfamilial relationships . Besides, these genes have been successfully used to resolve relationships at subfamily and genus levels in diverse groups of bats [21, 27, 73, 75]. The four mitochondrial genes were sequenced in two fragments: one containing the complete sequence of the Cytochrome b gene (Cytb, 1140 bp) and another including partial rRNA 12S gene (1069 bp), the valine tRNA gene, and partial rRNA 16S gene (1330 bp), totaling about 2550 bp. The latter fragment has also proven highly informative at the familial level in Chiroptera . The combined sequence set encompassed a total of 8181 bp of aligned nucleotides (including indels). Individual ingroup samples in dataset 1 had concatenated sequences ranging from 6011 bp to 8025 bp in length. Total DNA was obtained from preserved tissue samples with the DNeasy tissue kit (QIAGEN). PCR amplification was carried out using previously published primers (RAG1 and RAG2: ; vWF: ; Cytb: ; 12S: ; 16S: [16, 78]). New primers were designed for the 16S gene: 12l-f (AGAGGAGAYAAGTCGTAMCAAG), 16u-f (AGCCAYCAATTRAGAAAGC), 16q-r (GTTTGCCGAGTTCCTTTTAC), and 16k-r (ATAGATAGAAACCGACCTGGA); and the BRCA1 gene: BRCA1-f2 (AACAGATGGGTTGAAACTAAGG), BRCA1-f3 (AGGYGATTATGTTCAGAAGAAG), BRCA1-r2 (GAAGGCTAGGATTGACAAACTC), and BRCA1-r4 (ATTTAATTCTAGTTCCAYATTGC). Additional sequencing primers were also used for vWF , RAG1 and 12S/valine-tRNA . All sequences were obtained with an automated ABI 3730XL sequencer. Sequence editing and prealignment were done with the Sequencher 4.2 software (Gene Codes). Genbank accession numbers and voucher information for taxa included in this study are provided in the in the Additional file 8. Alignments were done using the program MAFFT using the default costs for gaps (gap opening penalty = 1.53; gap extension penalty = 0.123). Among the protein coding genes, only BRCA1 had indels, all of which were in frame. Gap positioning was adjusted to match amino acid codon positions with MacClade 4.08 . The fragment containing 12S-valine-tRNA/16S also contained several indels. This last fragment was treated as a single partition in our dataset, which totaled six gene partitions: RAG1, RAG2, vWF, BRCA1, Cytb, and 12S/val-tRNA/16S (hereafter "12S16S"). Conflicting phylogenetic signal among partitions was checked using the incongruence-length difference test (ILD) as implemented in PAUP* 4.10 b , running 500 searches with random stepwise addition and 10 replicates per search. The ILD test has been criticized for being sensitive to both type I and type II errors [83, 84]. As an alternative test for incongruence, we used the script concartepillar.py which employs a hierarchical clustering method and likelihood-ratio tests to identify pairs of loci that have incongruent phylogenetic signal . In these tests we excluded taxa for which one or more loci were not available, so that each alignment had the same set of taxa. Substitution saturation in the combined dataset was checked by plotting number of transition and transversions as a function of GTR distances. Additionally, we used a saturation test implemented in the program DAMBE . Base composition bias among taxa was analyzed for each locus including all codon positions and for each codon position separately using the χ2 test implemented in PAUP* 4.10 b . Pairwise relative rate tests were done using HyPhy . In all multiple tests, significance was corrected for multiple testing using the sequential Bonferroni criterion. Phylogenetic inferences were done using maximum parsimony (MP) and maximum likelihood (ML). The MP searches were run on PAUP* 4.10 b , with 1000 random sequence additions followed by tree bisection reconnection branch swapping (TBR). Gaps were treated as missing data. Statistical support for clades were obtained with non-parametric bootstrap using PAUP* 4.10 b and Bremer decay values using TreeRot v.3 . ML analyses were carried out with the program TreeFinder . For the combined dataset 1, we first tried several partitioning schemes and compared their outcomes to determine the optimal scheme. Seven different partition schemes based on gene and codon position were tested, from one that separates all genes and codon positions, totaling 16 partitions, to non-partitioning of the data (analyzing it as one single partition). In these analyses, the GTR model was generally applied, with partition-wide estimates of the rate parameters by maximum likelihood optimization and empirical nucleotide frequency parameters. The performances of the different partition schemes were evaluated by comparing the likelihood, AIC (Akaike Information Criterion) [89, 90], and BIC (Bayesian Information Criterion) values of the resulting trees. AICc was used instead of AIC in cases where the ratio of the number of parameters to the number of bases was equal or less than 40. AIC and BIC correct the likelihood of a model for the number of the parameters, penalizing overparameterization . The partition schemes with better scores (lower AIC and BIC values) were then used in ML analysis with optimal substitution models for each partition. Selection of partition-wide substitution models was done in Treefinder, using AIC. Statistical support of branches was obtained with 500 replicas of partition-wise bootstrap. Alternative topologies were compared in a ML framework using the Shimodaira-Hasegawa (SH) and the Approximately Unbiased (AU) tests as implemented in TreeFinder. In the MP framework, we used the program PAUP* to run the Kishino-Hasegawa (KH) and the Templeton non-parametric tests [95, 96]. Zero-branch length simulations To test whether basal, non-supported branches had lengths significantly different from zero in the individual gene and combined dataset trees, we compared the best tree found for that dataset with trees identical to the best tree but with unsupported branches collapsed. For that we employed the SH and the AU tests using TreeFinder. To access whether multiple nodes were involved in a polytomy at the base of the Pteropodidae tree, we used a similar approach to that proposed by Poe and Chubb . Briefly, for each best ML gene tree, basal branches were collapsed one by one simultaneously (up to 6), and the likelihood of these collapsed trees were compared with the likelihood of the best tree. Because typical likelihood comparison tests should not be employed when multiple branches are collapsed at the same time , we created null distributions for the test statistic (the difference in likelihood between the best and the collapsed tree) using simulated datasets as in the SOWH test . Sequences were simulated based on trees with collapsed branches using the same evolutionary model and substitution parameters obtained for the original dataset with the program evolver of PAML v.4.4 [99, 100]. For each of the 100 simulated matrices, we obtained the best tree over 10 independent runs using RAxML v7.2.6 and calculated the difference in likelihood of this tree to that of the collapsed tree (used to simulate the sequences) using baseml (PAML v4.4). In this way we obtained a null distribution of 100 likelihood differences between best and collapsed tree (the null hypothesis tree). In the analyses involving simulations, only ingroup species for which all genes were sequenced (44 species) were kept in the matrix and the GTR+Γ model was generally employed. These analyses were not done for RAG2, due the low resolution of its gene tree (Additional file 3, Figure S4), and Cytb, because of the large difference in substitution rates between the 3rd codon position and the other positions (Additional file 6). The biogeographic history of the major pteropodid clades was analyzed using DIVA (Dispersal-Vicariance Analysis) [56, 102]. Geographic distribution of the pteropodid genera were obtained in Simmons and double checked with updated information from the http://gis.miiz.waw.pl/webapps/thebats/iucn/ website. All species of the same genera were assigned the same distribution area, except for Roussetus. To remark that the most basal Rousettus in our tree (R. amplexicaudatus) inhabits the Asian continent, we assigned only its own area to this species, while to the other two Rousettus species (R. leschenaultii and R. madagascariensis) we assigned all areas occupied by species of this genus. The area units and the geographic distributions of genera used in the DIVA are listed in the Additional file 9 (Tables S5 and S6). DIVA was based on the ML tree obtained for dataset 2 (all available pteropodid taxa), using alternatively maxarea=2 or 3. Results obtained with maxarea = 3 option in general contained all the areas obtained with maxarea = 2 plus 3-area combinations of those areas. Hence, we show here only the results obtained with maxarea = 2. We are in debt with all the people and Institutions that provided us access to tissue samples for this study: Lawrence Heaney (Field Museum of Natural History, Chicago), Jim Patton and Carla Cicero (Museum of Vertebrate Zoology, Berkeley), John Wible and Suzanne McLaren (Carnegie Museum, Pittsburgh), Burton Lim and Judith Eger (Royal Ontario Museum, Toronto), Denis O'Meally (Australian Museum, Sydney), Linda Gordon, Jeremy Jacobs, Louise Emmons, and James Mead (National Museum of Natural History, Smithsonian Institution, Washington, D. C.), and Paul Bates and Malcolm Pearch (The Harrison Institute, Sevenoaks). Thanks to Kara M. Kaminski and Simone Loss for their help in generating the DNA sequences. Liliana Dávalos and Gabriela Aguileta provided comments and suggestions on an earlier version of the manuscript. Funding for this study was provided by the National Science Foundation (research awards DEB-9873663 and EF-0629811 to N. B. S.), a Vernay postdoctoral fellowship at the AMNH to F. C. A.. N. P. G. acknowledges support from Consejo Nacional de Investigaciones Científicas y Tecnológicas (CONICET), Argentina. - Simmons NB: Order Chiroptera. Mammal species of the world: a taxonomic and geographic reference. Edited by: Wilson DE, Reeder DM. 2005, Baltimore, MD: Johns Hopkins University Press, 312-529.Google Scholar - Nowak RM: Walker's bats of the World. 1994, Baltimore and London: The Johns Hopkins University PressGoogle Scholar - Mickleburgh SP, Hutson AM, Racey PA: Old World fruit bats: an action plan for their conservation. 1992, Gland, Switzerland: IUCNView ArticleGoogle Scholar - Simmons NB: Bat relationships and the origin of flight. Symposium of the Zoological Society of London. 1995, 67: 27-43.Google Scholar - Thewissen JG, Babcock SK: Distinctive cranial and cervical innervation of wing muscles: new evidence for bat monophyly. Science. 1991, 251 (4996): 934-936. 10.1126/science.2000493.PubMedView ArticleGoogle Scholar - Ammerman LK, Hillis DM: A molecular test of bat relationships: monophyly or diphyly?. Syst Biol. 1992, 41 (2): 222-232.View ArticleGoogle Scholar - Stanhope MJ, Czelusniak J, Si JS, Nickerson J, Goodman M: A molecular perspective on mammalian evolution from the gene encoding interphotoreceptor retinoid binding protein, with convincing evidence for bat monophyly. Mol Phylogenet Evol. 1992, 1 (2): 148-160. 10.1016/1055-7903(92)90026-D.PubMedView ArticleGoogle Scholar - Kirsch JAW, Flannery TF, Springer MS, Lapointe F-J: Phylogeny of the Pteropodidae (Mammalia: Chiroptera) based on DNA hybridisation, with evidence for bat monophyly. Aust J Zool. 1995, 43 (4): 395-428. 10.1071/ZO9950395.View ArticleGoogle Scholar - Teeling EC, Scally M, Kao DJ, Romagnoli ML, Springer MS, Stanhope MJ: Molecular evidence regarding the origin of echolocation and flight in bats. Nature. 2000, 403 (6766): 188-192. 10.1038/35003188.PubMedView ArticleGoogle Scholar - Teeling EC, Springer MS, Madsen O, Bates P, O'Brien SJ, Murphy WJ: A molecular phylogeny for bats illuminates biogeography and the fossil record. Science. 2005, 307 (5709): 580-584. 10.1126/science.1105113.PubMedView ArticleGoogle Scholar - Springer MS, Teeling EC, Madsen O, Stanhope MJ, de Jong WW: Integrated fossil and molecular data reconstruct bat echolocation. Proc Natl Acad Sci USA. 2001, 98 (11): 6241-6246. 10.1073/pnas.111551998.PubMedPubMed CentralView ArticleGoogle Scholar - Andersen K: Catalogue of the Chiroptera in the collection of the British Museum. Catalogue of the Chiroptera in the collection of the British Museum 2nd ed 1. 1912, (ci +854)-2Google Scholar - Hollar LJ, Springer MS: Old World fruitbat phylogeny: evidence for convergent evolution and an endemic African clade. Proc Natl Acad Sci USA. 1997, 94 (11): 5716-5721. 10.1073/pnas.94.11.5716.PubMedPubMed CentralView ArticleGoogle Scholar - Bergmans W: Taxonomy and biogeography of African fruit bats (Mammalia, Megachiroptera). 5. The genera Lissonycteris Andersen, 1912, Myonycteris Matschie, 1899 and Megaloglossus Pagenstecher, 1885; general remarks and conclusions; annex: key to all species. Beaufortia. 1997, 47 (2): 11-90.Google Scholar - Juste J, Alvarez Y, Tabares E, Garrido-Pertierra A, Ibanez C, Bautista JM: Phylogeography of African fruitbats (Megachiroptera). Mol Phylogenet Evol. 1999, 13 (3): 596-604. 10.1006/mpev.1999.0669.View ArticleGoogle Scholar - Romagnoli ML, Springer MS: Evolutionary relationships among Old World fruitbats (Megachiroptera: Pteropodidae) based on 12S rRNA, tRNA valine, and 16S rRNA gene sequences. J Mamm Evol. 2000, 7 (4): 259-284. 10.1023/A:1009485731963.View ArticleGoogle Scholar - Colgan DJ, da Costa P: Megachiropteran evolution studied with 12S rDNA and c-mos DNA sequences. J Mamm Evol. 2002, 9 (1-2): 3-22.View ArticleGoogle Scholar - Giannini NP, Simmons NB: A phylogeny of megachiropteran bats (Mammalia: Chiroptera: Pteropodidae) based on direct optimization analysis of one nuclear and four mitochondrial genes. Cladistics. 2003, 19 (6): 496-511. 10.1111/j.1096-0031.2003.tb00385.x.View ArticleGoogle Scholar - Giannini NP, Simmons NB: Conflict and congruence in a combined DNA-morphology analysis of megachiropteran bat relationships (Mammalia: Chiroptera: Pteropodidae). Cladistics. 2005, 21 (5): 411-437. 10.1111/j.1096-0031.2005.00083.x.View ArticleGoogle Scholar - Giannini NP, Cunha Almeida F, Simmons NB, DeSalle R: Phylogenetic relationships of the enigmatic harpy fruit bat, Harpyionycteris (Mammalia: Chiroptera: Pteropodidae). American Museum Novitates. 2006, 3533: 1-12. 10.1206/0003-0082(2006)3533[1:PROTEH]2.0.CO;2.View ArticleGoogle Scholar - Giannini NP, Almeida FC, Simmons NB: Phylogenetic relationships of hapyionycterine bats. Systematic Mammalogy: contributions in honor of Guy G Musser. Edited by: Voss R, Carleton M. 2009, New York: Bulletin of the American Museum of Natural History, 331: 83-201.Google Scholar - Delsuc F, Brinkmann H, Philippe H: Phylogenomics and the reconstruction of the tree of life. Nat Rev Genet. 2005, 6 (5): 361-375.PubMedView ArticleGoogle Scholar - Hillis DM: Inferring complex phylogenies. Nature. 1996, 383 (6596): 130-131. 10.1038/383130a0.PubMedView ArticleGoogle Scholar - Hillis DM, Pollock DD, McGuire JA, Zwickl DJ: Is sparse taxon sampling a problem for phylogenetic inference?. Syst Biol. 2003, 52 (1): 124-126. 10.1080/10635150390132911.PubMedPubMed CentralView ArticleGoogle Scholar - Delsuc F, Scally M, Madsen O, Stanhope MJ, de Jong WW, Catzeflis FM, Springer MS, Douzery EJ: Molecular phylogeny of living xenarthrans and the impact of character and taxon sampling on the placental tree rooting. Mol Biol Evol. 2002, 19 (10): 1656-1671.PubMedView ArticleGoogle Scholar - Davalos LM, Perkins SL: Saturation and base composition bias explain phylogenomic conflict in Plasmodium. Genomics. 2008, 91 (5): 433-442. 10.1016/j.ygeno.2008.01.006.PubMedView ArticleGoogle Scholar - Almeida FC, Giannini NP, DeSalle R, Simmons NB: The phylogenetic relationships of cynopterine fruit bats (Chiroptera: Pteropodidae: Cynopterinae). Mol Phylogenet Evol. 2009, 53 (3): 772-783. 10.1016/j.ympev.2009.07.035.PubMedView ArticleGoogle Scholar - Aguinaldo AM, Turbeville JM, Linford LS, Rivera MC, Garey JR, Raff RA, Lake JA: Evidence for a clade of nematodes, arthropods and other moulting animals. Nature. 1997, 387 (6632): 489-493. 10.1038/387489a0.PubMedView ArticleGoogle Scholar - Gruber KF, Voss RS, Jansa SA: Base-compositional heterogeneity in the RAG1 locus among didelphid marsupials: implications for phylogenetic inference and the evolution of GC content. Syst Biol. 2007, 56 (1): 83-96. 10.1080/10635150601182939.PubMedView ArticleGoogle Scholar - Steel MA, Lockhart PJ, Penny D: Confidence in evolutionary trees from biological sequence data. Nature. 1993, 364 (6436): 440-442. 10.1038/364440a0.PubMedView ArticleGoogle Scholar - Felsenstein J: Inferring phylogenies. 2004, Sunderland, Massachusetts: SinauerGoogle Scholar - Nikolaev S, Montoya-Burgos JI, Margulies EH, Rougemont J, Nyffeler B, Antonarakis SE: Early history of mammals is elucidated with the ENCODE multiple species sequencing data. PLoS Genet. 2007, 3 (1): e2-10.1371/journal.pgen.0030002.PubMedPubMed CentralView ArticleGoogle Scholar - Hallstrom BM, Janke A: Resolution among major placental mammal interordinal relationships with genome data imply that speciation influenced their earliest radiations. BMC Evol Biol. 2008, 8: 162-10.1186/1471-2148-8-162.PubMedPubMed CentralView ArticleGoogle Scholar - Poe S, Chubb AL: Birds in a bush: five genes indicate explosive evolution of avian orders. Evolution. 2004, 58 (2): 404-415.PubMedView ArticleGoogle Scholar - Hackett SJ, Kimball RT, Reddy S, Bowie RC, Braun EL, Braun MJ, Chojnowski JL, Cox WA, Han KL, Harshman J, et al: A phylogenomic study of birds reveals their evolutionary history. Science. 2008, 320 (5884): 1763-1768. 10.1126/science.1157704.PubMedView ArticleGoogle Scholar - Pamilo P, Nei M: Relationships between gene trees and species trees. Mol Biol Evol. 1988, 5 (5): 568-583.PubMedGoogle Scholar - Leite YL, Patton JL: Evolution of South American spiny rats (Rodentia, Echimyidae): the star-phylogeny hypothesis revisited. Mol Phylogenet Evol. 2002, 25 (3): 455-464. 10.1016/S1055-7903(02)00279-8.PubMedView ArticleGoogle Scholar - Arndt PF: Reconstruction of ancestral nucleotide sequences and estimation of substitution frequencies in a star phylogeny. Gene. 2007, 390 (1-2): 75-83. 10.1016/j.gene.2006.11.022.PubMedView ArticleGoogle Scholar - Pollock DD, Zwickl DJ, McGuire JA, Hillis DM: Increased taxon sampling is advantageous for phylogenetic inference. Syst Biol. 2002, 51 (4): 664-671. 10.1080/10635150290102357.PubMedPubMed CentralView ArticleGoogle Scholar - Zwickl DJ, Hillis DM: Increased taxon sampling greatly reduces phylogenetic error. Syst Biol. 2002, 51 (4): 588-598. 10.1080/10635150290102339.PubMedView ArticleGoogle Scholar - Baurain D, Brinkmann H, Philippe H: Lack of resolution in the animal phylogeny: closely spaced cladogeneses or undetected systematic errors?. Mol Biol Evol. 2007, 24 (1): 6-9.PubMedView ArticleGoogle Scholar - Kluge AG: A concern for evidence and a phylogenetic hypothesis of relationships among Epicrates (Boidae, Serpentes). Syst Biol. 1989, 38: 7-25.View ArticleGoogle Scholar - Nixon KC, Carpenter JM: On simultaneous analysis. Cladistics. 1996, 12: 221-241. 10.1111/j.1096-0031.1996.tb00010.x.View ArticleGoogle Scholar - Rokas A, Williams BL, King N, Carroll SB: Genome-scale approaches to resolving incongruence in molecular phylogenies. Nature. 2003, 425 (6960): 798-804. 10.1038/nature02053.PubMedView ArticleGoogle Scholar - Driskell AC, Ane C, Burleigh JG, McMahon MM, O'Meara BC, Sanderson MJ: Prospects for building the tree of life from large sequence databases. Science. 2004, 306 (5699): 1172-1174. 10.1126/science.1102036.PubMedView ArticleGoogle Scholar - DeSalle R: Animal phylogenomics: multiple interspecific genome comparisons. Methods Enzymol. 2005, 395: 104-133.PubMedView ArticleGoogle Scholar - de la Torre J, Egan M, Katari M, Brenner E, Stevenson D, Coruzzi G, DeSalle R: ESTimating plant phylogeny: lessons from partitioning. BMC Evol Biol. 2006, 6 (1): 48-10.1186/1471-2148-6-48.PubMedPubMed CentralView ArticleGoogle Scholar - Lee MS, Camens AB: Strong morphological support for the molecular evolutionary tree of placental mammals. J Evol Biol. 2009, 22 (11): 2243-2257. 10.1111/j.1420-9101.2009.01843.x.PubMedView ArticleGoogle Scholar - Cummings MP, Meyer A: Magic bullets and golden rules: data sampling in molecular phylogenetics. Zoology (Jena). 2005, 108 (4): 329-336.View ArticleGoogle Scholar - Sullivan J: Combining Data with Different Distributions of Among-Site Rate Variation. Syst Biol. 1996, 45 (3): 375-380. 10.1093/sysbio/45.3.375.View ArticleGoogle Scholar - Brown JM, Lemmon AR: The importance of data partitioning and the utility of Bayes factors in Bayesian phylogenetics. Syst Biol. 2007, 56 (4): 643-655. 10.1080/10635150701546249.PubMedView ArticleGoogle Scholar - Lemmon AR, Brown JM, Stanger-Hall K, Lemmon EM: The effect of ambiguous data on phylogenetic estimates obtained by Maximum Likelihood and Bayesian Inference. Syst Biol. 2009, 58 (1): 130-145. 10.1093/sysbio/syp017.PubMedView ArticleGoogle Scholar - Xia X, Xie Z, Salemi M, Chen L, Wang Y: An index of substitution saturation and its application. Mol Phylogenet Evol. 2003, 26 (1-7): - Jeffroy O, Brinkmann H, Delsuc F, Philippe H: Phylogenomics: the beginning of incongruence?. Trends Genet. 2006, 22 (4): 225-231. 10.1016/j.tig.2006.02.003.PubMedView ArticleGoogle Scholar - Leigh JW, Susko E, Baumgartner M, Roger AJ: Testing congruence in phylogenomic analysis. Syst Biol. 2008, 57 (1): 104-115. 10.1080/10635150801910436.PubMedView ArticleGoogle Scholar - Ronquist F: Dispersal-vicariance analysis: a new approach to the quantification of historical biogeography. Syst Biol. 1997, 46 (1): 195-203. 10.1093/sysbio/46.1.195.View ArticleGoogle Scholar - Teeling EC, Madsen O, Van den Bussche RA, de Jong WW, Stanhope MJ, Springer MS: Microbat paraphyly and the convergent evolution of a key innovation in Old World rhinolophoid microbats. Proc Natl Acad Sci USA. 2002, 99 (3): 1431-1436. 10.1073/pnas.022477199.PubMedPubMed CentralView ArticleGoogle Scholar - Whitfield JB, Lockhart PJ: Deciphering ancient rapid radiations. Trends Ecol Evol. 2007, 22 (5): 258-265. 10.1016/j.tree.2007.01.012.PubMedView ArticleGoogle Scholar - Kolaczkowski B, Thornton JW: Performance of maximum parsimony and likelihood phylogenetics when evolution is heterogeneous. Nature. 2004, 431 (7011): 980-984. 10.1038/nature02917.PubMedView ArticleGoogle Scholar - Rokas A, Kruger D, Carroll SB: Animal evolution and the molecular signature of radiations compressed in time. Science. 2005, 310 (5756): 1933-1938. 10.1126/science.1116759.PubMedView ArticleGoogle Scholar - Takezaki N, Figueroa F, Zaleska-Rutczynska Z, Takahata N, Klein J: The phylogenetic relationship of tetrapod, coelacanth, and lungfish revealed by the sequences of forty-four nuclear genes. Mol Biol Evol. 2004, 21 (8): 1512-1524. 10.1093/molbev/msh150.PubMedView ArticleGoogle Scholar - Miller-Butterworth CM, Murphy WJ, O'Brien SJ, Jacobs DS, Springer MS, Teeling EC: A family matter: conclusive resolution of the taxonomic position of the long-fingered bats, Miniopterus. Molecular Biology Evolution. 2007, 24 (7): 1553-1561. 10.1093/molbev/msm076.PubMedView ArticleGoogle Scholar - Gavrilets S, Losos JB: Adaptive radiation: contrasting theory with data. Science. 2009, 323 (5915): 732-737. 10.1126/science.1157966.PubMedView ArticleGoogle Scholar - Lack JB, Roehrs ZP, Stanley CE, Ruedi M, Van den Bussche RA: Molecular phylognetics of Myotis indicate familial-level divergence for the genus Cistugo (Chiroptera). J Mammal. 2010, 91 (4): 976-992. 10.1644/09-MAMM-A-192.1.View ArticleGoogle Scholar - Givnish T: Adaptive radiation and molecular systematics: issues and approaches. Molecular evolution and adaptive radiation. Edited by: Givnish T, Sytsma K. 1997, Cambrige, UK: Cambridge University Press, 1-54.Google Scholar - Yoder J, Clancey E, Roches SD, Eastman J, Gentry L, Godsoe W, Hagey T, Jochimsen D, Oswald B, Robertson J, et al: Ecological opportunity and the origin of adaptive radiations. J Evol Biol. 2010, 23 (8): 1581-1596. 10.1111/j.1420-9101.2010.02029.x.PubMedView ArticleGoogle Scholar - Pettigrew JD, Jamieson BGM, Robson SK, Hall LS, McAnally KI, Cooper HM: Phylogenetic relations between microbats, megabats and primates (Mammalia: Chiroptera and Primates). Philos Trans R Soc Lond, Ser B: Biol Sci. 1989, 325 (1229): 489-559. 10.1098/rstb.1989.0102.View ArticleGoogle Scholar - Hutcheon JM, Garland T: Are Megabats Big?. J Mamm Evol. 2004, 11 (3): 257-277.View ArticleGoogle Scholar - Platnick N, Griswold C, Coddington J: On missing entries in cladistic analysis. Cladistics. 1991, 7 (4): 337-343. 10.1111/j.1096-0031.1991.tb00042.x.View ArticleGoogle Scholar - Wiens JJ: Missing data, incomplete taxa, and phylogenetic accuracy. Syst Biol. 2003, 52 (4): 528-538. 10.1080/10635150390218330.PubMedView ArticleGoogle Scholar - Wiens JJ: Incomplete taxa, incomplete characters, and phylogenetic accuracy: is there a missing data problem?. J Vert Paleontol. 2003, 22 (2): 297-310.View ArticleGoogle Scholar - Wiens JJ: Missing data and the design of phylogenetic analyses. J Biomed Inf. 2006, 39 (1): 34-42. 10.1016/j.jbi.2005.04.001.View ArticleGoogle Scholar - Giannini NP, Almeida FC, Simmons NB, Helgen KM: The systematic position of Pteropus leucopterus and its bearing on the monophyly and relationships of Pteropus (Chiroptera: Pteropodidae). Acta Chiropterologica. 2008, 10 (1): 11-20. 10.3161/150811008X331054.View ArticleGoogle Scholar - Helgen KM: Systematics of the Pacific monkey-faced bats (Chiroptera:Pteropodidea), with a new species of Pteralopex and a new Fijian genus. Syst Biodivers. 2010, 3 (4): 433-453.View ArticleGoogle Scholar - Datzmann T, von Helversen O, Mayer F: Evolution of nectarivory in phyllostomid bats (Phyllostomidae Gray, 1825, Chiroptera: Mammalia). BMC Evol Biol. 2010, 10: 165-10.1186/1471-2148-10-165.PubMedPubMed CentralView ArticleGoogle Scholar - Porter CA, Goodman M, Stanhope MJ: Evidence on mammalian phylogeny from sequences of exon 28 of the von Willebrand Factor gene. Mol Phylogenet Evol. 1996, 5 (1): 89-101. 10.1006/mpev.1996.0008.PubMedView ArticleGoogle Scholar - Bastian ST, Tanaka K, Anunciado RVP, Natural NG, Sumalde AC, Namikawa T: Evolutionary relationships of flying foxes (genus Pteropus) in the Philippines inferred from DNA sequences of cytochrome b gene. Biochem Genet. 2002, 40 (3-4): 101-116.PubMedView ArticleGoogle Scholar - Springer MS, Hollar LJ, Kirsch JAW: Phylogeny, molecules versus morphology, and rates of character evolution among fruitbats (Chiroptera: Megachiroptera). Aust J Zool. 1995, 43 (6): 557-582. 10.1071/ZO9950557.View ArticleGoogle Scholar - Katoh K, Misawa K, Toh H, Miyata T: MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res. 2005, 33: 511-518. 10.1093/nar/gki198.PubMedPubMed CentralView ArticleGoogle Scholar - Maddison D, Maddison W: MacClade 4: Analysis of phylogeny and character evolution. 2000, Sunderland, Massachusetts: Sinauer Associates, 4.0Google Scholar - Farris JS, Kallersjo M, Kluge AG, Bult C: Permutations. Cladistics. 1994, 10 (1): 65-76. 10.1006/clad.1994.1005.View ArticleGoogle Scholar - Swofford DL: PAUP*: Phylogenetic Analysis Using Parsimony (* and other methods). Version 4. Sinauer Associates, Sunderland, Massachusetts. 2002Google Scholar - Barker FK, Lutzoni FM: The utility of the incongruence length difference test. Syst Biol. 2002, 51 (4): 625-637. 10.1080/10635150290102302.PubMedView ArticleGoogle Scholar - Darlu P, Lecointre G: When does the Incongruence Length Difference test fail?. Mol Biol Evol. 2002, 19 (4): 432-437.PubMedView ArticleGoogle Scholar - Xia X, Lemey P: Assesing substitution saturation with DAMBE. The Phylogenetic Handbook. Edited by: Lemey P. 2009, Cambridge, UK: Cambridge University Press, 611-626.Google Scholar - Pond S, Muse S: HyPhy: Hypothesis Testing Using Phylogenies. Statistical Methods in Molecular Evolution. 2005, 125-181.View ArticleGoogle Scholar - Sorenson MD, Franzosa EA: TreeRot, version 3. 2007, Boston, MA: Boston UniversityGoogle Scholar - Jobb G, von Haeseler A, Strimmer K: TREEFINDER: A powerful graphical analysis environment for molecular phylogenetics. BMC Evol Biol. 2004, 4: 18-10.1186/1471-2148-4-18.PubMedPubMed CentralView ArticleGoogle Scholar - Akaike H: Information theory and an extension of the maximum likelihood principle. Second International Symposium on Information Theory. Edited by: Petrov PN, Csaki F. 1973, Budapest: Akad. Kiado, 267-281.Google Scholar - Posada D, Crandall KA: MODELTEST: testing the model of DNA substitution. Bioinformatics. 1998, 14 (9): 817-818. 10.1093/bioinformatics/14.9.817.PubMedView ArticleGoogle Scholar - Schwarz G: Estimating the dimensions of a model. Annals of Statistics. 1978, 6 (2): 461-464. 10.1214/aos/1176344136.View ArticleGoogle Scholar - Sullivan J, Joyce P: Model selection in phylogenetics. Annu Rev Ecol Evol Syst. 2005, 36 (1): 445-466. 10.1146/annurev.ecolsys.36.102003.152633.View ArticleGoogle Scholar - Shimodaira H, Hasegawa M: Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol Biol Evol. 1999, 16 (8): 1114-1116.View ArticleGoogle Scholar - Shimodaira H: An approximately unbiased test of phylogenetic tree selection. Syst Biol. 2002, 51 (3): 492-508. 10.1080/10635150290069913.PubMedView ArticleGoogle Scholar - Kishino H, Hasegawa M: Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in hominoidea. J Mol Evol. 1989, 29 (2): 170-179. 10.1007/BF02100115.PubMedView ArticleGoogle Scholar - Templeton A: Phylogenetic inference from restriction endonuclease cleavage site maps with particular reference to the evolution of humans and the apes. Evolution. 1983, 37 (2): 221-244. 10.2307/2408332.View ArticleGoogle Scholar - Goldman N, Whelan S: Statistical tests of gamma-distributed rate heterogeneity in models of sequence evolution in phylogenetics. Mol Biol Evol. 2000, 17: 975-978.PubMedView ArticleGoogle Scholar - Goldman N, Anderson JP, Rodrigo AG: Likelihood-based tests of topologies in phylogenetics. Syst Biol. 2000, 49: 652-670. 10.1080/106351500750049752.PubMedView ArticleGoogle Scholar - Yang Z: PAML: a program package for phylogenetic analysis by maximum likelihood. Computer Applications in BioSciences. 1997, 13 (5): 555-556.Google Scholar - Yang Z: PAML 4: phylogenetic analysis by maximum likelihood. Mol Biol Evol. 2007, 24 (8): 1586-1591. 10.1093/molbev/msm088.PubMedView ArticleGoogle Scholar - Stamatakis A: RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics. 2006, 22 (21): 2688-2690. 10.1093/bioinformatics/btl446.PubMedView ArticleGoogle Scholar - Ronquist F: DIVA, ver1.1. Computer program avaialble by anonymous FTP from Uppsala University. 1996, Uppsala: Uppsala UniversityGoogle Scholar This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

<urn:uuid:84811de4-2bf4-41c3-9115-fdb09f23006f>

CC-MAIN-2017-04

http://bmcevolbiol.biomedcentral.com/articles/10.1186/1471-2148-11-281

s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560282631.80/warc/CC-MAIN-20170116095122-00374-ip-10-171-10-70.ec2.internal.warc.gz

en

This week I came across an article which reminded me of an interesting topic I had read about a couple of years back regarding the use of cell phone sensors and portable attachments being used to monitor your health in place of the traditional system of visiting a doctor to investigate symptoms as they appear. In this 2015 article from the Wall Street Journal, Ellen Weinstein examines what the future of medicine will look like as we live longer passed the “smartphone revolution.” She details a world where people are able to gather personal health data on their cellphones to send to doctors for review in order to democratize the process and allow people to take care of themselves on their own time. In her future, phones don’t just collect data, they analyze it and interpret it. There are wearable sensors in this world, passively collecting your vitals and monitoring for danger. There are sensors installed on microstents inside of your veins and arteries monitoring blood for early signs of cancer and other ailments that develop slowly and in secret. This society she envisions isn’t doctorless, but it does shake up doctor-patient relationships. Now, this world isn’t a fully realized reality yet. But, at this point in history, we are getting better and better at shrinking down sensors. In fact, that was what brought this topic back to the front of my mind this week. Scientists out of the University of British Columbia published new research in Nature this week detailing their creation of an ultrasound transducer probe that is portable, wearable, and scaled down to the size of a Band-aid. These scientists (Carlos D. Gerardo, Edmond Cretu, and Robert Rohling) took an existing alternative design of what is traditionally used to create ultrasound scanners and improved on it. This design, called a CMUT, is usually either too expensive to produce or not sensitive enough to compete with traditional ultrasounds that use piezoelectric crystals. Gerardo and his associates, however, were able to tweak this CMUT design using a polymer resin to create what they call polyCMUTS. These can be produced much more cheaply than other CMUT designs, they can produce sonogram images that are as good or better than traditional piezoelectric ultrasound scanners, and they can be powered from a smartphone. While this invention is exciting, the truly exciting step is the next one, according to co-author Robert Rohling, of the development of prototypes and clinical applications using this tech going forward. But this isn’t the only exciting advancement in sensors like this, only the most recent one. For example, in 2009 Timothy Bickmore developed an A.I. “virtual nurse” to help patients, especially disadvantaged people with poor healthy literacy, better transition back to their lives in a safe way when leaving the hospital. He has since developed other A.I. virtual assistants like a couple’s counselor or a personal trainer. This article from the New Yorker examines these innovations in virtual care and whether or not the way humans interface with them is beneficial to humans. For another example, this article in Health Data Management details the recent explosion in glucose monitoring technologies for helping diabetics manage their condition. To put this transition from hospital-centered care to patient-centered health management into perspective, the article compares the life of a woman named Mary Fortune in 1967 to her life now. In ’67, she was hospitalized because it was difficult to reliably measure her blood sugar. Today, however, she is able to continuously monitor her blood pressure throughout the day via a patch on her skin that transmits this data to an app on her phone. On top of virtual nurses and glucose monitoring patches, today’s phones and smartwatches are increasingly including things like heart rate sensors, with phones like the Samsung Galaxy S9 including blood oxygen and blood pressure sensors as well. There are even things like Kardia from AliveCor, an FDA cleared electrocardiogram device that can take medical grade ECG at home in 30 seconds using your phone or a smartwatch. University of Illinois scientists are even building a device that can plug into your phone and analyze blood, urine, or saliva samples. The list of emerging health sensors is massive. My point basically boils down to this: we’re getting better every day at miniaturizing sensors, and these small sensors are only going to become more useful to us. And this usefulness doesn’t have to apply to just medical care. Phones already have a ton of sensors built into them. They have microphones to pick up sound; cameras (some of which are quite good) to pick up images; and accelerometers, compasses, gyroscopes, and GPS to determine its position, orientation, and speed. Since smartphones are almost ubiquitous these days, and many apps are free (or at least cheaper than large sensing hardware), it is hard to not consider using these sensors many students and teachers carry around everywhere for teaching and learning. In fact, some already do see the full potential in phone sensors for teaching physics. In The Physics Teacher, a publication put out by the American Association of Physics Teachers (AAPT), there is a column called iPhysicslabs that is entirely dedicated to physics labs that rely on smartphones and smartphone sensors for their lesson. Though, The Physics Teacher and iPhysicslabs are only available via a subscription or by purchasing individual articles, their archives can still be checked for ideas, at the very least. With free sensor logger software out there, it is really up to your imagination how smartphones can be used to teach science in the classroom. Smartphones in schools are not without controversy, however. This blog article from Teacher magazine lays out two opposing sides of this debate. They describe how the Willoughby Girls High School (WGHS) in New South Wales, Australia and, as of September this year, all of France are banning cell phone usage in schools. On the other hand, they describe how schools like the John Monash Science School in Melbourne, Australia encourage the use smartphones for everything from notes and reminders to using sensors and data logging apps to study motion, pH, temperature, dissolved oxygen, and more. They stress at the John Monash Science School the importance of keeping phones updated, charged, and used only for school related activities. While I understand the urges of schools to entirely ban cell phones because of their likeliness to distract students, I think the possibilities of using smart phones in the lab to teach is too exciting to ignore. I imagine a world where a student might use these new advances in portable medical scanners to study what they are learning in biology class first hand, and then use their phones to also investigate what they learn in physics class. So, despite this argument having two valid sides, I am compelled to believe that these mini computers we (mostly) all carry with us everywhere will become more and more important tools in a lab as time goes on and the sensors become cheaper and more sophisticated. Though these sensors have innumerable ways they can benefit us, the ever-increasing presence of them in our world means one thing: data. A TON of data. If you think we as a species are swimming in an ocean of data right now, you are wrong. This is only a kiddie pool. Compared to the amounts of data we handle today, the future will dwarf it entirely. And, with that said, it is important to give a word to the cautious among us. This much data (and personal medical data, at that) offers up plenty of room for skeptics to worry about the privacy. I share these concerns. Who are we sending this onslaught of data to for storage? Who has access to it? Will we have control over it, or will the companies collecting it? Will doctors be able to view it universally across their systems safely? Will researchers be able to use it for large, cross-population studies? All of these questions are valid and bring up very important points. I don’t quite know that we’ll be able to satisfactorily address these concerns, however, before this future is at our doorstep. Whatever the answers to these questions though, these technologies aren’t slowing down to let us answer them. Are you excited by the possibilities of a world where many sensors are shrinking down to sizes that can be run by a cell phone? Do you have any experience using smartphones to teach? Have you ever used a smart phone to check something health related? Let me know in the comments! Written By: Jacob Monash

<urn:uuid:bee3b699-543c-4973-8308-92f786941fde>

CC-MAIN-2023-14

https://gosciencecrazy.com/blogs/blog-science-crazy/shrinking-sensors-changing-doctors-office-classroom

s3://commoncrawl/crawl-data/CC-MAIN-2023-14/segments/1679296945287.43/warc/CC-MAIN-20230324144746-20230324174746-00630.warc.gz

en

Phone: (214) 491-6090 7701-B West Virginia Pkwy Our Islamic studies program runs in parallel with our primary and elementary programs. All children take time out of their day to focus on learning key topics and texts in Islam. This is a unique and innovate program that seeks to develop children to love God and his Prophet (pbuh), attain a balanced and holistic understanding of the religion, and develop an Islamic character. Key Principles of our program that make it unique: One of the key aspects of MSE Islamic curriculum is that we focus on building the child’s appreciation and love of God as our Creator, Provider and Protector, love of the Prophet (pbuh), love of our families, and love of each other. Instead of framing Islam as a draconian set of do’s and don’ts, we teach it as a way to peace and prosperity. Instead of focusing only on memorization and following rules, we also focus on developing a strong appreciation and understanding of the Qur’an, hadith, and beliefs and practices that come from them. While one can force children to accept a way of life at a young age, they will be free to choose their faith and practices when they grow older. Thus, we want to instill in them the correct understanding they will need to make the right choices for themselves. We employ the same experience-focused approach to teach Islamic concepts that we do in our primary and elementary programs. Montessori-style materials that involve the children’s five senses have been developed to teach Islamic beliefs and practices. We believe that the Qur’an was revealed to be understood and applied, not just to be memorized. Teachers spend a great deal of time explaining and showing the concepts and values from the surahs (chapters) they teach while guiding each child to memorize at his or her own pace. The program begins with short surahs and progresses to longer ones. Students learn the 6 pillars of faith: Belief in one God, the Prophets, the Angels, the Books, The Hereafter, and Divine Destiny. Students learn the timeline of the Prophet’s (pbuh) life and key stories that illustrate his character. Children learn the basic rules of everyday living and how to practice the 5 Pillars of Islam. Children learn daily duas found in the Qur’an and Sunnah. Islamic virtues and manners are explained and incorporated into the everyday classroom setting.

<urn:uuid:6d239ab3-77b5-4a9d-a822-a66f6493e854>

CC-MAIN-2021-04

http://montessoriexcellence.com/programs/islamic-studies/

s3://commoncrawl/crawl-data/CC-MAIN-2021-04/segments/1610703512342.19/warc/CC-MAIN-20210117112618-20210117142618-00555.warc.gz

en

Many people will have suffered the discomfort of cystitis, the inflammation of the bladder. It is horrible and painful. Magnify it by TEN, and you may start to appreciate what ‘Tigger’ was suffering from when he was brought to Isabelle Vets in March. ‘Tigger’ is usually a very fine, handsome and healthy, five-year-old cat who enjoys strutting his stuff around the Vale. One morning he was very down in the dumps and appeared in pain. He didn’t like handling, and the owners thought that he was having problems going to the toilet. This was sudden and unusual as he normally was so well. They decided to play safe and brought him down the Vets. The emergency vet, David Jeffery immediately discovered that Tigger had a painful and distended bladder, it was blocked and not a drop of urine was being passed. This is a true emergency, as once they have developed to this degree, back-pressure will rapidly lead to kidney failure. Vet, David, set in place a sequence of events to depressurise the bladder (cystocentesis) and provide pain relief. He also organised for the diagnostic team to safeguard ‘Tigger’s’ immediate position by placing an indwelling urinary catheter, undertaking urine analysis, blood analysis, radiographs and ultrasound of the bladder while increasing urinary flow with an intravenous drip. Although neutering of male cats is often considered a piece of essential social surgery, stopping smells, spraying, fighting and other anti-social activities, it has other effects as well. Beneficially, the behavioural changes help to potentially reduce disease and trauma. However, a potential negative result (and there are very few) is that it makes the tube from the bladder through the penis (urethra) slightly more narrow than usual, which increases the risk of a blockage. This is what happened to ‘Tigger’. A blockage can occur for many reasons; infection, bladder stones, stress spasm, a tumour, etc. The blood results showed that the kidneys were under severe threat with raised levels of potentially toxic substances, such as creatinine and urea which the kidney normally would excrete. The urine results showed a haemorrhage through the bladder, but there was no firm evidence of bladder stones, active infection or tumours. Intensive care was provided to ‘Tigger’ for several days and slowly his kidney function improved, his appetite returned, and he was able to urinate without a catheter. What was the cause? Probably stress combined with environmental factors. What was that stress? A fight; chased by a dog; fell out of a tree? We will never know. He is now back to his usual marauding self, but the owner sensibly uses a very specific diet which controls urine acidity and mineral content and also has a calming agent built into the food to keep ‘Tigger’ chilled and happy! He is our Pet Hero for June because he survived where many would not have done so, he tolerated our interference and treatment and remained a good and lovely cat. ‘Pet Hero’ is a monthly competition where Isabelle Vets will nominate a pet who they believe has overcome, with stoicism and bravery, an exceptional medical condition, injury or surgery. This could be your pet and with the love and care of his owner and the help of Isabelle Vets they have battled through to become happy and healthy pets, again. At the end of 2017, we will ask all readers to vote for the ‘Pet Hero of the Year’ who will receive a prize in keeping with their position of being a very special animal. You can follow the competition at www.facebook.com/isabellevets Welcome to our news pages. We post updates about Isabelle Vets and the wonderful pets we deal with here in Guernsey.

<urn:uuid:b4429c68-7b19-444c-a541-79bebd19cac5>

CC-MAIN-2020-34

https://www.isabellevets.co.uk/news/pet-hero-5-meet-tigger/

s3://commoncrawl/crawl-data/CC-MAIN-2020-34/segments/1596439738960.69/warc/CC-MAIN-20200813043927-20200813073927-00477.warc.gz

en

Heart of America Council Webelos Scouts look forward to the day when they can participate in Boy Scout camping. Because it provides a taste of the outdoor adventure that awaits them in the troop, the Outdoorsman Activity Badge will be one of the most popular with the boys. It is also one of the most important because it helps prepare them for outdoor life. In most Webelos dens, the boys work on the Outdoorsman badge during the month before their first adult partner and Webelos Scout overnight campout. The reason is, of course, that they should be prepared for the experience of setting up camp, fixing their own meals and enjoying camp life. The activities will give each boy enough of the rudiments of outdoor living to make him comfortable on the campout, with a small amount of equipment, and have an enjoyable experience without trespassing on the Boy Scout camping program. It provides a good foundation for boys when they move into the troop. Todays push-button life is too easy from a physical standpoint. The boys must be given a chance, through their own efforts, to live in the outdoors. It can give them a sense of pride in knowing that they can take care of themselves. Through camping, the boys have a good opportunity to develop citizenship, character, and fitness. It is up the Webelos leader, with the help of other adults, to make this experience an enjoyable one. Suggested Den Activities 1. Show boys how to make an improvised sleeping bag or bed. 2. Study and learn fire safety rules including no flame lights in tents and no liquid starter for 3. Learn aluminum foil cooking 4. Have a den cook-out. Build charcoal stoves. Vent them at top and bottom with can opener. Teach boys how to build a fire in them. 6. Make a first aid 7. Practice camping in the backyard. 8. Practice laying fires for regular wood fires or charcoal, so boys will know how to lay fires for cooking or campfires. 9. Have a tent-making project of a simple tarp tent which will provide shelter for two 10. Make lists of items needed for backyard camping and adult partner and Webelos Scout camping. 11. Learn the 12. Plan and hold an adult partner and Webelos 1. Exhibit homemade tents, first aid kit, improvised sleeping bag, posters on safety. 2. Demonstrate how to make a tent or sleeping bag; explain contents of first aid kit; explain fire safety rules; oral report by adult partner and Webelos Scout on overnight Webelos Scouts are encouraged to have adult partner and son overnight experiences away from home. This is an important step in the transitional period from the Cub Scout to Scout program. The Webelos den adult partner and son overnight experience may be conducted with troops assisting and participating. There are three things to understand about a Webelos overnight experience: First - It is an Adult Partner - Webelos Scout event. The Webelos den leader should let the adult partner and Webelos Scout put up their own tents, prepare their own food and do their own clean-up. The Webelos leader should not take the whole responsibility for the den. He should, however, have a program of activities prepared and everything Second - It is not a tough, pioneering adventure. The campsite should be located in a spot isolated from the rest of the Scout camp or on private property easily accessible by car. More than likely family type camping equipment will be used which is heavy and difficult to carry any distance. Third - It requires protection from the weather, materials necessary for the preparation of food and program items to suit the area where the overnight is being held. Tentage will be required for protection. It does not make sense for a Webelos den to purchase tentage for just a few overnights a year. Put responsibility for tentage on each adult partner. Have each adult partner - Webelos Scout team provide and cook their own meals. Participation in any planned activities should also be as a team. There are other aspects toWebelos overnight camping. The overnight experience for adult partner and Webelos Scout is a den related activity. As stressed earlier, these are adult partner and Webelos Scout events, under the direction of the Webelos leader. Obviously, it is desirable to have each boy under the supervision of his own adult partner. The main point is that every boy should be under the supervision of a responsible adult. Let all adult partners get involved in the planning of the trip or ovemighter and give them definite real responsibility. During the planning meeting have a positive attitude. These adult partners are expected to be part of the activity. The dictionary defines Scouting as exploring an area so to obtain knowledge. The key letters to remember in the word Scout are OUT, as in outdoors. In order to go scouting you must go outdoors. In this section we will examine the proper way to eat, sleep, dress and make ourselves at home in the great outdoors. Two things can be accomplished at Den meetings Planning and Preparation. There are many planning guides available to Webelos Den Leaders. Equipment And Tents 1. Explain the plans for the overnight campout and distribute a personal equipment checklist to each boy-adult team. Review the checklist and discuss plans for obtaining tentage. 2. Have instruction and practice in pitching the tents you will use. Also have practice in making a ground bed. 3. Ask the den chiefto lead practice in tying knots needed for the campout. 4. Review the outdoor code. Each tent should have its own bag and should be labeled. Never pull a stake out by pulling on the grommet or canvas. Never leave a stake in the ground without a rope. If tents must be packed wet, be sure to set them up to dry out as soon as possible. Loosen ropes when canvas is wet so that the canvas wont tear while drying. Waterproofing solutions are available through Sears, Army Surplus, and other distributors of tents and Use a ground cloth under your tent, but be sure to tuck all the edges, all the way under the tents floor. 1. Practice fire lays for cooking and council fires. Stress safety in preparing fire sites, lighting, and putting out fires. Use the same type fuel (wood or Charcoal) that you will use for cooking fires on the campout. 2. Discuss the menu for the campout and show how to prepare the food. 3. When fires are ready, end with a marshmallow roast. From what point do you leave? How long will it take to travel to the camp site? When will we Have you filled out a local tour permit? (At least two week before departure) or other permits required? Does the campsite lend itself to conservation service project? available or do we need to bring it from home? Is the water supply safe or do we need to bring our own? Do we have enough cars and qualified drivers to carry boys, adults and equipment? What about car What about public Is there an adult to accompany every boy? substitutes adults needed? Is the den chief coming? Was he involved in the planning? Will anyone from the troop be there? Do the boys and adults know what to bring? Who will bring bow saws for Who will bring the first aid Have we planned a simple menu? How many meals? Which ones? Are there utensils to match eating utensils? Paper plates and cups for easy disposal? Games? What kind? Who will Campfire? Who is responsible for what? Hikes? Swimming? Fishing? Boating? Who? Equipment Check List Pack or bag for underwear, shirts, pants, (1 pair per day), socks (2 pair per day) Sweater or jacket Knife, fork and Mess kit (plastic Toilet kit (soap, toothbrush & paste, comb, towel) Sleeping bag or for the program In Boy Scouts the boy who keeps records, narratives and pictures of scouting activities is the troop Historian. For your overnight campouts try to get one of the boys to bring a camera (with his parents permission) and serve as historian. Have him mount his pictures on a display board and tell all the details of your outing at the next pack meeting. Divide into two teams. Give each team captain a 12 in. length of clothesline rope. At signal, the captain ties a double knot in the rope and passes it to the next in line. The second person unties the knot and passes it to the third person, and so on down the line. The first team to finish wins. The Frayed Knot Slide The Frayed Knot Slide is made to immortalize a great story. There was a hungry piece of rope. He wandered into a small cafe and sat down at a corner table. The head waiter came to the table and said, Hey ! Arent you a piece of rope? We dont serve rope here! He quickly escorted out friend out of the door and onto the curb. Not to be put off, our hero unraveled an inch or so and strolled back into the same cafe. Again the head waiter came over. Arent you that same piece of rope I just threw out of here? he asked. Oh no!. said our friend. Im a Frayed Knot! (afraid not) 1. Gather the wire. Check with the phone company or an electronics repair shop. 2. Put four or five colors together in a tight band. Make a loop and twist the ends. The loop should be about an inch wide. Twist the ends tightly, as this will hold the loop tight. 3. With the remaining ends, make a jumble of colors. Try wrapping the wires around pencils and then pulling out the pencils. Try anything, just make a large mess about the size of a 4. Remember to instruct the boys on the story of the Frayed Knot so that when someone asks about their slide they will be prepared to tell the story. How to Make a Compass Bowl of water 1. To magnetize the needle, rub the magnet down the needle 50-60 times. Always rub in the same direction. 2. Put the needle in the cork and place it in the water. 3. Which way does it point? Turn the cork the other direction. What happens? Materials found in Baloo's Bugle may be used by Scouters for Scouting activities provided that Baloo's Bugle and the original contributors are cited as the source of the Materials found at the U. S. Scouting Service Project, Inc. Website ©1997-2002 may be reproduced and used locally by Scouting volunteers for training purposes consistent with the programs of the Boy Scouts of America (BSA) or other Scouting and Guiding Organizations. No material found here may be used or reproduced for electronic redistribution or for commercial or other non-Scouting purposes without the express permission of the U. S. Scouting Service Project, Inc. (USSSP) or other copyright holders. USSSP is not affiliated with BSA and does not speak on behalf of BSA. Opinions expressed on these web pages are those of the web authors.

<urn:uuid:0c5ebf0e-e6b9-4c7f-b6a6-23c2af99fc18>

CC-MAIN-2018-05

http://usscouts.org/bbugle/bb0204/bbw2.html

s3://commoncrawl/crawl-data/CC-MAIN-2018-05/segments/1516084887077.23/warc/CC-MAIN-20180118071706-20180118091706-00772.warc.gz

en

As we headed from party crazy Prague into Austria and Germany, things got a little more serious. The historical significance of the places we went to such as Dresdon and Berlin were absolutely mind blowing and also quite confronting at times. This blog post is about our stop-off at one of the largest concentration camps used by the Nazis during World War II: Mauthausen. All the photos from this post have been sourced from Google images as I didn't take any of my own. On the way to the concentration camp, we watched a movie called The Boy In Striped Pyjamas. For those who haven't seen it, it is set in World War II and is about a little boy's innocent view of humanity. His family is quite well off as his dad is quite a powerful part of the Nazi party, however the little boy recognises that people are inherently good and therefore ignores the lies he hears about Jewish people. He befriends a little Jewish boy and from there, a very moving friendship grows between two people who should not be friends. I definately recommend watching it if you haven't yet seen it. Even though the movie had set the scene in terms of concentration camps, the Nazi attitude, and the disgusting way the Jewish people were treated and ultimately killed, nothing could prepare us for Mauthausen concentration camp. Established in 1938, prisoners were initially sent to Mauthausen as slave labour for a quarry nearby. While the Germans needed prisoners for labour, the terms 'return not desired' and 'extermination by work' were used by the Nazi party. Not too long down the track, the camp became overcrowded and, even though other camps were built nearby, the Germans had too many prisoners and not enough space to hold them. Initially, sick prisoners were sent to other concentration camps for extermination. However, from 1940 onwards, the prison system was becoming much too expensive for the Nazi party and by 1941, Mauthausen had its own gas chamber that had the capacity to murder 120 people at a time. While the exact death toll is unknown, it is estimated that between 150,000 and 250,000 people were killed at the Mauthausen concentration camp. The gas chamber murders were also severely in-humane. First the prisoners were lined up, beaten, and told to walk toward the gas chamber building. They were then checked for any gold teeth, which if found, were then ripped out of the prisoners. They were then shepherded into the gas chamber to await their death. Once murdered, their bodies were thrown into massive commercial crematorium ovens and burnt, often multiple bodies at a time. When we entered the gas chambers and crematorium on our way through the Mauthausen camp, the air was so thick you could almost feel all the pain and fear that had gone through that room in the past. Many people were also murdered by the SS guards outside of the gas chambers and were made to look like suicides. This included hosing prisoners down and then leaving them to freeze to death, or throwing prisoners into the electric fence and pretending that they were trying to escape. Unfortunately, this still wasn't a quick death for them as anyone on the electric fence would stay alive and char for 2-3 hours until finally a guard would shoot them. Toward the end of our tour through Mauthausen, we walked through the Room of Names. This is a room with incredibly large books recording every name that was killed at the concentration camp. Each name was also written on dark tables that filled the room. Seeing places like this has showed me how much history there is that I don't know about. The things that happened are recognised in society as terrible things, however it is just impossible to fathom the events that took place and therefore many people kind of turn a blind eye to it. After seeing this and other museums throughout Europe, I have decided to continue to learn about World War II and the terrible things that occurred during that time. Hopefully you have learnt something through this post. If you have any questions, please leave them in the comments and I will endeavour to research and provide an answer.

<urn:uuid:40cb0497-6438-4b15-b820-7c74e489b755>

CC-MAIN-2023-50

http://www.scottsimenauer.com/2015/06/mauthausen-concentration-camp.html

s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679101779.95/warc/CC-MAIN-20231210092457-20231210122457-00792.warc.gz

en

The History of the Gwyn Hall Howel Gwyn, benefactor of the Gwyn Hall, was a prominent public figure in Victorian Neath society. During his political career he had served as alderman, town councillor, mayor, Freeman of the Borough, chairman to the board of Guardians, High Sheriff of Glamorgan and MP for Brecon and Falmouth. A generous benefactor to the town he was revered for his paternalism having made substantial gifts and land for St David’s Church, Alderman Davies School, the building of the Constitutional Club and St Matthew’s Church, Dyffryn where he is buried. At his mansion in Dyffryn he hosted an annual fete for his tenants and provided the Christmas luncheon at the Neath Union Workhouse. The Gwyn Hall and Municipal Offices In 1882 Alderman Howel Gwyn, offered to assist in the finance of a new public hall and municipal offices for the town of Neath. After a number of years a site for the new hall had not been found and so at a public meeting in 1885 Gwyn announced that he would find suitable land himself donating the site on Orchard Street for the purpose. Funds for the project could not be raised by The Neath Corporation and to ensure the hall’s completion Gwyn agreed to pay for the building as well, donating a further £200 for the project. The final cost of the hall however was estimated at around £6,000. It was agreed that Gwyn could choose the architect himself and in March 1886 plans were received from London based architect John Norton who also designed St David’s Church in Neath. A description of the hall in 1891 was as follows: …a building of blue sandstone with Bath stone dressings, in the Gothic style, and consists of a large public hall, which accommodates 1,500 people, a council chamber and municipal offices; the cost of erection was about £7,000; the Glamorganshire county council hold meetings here quarterly; the borough council and various meetings of the county authorities are also held here. In front of the hall is a fine bronze statue of the late Howel Gwyn Esq. Designed by Raggi, and erected by subscription by the principal residents of the neighbourhood and county. Kelly’s Directory of South Wales, 1891 As part of the Queen’s 50th jubilee celebrations (and coincidently Howel Gwyn’s 81st birthday), Mrs Ellen Gwyn laid the foundation stone of the building on the 21st of June 1887. Sadly Howel Gwyn did not live to see the completion of the hall, dying peacefully at Dyffryn House on the 25th of January 1888. The hall took a further eight months to complete and was opened (informally) with the unveiling of a statue of its benefactor outside the Gwyn Hall on September the 26th, 1888 by Sir John Llewellyn Bart. Sculpted by Signor Merrio Raggi its positioning caused much controversy at the time as it was thought it would interfere with carriages pulling up outside the building. The first performance at the hall on the 21st of December 1888 was a capital concert arranged by the Town Band and Mr J. S. Church. As a further memorial to her husband, Mrs Gwyn pledged money for an organ to be placed at the hall. It was unveiled at the ‘official’ opening ceremony on the 7th of November 1889 to her husband’s favourite oratorio, Handel’s ‘Messiah’. The organ was removed in 1949 as part of renovations to improve the theatrical space, extending the stage and wing space for scenery. A newspaper article records that on the removal of the organ the names of those who originally built and fitted it in the hall were revealed, inscribed upon the arches of the back wall. Throughout its history the hall has hosted concerts, plays, musicals and even wrestling matches. Adelina Patti performed on numerous occasions; Charles Dickens (junior) gave a recital of his father’s works to an appreciative audience in 1889; David Lloyd George once gave a speech there and a young Leo McKern appeared with the Western Theatre Company in ‘Cockpit’ in 1948. More recent stars that have treaded the Gwyn’s stage are actor Steven Meyo, opera star Katherine Jenkins and the Stereophonics. In 1989 the Gwyn Hall received a Grade 2 listed building status. Plans were made to improve the hall with a £4 million development but with just a few months to go before opening the building was destroyed by fire on the 21st of October 2007. Thanks to support from a strong friends group and a continued commitment from Neath-Port Talbot County Borough Council the Gwyn Hall is officially open once more on the 8th of March 2012. Heritage Education Officer

<urn:uuid:4e3635d5-07f8-4ba8-99b3-b27f48db8115>

CC-MAIN-2018-43

https://gwynhall.celticleisure.org/about-us/a-proud-history/

s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583512323.79/warc/CC-MAIN-20181019041222-20181019062722-00001.warc.gz

en

Twenty-five years ago, the Wall fell and the two German states, which until then had been separated, became once again a single state. But not in all areas are the differences between FRG and the former GDR completely balanced. In addition to the still existing differences in wages, differences in financial behavior are also recognizable. Thus, a large German online comparison portal has taken the credit behavior of East German citizens with the West German national under the microscope. The result of this investigation revealed that people in the East are applying for significantly less credit than people doing in the so-called “West” of the Federal Republic. On average, the lending volume there is 12 percent higher than in the East. It is interesting, however, that the difference in interest rates for loans between East and West is nowhere near as serious, but more on that later. Loans over 10,000 euros the rule The loans taken up by the citizens in the East between July 2014 and June 2015 reached an average of € 10,369, whereas the average loan amount of € 11,585 in the West was significantly higher. To what extent the still existing wage differentials between East and West could play a role in the granting of the loan or the loan amount is not clear from the study of the comparison portal. On the other hand, it is interesting to look at the level of loans by federal state, because here in the west are Bavaria, Baden-Württemberg at the forefront, whereas in Saxony, Thuringia and Mecklenburg-Vorpommern the lending volume is the lowest. Obviously, the demand for credit is highest in the federal states, where current statistics show the highest per capita income. Generally speaking, however, the loan amount shows a clear decline, because only 1 year before, the average loan amounts were still well over 15,000 € nationwide! Income Does Not Affect Interest Rates on Credit! As mentioned at the beginning of the article, the difference in interest rates in the East-West comparison is not so severe compared to the loan amount, because for a sample loan of € 10,000 with a maturity of 84 months, banks in the West estimated an average effective interest rate of 4.83 percent. Customers from Eastern Germany received this loan combination at an average effective interest rate of 4.97 percent. The interest differential between East and West is thus around 3 percent. Faster repayment of loans in the East As a final finding, it also became apparent that East German borrowers are aiming for a much faster repatriation of a loan taken compared to the West German citizen. On average they opt for shorter loan terms (44 months in the east, 47 months in the west). The loans are taken up in the East mainly for the financing of consumer goods (49 percent), such as furniture or technology and motor vehicle financing (40 percent). In West Germany, on the other hand, car buying is the most common reason for borrowing (42 percent) – followed directly by consumer credit (41 percent).

<urn:uuid:88c57f03-482e-4e4c-91c5-3600a99c64ac>

CC-MAIN-2020-50

http://www.gobelins-annecy.com/the-difference-in-wages-among-countries/

s3://commoncrawl/crawl-data/CC-MAIN-2020-50/segments/1606141203418.47/warc/CC-MAIN-20201129214615-20201130004615-00636.warc.gz

en

There is an increasing pressure to reduce the level of food waste before it even reaches the table. It's believed that 1.9 million tonnes of foodstuff are dumped each year in the UK alone. This is considered to be not just an economic imperative but also a social and ethical dilemma. While in some parts of the world people starve, in others vast amounts of perfectly edible food are dumped or neglected to the point of no return. How can organisations in the food industry, from producers to retailers, make a positive difference? Using local suppliers One of the more successful measures employed so far has been to support more local producers in the areas around supermarkets, which helps to reduce transport emissions. It also provided food retailers with a competitive advantage, as consumers are now demanding "less travelled" food in stores that is fresher, and therefore sourced more locally. Technology in logistics and transport Fortunately, technology is increasingly providing solutions for the swift and effective movement of foodstuffs, including greater automation. For example, it's now possible to put sensors even within individual cases, as well as lorries, to monitor the status of their contents and the temperature. These techniques enable logistics and transport teams to move food around with greater control, avoids previous issues with delayed or misplaced lorries having to dump their contents and minimise incorrect temperature levels that can spoil the goods. Assessing the hub network and create a more intuitive logistics network, will provide the ability to sort and split consignments, the sending of required and accurate quantities to their required destination. By having a strategic hub network can also help reduce lead times and transport costs in the long run. Change perception of what is acceptable Many have been horrified by recent reports; a report from the University of Edinburgh, suggests that over 50 million tonnes of fruit and vegetables or around a third of the total produce grown in Europe, are discarded annually as they are believed to be 'too ugly to sell’. But this is not just due to the supermarkets wanting perfect displays or consumers perception of what is edible fruit and veg - the Government has also imposed strict regulations on the shape and size of produce. Companies in the industry should work together to encourage a wider acceptance of the way fruit and veg appear in its natural form and find ways of using the produce that is 'too ugly to sell'. Education and consumers Taking measures to provide better food education and information includes providing the general public with more information on creative uses or recipes for leftovers which could help reduce what goes in the bin. It could also include providing children more opportunities to learn about the origins of their food and even basic cooking skills. The above point also hinges on clearer food labelling too, and a greater understanding of food "best before" dates and other information. Manufacturers and retailers can create sustainable and easy to understand systems to show ingredients and shelf life without encouraging consumers to dump foodstuffs that could potentially still be viable. New packaging concepts Intelligent packaging is also an important way forward. However, it represents a massive challenge to food companies. There is increasing pressure to minimise product wrappings and containers – especially plastic – but packaging plays a massive role in keeping food products fresh enough to sell. Finding a sustainable solution is vital. Better resource management From food producers, through to manufacturers and logistics firms, right to the retailers, there is one step forward that can help them all to combat food waste. It involves utilising the transparency and control offered by having connected and data-rich technology. Well configured Enterprise Resource Planning (ERP) software provides limitless possibilities to precisely manage the collection, storage and onward movement of foodstuffs. For details of how WinMan ERP software can better support those working in the food industry in increasing efficiency in the supply chain, eliminating waste and creating more opportunities for productivity and profitability, contact us today.

<urn:uuid:09df148d-dc87-4474-ad07-a515d059731c>

CC-MAIN-2024-10

https://www.winman.com/blog/how-food-manufacturers-can-help-minimise-food-waste-within-the-supply-chain

s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474544.15/warc/CC-MAIN-20240224180245-20240224210245-00043.warc.gz

en

Together with the CIC Applied Science and Culture Divisions, the aim of the Policy and Law Division (PLD) is to advocate the benefits of conservation through the sustainable use of wildlife. In today’s political landscape, science alone is often not enough to promote the benefits of sustainable use. The three pillars of sustainability: economy, ecology and social matters, are all linked to the work of the Division. The principle of sustainable use is widely recognised in the United Nations (UN) and other international conventions. Within the field of biodiversity conservation, the Convention on Biological Diversity (CBD) has established the sustainable use of the components of biological diversity as one of the three pillars of the CBD. This is further strengthened under the CBD by the Addis Ababa Principles and Guidelines for the Sustainable use of Biodiversity. The PLD aligns itself with these principles and strives to identify mutually beneficial activities in promoting them.

<urn:uuid:ea00e730-fe3a-44c7-9dbd-3a8479115540>

CC-MAIN-2020-05

http://www.cic-wildlife.org/fr/divisions/policy-law/

s3://commoncrawl/crawl-data/CC-MAIN-2020-05/segments/1579250609478.50/warc/CC-MAIN-20200123071220-20200123100220-00295.warc.gz

en

The Bible3,61 79 5 Scritto da: Karen Armstrong Letto da: Josephine Bailey In this seminal account, acclaimed historian Karen Armstrong discusses the conception, gestation, and life of history's most powerful book. Armstrong analyzes the social and political situation in which oral history turned into written scripture, how this all-pervasive scripture was collected into one work, and how it became accepted as Christianity's sacred text. She explores how scripture came to be read for information and how, in the nineteenth century, historical criticism of the Bible caused greater fear than Darwinism. The Bible is a brilliant, captivating book, crucial in an age of declining faith and rising fundamentalism. Più informazioniEditore: Tantor Audio Durata: 6H 9Min

<urn:uuid:f27d4bdc-119e-4448-975d-4bdcc24d6d72>

CC-MAIN-2020-34

https://www.storytel.com/it/it/books/49653-The-Bible

s3://commoncrawl/crawl-data/CC-MAIN-2020-34/segments/1596439737172.50/warc/CC-MAIN-20200807083754-20200807113754-00038.warc.gz

en

Why is it that what one art critic considers a masterpiece looks like a child’s finger painting to someone else? Psychological scientists are looking for answers by analyzing art, society, and the human brain. In a paper published in March 2011 by the Journal of Cognitive Psychology, Annukka K. Lindell and Julia Mueller review scientific research addressing subjective visual art appreciation. While Lindell and Mueller acknowledge that science may never be able to predict anyone’s reaction to a piece of art with complete accuracy, they also report that studying the psychology of visual art has allowed scientists to understand which variables contribute to our preferences. According to Kindell and Mueller, bottom-up influences such as abstraction, form, complexity, and symmetry can be used to predict a viewer’s response to art. Top-down influences such as novelty and life experiences of the viewer also influence artwork’s reception. It’s not the case, the authors argue, that aesthetic opinions are completely random and unpredictable. Science is dissecting the relationship between art and its viewers in order to explain what we like about our favorite art. Leave a comment below and continue the conversation.

<urn:uuid:c44254e9-09ec-49ad-b0f7-332f9ed74390>

CC-MAIN-2015-11

http://www.psychologicalscience.org/index.php/publications/observer/obsonline/beauty-in-the-brain-of-the-beholder.html

s3://commoncrawl/crawl-data/CC-MAIN-2015-11/segments/1424936462898.92/warc/CC-MAIN-20150226074102-00060-ip-10-28-5-156.ec2.internal.warc.gz

en

A low-cost laser scanning system could help in the fight against document and ID fraud, according to its developers at Imperial College London. Important documents could be identified by their own "fingerprints" The Laser Surface Authentication (LSA) system scans tiny surface variations of paper, plastic, metal and ceramics to detect the material's "fingerprint". The system then records the naturally occurring pattern of imperfections. The imperfections are so minute, say the scientists, that they are virtually impossible to replicate. "A unique 'fingerprint' is formed by microscopic surface imperfections on almost all paper documents, plastic cards and product packaging," explained Professor Russell Cowburn, professor of nanotechnology at Imperial College, London. "That is what makes it possible to develop a much cheaper method to combat fraud because this inherent identity code is virtually impossible to modify. It can easily be read using a low-cost portable laser scanner." It could be used on materials such as passports, ID cards, credit cards, music or software CDs and DVDs, banknotes, and packaging. He said the system signalled a shift in the approach to authentication and ID techniques. It offered a much simpler and largely foolproof, in-built - thus cheaper - way to authenticate and track sensitive documents than current methods, such as holographs. The "fingerprints" of the materials are made up of different variations of ridges and grooves which characterise materials, a few hundred nanometres in size. The Imperial College and Durham University scientists used an optical phenomenon known as "laser speckle" to detect the variations in surfaces. Laser speckle occurs when a focused beam of laser light scatters over a random system, such as the surface of paper. The scanner records the way the laser light is reflected off the surface of the paper or plastic. The speckles, as with human fingerprints, are almost unique, said Professor Cowburn, who described the system in the journal Nature. He said it could help to clamp down on fraud, drug counterfeiting, terrorism and identity theft. A quarter of UK adults have had their identity stolen or know someone who has fallen victim to ID fraud, a survey suggested earlier this year. The system works on surfaces such as CDs too It is one of the UK's fastest-growing crimes, with criminals netting an estimated £1.3bn last year. There are also concerns over passport document fraud following the London Underground bomb attacks. Leader of the Commons, Geoff Hoon, suggested last week that extra passport checks could be brought in as ministers looked into how a London bomb suspect was able to leave the UK. If deployed, it means that a passport, for example, could be quickly scanned using the system and its laser speckles recorded and encoded in a unique serial number or onto a database before being issued. It could then be quickly re-scanned and checked against its record when authentication is required. The laser system, which includes a low-cost, portable scanner, is extremely accurate, according to the research team, and it also still recognised surface patterns after the materials had been abused. Different materials were handled roughly, placed in water, burnt, scoured with an abrasive cleaning pad and covered in black marker pen, but the laser was still able to read the surface fingerprint. "The beauty of this system is that we do not need to modify the item being protected in any way with tags, chips or ink - it is as if documents and packaging had their own unique DNA," said Professor Cowburn. The system, according to the researchers, makes spoofing the unique document fingerprints extremely difficult, if not impossible currently, because there is no way to replicate the surface structures artificially.

<urn:uuid:dab95a6e-276d-4b64-bd43-db45fec5a96c>

CC-MAIN-2016-18

http://news.bbc.co.uk/2/hi/technology/4741809.stm

s3://commoncrawl/crawl-data/CC-MAIN-2016-18/segments/1461860113541.87/warc/CC-MAIN-20160428161513-00009-ip-10-239-7-51.ec2.internal.warc.gz

en

We drew this dinosaur specially for our kid's app "Ginkgo Dino". Tarbosaurus lived during the Late Cretaceous period (over 70 million years ago). It’s the Asian step-brother of T.rex. Tarbosaurus was slightly smaller than T. rex, but this didn’t make it any less terrifying. We spent several weeks to draw and animate this character. The scientific name of the only known species of Tarbosaurus, Tarbosaurus bataar, comes from the Mongolian word, "baatar" which means "hero". "Ma" is commonly used in scientific disciplines such as geology, paleontology, and celestial mechanics to signify very long time periods into the past or future. For example, the dinosaur species Tarbosaurus bataar was abundant approximately 70 Ma (70 million years) ago.

<urn:uuid:80a3fe3f-ff55-4d1c-9eaa-ecc7123acb2d>

CC-MAIN-2018-13

http://www.neatoshop.com/product/Tarbosaurus-Est-70-Ma-Ago

s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257647153.50/warc/CC-MAIN-20180319214457-20180319234457-00706.warc.gz

en

Audio Description Performance What is audio description? Audio description is a verbal commentary that tells visually impaired theatre-goers what is happening on the stage during the parts of the performance where there is no dialogue (i.e. during fight scenes). The description does not interfere with the performance but fills in the gaps, describing facial expressions, costume, scenery and action sequences so that anyone with a sight problem can follow the plot fully and independently. Many visually impaired theatre-goers are enthusiastic about audio description. How does audio description work? The trained describer sits in a soundproof booth or box in the theatre and explains what is happening on the stage. Usually, the describer has seen the performance three or four times before and is well prepared to describe the performance. Visually impaired theatre-goers are equipped with a headset or earpiece before the performance and the description is relayed from the booth to the headset/ear-piece via an infrared or radio sound system. Can theatre-goers sit in any seat in the theatre? No, specific seats are allocated in the theatre, mostly in the Stalls or Dress Circle, so there is clear transmission between the describer and the headsets.

<urn:uuid:5fac1782-7911-4982-9ff3-3ae9a317040b>

CC-MAIN-2016-26

http://www.seetickets.com/CONTENT/SEE-ACCESS-AUDIO

s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783394414.43/warc/CC-MAIN-20160624154954-00135-ip-10-164-35-72.ec2.internal.warc.gz

en

China Bird Watching Network website Bird watching is becoming increasingly popular in China mainland. In the past couple of years, more and more bird watching societies have been formed. Learn more about these bird watching societies. This website provides information about this emerging community of bird watchers. It is also hoped that it would facilitate the sharing of experience, birding information, education material and conservation news within the community. Publication of China Coastal Waterbird Census Report (1.2010-12.2011) China Coastal Waterbird Census started in September 2005 with the aim of understanding the distribution, migration and seasonal changes of waterbirds along the eastern coast of China mainland through the monthly surveys. It is hoped that results of the census can help in conserving China's biodiversity and Important Bird Areas. This is the third publication and it incorporates the reports written by the coordinators based on the data collected from January 2010 to December 2011. Proceedings of 2010 Seabird Conservation and Marine Protected Areas Management International Forum The 2010 Seabird Conservation and Marine Protected Areas Management International Forum was held during 12 -14 Jul, 2010 in Xiangshan, Zhejiang Province. More than 60 government officers, experts, and representatives of civil societies from the U.S., Japan, Hong Kong, Taiwan, Shandong, Zhejiang, Fujian participated in the meeting. This proceedings contains the minutes of the meeting and reports given during the forum. The China Bird Report Checklist of Birds of China 2010 This masterpiece is eventually released in March 2010. Directory of Important Bird Areas in China (Mainland): Key Sites for Conservation Launched at the 23rd Society of Conservation Biology Meeting in Beijing in July 2009. Published by BirdLife International after consulting Chinese ornithologists, birdwatching societies in different parts of mainland China and Chinese birdwatchers, the number of Important Bird Areas (IBAs) in China (Mainland) increased from 445 in 2004 to 512 in 2009. There are another 56 IBAs in Hong Kong, Macau and Taiwan. China Coastal Waterbird Census Report (1.2008-12.2009) China Coastal Waterbird Census Report (9.2005 - 12.2007) Rare Birds Yearbook 2009 Published by the BirdLife International in November 2008, this is a book about the 190 rarest birds (those categorized as Critically Endangered on a global scale) with the objective to describe the situation of these birds in a comprehensible and popular way and to attract and involve persons who have not dedicated their lives to birds, but also engage those who have. £4.00 will be donated to BirdLife International for the protection and conservation of these exclusive species for every book sold. To order, please click here. Publication of the 2007 "China Bird Report" Published by the China Ornithological Society.The record covers a total of 1070 species from 68 families and 16 orders, which is about 80% of the total bird species recorded in China.These records include one species which is newly described by science, three species which are additions to the national checklist, and a suite of species which are additions at provincial-level. In terms of globally-threatened species on the IUCN red-list, the current report includes four Critically-endangered species, 10 Endangered species, and 42 Vulnerable species, whilst also highlighting species under National Protection Class I. Publication of the 2006 "China Bird Report" Published by the China Ornithological Society.The record covers a total of 1078 species from 70 families and 17 orders (55 species more than that in the 2005 Report), which is about 80% of the total bird species recorded in China. China Bird Festival 2007 Same as last year, the Festival brings excellent birdwatching atmosphere to China mainland! 12 active birdwatching societies in China join the Festival and hold at least 30 different activities to attract people to go out and watch birds during the wonderful weather of autumn. For activity details and up-to-date news about the Festival, please click here (in Chinese). The first China Bird Festival This year is the first time for birdwatching societies in China to join the BirdLife International's World Bird Festival. 12 birdwatching societies organized excellent and attractive activities which created a wonderful birdwatching atmosphere in October 2006! This forum is treated as a platform for different bird watching societies in China to communicate with each other and the "Birder Inquiry" there is a place for birders to ask questions about bird identification and birding. The "Overseas News" is a convenient place for them to notice overseas news about birding and bird conservation in other parts of the world. Conference on Organizational Development of Bird Watching Societies in China (2006) organized by the China Ornithological Society and the Chengdu Bird Watching Society and supported by Darwin Initiative and the Hong Kong Bird Watching Society was completed successfully in Chengdu in 1-2 May 2006. Summary and conclusion of the meeting (both in chinese) have been prepared for sharing. A Database of the Birds of China - now has 33,463 images of 1,265 species (till 22nd May 2012)! The database is a collaboration between China Ornithological Society and Shenzhen Bird Watching Society. China Bird Gallery - now has 101,068 images of 1,134 species (till 22nd May 2012)! Developed by an active volunteer, the gallery provides a user-friendly way to search for pictures according geographical location. Wild birds and avian flu - BirdLife International statement - Avian flu: update information - Advice to birdwatchers - Advice for public authorities on HPAI at the 9th Conference of Contracting Parties of the Ramsar Convention (Kampala, Uganda, November 2005) on HPAI at the 8th Conference of Contracting Parties of the Convention on Migratory Species (Nairobi, Kenya, November 2005) Important Bird Areas and potential Ramsar Sites in Asia launched at the 9th meeting of the Conference of the Parties to the Convention on Wetlands or Ramsar Convention (Ramsar COP9) in Kampala, Uganda in November 2005. The book identifies 1,111 Important Bird Areas (IBAs) which contain wetland areas that qualify as Ramsar Sites. Besides the official designated ones in Asia, about 89% of the potential sites identified in the BirdLife International report have not yet been afforded protection under the Ramsar Convention. >> More info New!! Other conservation updates can be found here.

<urn:uuid:114cfaa3-ab05-4704-bcc3-f878d4334273>

CC-MAIN-2020-45

http://chinabirdnet.org/indexe.html

s3://commoncrawl/crawl-data/CC-MAIN-2020-45/segments/1603107894175.55/warc/CC-MAIN-20201027111346-20201027141346-00251.warc.gz

en

Storm Doris has become a "weather bomb" as it batters Britain according to forecasters from the Met Office. The storm swept in across the west of the UK on Thursday morning, bringing with it heavy rain and wind gusts of up to 80mph. Flights have been cancelled at Manchester Airport, trains delayed on the line to Liverpool and filming has been cancelled on the set of Coronation Street. But what is a weather bomb? While it may sound like a term dreamed up by tabloid headline writers, there is actually a way for meteorologists to measure it. According to forecasters, the storm "rapidly deepened" this morning and underwent "explosive cyclogenisis". This process happens when dry air flows quickly into an area of low pressure. It creates a more vigorous storm, or weather bomb, as the air within the depression rises very rapidly, increases its rotation and intensifies the pressure. Meteorologists say to be classed as a weather bomb, the central pressure of the storm system must dip by 24 millibars in a 24-hour period. Storm Doris has fulfilled this criteria, meaning it is now a weather bomb. It may explain why the storm has caused so much disruption, including a blocked railway line at Liverpool Lime Street which means there is severe disruption between Manchester and Liverpool. A number of flights have been cancelled including to the Isle of Man and Amsterdam. Passengers whose flights are cancelled are being advised to take advice about getting their money back.

<urn:uuid:970d88f3-d522-4710-a818-2081f20ce38f>

CC-MAIN-2018-17

https://www.manchestereveningnews.co.uk/news/greater-manchester-news/storm-doris-weather-bomb-met-12645760

s3://commoncrawl/crawl-data/CC-MAIN-2018-17/segments/1524125945459.17/warc/CC-MAIN-20180421223015-20180422003015-00433.warc.gz

en

This time signature chart shows the most common regular time signatures. A regular time signature is one which represents 2, 3 or 4 main beats per bar. Duple time means 2 main beats per bar Triple time means 3 main beats per bar Quadruple time means 4 main beats per bar Any time signatures which do not have 2, 3 or 4 main beats per bar are classed as irregular. They are not shown in this time signature chart. The time signature chart also shows you which are simple and compound time signatures. Simple time signatures have a main beat which divides into two 1st level sub-beats. The top number is 2, 3 or 4. Compound time signatures have a main beat which divides into three 1st level sub-beats. The top number is 6 (duple), 9 (triple) or 12 (quadruple). In both simple and compound time, 2nd level sub-beats always subdivide by two (never by three). |Time Signature Chart |Main beat/1st sub-beat/2nd sub-beat In simpe duple time, there are two main beats per bar. The 1st and 2nd level sub-beats are beamed to show two beats per bar. In simple triple time, there are three main beats per bar. The 1st level sub-beats are beamed in sixes, and the 2nd level sub-beats are beamed to show three beats per bar. In simple quadruple time, there are four main beats per bar. The 1st level sub-beats are beamed across two main beats. The 2nd level sub-beats show four beats per bar. In compound time, the main beats are dotted. The 1st level sub-beat is beamed in threes, and the second level sub-beat is beamed in sixes. You will probably come across other time signatures which are not on this chart. In Bach’s first book of 48 Preludes and Fugues, for example, you can find the time signatures 12/16 and 24/16. Time signatures with a lower number 16 are rare, but do crop up from time to time. However, the chart shows you the most common regular time signatures which you are likely to find today. How Time Signatures Work Time signatures give you information about the “main beat” in a piece of music, and how that beat is divided up. Most music has 2, 3 or 4 “main beats” per bar. This is the pulse you would tap your foot or clap to. Music with 2, 3 or 4 pulses per bar is called “regular“. Some music written since the turn of the 20th century has an “irregular” main beat, meaning that there are not 2, 3 or 4 main beats per bar, but some other number. Common irregular pulses are 5 or 7 main beats per bar. (e.gs in simple time). Music with 2 main beats per bar is in “duple” time. Three beats per bar=”triple” time, and 4 beats=”quadruple” time. Subdivided Beats & Regular Patterns Each of the main beats can be split into smaller note values. This is called a “subdivision”. There are only two ways to split a main beat – into two halves, or into three thirds. This gives us six possible regular patterns for time signatures. Simple and Compound Time When the main beat is divided up into two, it is “simple time“. The top number of the time signature is 2, 3 or 4, depending on how many main beats per bar there are. When it subdivides into three, it is “compound time“. The top number of the time signature is 6 (2 beats), 9 (3 beats) or 12 (4 beats). Types of Main Beat The reason why we have more than 6 regular time signatures is because we can use different lengths of note for the main beat. The note used for the main beat is most often the quaver, crotchet or minim, the dotted crotchet or the dotted minim. An undotted main beat always subdivides into two (simple time), but a dotted main beat always subdivides into three (compound time). The lower number of the time signature shows you what type of beat to count. 2=minim, 4=crotchet or dotted minim, 8=quaver or dotted crotchet and 16=semiquaver. Each subdivision can, of course, be divided up again into even smaller notes. All further sub-divisions are into two, whatever the time signature. (If you want to subdivide into three, you need a triplet. Irregular time signatures are always simple (the main beat divides into two). The top number will tell you how many main beats there are per bar, and the bottom number tells you what type of beat. E.g. 5/8 is five quavers per bar, or 11/16 is eleven semiquavers. To our ears, it is very difficult to tell the difference between these time signatures with the same basic pattern. Generally though, when the main beat is a quaver, the tempo is quick, and when it is a minim the tempo is slow. It is easy to tell the difference between time signatures with different basic patterns, because the notes in the bar will be grouped according to their pattern. When there are two main beats per bar, the notes are grouped into two equal-sized blocks, three beats per bar = three blocks and so on. Notes are grouped with the use of a) note values which fall on the beat (not off it), b) beaming and c) ties. Try to draw blocks around each beat of the bar. - Each block must be the same size. - Notes which are the main beat, have to fall at the start of the block. - Ties are used when a note begins in one block but ends in another. - Beams don’t cross blocks. - Beams are not broken within blocks. Triplets & Duplets Sometimes we will want to split a main beat into three in a simple time, instead of the usual two. Or in a compound time, we might want to split the beat into two instead of three. When the main beat is divided into a number which is not the one expected, we draw a bracket over the affected notes and write a number to show the subdivision we want. (If the notes are already joined with a beam, you don’t need a bracket as well). For example in simple time the main beat can be subdivided into three with a bracket and a three, called a “triplet“. In compound time, we can write a two, which makes a “duplet“. Watch out- a triplet doesn’t always have three notes in it! A crotchet plus a quaver can make a triplet (because added together they make up the same as 3 quavers). An anacrusis is a bar which begins a composition which has fewer than the expected number of notes in it. When counting bars, bar 1 is always the first full bar. The last bar of a piece has to take into account any anacrusis.

<urn:uuid:0e720de8-7e30-449d-95fa-4a7742536a2b>

CC-MAIN-2024-10

https://mymusictheory.com/rhythm/time-signature-chart/

s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474697.2/warc/CC-MAIN-20240228044414-20240228074414-00335.warc.gz

en

New research sheds light on the beginnings of melanoma in the body—and potentially how to stop it from starting. Melanoma, a cancer of skin pigment cells called melanocytes, will strike an estimated 87,110 people in the United States in 2017, according to the Centers for Disease Control and Prevention. A fraction of those melanomas come from pre-existing moles, but the majority of them come from sources unknown—until now. “If you had mutations that were sufficient for melanoma, everything would be fine until you went out and got a sunburn…” In a new study, researchers found that when melanocyte stem cells accumulate a sufficient number of genetic mutations, they can become the cells where these cancers originate. Under normal conditions, ultraviolet (UV) radiation from the sun activates melanocytes to release melanin, a pigment that protects the skin from the sun’s rays. But if melanocyte stem cells have surpassed a threshold of genetic mutations, a tumor can start to grow when those skin stem cells are activated by sun exposure. “If you had mutations that were sufficient for melanoma, everything would be fine until you went out and got a sunburn,” says Andrew White, an assistant professor of biomedical sciences at Cornell University’s College of Veterinary Medicine, and senior author of the study. “The stimuli that would normally just give you a tanning response could in fact start a melanoma instead,” White says. The researchers may have also discovered a way to prevent melanomas caused by mutated stem cells. The researchers suspected a gene called Hgma2 would be expressed in the skin under UV radiation. When expressed, Hgma2 facilitates melanocyte stem cells to move from the base of skin hair follicles to the skin’s surface (the epidermis), where the cells release melanin. The researchers used mice engineered with melanocyte stem cell mutations in the study. One set of mice had the mutations, while another set with the mutations had the Hgma2 gene deleted. They then gave the mice a very low dose of UV radiation, just enough to trigger a tanning response. Mice with tumor-causing mutations and the Hgma2 gene intact developed melanomas, but the mice with mutations and the deleted gene remained healthy. Researchers must do more work to better understand the Hgma2 gene’s function. “We have an actual mechanism, with Hgma2, that can be explored in the future and could be a way we can prevent melanomas from happening,” White says. The researchers report their work in the journal Cell Stem Cell. The Office of the Assistant Secretary of Defense for Health Affairs through the Peer Reviewed Cancer Research Program, the Cornell Center for Vertebrate Genomics, the Cornell University Stem Cell Program, and the National Institutes of Health supported the study. Source: Cornell University

<urn:uuid:d75689a1-2cc8-42d1-9020-d162ba8503bf>

CC-MAIN-2018-47

https://www.futurity.org/uv-light-skin-cancer-1584152/

s3://commoncrawl/crawl-data/CC-MAIN-2018-47/segments/1542039742968.18/warc/CC-MAIN-20181116004432-20181116030432-00379.warc.gz

en

In today’s global business environment, consumers anticipate that companies will interact with them in their native language for everything from customer support to product information. If your business is looking to translate material into different languages, you must consider the amount of content that’s needed to meet consumer expectations and then multiply that by the number of languages you plan on providing. Your budget and timeframe will dictate how much content you’ll be able to translate. Luckily, automated translation is designed to make translation projects more reasonable when it comes to cost and turnaround time. There are several different types of automated translation, with machine translation (MT) being one of them. MT is the use of computer software and applications to translate text from one language to another. Usually, MT is used by language service providers (LSPs) as just one component of a whole translation process. To ensure the highest quality translation, the MT engine is customized by expert linguists who then post-edit the raw machine output to achieve the desired results. Continue reading » The role of localization engineering and whether it is necessary is often misunderstood when it comes to translation and localization projects. Many are under the impression that localization engineering is unnecessary in the context of a software localization project. In addition, a common question is, “My product has already been engineered, so why do I also need localization engineering?” and it’s understandable to ask this. For others, the term “localization engineering” conjures expectations based on standard software engineering. With this blog, I want to paint a clear picture of what exactly localization engineering is and how it is used, for those who may be unsure of its purpose and role, and to help you receive the maximum benefit from it. Continue reading » Localization is something that has been referenced and briefly touched upon in many of my previous blogs, but I’ve never taken the time to really define the term and discuss it at length. So here it goes. Localization (also abbreviated as L10n) is the translation and adaptation of material for foreign-language markets that involves changing words from the source language into the target languages. In addition, localization requires analysis of the semantics in the new language, to make sure that the correct message is conveyed and to ensure that the product functions (both linguistically and in terms of usability) properly in the target culture. Remembering that the target market is different from the market for which the product was initially created is crucial to effective localization. Continue reading » Translation is a critical component to the success of every global business, but understanding that translating content isn’t just a one-shot deal is just as important. It’s a process that must be performed continuously as an organization creates new material, making the ongoing investment in website translation and/or updating their existing content in other formats. With these considerations, companies should be ecstatic to discover existing translation tools that can save their business both time and money as they continue to translate more material for their target markets. One of these translation tools is called a glossary, and it serves the same purpose as every other glossary that you’ve ever come across. Continue reading » In order to thrive, your global business needs to communicate with international audiences, which requires both interpretations and translations of your content. But, how do you know which process is the best option for certain situations? Understanding the core differences between interpretation and translation is critical to the success of your multinational organization. Continue reading » You operate a global business: the international clients you serve speak multiple languages, but are still able to use your products thanks to the translations supplied by your language service provider (LSP). Now, let’s say you’re releasing an updated version of one of your most popular products in Japan. In order to promote the product in the Japanese market, you’re going to have to tweak all your content related to the product, including your current marketing campaign, to reflect the new features that this product has to offer. Once you’ve developed the copy, you’ll have to send it out to your LSP and wait for them to translate all of this new material and review it with your in-country teams or have a 3rd party review the translation. Multiply this repetitive, time consuming cycle by the number of new markets you’re targeting, plus each and every market you already serve. That’s a lot of translating. But what if there was an easier way to get consistent, high-quality translations? Well, there is actually and it’s called Translation Memory (TM). Continue reading » Today, one click of a mouse can take you halfway around the world without having to leave the room. We’ve grown accustomed to this information convenience, and have come to expect it from all businesses. Now, more than ever, website translation is vital for companies looking to thrive in the global marketplace. Having a website that supports multiple languages is essential because consumers of your information from every corner of the world are potential clients. With this recent shift to digital, everyone’s under increased pressure to deliver more ROI faster than ever before and with less resources. With more channels, devices and opportunity, it’s becoming increasingly important that your websites connect and convert in any language. Having a multilingual website enables your business to target international consumers effectively, since they are able to understand your message and make an informed purchase decision. But managing a multilingual website can be a painful task and involves multiple steps with plenty of room for error. Continue reading » Many organizations have high demands for translation, producing large volumes of content that they need in multiple languages in order to reach their diverse target audiences across the globe. For these companies, keeping translations organized can become a task all its own, which is why centralizing translations becomes so vital. Selecting the right partner to help manage content translation flow is essential to the success of your global business. Some language service providers (LSPs) are not equipped to deal with the massive workloads that large organizations require, which forces them to use multiple LSPs for their translation projects. Continue reading » Lionbridge is presenting a webinar for ASTD (American Society for Training & Development) on the topic of developing global training programs. The live session of “Global E-Learning for Today’s Multinational Work Models” will take place on Wednesday July 31st at 2:00pm EDT. Lionbridge’s Wendy Farrell and Eric Jacobs are thrilled to offer their expertise on the development of content for audiences worldwide. Lionbridge has been approached by hundreds of organizations Continue reading » Global businesses understand the importance of using style guides for the creation of content, but many are unaware that similar guides can be designed specifically for their translation projects. A typical style guide contains a company’s standards and expectations for materials that must be followed when writing and designing documents, websites, or graphics. Guides like this are created to ensure that brand image is accurately portrayed and it remains consistent across the variety of content an organization produces. This same concept can be applied to the translation of content, and it is equally important to define the styles and conventions that should be used in international markets. Continue reading »

<urn:uuid:ed6318b7-72af-4e89-9a6a-2ab5cb6351dd>

CC-MAIN-2015-27

http://blog.lionbridge.com/translation/tag/global-business/

s3://commoncrawl/crawl-data/CC-MAIN-2015-27/segments/1435375099173.16/warc/CC-MAIN-20150627031819-00106-ip-10-179-60-89.ec2.internal.warc.gz

en

About this series This Series makes available important source materials from Austro-German philosophy relating to the foundations and background of currents of thought that shaped decisively the development of twentieth century philosophy. It is divided into four main sections, each of them containing materials or translations of otherwise inaccessible sources, supplemented by interpretative studies designed to establish the systematic implications, historical context, and contemporary relevance of the materials presented. The four sections are 1) Franz Brentano; 2) The School of Brentano (including Marty, Meinong, Twardowski, Ehrenfels, Husserl, and Stumpf); 3) Early phenomenology (including Scheler, Geiger, Pfänder, and Reinach.); and 4) Influences of Austro-German philosophy in other disciplines, especially in logic, linguistics, and theoretical psychology (from Bolzano to Bühler). The Series combines editions and translations of original and previously unpublished works with volumes having a stronger focus on interpretation, including both monographs and edited collections. This Series has been established in response to the increasing interest in early phenomenology and early analytic philosophy of the late nineteenth and early twentieth century. It promotes publications, both new editions and interpretative works, relating to a period and a current of the history of nineteenth and twentieth century philosophy which is of central importance for both analytic philosophy and phenomenology, but which until quite recently has been almost completely neglected by both of these fields. · Contributes to widening the focus of research of both phenomenology and analytic philosophy. · Investigates the influence of phenomenology and analytic philosophy in fields such as logic, linguistics, and theoretical psychology. · Is unique in its focus on Brentano and his students and on those they influenced.

<urn:uuid:8ed5dc4d-cd61-45f0-9bc2-a3d27642d6c6>

CC-MAIN-2018-39

https://link.springer.com/bookseries/6452

s3://commoncrawl/crawl-data/CC-MAIN-2018-39/segments/1537267159165.63/warc/CC-MAIN-20180923075529-20180923095929-00204.warc.gz

en

There is an interesting conversation going on in lighting land across the globe about a particular subject: light and the human condition. Like photosynthesis in plants, humanity as a species has evolved in harmony with the dictates of light — night and day, day and night. Like gravity or any other of the fundamental forces, light is hardwired into the absolute core of our bodily functions. Current studies in photometrics and circadian rhythms show clearly how our bodies crave and need daylight to function properly. Not enough full-spectrum daylight, not enough vitamin B production, or not enough vitamin B, and our bodies pay a physical price. SAD (seasonal affective disorder) becomes more pronounced the further north or south we live and the fewer hours of daylight exposure we receive. Move much beyond the 46th parallel, and it becomes quite an issue. Obviously, full-spectrum daylight is the result of huge thermonuclear reactions far away from the sun. And Mr. Soleil bathes us in an extraordinary array of wavelengths, which make up what we call daylight. Compared to this, the fluorescent tubes of our modern lighted environments are mere blips. They deliver an extremely small spectrum of light, just enough to see. Worse still, our latest magic bullet, the LED, by nature delivers an even narrower wavelength. Energy efficient it may be (and that is another absolute essential), but responsive to our needs, perhaps not. Looking a bit beyond all this physiology stuff, daylight and the specific wavelengths that make up what we call color have become an integral part of our vocabulary, too. Red is for danger, a provocative color of fire and blood (also Ferraris). Or green for go, a safety color of shelter and food. Likewise, color within language helps express mood and feeling: This person may have a “crimson temper,” while another a “sunny disposition.” References to “feeling a little blue” relate to dead of night when circadian rhythms are lowest. The list goes on. This visual language of light and color also extends to imagery. In its simplest form — let's say during a walk in the park on a sunny day — the shadows of the leaves on the ground are instantly recognizable and give us pleasure. We enjoy the contrast of light and dark. Watching clouds drift across the sky is a magical experience enjoyed by every single (sighted) person across the globe, across every culture, and across history. Their hidden message of dreamy contemplation is universal. Stars, too, are an example of both light and imagery that predate every civilization on the planet. As a visual language, they always conjure up the evocative and mystic thoughts that take our imaginations to far and distant places — cosmic, actually! And our moon is another perfect example. It's a lighting surface, lighting source, and emotional image all rolled up in one — a lighting surface for our sun, a lighting source for our planet, and a powerful piece of imagery to which we feel emotionally attached. The crescent moon even has a national identity. Today's entertainment technology, coupled with theatrical techniques, provides great opportunities to expand on this simple concept. Media servers, high-res gobos, and moving-head projectors give designers the tools to engage wide demographics in quite complex conversations and shared experiences. This nonverbal communication can cross the boundaries of age, language, and culture to address mood and feeling in a very positive way. And more of that in today's world would be a good thing. For example, in an installation for The Starlight Children's Foundation (Lighting Dimensions, March 2003), I wanted to instill a sense of community in a respite room for sick kids. The demographics were wide — children of varying cultures from 18 months to 16 years, some with no language at all to young adults with language I didn't understand. One of my ideas (as well as clouds and stars, etc.) was to incorporate images of families of tropical fish as one might see them in a coral reef, a complete cornucopia of life and different species living together in symbiosis, a colorful and vibrant Moving Wallpaper™. This disparate nature of harmony, as experienced in our music and our big cities, is something I guessed all people would understand and would be effective as a hidden conversation. It was, and it has continued to add another tool for therapy in the hospital environment. So light plays a huge part in the human condition. As designers, we have great opportunities to engage people at an emotional level, pre-verbally. Benoit Mandelbrot, the father of fractal geometry, said, “Lightning does not flow in a straight line.” Even though an arc of electricity should choose the shortest route, even that takes into consideration the conflicting and disparate needs of our natural world. So should our designs. Ken Flower is a designer (IESNA associate, IALD affiliate), conference presenter, lecturer, and executive-in-residence at Temple University. His work at Starlight Children's Foundation was awarded at IES IIDA 2004, and featured at USITT World Stage Design 2005, LDI 2005, and IALD 2006.

<urn:uuid:58b417cf-a331-49b1-9c73-be036f884f34>

CC-MAIN-2014-10

http://livedesignonline.com/print/mag/light-and-human-condition

s3://commoncrawl/crawl-data/CC-MAIN-2014-10/segments/1394678683543/warc/CC-MAIN-20140313024443-00018-ip-10-183-142-35.ec2.internal.warc.gz

en

I, Robot by Isaac Asimov Isaac Asimov’s Three Laws of Robotics have become some of the founding concepts of science fiction and artificial intelligence alike. I, Robot is a collection of 9 short stories tied together by the memories and experiences of Dr. Susan Calvin that deal with the first writings by Asimov on the subject of robots. After a long and illustrious career in robot psychology working for U.S. Robots and Mechanical Men, Dr. Susan Calvin is retiring. A reporter from one of the major newspapers comes to interview her, looking for a recap of her career and any interesting or exciting stories she may have to tell about her robotic patients over the long years of her practice. Each story in the collection features a unique and mind bending look at how the Three Laws shape a robot’s psychology, as well as how a human must twist to see things from their perspective. The Three Laws of Robotics are as follows: 1. A robot may not injure a human being or, through inaction, allow a human being to come to harm. 2. A robot must obey any orders given to it by human beings, except where such orders would conflict with the First Law. 3. A robot must protect its own existence as long as such protection does not conflict with the First or Second Law. As Calvin begins to relive the important robot-centric events from her life, we are shown heartbreaking characters, human and robot both, and frightening looks at what would happen to humans if ever the Three Laws were changed or broken in any way. In “Little Lost Robot” a group of robots have a modified First Law, wherein the second half of the law is not part of their positronic brains. This leads to a scenario in which a robot, through action and then inaction, could cause harm to humans. With the story “Liar!” a quirk in manufacturing has led to a robot that can read minds, but will a robot who is programmed to cause no harm, really be capable of revealing the true thoughts of those around us? Or will we only hear what we want to? And in “Evidence” we are presented with the possibility of a robot made to look and pass as human. Would he become our overlord, or the greatest humanitarian in history? The fascinating thing about these stories is the almost complete lack of action, proving definitively that you can in fact write science fiction without explosions and drooling aliens. Very few of them actually contain even scenes in the outdoors; most of the storylines take place in dialogue or inner monologues, leading to a book that not only makes us think, but makes us think hard. Another amazing point in their favor is the sheer ability of these stories to withstand the test of time. They are as relevant today as they were fifty or sixty years ago. The fact that Susan Calvin is a woman, a pioneer in her field, a juggernaut in the robotics industry, and incredibly intelligent in her own right is a huge point in the book’s favor as well. But unfortunately, Asimov chose to make her independent by turning her into the stereotypical “Ice Queen”. Calvin is cold, blunt, and often compared to her beloved robots to her detriment. In “Liar” she is shown to have a heart, but the cruelty with which it is bruised and made mock of by her fellow robotics engineers is incredibly harsh. I would have enjoyed it slightly more if Calvin could be seen as human, rather than a human-shaped robot. As well, the world in the future is apparently run by your typical WASP man, with the exception of Calvin. I don’t recall a single character of color, male or female, in the entire set of stories, except the very last one in “The Evitable Conflict”, and even then I’m not sure of their actual ethnicities. Given that this was written half a century ago, I can actually understand the misstep, but that point doesn’t make me regret it any less. Overall, while dated in some ways, this collection is still a magnificent piece of science fiction, and any fan would do well to read it, several times in fact.

<urn:uuid:f84686e2-daf0-4cc4-a631-012478be5744>

CC-MAIN-2017-17

https://awthome.wordpress.com/2009/10/02/i-robot-runs-like-clockwork/

s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917126237.56/warc/CC-MAIN-20170423031206-00378-ip-10-145-167-34.ec2.internal.warc.gz

en

What is Dyslexia? Dyslexia is an umbrella term that refers to an unexplained difficulty in learning to read and spell despite appropriate learning opportunities. It affects 5-17% of all children. Read on to find out why dyslexia occurs and how it can be overcome. Where do these difficulties stem from? Reading experts once believed that reading, spelling and some writing problems resulted from a difficulty in making visual discriminations. However, using brain imaging technology known as fMRIs, neuroscientists have shown that the same areas of the brain involved in oral language and comprehension are in fact involved in reading. Dr Burns, Associate Adjunct Professor at Northwestern University, put this eloquently when she said “…As far as the brain is concerned, reading is language, so if a child’s language abilities can be improved, they’ll find it easier to learn to read…” So today it is understood that rather than being a primarily visual discrimination task as once thought, reading is principally an auditory task. Children with dyslexia have problems recognising and manipulating the underlying sound structures of words (known as phonological processing) and experience difficulties mapping oral sounds to written language. How Fast ForWord helps struggling readers Students are typically taught to read using phonics, the process of learning to associate letters with their sounds. However, if a student’s auditory development is impaired due to chronic ear infections, glue ear or for any other reason when the brain is organising itself for language from 0 – 4 years of age, their brain will have trouble processing sounds properly and therefore developing sound discrimination skills. For these students, more and more phonics instruction in isolation will act somewhat as a band-aid for their reading, spelling and/or writing problems because they need to develop strong auditory processing skills before building phonics and phonemic awareness skills. Fast ForWord trains the cognitive skills necessary for reading, spelling and writing, including auditory processing skills (auditory discrimination, speed and fluency) and sequencing while simultaneously developing the foundational reading skills (including phonics, phonemic awareness, reading comprehension, fluency, vocabulary, grammar, syntax and morphology). The overall goal is to make reading easier and more enjoyable for students so that they actively seek rather than avoid reading activities and feel a sense of success in themselves as a learner. The scientific evidence Research continues to show that Fast ForWord is an extremely effective reading development tool. - Researchers from prestigious Stanford University conducted research on Dyslexic students before and after participation in the Fast ForWord program. The results of the study were amazing, showing ‘normalisation’ of brain activation patterns and increased activation in the areas of the brain associated with reading, spelling and writing following participation in the Fast ForWord program. - In addition, the Nevada Department of Education recently published findings of a large-scale research study conducted between 2006 and 2008 which showed that of the 24 innovative and remedial programs extensively studied, Fast ForWord was the most effective reading intervention tool. The report concludes that the Fast ForWord programs increased student reading achievement by an average of 22.2 percentage points, which was the largest average impact of all programs reviewed in the report. - John Gabrieli’s research (2009) discusses the evidence that neuroscience derived technologies such as Fast ForWord, combined with evidence-based teaching practices, could prevent many cases of dyslexia from occurring. - Raschle. N.; Zuk, J. & Gaab, N (in press). Functional characteristics of developmental dyslexia in left-hemispheric posterior brain regions predate reading onset. Proceedings of the National Academy of Sciences. - Temple, E., Deutsch, G. K., Poldrack, R. A., Miller, S. L., Tallal, P., Merzenich, M. M., Gabrieli, J. D. (2003). Neural deficits in children with dyslexia ameliorated by behavioral remediation: Evidence from functional MRI. Proceedings of the National Academy of Sciences, Vol. 100, No. 5: pp. 2860-2865. - Gabrieli, J.D.E., et al. (2009). Dyslexia: A New Synergy Between Education and Cognitive Neuroscience. Science, 325, 280. Interested in learning more about the Fast ForWord program? Have a question about learning, neuroscience and/or education? Contact the team of health and education professionals at Sonic Learning.

<urn:uuid:34e8885b-8fce-4949-9a17-b557423b0571>

CC-MAIN-2018-43

http://soniclearning.com.au/dyslexia-new-insights/

s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583514443.85/warc/CC-MAIN-20181022005000-20181022030500-00124.warc.gz

en

Astronauts on the International Space Station (ISS) yesterday were to examine and measure a troublesome gash in the shuttle Endeavour's heat shield by means of a camera and a laser atop a robotic arm. The 56cm2 gouge near a landing gear hatch was apparently made by a piece of ice that broke off the shuttle's external fuel tank 58 seconds after Wednesday's launch from Cape Canaveral, Florida. The laser device will provide the exact measurement and depth of the gash so NASA engineers can decide whether repairs are needed, for which the Endeavour mission would be prolonged to allow for an additional spacewalk. Endeavour's mission was initially planned for 11 days, with three space walks. NASA may extend the mission by three days, and add a space walk, after they test a new system that transfers electricity from the ISS to the orbiter, prolonging the life of the shuttle's batteries. Separately, if NASA decides that the damaged shuttle tiles need fixing, an additional space walk is possible. NASA on Saturday studied pictures of the damage taken on Friday, while two astronauts completed the first spacewalk of the shuttle's 11-day mission. Mission specialists Rick Mastracchio of the US and Canadian Dave Williams spent six hours, 17 minutes installing and activating a new, 1.58 tonne segment for the International Space Station that the Endeavour had delivered. The two astronauts attached the Starboard 5 truss segment to the Starboard 4 segment, with the help of shuttle pilot Charles Hobaugh, who from inside the ISS operated the station's robot arm holding the 3.37m x 4.24m truss.

<urn:uuid:fa246375-f3b4-4021-964e-21c416add3c9>

CC-MAIN-2016-40

http://www.taipeitimes.com/News/world/archives/2007/08/13/2003373945

s3://commoncrawl/crawl-data/CC-MAIN-2016-40/segments/1474738660436.26/warc/CC-MAIN-20160924173740-00013-ip-10-143-35-109.ec2.internal.warc.gz

en

This article is only available in the PDF format. Download the PDF to view the article, as well as its associated figures and tables. April 14, 1928. A Procedure for the Early Diagnosis of Cancer For some time past, various communications have been published on the discovery of a diagnostic procedure that is said to permit the recognition of cancer in its earliest stages by means of the application of a special staining method to the blood. As it would be of the greatest importance for the recognition and combating of cancer to possess such a method for early diagnosis, the "Ringold procedure" was immediately subjected to verification by Dr. E. Haagen in the cell research laboratory of the bacteriologie department of the Reichsgesundheitsamt (federal bureau of health) in Berlin-Dahlem. According to statements by the discoverer of the method, it is possible, by means of the procedure, to determine, within a few minutes, from a blood smear taken from the earlobe of the examinee and treated with a special staining and differentiating fluid, whether BERLIN. JAMA. 1928;90(20):1644. doi:10.1001/jama.1928.02690470050025

<urn:uuid:64a353d8-8b1b-4e81-a46f-1717ff64b70d>

CC-MAIN-2017-39

http://jamanetwork.com/journals/jama/article-abstract/256740

s3://commoncrawl/crawl-data/CC-MAIN-2017-39/segments/1505818689779.81/warc/CC-MAIN-20170923213057-20170923233057-00043.warc.gz

en

After the massive devastation that was placed on Puerto Rico during hurricane Maria, the children’s hospital, Hospital del Nino’s in San Juan, has resorted to alternative methods for energy and have re-purposed one of their parking lots into a solar panel covered source of power. The massive space in the parking lot allowed for them to establish nearly more than 800 solar panels to help provide the much needed electricity to the children’s hospital. This an extremely crucial factor for locals since this nonprofit hospital is one of the only rehabilitation facilities for children in Puerto Rico right now. To give you some idea of how important this is, Hospital del Nino is one of the first alternative-energy experiments that has been successful on the island with an awesome partnership between the government of Puerto Rico and Tesla, the organization that is well known for their electric car models. Juliana Canino, director of Hospital del Nino’s, states that the microgrid “Gives us the opportunity to continue our services. We have 35 patients with chronic and physical and mental conditions, and they need skilled nursing services 24 hours a day seven days a week.” As Canino gives a tour of the microgrid she explains: “They were assembled and tested in eight days, and on a sunny day we can produce up to 250 kilowatts of energy.” This amount of energy can provide power for the hospital up to about 20 hours while having to resort to their generators for the rest of the time. Canino claims “Generators are not built to run 24 hours a day, seven days a week, for 50 days. We only had one generator working at the time of the hurricane, and it was after two weeks we were able to put the second generator to work. So definitely we were scared that the first generator was going to break.” That was about the time that Tesla decided to call the hospital so that they could provide the money and materials necessary to get their first microgrid up and running for the sake of saving lives by the minute. Tesla states that they will lend a hand in the hospital solar microgrid as part of a humanitarian aid initiative in Puerto Rico. This is so that the children’s hospital can have the necessary time to recover from the damage until the local electrical system has been fixed. Canino states that getting a call from Tesla was like winning the jackpot, she says “I actually felt a little bit skeptical at the beginning, but then when I saw them working I was very relieved. Definitely, it’s less of a burden for us not to use diesel [generators] all the time.” Although many parts of Puerto Rico are still in dire need of aid when it comes to food, water, and energy, this is one of the next best steps for the island to start rebuilding themselves. Many other projects such as this microgrid will be introduced all over the island in hopes that communities can finally reestablish a basic way of living again. There are multiple ways that you can get involved, ranging from donating canned foods, bottled water, and even money donations are all effective ways to aid in the recovery of hurricane Maria.

<urn:uuid:abb5ba40-97fb-455a-8c04-415623072390>

CC-MAIN-2021-10

https://blog.tentree.com/tesla-provides-solar-power-to-puerto-rico-hospital-left-in-the-dark/

s3://commoncrawl/crawl-data/CC-MAIN-2021-10/segments/1614178369054.89/warc/CC-MAIN-20210304113205-20210304143205-00424.warc.gz

en

Although Epimetheus appears to be orbiting between the A and F rings in this image, it's just an illusion! Epimetheus, which orbits Saturn well outside of the F ring's orbit, is actually on the near side of Saturn to Cassini while the rings seen here are on the far side of the planet. Whew, that's a relief! This view looks toward the unilluminated side of the rings from about 3 degrees below the ringplane. The image was taken in visible light with the Cassini spacecraft narrow-angle camera on April 15, 2013. The view was acquired at a distance of approximately 700,000 miles (1.1 million kilometers) from Epimetheus and at a Sun-Epimetheus-spacecraft, or phase, angle of 30 degrees. Image scale is 4 miles (7 kilometers) per pixel. The Cassini-Huygens mission is a cooperative project of NASA, the European Space Agency and the Italian Space Agency. The Jet Propulsion Laboratory, a division of the California Institute of Technology in Pasadena, manages the mission for NASA's Science Mission Directorate in Washington. The Cassini orbiter and its two onboard cameras were designed, developed and assembled at JPL. The imaging team is based at the Space Science Institute, Boulder, Colo. Credit: NASA/JPL-Caltech/Space Science Institute

<urn:uuid:0b7eb9ab-0d5b-448f-a363-1fdaebee04ce>

CC-MAIN-2019-47

https://solarsystem.nasa.gov/resources/15877/going-rogue/

s3://commoncrawl/crawl-data/CC-MAIN-2019-47/segments/1573496670731.88/warc/CC-MAIN-20191121050543-20191121074543-00253.warc.gz

en

(NaturalNews) Clean, pure water is one of the greatest natural resources in the world. Every metabolic function depends on the presence of water. Cities are built around abundant supplies of water. There are many industrial toxins present in our municipal water sources that must be avoided. Water is absolutely necessary for optimizing energy production and detoxification abilities within the body. The ideal source of water is as pure and unadulterated as possible from a natural spring. Unfortunately, our water supply is loaded with toxic contaminants. Here are a few we all need to be aware of and take measures to avoid: Arsenic: This is a powerful cancer-causing agent. In 2001, the EPA lowered the maximum level permitted in drinking water from 50 ug/L to 10 ug/L due to the well-established carcinogenic risk. The Natural Resources Defense Council estimates that as many as 56 million Americans living in 25 states drink water with unsafe arsenic levels. Aluminum: This toxic heavy metal is linked with neurological, gastrointestinal and liver damage. Most city water has elevated levels of aluminum. Aluminum competes with calcium for skeletal absorption but does not mimic calcium's effects in the body. High aluminum reduces skeletal mineralization. It also retards the absorption of phosphorus, zinc, and selenium. Zinc and selenium are key immune system modulators. Aluminum causes deficiencies in these critical minerals and malcoordinates the immune system. Fluoride: This halogen molecule is a highly potent free radical in the body that damages neurological tissue, injures the immune system and hampers thyroid function among many other problems. In a 2006 report by the National Research Council of The National Academies it states, "Fluoride is an endocrine disruptor in the broad sense of altering normal endocrine function." Chlorine: This is used to sterilize the water and rightfully so as many infectious diseases can be attained through contaminated water. Natural springs should never be sterilized but city water absolutely should be. Unfortunately, when chlorine is not filtered out of the water and is instead consumed in tap water, it destroys the natural microflora throughout the body. This adversely affects natural immunity and dramatically increases the risk for immune disorders and cancer. One of the most dangerous forms of chlorine includes chlorine vapors and chloroform gas. The FDA and other US government agencies have reported that most homes in the U.S. have measurable levels of chloroform gas. This seeps out of toilet bowls, dishwashers, showers, etc. These vapors dramatically increase the risk of asthma, airway inflammation and respiratory allergies. Chloroform gas is known to cause acute dizziness, nausea and fatigue. DisInfectant ByProducts (DBP's): These are used along with chlorine to destroy any form of life in the water. These chemicals include trihalomethanes, halogenic acetic acids, haloacetonitrils and haloketons among others. DBP's are considered to be far more dangerous for consumption than chlorine. They are powerful carcinogenic molecules that destroy the liver, kidneys and nervous system. Prescription and Over-the Counter Drugs (OTC): Studies have shown that even minute amounts of RX and OTC drug exposure causes human cells to grow and mature abnormally. There are numerous small drug combinations within tap water that are extremely hazardous for consumption. Some individuals have extreme allergic reactions to certain drugs that may also be present in a very diluted form in the tap water they are drinking. The Maine Department of Environmental Protection tested their water and found a number of different drugs to be present. The most common ones included: OTC pain relievers such as ibuprofen and acetaminophen Antidepressants Birth control pills Blood pressure and cholesterol medications About the author: Dr David Jockers is a Maximized Living doctor and owns and operates Exodus Health Center in Kennesaw, Georgia where he specializes in functional nutrition, functional medicine and corrective chiropractic care to get to the underlying cause of major health problems. His website features great articles on natural health and incredible recipes. He is the author of the best-selling book SuperCharge Your Brain - the complete guide to radically improve your mood, memory and mindset. He has over 50,000 active followers on his social media and email newsletter and is a big influencer in the Primal Health movement. Dr. Jockers is also available for long distance consultations and health coaching to help you beat disease and reach your health goals. For more information got to www.drjockers.com

<urn:uuid:6a178ac0-56db-4211-b355-79b4911ce5e5>

CC-MAIN-2015-11

http://www.naturalnews.com/037205_water_toxins_arsenic.html

s3://commoncrawl/crawl-data/CC-MAIN-2015-11/segments/1424936462426.4/warc/CC-MAIN-20150226074102-00012-ip-10-28-5-156.ec2.internal.warc.gz

en

Lothair was crowned emperor at the Lateran in June 1133, and as a further reward Innocent gave him the territories of the Countess Mathilda as a fief, but refused to surrender the right of investiture. Far more comprehensive was the second charter, granted by Philip's widow Mathilda, after his death on crusade in 1191, as the price paid for the faithfulness of the city to her cause. When he took over the city from Mathilda, an important new provision being that general rules for the government of the city were only to be made by arrangement between the count or his officials and the common council of the citizens. Next in the order of age, follows the oval map which Henry, canon of Mayence Cathedral, dedicated to Mathilda, consort of the emperor Henry V. 983), Mathilda, abbess of Quedlinburg (d. From the marriage of the heiress Mathilda (1282-1299) with Engelbert II., count of La Marck (d. Anthony and Mathilda Joslyn Gage she wrote The History of Woman Suffrage (3 vols., 1880-1886).

<urn:uuid:b58a8a26-64a1-4103-9858-1a0e3741368a>

CC-MAIN-2017-30

http://sentence.yourdictionary.com/mathilda

s3://commoncrawl/crawl-data/CC-MAIN-2017-30/segments/1500549424961.59/warc/CC-MAIN-20170725042318-20170725062318-00433.warc.gz

en

A global community of nature enthusiasts photographing and learning about wildlife This is a venomous pit viper species endemic to the South Western Ghats in India. Their tails are prehensile. Many different color morphs are known to exist, including colors such as yellow, green, and brown. They are nocturnal and usually inactive in the day, sometimes seen basking on rocks or trees near streams. It inhabits moist forests, both evergreen and deciduous, where it may be found on the ground, on low vegetation, or in shrubs.

<urn:uuid:4bdc958f-5fe5-419d-bf86-c2c215718e4e>

CC-MAIN-2023-40

https://www.projectnoah.org/spottings/34589065

s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233511075.63/warc/CC-MAIN-20231003092549-20231003122549-00057.warc.gz

en