Datasets:

mit-han-lab

/

pile-val-backup

like 13

Follow

MIT HAN Lab 74

Capture of Kufra The Capture of Kufra (, ) was part of the Allied Western Desert Campaign during the Second World War. Kufra is a basin and oasis group in the Kufra District of south-eastern Cyrenaica in the Libyan Desert. In 1940, it was part of the colony of Italian Libya , which was part of (ASI), which was established in 1934. With some early assistance from the British Long Range Desert Group, Kufra was captured by Free French Forces when the Italian and Libyan garrison surrendered after a siege from 31 January to 1 March 1941. Background Kufra, in the Libyan Desert subregion of the Sahara, was an important trade and travel centre for the nomadic desert peoples of the region, including Berbers and Senussi. The Senussi made the oasis their capital at one point against British, Italian and French designs on the region. In 1931, the Kingdom of Italy captured Kufra and incorporated it into the Italian North Africa () colonisation of the Maghreb. The Italian post at Kufra included the Buma airfield and radio station, used for air supply and communications with Italian East Africa and a fort at the nearby village of El Tag. Prelude After the Allied defeat of 1940 in the Battle of France, the colony of French Equatorial Africa (FEA) declared its allegiance to Free France, the government-in-exile led by Charles de Gaulle. Chad, the northern part of FEA, borders Libya. De Gaulle ordered the Free French in Chad to attack Italian positions in Libya. Kufra was the obvious target and the troops available to the Free French commander in Chad, Lieutenant Colonel Jean Colonna d'Ornano, were 5,000 (riflemen) of the Senegalese Light Infantry Regiment of Chad ( (RTST) in twenty companies garrisoning various places and three detachments of (camel cavalry), in Borkou, Tibesti and Ennedi. Attacking Kufra would be very difficult for this motley force. The Free French had very little motor transport and needed to cross of desert, much of which was sand dune or the fine, powdery soil called which was thought impassable to motor vehicles. The French received assistance from the British Long Range Desert Group (LRDG), a reconnaissance and raiding unit formed to operate behind the Italian lines, who had become expert in desert navigation. Major Pat Clayton of the LRDG was keen to join with the Free French to test the Italians. Clayton commanded G Guard (Brigade of Guards) and T Patrol (New Zealand) of the LRDG, 76 men in 26 vehicles. The LRDG and Free French first raided the Italian airfield at Murzuk, in the –Fezzan region in south-western Libya. D'Ornano and ten Free French (three officers, two sergeants and five local soldiers) met Clayton's LRDG patrols on 6 January 1941 at Kayouge. The combined force reached Murzuk on 11 January and in a daring daylight raid, surprised the sentries and devastated the base. Most of the force attacked the main fort; a troop from T Patrol under Lieutenant Ballantyne attacked the airfield, destroying three Caproni aircraft and capturing some prisoners; D'Ornano was killed in this raid along with one trooper of T Patrol. A French officer cauterised his leg wound with a cigarette, much to the admiration of the LRDG. A diversionary raid by French camel cavalry failed after it was betrayed by local guides. These troops were relegated to reconnaissance duties only. Battle Colonel Philippe Leclerc assumed command in place of d'Ornano. After the success of the Murzuk raid, Leclerc marshalled his forces to take on Kufra. The attacking column included about 400 men in sixty trucks, two Laffly S15 ( TOE) scout cars, four Laffly S15R cross country personnel carriers and two mountain guns. Kufra was protected by two defensive lines around the El Tag fort with barbed wire, trenches, machine-guns and light anti-aircraft guns. The Royal Italian Army () garrison comprised the 59th and 60th Machine-gun companies, with 280 (local infantry) and an Auto-Saharan Company, the . The Saharan companies were a mixed force of motorised infantry with well-armed cross-country vehicles (SPA AS37), which could also call on the (Italian Royal Air Force) for support. The in Kufra was around 120-men strong (45 Italians and 75 Libyans). Leclerc asked the LRDG to deal with the Saharan company, based in El Tag fort in the Kufra oasis. The LRDG was detected by a radio intercept unit at Kufra and the Italians organised a mobile column of forty men, one AS37 and four FIAT 634 lorries to intercept them. G Patrol had been kept in reserve. On 31 January, Major Clayton was at Bishara ( south-south-west of Kufra) with T Patrol (30 men in 11 trucks). The patrol was spotted by an Italian aeroplane in the morning. T Patrol took cover in a small wadi at Gebel Sherif, a few kilometres north. The plane directed the Saharan patrol to attack the LRDG force. Due to the fire-power of the Italian vehicles were armed with cannon and constant air attack, T Patrol was driven off, losing four trucks and Major Clayton, who was captured with several others. Trooper Ronald Moore led other survivors to safety after a long foot march. The remaining LRDG force withdrew to Egypt for refitting, except for one vehicle of T Patrol, equipped for desert navigation. During the fight, 1st Lieutenant Caputo, in command of the , was killed as were two Libyan soldiers. Leclerc pressed on with his attack, even though the Italians had captured a copy of his plans from Major Clayton. After conducting further reconnaissance, Leclerc reorganised his forces on 16 February. He abandoned his two armoured cars and took with him the remaining serviceable artillery piece. Only about 350 men reached Kufra, due to breakdowns of trucks on the march. Aware of the French approach, the Italians organised another strong mobile column from the Saharan company (seventy men, ten AS37 and five trucks). On 17 February, Leclerc's forces met the north of Kufra. Despite losing many trucks to the 20 mm guns of the Italian AS37 cars, the French drove off the as the Kufra garrison failed to intervene. The French surrounded El Tag and laid siege to the fort, despite another attack by the and harassment from the air. The 75 mm gun was placed from the fort, beyond range of the defenders and fired twenty shells per day at regular intervals from different places to give the appearance of more guns. Some mortars were placed from the fort and bombed the Italian positions to increase the pressure on the defenders. Italian surrender The fort was commanded by an inexperienced reserve captain, who lacked the will and the determination to fight. Surrender negotiations began on 28 February and on 1 March 1941, the Italian garrison of 11 officers, 18 NCOs and 273 Libyan soldiers (12, 47 and 273, according to French sources) surrendered El Tag and the Kufra oasis to the Free French. During the siege, the Italian garrison had suffered one Italian officer killed, two Libyan soldiers killed and four wounded; the French suffered four fatal casualties and 21 wounded. The Italian garrison was permitted to withdraw to the north-west and the French forces took over eight SPA AS.37 light trucks, six lorries, four 20 mm cannon and 53 machine-guns. Orders of battle French HQ: 1 Matford truck, 2 Chevrolet light trucks, 2 Bedford 1.5 ton trucks, 1 ER26bis radio 1 reduced infantry company (Captain Rennepont): 23 Bedford 1.5 ton trucks 2 platoons, GN Ennedi (Captain Barboten): 120 men, 1 Dodge truck, 16 Matford V8 3 ton trucks 1 platoon, 7th Company, RTST (Captain Florentin): 60 men, 1 Dodge truck, 2 Matford V8 3 ton trucks Artillery platoon (Lieutenant Ceccaldi): 2 75 mm Mle1928 Schneider mountain guns, 4 Laffly S15 carriers, 1 Dodge truck, 2 Matford V8 3 ton trucks Armoured car detachment (Adjudant Detouche): 2 Laffly S15TOE, 1 Matford V8 3 ton truck, 1 ER26bis/39 radio Italian HQ forces Settore Cufra (Kufra sector) 59th : 3 officers, 1 NCO, 3 Italian enlisted, 110 colonial troops enlisted, 13 MG (8 mm Schwarzlose 07/12 or 6.5 mm FIAT mod. 14) 60th : 3 officers, 1 NCO, 3 Italian enlisted, 110 colonial troops enlisted, 13 MG (8 mm Schwarzlose 07/12 or 6.5 mm FIAT mod. 14) (LT Caputo – KIA): 4 officers, 7 NCO, 32 Italian enlisted, 77 colonial troops enlisted, 16 AS 37 off-road vehicles, 4 FIAT 634 trucks : 4 officers, 4 NCO, 32 Italian enlisted, four aircraft Oath of Kufra After the fall of Kufra, Leclerc and his troops swore an oath to fight until "our flag flies over the Cathedral of Strasbourg" The oath was fulfilled on 23 November 1944, when Leclerc and the French 2nd Armoured Division liberated Strasbourg. See also North African Campaign timeline List of World War II Battles Sudan Defence Force Kufra District Notes Footnotes References Further reading External links Peter McIntyre, Salt Lake at Kufra Oasis, 1941–1943 (Painting) Real location of Kayouge rendezvous Category:Conflicts in 1941 Category:1941 in Libya Category:Western Desert Campaign Category:Libya in World War II Category:Kufra District Category:Battles of World War II involving France Category:Battles of World War II involving Italy C

Benefits of Eating Red Colored Fruits and Vegetables Red fruits and vegetables have great health benefits. They are known to protect from various health conditions including prevention of cardiovascular diseases and reduction of cancer risks. The color red has long been associated with strength, health and passion. The red group of Vegetables and fruits are rich in iron and potassium. They also contain phytochemical such as lycopene and anthocyanins which helps our body to fight several diseases. These phytochemicals in the red group of fruits and vegetables have unique anti aging and cancer protecting functions. Red fruits and Vegetables are great for the immune system and can help when one is weak, anemic and are vulnerable to Viruses. The red color of these fruits and vegetables is due to the lycopene content in them. Lycopene is an antioxidant that neutralizes free radicals in the body. Lycopene has been known to assist with memory and reduce the risk of several types of cancer, including prostate cancer. Some of the fruits and vegetables rich in Lycopene are tomato, Watermelons, pink grapefruits and guava. The lycopene content becomes even stronger when cooked. Some such cooked items with high lycopene content are tomato soups, tomato sauce, tomato paste, spaghetti sauce etc. Another phytochemical in the red group of vegetables and fruits is anthocyanin. It is proved to be a good antioxidant and also helpful in reducing the risk of heart disease, blood pressure, diabetics etc. Red fruits and vegetables like strawberries, raspberries, Cranberries, Red Cabbage, Kidney Beans, Cherries, Beetroots, Red Apples and Red Onion contains anthocyanin. Red Color Fruits and vegetables are excellent for the Root Chakra and are used to treat problems and conditions related to the Base or Root Chakra which is associated with qualities like patience, stability and confidence etc. An easy Root Chakra Juice can be made with a base of Apple Juice by adding other vegetables and fruits to it. These can be Beets and tomatoes, Beets, Strawberries, Oranges etc.

2005 Japan national football team This page records the details of the Japan national football team in 2005. General The Japan national football team competed in the 2005 FIFA Confederations Cup hosted by Germany, the 2005 East Asian Football Championship hosted by Korea Republic and the 2005 Kirin Cup hosted by Japan. Schedule Key H = Home match A = Away match N = Neutral venue Players statistics Top goal scorers for 2005 Kits References External links Japan Football Association Category:Japan national football team results Category:2005 in Japanese football Japan

REMOVAL VAN PERSIE Coral bookmakers approached us in 2012 to see if we could help deliver their first ever PR stunt and help them take a steal on their competitors. The brief was simple: create a stir with an irreverent stunt before the start of the football season. That was during the Olympics when no one was even thinking about football. However, there was one opportunity we identified: the ongoing discontent of Robin Van Persie and ‘will he, won’t he?’ transfer sitation at Arsenal. In true gambling fashion we took a punt and decided he WOULD leave and we would be ready for it. When news broke Man United had agreed a deal to sign we rolled into action the next morning with the Removal Van Persie – helping pack up RVP and his much used physio bench. After the Emirates was punk’d first thing (with Cows dressed as removal men and our Head Of News dealing with a bewildered security man), we sold-in the images to picture desks and seeded them out virally on Twitter to provide a Coral-owned humorous hijack to the conclusion of a drawn-out, dramatic and bitter saga. Within hours #removalvanpersie was trending across the UK – with many footie fans saluting Coral for pulling it off or using our images to taunt poor Piers Morgan who’d promised to jump off a pier if RVP left Arsenal. One random, single tweet send by a football fan called Sean Walsh praising the stunt was retweeted 1,254 times – which meant Sean Walsh started trending as well! 24 hours on and there was still a tweet every few seconds about our prank around the globe and our in-house – Removal Van Persie – produced film racked up thousands of views online. Coverage appeared in The Sun, Daily Star, Mail Online, Metro Online, This Is London and Telegraph Online.

349. Calculate n(6). -2059 Let y(m) = -805*m - 15541. What is y(-19)? -246 Let a(q) = 8962*q - 483916. What is a(54)? 32 Let q(g) = 320*g + 20439. Calculate q(-64). -41 Let g(q) = 4174*q - 20875. Calculate g(5). -5 Let p(k) = -3*k**2 + 82*k + 121. What is p(16)? 665 Let r(h) = 67*h**2 + 362*h - 56. What is r(-6)? 184 Let u(k) = 89*k + 2750. Give u(-27). 347 Let p(v) = -16*v**3 + v**2 - 201*v - 638. Calculate p(-3). 406 Let s(w) = -3*w**3 + 139*w**2 - 843*w - 63. Calculate s(39). 522 Let r(i) = -566*i - 1982. What is r(-3)? -284 Let h(z) = -8359*z - 108706. What is h(-13)? -39 Let j(h) = -7*h**2 + 97325*h + 1949302. What is j(-20)? 2 Let k(f) = 8*f**2 - 160*f + 100. Give k(19). -52 Let u(f) = 334*f + 36411. What is u(-109)? 5 Let v(p) = 594*p**2 + 131*p - 132. Calculate v(1). 593 Let u(q) = -3*q**3 + 121*q**2 - 802*q + 29. Calculate u(32). -35 Let k(f) = f**3 + 213*f**2 - 1536*f - 227. Determine k(-220). -1107 Let w(f) = f**3 + 19*f**2 - 660*f + 1782. What is w(3)? 0 Let s(i) = 19002*i + 1026121. Determine s(-54). 13 Let z(q) = -1366*q - 75. Determine z(0). -75 Let l(t) = -2*t**2 - 431319*t + 2587990. Calculate l(6). 4 Let x(k) = 697*k - 284354. Give x(408). 22 Let l(z) = 312*z**3 - 2803*z**2 - 30*z - 130. What is l(9)? 5 Let p(q) = 8*q**3 + 43*q**2 - 19*q + 59. Give p(-6). -7 Let a(g) = 20*g**2 - 56*g - 799. Give a(8). 33 Let c(t) = 3036*t + 15190. Give c(-5). 10 Let g(a) = -88*a**3 - 526*a**2 + 25*a + 90. What is g(-6)? 12 Let n(u) = -98*u**3 - 13*u**2 - 25*u - 14. Determine n(-2). 768 Let c(f) = 189*f + 7016. What is c(-40)? -544 Let y(x) = 10476*x - 230519. Determine y(22). -47 Let i(b) = -62218*b + 23. Determine i(0). 23 Let u(t) = 2237*t - 1912638. Calculate u(855). -3 Let u(l) = 22*l**2 + 2899*l + 2654. Calculate u(-131). 427 Let c(m) = -5*m**2 - 128*m - 1724. Give c(-17). -993 Let q(h) = 8*h**2 - 1727*h - 19942. Determine q(-11). 23 Let k(c) = -111*c**2 - 293*c - 294. Determine k(-2). -152 Let a(j) = 712*j**2 + 49*j + 47. Determine a(-1). 710 Let d(g) = 2*g**2 - 499*g - 719. Give d(251). 34 Let a(u) = -772*u + 4752. Determine a(6). 120 Let m(u) = -916*u - 18525. Determine m(-17). -2953 Let o(q) = q**2 + 9099*q - 118471. Give o(13). -15 Let s(c) = -c**3 - 65*c**2 - 156*c - 1187. Calculate s(-63). 703 Let g(n) = -n**2 - 56*n - 442. Give g(-47). -19 Let g(p) = -2*p**2 - 198*p - 1828. What is g(-89)? -48 Let p(m) = -5*m**2 + 210*m + 3193. Determine p(54). -47 Let i(s) = -47525*s. Give i(0). 0 Let p(n) = -35661*n + 71647. Calculate p(2). 325 Let y(m) = 2187*m - 63178. Determine y(29). 245 Let o(m) = m**3 + 28*m**2 + 212*m + 1752. Determine o(-22). -8 Let m(p) = -14*p**3 + p**2 - 17*p - 14. Determine m(-4). 966 Let p(u) = 7*u**3 + 2419*u**2 + 1379*u - 366. Calculate p(-345). -21 Let b(j) = 3627*j + 137189. Calculate b(-38). -637 Let f(o) = -401*o + 41215. What is f(103)? -88 Let y(r) = r**2 + 154*r - 53712. Give y(167). -105 Let q(w) = 542551*w - 16276524. What is q(30)? 6 Let i(b) = -1050*b - 947096. Give i(-902). 4 Let h(g) = g**3 + 104*g**2 + 69*g + 7370. What is h(-104)? 194 Let d(w) = -930*w - 49312. Give d(-53). -22 Let s(q) = -3*q**3 - 156*q**2 - 1724*q + 77. Calculate s(-20). -3843 Let m(g) = 33*g**2 - 2489*g - 19016. What is m(-7)? 24 Let n(x) = x**2 - 95498*x - 2005892. What is n(-21)? 7 Let g(s) = -204*s + 45245. Calculate g(221). 161 Let q(w) = w**3 - 128*w**2 + 261*w - 3333. What is q(126)? -2199 Let p(l) = l**3 + 80*l**2 + 398*l + 435. Calculate p(-4). 59 Let b(i) = 2*i**3 - 4*i**2 - 2099*i + 10502. Calculate b(5). 157 Let x(k) = 32*k**2 - 298*k - 609. Calculate x(11). -15 Let n(h) = -17*h**3 + 93*h**2 - 68*h - 17. Give n(1). -9 Let o(a) = -5*a**2 + 424*a + 6973. Determine o(-14). 57 Let z(w) = -63097*w + 252406. Calculate z(4). 18 Let o(a) = 7*a**2 + 37*a - 524. What is o(-12)? 40 Let j(h) = 2*h**3 + 595*h**2 + 21656*h - 4841. Calculate j(-255). 4 Let w(s) = 2*s**3 - 26*s**2 - 181*s + 2193. What is w(13)? -160 Let x(r) = -119195*r - 953557. Calculate x(-8). 3 Let y(q) = -33*q**2 + 3104*q - 41. Give y(94). 147 Let r(w) = -41*w**2 + 197*w - 35. What is r(5)? -75 Let v(z) = z**3 + 383*z**2 + 6240*z + 6583. Give v(-366). -5 Let n(d) = -3*d**2 - 13*d - 185. Determine n(-14). -591 Let u(h) = 2*h**3 - 75*h**2 + 197*h - 5688. Determine u(37). 232 Let s(f) = -f**3 - 16*f**2 - 54*f - 69. Determine s(-10). -129 Let j(u) = 44*u**3 - 2*u**2 + 54185*u + 54186. Give j(-1). -45 Let i(j) = -19*j**3 + 77*j**2 - 87*j + 322. Give i(4). -10 Let q(i) = 86451*i - 864511. Determine q(10). -1 Let b(c) = 31291*c + 1533265. Calculate b(-49). 6 Let g(c) = -2*c**3 + 520*c**2 - 2056*c - 4. What is g(4)? -36 Let v(x) = -x**3 + 79*x**2 + 788*x - 238. Give v(88). -590 Let p(m) = -13*m**3 + 821*m**2 - 135*m + 372. What is p(63)? -195 Let p(a) = -3*a**3 - 89*a**2 + 87*a - 1166. Calculate p(-31). -19 Let t(c) = -9486*c - 125649. Give t(-13). -2331 Let i(w) = -563959*w - 6767436. Calculate i(-12). 72 Let c(m) = -4328*m**2 + 30291*m + 22. Determine c(7). -13 Let k(g) = -30*g**2 + 47*g - 210. Calculate k(5). -725 Let c(u) = 1655*u + 146446. Determine c(-86). 4116 Let p(x) = 2162450*x - 4324902. Give p(2). -2 Let a(s) = -113*s**2 - 21838*s - 5352. What is a(-193)? 245 Let l(c) = -c**2 + 1023*c + 216537. Determine l(-180). -3 Let b(i) = -28*i**3 + 2099*i**2 + 27*i + 3516. What is b(75)? -84 Let m(l) = 4*l**2 - 226*l - 83. Calculate m(0). -83 Let b(s) = -400*s - 96535. Give b(-244). 1065 Let n(l) = -2973*l - 205127. Calculate n(-69). 10 Let b(k) = 5*k**2 + 222*k - 858. Determine b(-48). 6 Let q(k) = k**3 - 743*k**2 + 47110*k - 832. Calculate q(673). -832 Let g(c) = 3283*c + 12. Determine g(0). 12 Let h(i) = -2*i**2 + 131*i - 236. Give h(63). 79 Let w(f) = f**3 + 141*f**2 - 439*f - 1328. Determine w(-144). -320 Let g(r) = -2*r**3 + 1523*r**2 - 43187*r - 634. Calculate g(732). 98 Let u(v) = 40316*v + 362695. What is u(-9)? -149 Let d(u) = u**3 + 12*u**2 + 76*u + 317. Determine d(-8). -35 Let j(g) = -15*g**2 + 49664*g - 396363. Determine j(8). -11 Let t(b) = 10*b**2 - 5382*b - 16152. Give t(-3). 84 Let r(c) = 732008*c - 14640165. Determine r(20). -5 Let r(w) = w**2 - 208*w - 16275. What is r(-60)? -195 Let i(b) = 2168*b + 184258. Give i(-85). -22 Let i(j) = 3*j**2 + 461*j - 13313. Calculate i(-175). -2113 Let p(n) = -n**3 - 126*n**2 - 79*n - 10076. What is p(-126)? -122 Let o(a) = 9650*a - 67476. Calculate o(7). 74 Let w(o) = -o**2 + 1721*o + 13857. Calculate w(-8). 25 Let m(r) = r**2 + 15468*r - 30956. Calculate m(2). -16 Let f(t) = -19*t**3 - 26*t**2 + 103*t - 6. What is f(-5)? 1204 Let r(c) = 20*c**2 - 41255*c + 776624. Determine r(19). -1 Let t(r) = 443*r - 1796. Give t(8). 1748 Let j(h) = 166*h**3 - 5147*h**2 + 32*h - 49. Determine j(31). -18 Let f(u) = -u**3 - 44*u**2 + 2464*u + 108142. Give f(-50). -58 Let m(x) = 527*x - 17572. Give m(31). -1235 Let t(w) = 4*w**3 + 8175*w**2 - 167187*w - 6186. Determine t(-2064). 6 Let p(t) = -387*t**2 - 272*t + 727. Determine p(3). -3572 Let j(w) = w**3 - 41*w**2 - 175*w - 3111. Calculate j(45). -2886 Let h(f) = -4*f**2 - 11230*f - 300281. What is h(-27)? 13 Let v(j) = -j**3 + 10*j**2 - 349*j + 3970. Give v(11). 10 Let y(f) = -f**2 - 1046*f - 91224. Give y(-96). -24 Let p(w) = 1240*w**2 - 3716*w - 36. Determine p(3). -24 Let v(x) = 19140*x + 8345011. Calculate v(-436). -29 Let n(r) = r**3 - 11*r**2 - 35*r - 10725. What is n(27)? -6 Let r(c) = -124*c**2 - 3539*c - 3402. Calculate r(-1). 13 Let i(c) = -355*c + 23679. Calculate i(66). 249 Let l(v) = v**3 - 33*v**2 - 133*v + 152. Calculate l(41). 8147 Let j(h) = -3*h**2 - 212*h - 3690. What is j(-40)? -10 Let q(w) = 39998*w - 480005. Calculate q(12). -29 Let b(o) = 223*o**2 + 11963*o - 4259. Calculate b(-54). 7 Let z(q) = -2*q**2 - 689*q - 19679. Calculate z(-313). 40 Let o(b) = -2*b**2 - 111*b + 905. Determine o(-74). -1833 Let q(d) = -11158*d + 4887211. Determine q(438). 7 Let o(l) = -171*l - 38657. Give o(-255). 4948 Let m(u) = -19033*u + 1408361. Give m(74). -81 Let r(s) = 17003*s + 84994. Give r(-5). -21 Let o(u) = -u**3 - 54*u**2 + 5050*u + 357. Give o(-103). 48 Let j(q) = -18*q**3 - 31*q**2 + 26*q. Calculate j(-3). 129 Let m(u) = u**2 - 358*u + 17135. What is m(299)? -506 Let w(m) = -52119*m - 1615670. Determine w(-31). 19 Let h(f) = 6*f**3 + 28*f**2 + 22*f + 128. What is

Fishing lures have been provided generally in the shape of spoons and minnows having a line attachment means on one end and hook attachment means on the other, often in the form of embedded or otherwise rigidly attached eyelets. The bodies of such lures have been painted or otherwise coated with reflective material applied as by dipping. Such lures have been bent or weighted so as to provide a variety of movements or actions as, for example, simulating an injured minnow so as to attract fish. The use of reflective paint or material on lures is illustrated in U.S. Pat. Nos. 284,056 and 564,839. A lure having a bright color is illustrated in U.S. Pat. No. 1,805,416. The fishhook of U.S. Pat. No. 1,390,767 has a body of pliable lead while the sinker of U.S. Pat. No. 2,591,294 has a spoon shape with attachment means on one end. A sinker having a particulate puttylike mass of sinker composition or heavy material is attachable to a fishing line assembly. It is an important object of this invention to provide a lure which is constructed of heavy moldable lead like material which may be bent by the fisherman as desired to vary the action of the lure while casting is facilitated avoiding the addition of at least part of additional sinker material as may otherwise have been necessary to cause the lure to sink and act as desired for a lure of given shape and appearance. It is also an important object of the invention to provide a line to which a reflective tape which may have an iridescent appearance has been adhesively applied. Another important object of the invention is the provision of a lure having a body which may be molded of lead like material to which eyelets may be attached during molding and which may be coated with a water resistant bendable material and to which reflective material may be applied in the material or otherwise as by a reflective adhesive tape.

Nature of M-Ga bonds in dihalogallyl complexes (η5-C5H5)(Me3P)2M(GaX2) (M = Fe, Ru, Os) and (η5-C5H5)(OC)2Fe(GaX2) (X = Cl, Br, I): a DFT study. Density functional theory (DFT) calculations have been performed on the terminal dihalogallyl complexes of iron, ruthenium, and osmium (η(5)-C(5)H(5))(Me(3)P)(2)M(GaX(2)) (M = Fe, Ru, Os; X = Cl, Br, I) and (η(5)-C(5)H(5))(OC)(2)Fe(GaX(2)) (X = Cl, Br, I) at the BP86/TZ2P/ZORA level of theory. On the basis of analyses suggested by Pauling, the M-Ga bonds in all of the dihalogallyl complexes are shorter than M-Ga single bonds; moreover, on going from X = Cl to X = I, the optimized M-Ga bond distances are found to increase. From the perspective of covalent bonding, however, π-symmetry contributions are, in all complexes, significantly smaller than the corresponding σ-bonding contribution, representing only 4-10% of the total orbital interaction. Thus, in these GaX(2) complexes, the gallyl ligand behaves predominantly as a σ donor, and the short M-Ga bond lengths can be attributed to high gallium s-orbital character in the M-Ga σ-bonding orbitals. The natural population analysis (NPA) charge distributions indicate that the group 8 metal atom carries a negative charge (from -1.38 to -1.62) and the gallium atom carries a significant positive charge in all cases (from +0.76 to +1.18). Moreover, the contributions of the electrostatic interaction terms (ΔE(elstat)) are significantly larger in all gallyl complexes than the covalent bonding term (ΔE(orb)); thus, the M-Ga bonds have predominantly ionic character (60-72%). The magnitude of the charge separation is greatest for dichlorogallyl complexes (compared to the corresponding GaBr(2) and GaI(2) systems), leading to a larger attractive ΔE(elstat) term and to M-Ga bonds that are stronger and marginally shorter than in the dibromo and diiodo analogues.

Clinical effects of buprenorphine on open field behaviour and gait symmetry in healthy and lame weaned piglets. Lameness in pigs decreases animal welfare and economic profit for the farmer. An important reason for impaired welfare in lame animals is pain due to lameness. No direct measurement of pain is possible in animals, and methods to indirectly detect and quantify the amount of pain an animal is experiencing are urgently needed. In this study, two methods to assess pain associated with lameness in pigs were evaluated to determine if they were sensitive enough to detect a lameness reduction as an effect of an experimental analgesic medication. Asymmetry associated with lameness was objectively quantified using pressure mat kinetic parameters: peak vertical force (PVF), load rate (LR), vertical impulse (VI) and peak vertical pressure (PVP). Locomotor activity was assessed in an open field test. A dose of 0.04 mg/kg buprenorphine, a strong analgesic, was used to treat 10 lame pigs, while eight other lame pigs, treated with physiological saline solution, served as controls. Buprenorphine decreased lameness-associated asymmetry for pressure mat LR (P = 0.002), VI (P = 0.003) and PVP (P = 0.001) and increased activity of the lame pigs in the open field (P = 0.023), while saline-treated animals did not show any changes in asymmetry and became less active in the open field (P <0.001). It was concluded that measurement of gait asymmetry by pressure mat analysis and locomotor activity in an open field test are both sensitive enough to detect the analgesic effects of buprenorphine when used to treat moderate to severe clinical pain in a relatively small group of affected pigs. The methods used in this study may also provide promising additional tools for future research into early pain recognition and lameness treatment in pigs.

The problem is that while 16:10 is definitely better than 16:9, you need to ask yourself whether it is worth the cost. The U2311H is an amazing panel for the price and the U2410 is a lot more expensive. Originally Posted by NrGx;13159252 The problem is that while 16:10 is definitely better than 16:9, you need to ask yourself whether it is worth the cost. The U2311H is an amazing panel for the price and the U2410 is a lot more expensive. Again, WHY do you think 16:9 is better than 16:10? Blindly assessing that statement in your posts helps nobody. Aspect ratio =/= resolution. We can all agree that 1920x1200 is more than 1920x1080, but that does not equal 16:10 vs 16:9. If you're gonna go 16:10>16:9, please tell us why. If you don't, you're not helping anyone.

National Science Board approves plan for 21st Century STEM education August 27, 2007 By Flinn Foundation [Source: NSTA Reports, via Richard D. Fisher, Biodesign Institute at ASU] — At its August meeting, the National Science Board (NSB) unanimously adopted a motion to release for public comment a draft national action plan to address critical 21st-century needs in the nation’s STEM (science, technology, engineering, and mathematics) education system. The draft of “A National Action Plan for Addressing the Critical Needs of the U.S. Science, Technology, Engineering, and Mathematics Education System” can be found at this web page. The plan states that the overarching goal is to enhance the quantitative skills and scientific literacy of all students because all jobs increasingly will require technical knowledge. Universities and colleges would play a crucial role by producing STEM teachers better trained in the content of science and mathematics along with proven, researched ways to teach. The overarching actions stressed in the plan are increasing coordination of STEM education

Clinical research in family medicine: quantity and quality of published articles. Publication of clinical research in peer-reviewed journals is an important measure of scholarly productivity. This study determined the quantity and quality of original clinical research published by family physicians. We surveyed clinical research papers published in the year 2000 in four leading family medicine research journals and research originating in a family practice institution but published in 16 non-family medicine journals. All were selected on the basis of relevance to family physicians and "impact factor." The relevance and validity of papers was assessed using previously established criteria. The survey of family medicine journals revealed a total of 170 original research articles. Ninety eight were from academic family practice programs, and the remaining 72 were from other medical specialties or health care institutions. Most of the papers were cross-sectional surveys. There were seven qualitative studies, six randomized controlled trials, and no systematic reviews from family practice programs in these journals. Eight of the articles were from practice-based research networks. A total of 79 articles were considered relevant or highly relevant, and 22 of these were also considered valid (Patient-oriented Evidence That Matters or POEMs). The survey of 16 non-family medicine journals revealed 37 clinical research papers: 16 surveys, nine prospective cohort studies, seven randomized controlled trials, three systematic reviews/meta-analysis, one qualitative study, and one case-control study. There were nine "highly relevant" papers--seven could be classified as POEMs. Most clinical family medicine research uses less-rigorous study designs, such as the cross-sectional survey. The majority of papers do not meet established criteria for relevance and validity. There are no standards or comparable studies to compare these results to prior years or to other disciplines.

#!/usr/bin/env python3 """ A program to filter tweets that contain links to a web archive. At the moment it supports archive.org and archive.is, but please add more if you want! """ import json import fileinput archives = [ 'archive.is', 'web.archive.org', 'wayback.archive.org' ] for line in fileinput.input(): tweet = json.loads(line) for url in tweet['entities']['urls']: for host in archives: if host in url['expanded_url']: print(line, end='') done = True # prevent outputting same data twice if it contains # multiple archive urls if done: break

The Minister for Culture, Heritage and the Gaeltacht, Heather Humphreys TD, has today (Tuesday) announced €600,000 in funding from Culture Ireland, which will allow 117 Irish artists and arts organisations to present their work worldwide in 2017 and 2018. The Minister for Culture, Heritage and the Gaeltacht, Heather Humphreys TD, has today (Tuesday) announced €600,000 in funding from Culture Ireland, which will allow 117 Irish artists and arts organisations to present their work worldwide in 2017 and 2018.

Welcome Captain's Traditional Fish & Chips Hoddesdon Welcome to Captain's Fish & Chips Hoddesdon Welcome to Captain's Traditional Fish & Chips Hoddesdon. At Captain's Best of British eat in and takeaway Fish and Chip Shop, we pride ourselves on quality and affordable food and have done since 1998. For 18 years, Captain Cod has been the go-to fish and chip shop in Hoddesdon, with the queue of customers snaking out of the door (particularly on a Friday and Saturday evening) the stuff of local legend. Now, after a month-long closure to completely refurbish the High Street shop, it has reopened with a totally fresh and modern new look, and even a new name – Captain’s Fish and Chips. It is still run by the same owners, Tony Forgione and his brothers Luigi and Libby, who opened it back in 1998. Tony and his brothers are the third generation of their family to have been in the fish and chip business, so they know how to cook Britain’s traditional national takeaway dish to perfection.

Related literature {#sec1} ================== For the triclinic polymorph of the title compound, see: Chekhlov (2007[@bb3]). Experimental {#sec2} ============ {#sec2.1} ### Crystal data {#sec2.1.1} H~3~O^+^·ClO~4~ ^−^·C~20~H~24~O~6~*M* *~r~* = 478.9Monoclinic,*a* = 8.6586 (1) Å*b* = 26.7718 (3) Å*c* = 19.1518 (2) Åβ = 100.0011 (10)°*V* = 4372.05 (8) Å^3^*Z* = 8Cu *K*α radiationμ = 2.09 mm^−1^*T* = 124 K0.26 × 0.18 × 0.13 mm ### Data collection {#sec2.1.2} Oxford Diffraction Xcalibur Atlas Gemini ultra diffractometerAbsorption correction: multi-scan (*CrysAlis RED*; Oxford Diffraction, 2008[@bb4]) *T* ~min~ = 0.098, *T* ~max~ = 1.00036184 measured reflections6865 independent reflections5283 reflections with *I* \> 3σ(*I*)*R* ~int~ = 0.048 ### Refinement {#sec2.1.3} *R*\[*F* ^2^ \> 2σ(*F* ^2^)\] = 0.051*wR*(*F* ^2^) = 0.124*S* = 2.076865 reflections595 parametersH atoms treated by a mixture of independent and constrained refinementΔρ~max~ = 0.49 e Å^−3^Δρ~min~ = −0.32 e Å^−3^ {#d5e700} Data collection: *CrysAlis CCD* (Oxford Diffraction, 2008[@bb4]); cell refinement: *CrysAlis RED* (Oxford Diffraction, 2008[@bb4]); data reduction: *CrysAlis RED*; program(s) used to solve structure: *SIR2002* (Burla *et al.*, 2003[@bb2]); program(s) used to refine structure: *JANA2006* (Petříček *et al.*, 2006[@bb5]); molecular graphics: *DIAMOND* (Brandenburg & Putz, 2005[@bb1]); software used to prepare material for publication: *JANA2006* and *publCIF* (Westrip, 2010[@bb6]). Supplementary Material ====================== Crystal structure: contains datablocks global, I. DOI: [10.1107/S1600536810048622/hb5736sup1.cif](http://dx.doi.org/10.1107/S1600536810048622/hb5736sup1.cif) Structure factors: contains datablocks I. DOI: [10.1107/S1600536810048622/hb5736Isup2.hkl](http://dx.doi.org/10.1107/S1600536810048622/hb5736Isup2.hkl) Additional supplementary materials: [crystallographic information](http://scripts.iucr.org/cgi-bin/sendsupfiles?hb5736&file=hb5736sup0.html&mime=text/html); [3D view](http://scripts.iucr.org/cgi-bin/sendcif?hb5736sup1&Qmime=cif); [checkCIF report](http://scripts.iucr.org/cgi-bin/paper?hb5736&checkcif=yes) Supplementary data and figures for this paper are available from the IUCr electronic archives (Reference: [HB5736](http://scripts.iucr.org/cgi-bin/sendsup?hb5736)). This work was supperted by the institutional research plan No. AVOZ10100521 of the Institute of Physics, the project Praemium Academiae of the Academy of Sciences of the Czech Republic and the Czech Ministry of Education, Youth and Sports, Project MSM 4977751303. Comment ======= The crystal structure of dibenzo-18-crown-6 hydronium perchlorate was previously published by A.N.Chekhlov (2007). The published structure determined at room temperature is triclinic(space group P-1, a = 8.582 Å, b = 10.486 Å, c = 26.293 Å, α = 79.45°,β = 82.00° and γ = 79.36°, V =2272.5 Å) with asymmetric unit consisting of two independent molecules of macrocycle with complexed hydronium ions. The neutrality of the compound is ensured by two perchlorate anions. The data of crystal structure, presented in this paper, were collected at room temperature (testing stage) and at 120 K (final data collection). We found the complex monoclinic, *P*2~1~/*c* space group, with unit-cell parameters a = 8.6535 Å, b = 26.7823 Å, c = 19.1707 Å, β = 99.9987° and doubled unit cell volume V = 4372.05 Å^3^. The difference between both structures is in their system of hydrogen bonds. In Chekhlov\'s structure, the hydronium ion is held by three hydrogen bonds inside the crown cavity. In presented structure, hydronium ion and crown-ether form only two hydrogen bonds. The third hydrogen atom of hydronium ion is shared with perchlorate anion which makes it to point out of the cavity. This hydrogen bond causes that the perchlorate anions are not disordered as it was observed in Chekhlov\'s structure. Consequently, sharp maxima in difference Fourier map could be used for localizing hydrogen positions in both oxonia cations (Fig 3) and the found hydrogen positions could be refined without restraints. The distance between hydronium and oxygen atoms in macrocycles are 1.637 Å (O21---H1···O3) and 1.864 Å (O21---H9···O5) for one crownether molecule and 1.895 Å (O22---H10···O11) and 1.661 Å (O22---H8···O9) for the other one. The length of hydrogen bond between hydronium ion and perchlorate is 1.732 Å (O21---H7···O17) and 1.687 Å (O22---H6···O14). The distances between hydrogen atoms and oxygen atoms in hydronium correspond to the extent of their participation in hydrogen bonding system: O---H distance close (but still longer) to the standard value 0.983 Å has been only found for the weakest hydrogen bond O22---H10···O11. For stronger hydrogen bonds O---H distance becomes significantly longer, taking the maximum value 1.29 (4) for O22---H6···O14. The O---H and corresponding H···O distances for oxonia are summarized in Table 2. The hydronium ions are enclosed in the crown-ether cavities by phenyl ring of neighbouring molecules. This arrangement is stabilized due to CH-π interactions between phenyl rings and CH~2~ groups of crownether (the distance between centroid of phenyl ring C11→C16 and H37*b* in ethylen group is 2.989 Å and between centriod of phenyl ring C31→C36 and H17*a* in ethylen group is 2.870 Å) and due to the face-to-edge orientation of phenyl rings (distance between the centriod of phenyl ring C21→C26 and H13 of phenyl ring C11→C16 is 3.207 Å and between the centriod of phenyl ring C1→C6 and H33 in phenyl ring C31→C36 is 3.004 Å). Experimental {#experimental} ============ Dibenzo-18-crown-6, perchloric acid and acetonitrile were purchased by Fluka. Crystals were prepared by slow evaporation of equimolar mixture of dibenzo-18-crown-6 (0.05*M*) and perchloric acid (0.05*M*) in acetonitrile to yield colourless prisms of the title compound. Figures ======= {#Fap1} {#Fap2} {#Fap3} Crystal data {#tablewrapcrystaldatalong} ============ ----------------------------------- ---------------------------------------- H~3~O^+^·ClO~4~^−^·C~20~H~24~O~6~ *F*(000) = 2016 *M~r~* = 478.9 *D*~x~ = 1.455 Mg m^−3^ Monoclinic, *P*2~1~/*c* Cu *K*α radiation, λ = 1.5418 Å Hall symbol: -P 2ybc Cell parameters from 20984 reflections *a* = 8.6586 (1) Å θ = 3.3--62.5° *b* = 26.7718 (3) Å µ = 2.09 mm^−1^ *c* = 19.1518 (2) Å *T* = 124 K β = 100.0011 (10)° Prism, colourless *V* = 4372.05 (8) Å^3^ 0.26 × 0.18 × 0.13 mm *Z* = 8 ----------------------------------- ---------------------------------------- Data collection {#tablewrapdatacollectionlong} =============== ------------------------------------------------------------------------------ -------------------------------------- Oxford Diffraction Xcalibur Atlas Gemini ultra diffractometer 6865 independent reflections Radiation source: Enhance Ultra (Cu) X-ray Source 5283 reflections with *I* \> 3σ(*I*) mirror *R*~int~ = 0.048 Detector resolution: 10.3784 pixels mm^-1^ θ~max~ = 62.6°, θ~min~ = 3.3° rotation method data acquisition using ω scans *h* = −9→9 Absorption correction: multi-scan (*CrysAlis RED*; Oxford Diffraction, 2008) *k* = −30→28 *T*~min~ = 0.098, *T*~max~ = 1.000 *l* = −22→21 36184 measured reflections ------------------------------------------------------------------------------ -------------------------------------- Refinement {#tablewraprefinementdatalong} ========== ------------------------------------- --------------------------------------------------------------------------------- Refinement on *F*^2^ 198 constraints *R*\[*F*^2^ \> 2σ(*F*^2^)\] = 0.051 H atoms treated by a mixture of independent and constrained refinement *wR*(*F*^2^) = 0.124 Weighting scheme based on measured s.u.\'s *w* = 1/\[σ^2^(*I*) + 0.0016*I*^2^\] *S* = 2.07 (Δ/σ)~max~ = 0.022 6865 reflections Δρ~max~ = 0.49 e Å^−3^ 595 parameters Δρ~min~ = −0.32 e Å^−3^ 0 restraints ------------------------------------- --------------------------------------------------------------------------------- Special details {#specialdetails} =============== --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Refinement. The refinement was carried out against all reflections. The conventional *R*-factor is always based on *F*. The goodness of fit as well as the weighted *R*-factor are based on *F* and *F*^2^ for refinement carried out on *F* and *F*^2^, respectively. The threshold expression is used only for calculating *R*-factors *etc*. and it is not relevant to the choice of reflections for refinement.All the H atoms were discernible in difference Fourier maps and could be refined to reasonable geometry. Despite of it the H atoms bonded to carbon atoms were constrained to ideal positions. The O---H distances and angles in hydronium ions were not restrained. The isotropic temperature parameters of hydrogen atoms were calculated as 1.2\**U*~eq~ of the parent atom.The program used for refinement, Jana2006, uses the weighting scheme based on the experimental expectations, see \_refine_ls_weighting_details. --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Fractional atomic coordinates and isotropic or equivalent isotropic displacement parameters (Å^2^) {#tablewrapcoords} ================================================================================================== ------ ------------- -------------- -------------- -------------------- -- *x* *y* *z* *U*~iso~\*/*U*~eq~ Cl1 0.25806 (7) 0.16885 (2) 0.35587 (3) 0.0248 (2) Cl2 0.74151 (7) 0.41184 (2) 0.38383 (4) 0.0261 (2) O1 1.0665 (2) 0.50098 (6) 0.15146 (9) 0.0252 (6) O2 1.2316 (2) 0.46140 (6) 0.26441 (9) 0.0238 (6) O3 1.1821 (2) 0.35876 (6) 0.28737 (9) 0.0270 (6) O4 0.9437 (2) 0.30634 (6) 0.19288 (9) 0.0249 (6) O5 0.7465 (2) 0.35281 (6) 0.09651 (9) 0.0271 (6) O6 0.8039 (2) 0.45403 (6) 0.06355 (9) 0.0243 (6) O7 0.5802 (2) 0.08959 (6) 0.11052 (9) 0.0263 (6) O8 0.7525 (2) 0.12376 (6) 0.22540 (9) 0.0243 (6) O9 0.7056 (2) 0.22401 (6) 0.27262 (9) 0.0268 (6) O10 0.4558 (2) 0.28100 (6) 0.19535 (10) 0.0267 (6) O11 0.2643 (2) 0.24193 (6) 0.08853 (9) 0.0284 (6) O12 0.3196 (2) 0.14350 (6) 0.03615 (10) 0.0266 (6) O13 0.4098 (2) 0.17956 (8) 0.39605 (12) 0.0404 (7) O14 0.2617 (2) 0.17463 (8) 0.28118 (10) 0.0400 (8) O15 0.1434 (2) 0.20252 (7) 0.37496 (10) 0.0327 (7) O16 0.2159 (2) 0.11841 (7) 0.36877 (11) 0.0348 (7) O17 0.7348 (2) 0.40931 (8) 0.30779 (10) 0.0399 (8) O18 0.6961 (2) 0.46121 (6) 0.40192 (10) 0.0298 (6) O19 0.8976 (2) 0.40152 (8) 0.41890 (12) 0.0452 (8) O20 0.6341 (2) 0.37595 (7) 0.40378 (11) 0.0345 (7) O21 0.9470 (3) 0.41200 (9) 0.20320 (14) 0.0495 (9) O22 0.4740 (3) 0.17637 (9) 0.17481 (13) 0.0478 (9) C1 1.2210 (3) 0.51595 (9) 0.16739 (14) 0.0213 (8) C2 1.2909 (3) 0.54843 (9) 0.12647 (14) 0.0249 (9) C3 1.4465 (3) 0.56198 (10) 0.14712 (14) 0.0273 (9) C4 1.5327 (3) 0.54337 (10) 0.20921 (15) 0.0272 (9) C5 1.4644 (3) 0.50926 (9) 0.25017 (14) 0.0251 (9) C6 1.3092 (3) 0.49536 (9) 0.22946 (14) 0.0218 (8) C7 1.3267 (3) 0.43350 (10) 0.32048 (13) 0.0243 (9) C8 1.2279 (3) 0.39347 (10) 0.34457 (14) 0.0271 (9) C9 1.0956 (3) 0.31719 (9) 0.30858 (14) 0.0277 (9) C10 1.0523 (3) 0.28207 (10) 0.24743 (13) 0.0251 (9) C11 0.8679 (3) 0.27715 (9) 0.13818 (14) 0.0235 (9) C12 0.8904 (3) 0.22609 (10) 0.13211 (14) 0.0263 (9) C13 0.8027 (3) 0.19963 (10) 0.07643 (15) 0.0295 (10) C14 0.6942 (3) 0.22368 (10) 0.02681 (16) 0.0315 (10) C15 0.6734 (3) 0.27535 (10) 0.03163 (15) 0.0300 (9) C16 0.7594 (3) 0.30152 (9) 0.08723 (14) 0.0249 (9) C17 0.6510 (3) 0.37942 (10) 0.03977 (14) 0.0264 (9) C18 0.6510 (3) 0.43353 (10) 0.05990 (14) 0.0267 (9) C19 0.8080 (3) 0.50524 (9) 0.08415 (14) 0.0264 (9) C20 0.9729 (3) 0.52437 (10) 0.09165 (14) 0.0251 (9) C21 0.7327 (3) 0.07209 (9) 0.12468 (14) 0.0224 (8) C22 0.7959 (3) 0.03910 (10) 0.08188 (14) 0.0268 (9) C23 0.9502 (3) 0.02291 (10) 0.10120 (15) 0.0295 (9) C24 1.0392 (3) 0.04011 (10) 0.16306 (15) 0.0285 (9) C25 0.9785 (3) 0.07432 (9) 0.20588 (15) 0.0262 (9) C26 0.8251 (3) 0.09029 (9) 0.18699 (14) 0.0232 (8) C27 0.8501 (3) 0.14721 (9) 0.28477 (13) 0.0237 (8) C28 0.7525 (3) 0.18269 (10) 0.31932 (14) 0.0272 (9) C29 0.6189 (3) 0.26055 (9) 0.30496 (15) 0.0277 (9) C30 0.5650 (3) 0.30146 (10) 0.25339 (14) 0.0258 (9) C31 0.3730 (3) 0.31430 (10) 0.14860 (14) 0.0247 (9) C32 0.3859 (3) 0.36568 (10) 0.15492 (15) 0.0291 (10) C33 0.2916 (3) 0.39643 (11) 0.10659 (15) 0.0336 (10) C34 0.1876 (4) 0.37606 (11) 0.05210 (16) 0.0362 (10) C35 0.1769 (4) 0.32457 (10) 0.04384 (16) 0.0329 (10) C36 0.2687 (3) 0.29363 (9) 0.09150 (14) 0.0247 (9) C37 0.1739 (3) 0.22021 (10) 0.02603 (14) 0.0287 (9) C39 0.3192 (3) 0.09096 (9) 0.04725 (14) 0.0269 (9) C38 0.1685 (3) 0.16499 (10) 0.03607 (15) 0.0291 (9) C40 0.4813 (3) 0.07089 (10) 0.04808 (14) 0.0255 (9) H2 1.231405 0.561714 0.083496 0.0299\* H3 1.494768 0.584392 0.118191 0.0328\* H4 1.63932 0.55383 0.224244 0.0326\* H5 1.525077 0.49554 0.292542 0.0302\* H12 0.966406 0.209052 0.166353 0.0316\* H13 0.81811 0.164292 0.072615 0.0354\* H14 0.632921 0.205091 −0.011045 0.0378\* H15 0.599728 0.292466 −0.003542 0.036\* H22 0.733316 0.027309 0.038698 0.0321\* H23 0.994135 −0.000095 0.071569 0.0354\* H24 1.144758 0.028339 0.17691 0.0342\* H25 1.042704 0.086749 0.248246 0.0314\* H32 0.459801 0.380137 0.192675 0.0349\* H33 0.299694 0.432064 0.111515 0.0403\* H34 0.121755 0.397456 0.019413 0.0435\* H35 0.105429 0.310504 0.004858 0.0395\* H7a 1.364134 0.455426 0.359401 0.0292\* H7b 1.413162 0.41857 0.302888 0.0292\* H8a 1.287265 0.376258 0.384371 0.0325\* H8b 1.135985 0.408146 0.357785 0.0325\* H9a 1.002067 0.329164 0.323545 0.0332\* H9b 1.159082 0.299958 0.347238 0.0332\* H10a 1.144849 0.272934 0.229166 0.0301\* H10b 1.004393 0.252726 0.263034 0.0301\* H17a 0.545754 0.366738 0.033141 0.0317\* H17b 0.694493 0.375793 −0.002769 0.0317\* H18a 0.578391 0.451419 0.02519 0.0321\* H18b 0.6189 0.436793 0.105205 0.0321\* H19a 0.772303 0.508381 0.128674 0.0317\* H19b 0.741144 0.524343 0.04869 0.0317\* H20a 1.01435 0.516511 0.049624 0.0302\* H20b 0.973457 0.559875 0.098682 0.0302\* H27a 0.932884 0.165285 0.268531 0.0285\* H27b 0.893741 0.122157 0.318336 0.0285\* H28a 0.661042 0.165685 0.329117 0.0326\* H28b 0.812898 0.194786 0.362846 0.0326\* H29a 0.684642 0.274275 0.345999 0.0333\* H29b 0.529575 0.244913 0.319251 0.0333\* H30a 0.514058 0.326949 0.27639 0.031\* H30b 0.653423 0.315137 0.235919 0.031\* H37a 0.222792 0.22752 −0.014119 0.0344\* H37b 0.069301 0.233425 0.018916 0.0344\* H39a 0.247671 0.07545 0.009571 0.0323\* H39b 0.287414 0.084002 0.091848 0.0323\* H38a 0.13522 0.157791 0.080279 0.0349\* H38b 0.094171 0.150572 −0.001568 0.0349\* H40a 0.478954 0.035064 0.049777 0.0306\* H40b 0.519586 0.082359 0.006772 0.0306\* H1 1.043 (4) 0.3869 (13) 0.2320 (19) 0.0594\* H6 0.384 (4) 0.1733 (12) 0.2216 (18) 0.0574\* H7 0.855 (4) 0.4148 (12) 0.2446 (19) 0.0594\* H8 0.572 (4) 0.2039 (12) 0.2057 (18) 0.0574\* H9 0.893 (4) 0.3913 (13) 0.156 (2) 0.0594\* H10 0.421 (4) 0.1965 (13) 0.1302 (19) 0.0574\* ------ ------------- -------------- -------------- -------------------- -- Atomic displacement parameters (Å^2^) {#tablewrapadps} ===================================== ----- ------------- ------------- ------------- -------------- -------------- -------------- *U*^11^ *U*^22^ *U*^33^ *U*^12^ *U*^13^ *U*^23^ Cl1 0.0258 (3) 0.0217 (3) 0.0262 (3) −0.0007 (3) 0.0022 (3) 0.0018 (3) Cl2 0.0255 (3) 0.0245 (3) 0.0287 (4) 0.0012 (3) 0.0055 (3) −0.0003 (3) O1 0.0219 (10) 0.0248 (10) 0.0276 (10) −0.0008 (8) 0.0004 (8) 0.0063 (8) O2 0.0254 (10) 0.0211 (9) 0.0240 (10) −0.0010 (8) 0.0020 (8) 0.0068 (8) O3 0.0385 (11) 0.0212 (10) 0.0217 (10) −0.0086 (8) 0.0057 (8) −0.0004 (8) O4 0.0308 (11) 0.0193 (9) 0.0222 (10) 0.0028 (8) −0.0023 (8) 0.0007 (8) O5 0.0345 (11) 0.0176 (9) 0.0258 (10) 0.0015 (8) −0.0042 (8) 0.0004 (8) O6 0.0259 (10) 0.0161 (9) 0.0295 (10) 0.0001 (8) 0.0010 (8) −0.0017 (8) O7 0.0255 (10) 0.0250 (10) 0.0268 (10) 0.0005 (8) −0.0003 (8) −0.0064 (8) O8 0.0269 (10) 0.0213 (9) 0.0236 (10) 0.0012 (8) 0.0014 (8) −0.0051 (8) O9 0.0396 (11) 0.0189 (9) 0.0227 (10) 0.0054 (8) 0.0074 (8) 0.0015 (8) O10 0.0341 (11) 0.0181 (9) 0.0257 (10) −0.0008 (8) −0.0009 (8) −0.0012 (8) O11 0.0358 (11) 0.0207 (10) 0.0259 (10) 0.0012 (8) −0.0022 (9) −0.0016 (8) O12 0.0273 (10) 0.0207 (10) 0.0309 (11) 0.0011 (8) 0.0027 (8) −0.0005 (8) O13 0.0249 (11) 0.0429 (13) 0.0482 (14) −0.0092 (9) −0.0080 (10) −0.0016 (10) O14 0.0500 (14) 0.0495 (13) 0.0231 (11) 0.0046 (10) 0.0135 (10) 0.0041 (9) O15 0.0371 (12) 0.0303 (11) 0.0304 (11) 0.0104 (9) 0.0048 (9) −0.0022 (9) O16 0.0360 (12) 0.0173 (10) 0.0503 (13) −0.0042 (8) 0.0053 (10) 0.0068 (9) O17 0.0541 (14) 0.0455 (13) 0.0241 (11) −0.0078 (10) 0.0185 (10) −0.0074 (9) O18 0.0388 (12) 0.0193 (10) 0.0300 (11) 0.0057 (8) 0.0027 (9) −0.0035 (8) O19 0.0232 (11) 0.0461 (13) 0.0626 (16) 0.0111 (10) −0.0032 (10) 0.0050 (11) O20 0.0379 (12) 0.0254 (10) 0.0423 (12) −0.0069 (9) 0.0127 (10) 0.0065 (9) O21 0.0451 (14) 0.0437 (14) 0.0543 (16) −0.0028 (11) −0.0068 (12) 0.0096 (12) O22 0.0459 (14) 0.0455 (14) 0.0467 (15) 0.0057 (11) −0.0070 (12) −0.0087 (11) C1 0.0202 (13) 0.0173 (13) 0.0258 (14) 0.0009 (11) 0.0026 (11) −0.0028 (11) C2 0.0291 (15) 0.0199 (14) 0.0259 (15) 0.0013 (12) 0.0056 (12) 0.0015 (11) C3 0.0301 (16) 0.0248 (15) 0.0276 (15) −0.0035 (12) 0.0066 (12) 0.0018 (12) C4 0.0256 (15) 0.0225 (14) 0.0334 (16) −0.0006 (12) 0.0052 (12) 0.0005 (12) C5 0.0280 (15) 0.0214 (14) 0.0255 (15) 0.0006 (12) 0.0031 (12) −0.0002 (11) C6 0.0247 (14) 0.0153 (13) 0.0262 (14) −0.0015 (11) 0.0064 (11) −0.0005 (11) C7 0.0290 (15) 0.0231 (14) 0.0192 (14) 0.0018 (12) −0.0005 (11) 0.0014 (11) C8 0.0343 (16) 0.0257 (14) 0.0207 (15) −0.0046 (12) 0.0030 (12) −0.0009 (12) C9 0.0345 (16) 0.0233 (14) 0.0244 (15) −0.0069 (12) 0.0029 (12) 0.0047 (12) C10 0.0299 (15) 0.0184 (13) 0.0255 (15) −0.0004 (11) 0.0010 (12) 0.0065 (11) C11 0.0291 (15) 0.0203 (14) 0.0213 (14) −0.0042 (12) 0.0052 (12) −0.0005 (11) C12 0.0325 (16) 0.0212 (14) 0.0259 (15) −0.0002 (12) 0.0066 (12) 0.0030 (12) C13 0.0392 (17) 0.0189 (14) 0.0313 (16) 0.0001 (12) 0.0090 (13) 0.0005 (12) C14 0.0364 (17) 0.0267 (16) 0.0297 (16) −0.0060 (13) 0.0016 (13) −0.0059 (13) C15 0.0343 (17) 0.0247 (15) 0.0284 (16) −0.0012 (13) −0.0018 (13) 0.0011 (12) C16 0.0299 (15) 0.0177 (14) 0.0264 (15) −0.0018 (11) 0.0030 (12) 0.0013 (11) C17 0.0280 (15) 0.0235 (14) 0.0252 (15) 0.0006 (12) −0.0023 (12) 0.0052 (12) C18 0.0226 (14) 0.0254 (15) 0.0296 (16) −0.0002 (12) −0.0026 (12) 0.0029 (12) C19 0.0281 (15) 0.0183 (14) 0.0305 (16) 0.0036 (11) −0.0014 (12) −0.0019 (12) C20 0.0309 (15) 0.0191 (14) 0.0236 (14) 0.0045 (12) 0.0000 (12) 0.0029 (11) C21 0.0215 (14) 0.0190 (13) 0.0267 (15) 0.0018 (11) 0.0042 (11) 0.0031 (11) C22 0.0329 (16) 0.0234 (15) 0.0235 (15) −0.0008 (12) 0.0038 (12) −0.0005 (12) C23 0.0333 (16) 0.0263 (15) 0.0299 (16) 0.0043 (13) 0.0084 (13) 0.0002 (12) C24 0.0262 (15) 0.0244 (15) 0.0351 (17) 0.0018 (12) 0.0060 (13) 0.0004 (12) C25 0.0303 (15) 0.0222 (14) 0.0255 (15) −0.0013 (12) 0.0030 (12) 0.0010 (12) C26 0.0268 (15) 0.0179 (13) 0.0250 (15) −0.0008 (11) 0.0046 (12) −0.0015 (11) C27 0.0261 (15) 0.0216 (14) 0.0213 (14) −0.0035 (11) −0.0020 (11) 0.0003 (11) C28 0.0348 (17) 0.0242 (14) 0.0215 (14) 0.0006 (12) 0.0021 (12) 0.0011 (12) C29 0.0341 (16) 0.0234 (14) 0.0263 (15) 0.0016 (12) 0.0070 (12) −0.0051 (12) C30 0.0298 (15) 0.0207 (14) 0.0262 (15) −0.0025 (12) 0.0027 (12) −0.0057 (11) C31 0.0306 (16) 0.0230 (14) 0.0223 (14) 0.0015 (12) 0.0091 (12) 0.0019 (11) C32 0.0374 (17) 0.0227 (15) 0.0296 (16) −0.0008 (12) 0.0125 (13) −0.0023 (12) C33 0.0499 (19) 0.0211 (15) 0.0322 (17) 0.0052 (14) 0.0139 (15) 0.0014 (13) C34 0.0502 (19) 0.0265 (16) 0.0329 (17) 0.0116 (14) 0.0096 (15) 0.0059 (13) C35 0.0414 (18) 0.0289 (16) 0.0277 (16) 0.0040 (13) 0.0039 (14) 0.0001 (13) C36 0.0320 (15) 0.0178 (14) 0.0248 (14) 0.0015 (12) 0.0067 (12) −0.0001 (11) C37 0.0306 (16) 0.0287 (15) 0.0240 (15) 0.0015 (12) −0.0027 (12) −0.0041 (12) C39 0.0288 (15) 0.0221 (14) 0.0284 (15) −0.0032 (12) 0.0010 (12) −0.0019 (12) C38 0.0244 (15) 0.0307 (15) 0.0300 (16) 0.0023 (12) −0.0014 (12) −0.0050 (13) C40 0.0315 (15) 0.0212 (14) 0.0221 (14) −0.0003 (12) −0.0001 (12) −0.0044 (11) ----- ------------- ------------- ------------- -------------- -------------- -------------- Geometric parameters (Å, °) {#tablewrapgeomlong} =========================== ------------------- ------------- ------------------- ----------- Cl1---O13 1.4313 (19) C13---C14 1.375 (4) Cl1---O14 1.445 (2) C13---H13 0.96 Cl1---O15 1.435 (2) C14---C15 1.400 (4) Cl1---O16 1.4315 (19) C14---H14 0.96 Cl2---O17 1.449 (2) C15---C16 1.380 (4) Cl2---O18 1.4385 (19) C15---H15 0.96 Cl2---O19 1.428 (2) C17---C18 1.499 (4) Cl2---O20 1.434 (2) C17---H17a 0.96 O1---C1 1.379 (3) C17---H17b 0.96 O1---C20 1.428 (3) C18---H18a 0.96 O2---C6 1.372 (3) C18---H18b 0.96 O2---C7 1.443 (3) C19---C20 1.499 (4) O3---C8 1.439 (3) C19---H19a 0.96 O3---C9 1.438 (3) C19---H19b 0.96 O4---C10 1.434 (3) C20---H20a 0.96 O4---C11 1.379 (3) C20---H20b 0.96 O5---C16 1.392 (3) C21---C22 1.381 (4) O5---C17 1.435 (3) C21---C26 1.403 (3) O6---C18 1.423 (3) C22---C23 1.392 (4) O6---C19 1.426 (3) C22---H22 0.96 O7---C21 1.383 (3) C23---C24 1.376 (4) O7---C40 1.435 (3) C23---H23 0.96 O8---C26 1.378 (3) C24---C25 1.392 (4) O8---C27 1.438 (3) C24---H24 0.96 O9---C28 1.436 (3) C25---C26 1.382 (4) O9---C29 1.437 (3) C25---H25 0.96 O10---C30 1.437 (3) C27---C28 1.499 (4) O10---C31 1.374 (3) C27---H27a 0.96 O11---C36 1.385 (3) C27---H27b 0.96 O11---C37 1.435 (3) C28---H28a 0.96 O12---C39 1.423 (3) C28---H28b 0.96 O12---C38 1.429 (3) C29---C30 1.494 (4) C1---C2 1.379 (4) C29---H29a 0.96 C1---C6 1.409 (3) C29---H29b 0.96 C2---C3 1.386 (4) C30---H30a 0.96 C2---H2 0.96 C30---H30b 0.96 C3---C4 1.382 (4) C31---C32 1.384 (4) C3---H3 0.96 C31---C36 1.405 (4) C4---C5 1.400 (4) C32---C33 1.392 (4) C4---H4 0.96 C32---H32 0.96 C5---C6 1.384 (4) C33---C34 1.368 (4) C5---H5 0.96 C33---H33 0.96 C7---C8 1.493 (4) C34---C35 1.389 (4) C7---H7a 0.96 C34---H34 0.96 C7---H7b 0.96 C35---C36 1.378 (4) C8---H8a 0.96 C35---H35 0.96 C8---H8b 0.96 C37---C38 1.493 (4) C9---C10 1.498 (4) C37---H37a 0.96 C9---H9a 0.96 C37---H37b 0.96 C9---H9b 0.96 C39---C40 1.500 (4) C10---H10a 0.96 C39---H39a 0.96 C10---H10b 0.96 C39---H39b 0.96 C11---C12 1.388 (4) C38---H38a 0.96 C11---C16 1.393 (3) C38---H38b 0.96 C12---C13 1.391 (4) C40---H40a 0.96 C12---H12 0.96 C40---H40b 0.96 O13---Cl1---O14 109.58 (13) O6---C19---C20 109.4 (2) O13---Cl1---O15 110.37 (12) O6---C19---H19a 109.4711 O13---Cl1---O16 109.51 (12) O6---C19---H19b 109.4709 O14---Cl1---O15 108.66 (12) C20---C19---H19a 109.4713 O14---Cl1---O16 108.79 (13) C20---C19---H19b 109.4711 O15---Cl1---O16 109.90 (12) H19a---C19---H19b 109.4972 O17---Cl2---O18 108.66 (12) O1---C20---C19 109.0 (2) O17---Cl2---O19 109.47 (14) O1---C20---H20a 109.4717 O17---Cl2---O20 108.77 (12) O1---C20---H20b 109.4714 O18---Cl2---O19 109.90 (12) C19---C20---H20a 109.4707 O18---Cl2---O20 109.54 (12) C19---C20---H20b 109.4714 O19---Cl2---O20 110.47 (12) H20a---C20---H20b 109.9286 C1---O1---C20 116.4 (2) O7---C21---C22 124.3 (2) C6---O2---C7 116.22 (19) O7---C21---C26 115.7 (2) C8---O3---C9 111.9 (2) C22---C21---C26 120.0 (2) C10---O4---C11 117.51 (19) C21---C22---C23 120.1 (2) C16---O5---C17 116.21 (19) C21---C22---H22 119.9264 C18---O6---C19 111.29 (19) C23---C22---H22 119.9263 C21---O7---C40 117.2 (2) C22---C23---C24 119.5 (3) C26---O8---C27 116.48 (19) C22---C23---H23 120.231 C28---O9---C29 111.6 (2) C24---C23---H23 120.2312 C30---O10---C31 117.10 (19) C23---C24---C25 121.0 (3) C36---O11---C37 116.52 (19) C23---C24---H24 119.4897 C39---O12---C38 111.8 (2) C25---C24---H24 119.4882 O1---C1---C2 124.2 (2) C24---C25---C26 119.5 (2) O1---C1---C6 115.8 (2) C24---C25---H25 120.227 C2---C1---C6 120.0 (2) C26---C25---H25 120.2259 C1---C2---C3 120.3 (2) O8---C26---C21 115.7 (2) C1---C2---H2 119.8743 O8---C26---C25 124.6 (2) C3---C2---H2 119.8742 C21---C26---C25 119.7 (2) C2---C3---C4 120.3 (3) O8---C27---C28 109.1 (2) C2---C3---H3 119.8663 O8---C27---H27a 109.4717 C4---C3---H3 119.866 O8---C27---H27b 109.4708 C3---C4---C5 120.0 (2) C28---C27---H27a 109.4709 C3---C4---H4 120.0034 C28---C27---H27b 109.4711 C5---C4---H4 120.0038 H27a---C27---H27b 109.8839 C4---C5---C6 119.9 (2) O9---C28---C27 109.5 (2) C4---C5---H5 120.0572 O9---C28---H28a 109.4715 C6---C5---H5 120.0574 O9---C28---H28b 109.4712 O2---C6---C1 115.6 (2) C27---C28---H28a 109.4707 O2---C6---C5 124.9 (2) C27---C28---H28b 109.4711 C1---C6---C5 119.6 (2) H28a---C28---H28b 109.4873 O2---C7---C8 108.6 (2) O9---C29---C30 109.9 (2) O2---C7---H7a 109.4716 O9---C29---H29a 109.4711 O2---C7---H7b 109.471 O9---C29---H29b 109.4712 C8---C7---H7a 109.4713 C30---C29---H29a 109.4714 C8---C7---H7b 109.4716 C30---C29---H29b 109.4712 H7a---C7---H7b 110.3703 H29a---C29---H29b 109.0288 O3---C8---C7 109.0 (2) O10---C30---C29 108.7 (2) O3---C8---H8a 109.4704 O10---C30---H30a 109.4715 O3---C8---H8b 109.4715 O10---C30---H30b 109.4713 C7---C8---H8a 109.4715 C29---C30---H30a 109.4711 C7---C8---H8b 109.4715 C29---C30---H30b 109.4714 H8a---C8---H8b 109.952 H30a---C30---H30b 110.27 O3---C9---C10 109.7 (2) O10---C31---C32 124.3 (2) O3---C9---H9a 109.471 O10---C31---C36 116.3 (2) O3---C9---H9b 109.4715 C32---C31---C36 119.4 (2) C10---C9---H9a 109.4714 C31---C32---C33 120.1 (2) C10---C9---H9b 109.4705 C31---C32---H32 119.973 H9a---C9---H9b 109.2636 C33---C32---H32 119.9722 O4---C10---C9 109.2 (2) C32---C33---C34 120.2 (3) O4---C10---H10a 109.4713 C32---C33---H33 119.8784 O4---C10---H10b 109.4713 C34---C33---H33 119.8778 C9---C10---H10a 109.4712 C33---C34---C35 120.3 (3) C9---C10---H10b 109.4714 C33---C34---H34 119.8372 H10a---C10---H10b 109.7634 C35---C34---H34 119.8381 O4---C11---C12 124.5 (2) C34---C35---C36 120.1 (3) O4---C11---C16 116.1 (2) C34---C35---H35 119.9488 C12---C11---C16 119.3 (2) C36---C35---H35 119.9493 C11---C12---C13 120.0 (2) O11---C36---C31 115.8 (2) C11---C12---H12 120.0012 O11---C36---C35 124.4 (2) C13---C12---H12 119.9988 C31---C36---C35 119.8 (2) C12---C13---C14 120.5 (3) O11---C37---C38 108.6 (2) C12---C13---H13 119.7378 O11---C37---H37a 109.4712 C14---C13---H13 119.7376 O11---C37---H37b 109.4723 C13---C14---C15 119.8 (2) C38---C37---H37a 109.4709 C13---C14---H14 120.0818 C38---C37---H37b 109.4708 C15---C14---H14 120.0821 H37a---C37---H37b 110.3319 C14---C15---C16 119.6 (2) O12---C39---C40 109.2 (2) C14---C15---H15 120.1961 O12---C39---H39a 109.4712 C16---C15---H15 120.1939 O12---C39---H39b 109.4706 O5---C16---C11 115.6 (2) C40---C39---H39a 109.4708 O5---C16---C15 123.7 (2) C40---C39---H39b 109.4716 C11---C16---C15 120.7 (2) H39a---C39---H39b 109.7323 O5---C17---C18 108.1 (2) O12---C38---C37 110.4 (2) O5---C17---H17a 109.4708 O12---C38---H38a 109.471 O5---C17---H17b 109.471 O12---C38---H38b 109.4713 C18---C17---H17a 109.4713 C37---C38---H38a 109.4714 C18---C17---H17b 109.4714 C37---C38---H38b 109.4718 H17a---C17---H17b 110.8097 H38a---C38---H38b 108.4738 O6---C18---C17 110.1 (2) O7---C40---C39 107.8 (2) O6---C18---H18a 109.4711 O7---C40---H40a 109.4719 O6---C18---H18b 109.4712 O7---C40---H40b 109.4709 C17---C18---H18a 109.4709 C39---C40---H40a 109.4714 C17---C18---H18b 109.4714 C39---C40---H40b 109.4709 H18a---C18---H18b 108.827 H40a---C40---H40b 111.0734 ?---?---?---? ? ------------------- ------------- ------------------- ----------- Hydrogen-bond geometry (Å, °) {#tablewraphbondslong} ============================= ------------------------------------------------------------------------------------------------------------- Cg1, Cg2, Cg3 and Cg4 are the centroids of the C31--C36, C11--C16, C21--C26 and C1--C6 rings, respectively. ------------------------------------------------------------------------------------------------------------- ----------------------- ---------- ---------- ----------- --------------- *D*---H···*A* *D*---H H···*A* *D*···*A* *D*---H···*A* O21---H1···O3 1.14 (3) 1.64 (3) 2.763 (3) 168 (3) O21---H1···O4 1.14 (3) 2.39 (3) 2.835 (3) 101 (2) O21---H7···O17 1.22 (4) 1.73 (4) 2.945 (4) 171 (3) O22---H8···O9 1.20 (3) 1.66 (3) 2.802 (3) 157 (3) O22---H8···O10 1.20 (3) 2.29 (3) 2.837 (3) 104.4 (19) O21---H9···O4 1.09 (3) 2.40 (3) 2.835 (3) 102 (2) O21---H9···O5 1.09 (3) 1.87 (3) 2.910 (3) 159 (3) O21---H9···O6 1.09 (3) 2.47 (4) 2.967 (3) 107 (2) O22---H10···O11 1.05 (3) 1.90 (3) 2.840 (3) 149 (3) O22---H10···O12 1.05 (3) 2.34 (3) 2.895 (3) 112 (2) C5---H5···O18^i^ 0.96 2.52 3.479 (3) 177 C8---H8b···O19 0.96 2.55 3.416 (3) 150 C15---H15···O13^ii^ 0.96 2.42 3.369 (3) 169.02 C20---H20b···O16^iii^ 0.96 2.43 3.165 (3) 134 C35---H35···O15^ii^ 0.96 2.59 3.278 (4) 129 C38---H38b···O19^iv^ 0.96 2.50 3.447 (3) 168 C17---H17a···Cg1 0.96 2.87 3.704 (3) 146 C37---H37b···Cg2^v^ 0.96 2.99 3.825 (3) 146 C13---H13···Cg3 0.96 3.20 4.070 (3) 150 C33---H33···Cg4^v^ 0.96 3.00 3.899 (3) 156 ----------------------- ---------- ---------- ----------- --------------- Symmetry codes: (i) *x*+1, *y*, *z*; (ii) *x*, −*y*+1/2, *z*−1/2; (iii) −*x*+1, *y*+1/2, −*z*+1/2; (iv) *x*−1, −*y*+1/2, *z*−1/2; (v) *x*−1, *y*, *z*. ###### Hydrogen-bond geometry (Å, °) *Cg*1, *Cg*2, *Cg*3 and *Cg*4 are the centroids of the C31--C36, C11--C16, C21--C26 and C1--C6 rings, respectively. *D*---H⋯*A* *D*---H H⋯*A* *D*⋯*A* *D*---H⋯*A* ----------------------- ---------- ---------- ----------- ------------- O21---H1⋯O3 1.14 (3) 1.64 (3) 2.763 (3) 168 (3) O21---H1⋯O4 1.14 (3) 2.39 (3) 2.835 (3) 101 (2) O21---H7⋯O17 1.22 (4) 1.73 (4) 2.945 (4) 171 (3) O22---H8⋯O9 1.20 (3) 1.66 (3) 2.802 (3) 157 (3) O22---H8⋯O10 1.20 (3) 2.29 (3) 2.837 (3) 104.4 (19) O21---H9⋯O4 1.09 (3) 2.40 (3) 2.835 (3) 102 (2) O21---H9⋯O5 1.09 (3) 1.87 (3) 2.910 (3) 159 (3) O21---H9⋯O6 1.09 (3) 2.47 (4) 2.967 (3) 107 (2) O22---H10⋯O11 1.05 (3) 1.90 (3) 2.840 (3) 149 (3) O22---H10⋯O12 1.05 (3) 2.34 (3) 2.895 (3) 112 (2) C5---H5⋯O18^i^ 0.96 2.52 3.479 (3) 177 C8---H8*b*⋯O19 0.96 2.55 3.416 (3) 150 C15---H15⋯O13^ii^ 0.96 2.42 3.369 (3) 169.02 C20---H20*b*⋯O16^iii^ 0.96 2.43 3.165 (3) 134 C35---H35⋯O15^ii^ 0.96 2.59 3.278 (4) 129 C38---H38*b*⋯O19^iv^ 0.96 2.50 3.447 (3) 168 C17---H17*a*⋯*Cg*1 0.96 2.87 3.704 (3) 146 C37---H37*b*⋯*Cg*2^v^ 0.96 2.99 3.825 (3) 146 C13---H13⋯*Cg*3 0.96 3.20 4.070 (3) 150 C33---H33⋯*Cg*4^v^ 0.96 3.00 3.899 (3) 156 Symmetry codes: (i) ; (ii) ; (iii) ; (iv) ; (v) .

Trump arrives in Israel, but you wouldn’t know it watching MSNBC Jazz ShawPosted at 8:01 am on May 22, 2017 Air Force One touched down in Tel Aviv this morning a little after five o’clock on the east coast. The President and the First Lady quickly deplaned and were greeted by Prime Minister Netanyahu and his wife. It was one of the more friendly, informal initial greetings between world leaders I’ve seen in a while, with both men smiling broadly, shaking hands and joking about where they should stand for the pictures and in what order they should walk down the carpet. One microphone picked up the two leaders joking around with each other and Netanyahu saying that he never knows what the protocol is for these things. ABC News offered a preview of the upcoming agenda items as soon as the plane was on the ground. The two-day visit there will include private meetings with Israeli Prime Minister Benjamin Netanyahu and Palestinian Authority President Mahmoud Abbas, a wreath-laying at the Holocaust memorial Yad Vashem and a visit to the Western Wall in Jerusalem. The stop in Israel comes after the president’s visit to Saudi Arabia, the birthplace of Islam, and will be followed by a trip to the Vatican, where Trump will meet with the pope. I happened to have my television tuned in to MSNBC and their warm-up, five to six block actually did a good job of covering the arrival and the opening remarks made by several Israeli officials, including Netanyahu. He was beyond gracious in his welcoming speech, though he did seem to take a bit of a poke at Barack Obama and other previous presidents (without mentioning them by name, of course) when he noted that this was the only time that an American President’s first overseas trip had included a visit to Israel. There was more going on after that, but if you were watching MSNBC like I was you probably didn’t know it because the six o’clock hour had rolled around. Morning Joe began, and even though they had a split screen going showing President Trump greeting and speaking with various dignitaries, Mika and Joe were talking about two things: Russia and James Comey. They were holding up newspapers with the latest rumors about who may or may not be directly under investigation. One of the only early mentions of “Israel” in the first block was for Scarborough to say that this trip to Israel was not going to distract the new special investigator from his duties, day after day seeking the truth. Since there was nothing new on the Russia story breaking overnight they were basically just rehashing what their network had already covered the night before while the President of the United States was walking into meetings in one of the most contentious regions on the planet. Shortly after the program kicked off, I checked on Twitter and noted that the Morning Joe account had, for some mysterious reason, tweeted out a claim that they were covering the President’s trip. My response, I admit, was probably less than gracious. I suppose this is the response we can expect in much of the American press over the days to come. I realize that it probably comes as a tremendous disappointment to the legacy MSM, but thus far Donald Trump’s first overseas trip has been basically devoid of things to attack him over. (Though that didn’t stop some of them from trying.) In front of both Arab and now Jewish leaders, Trump has been managing to dive into foreign affairs with a series of seemingly productive meetings which have been well received by leaders in that part of the world. That’s not to say that issues surrounding the ongoing investigations in Washington have gone away or should be ignored, but you’d think that the details of this trip would be big news also, eh?

Bissau, Rajasthan Bissau is a city and a municipality in Jhunjhunu district in the state of Rajasthan, India. Geography Bissau is located at . It has an average elevation of 292 metres (958 feet). It is about 40 km. from Jhunjhunu, and 12 km. from Churu. Bissau is well connected by private & R.S.R.T.C. bus services. It is also connected by trains with big cities along with the neighbouring tourist towns like as Churu, Fatehpur, Sikar & Jaipur. Bissau is 210 km from Jaipur, 280 km from New Delhi, and 1300 km from Mumbai. Places of tourist attractions Bissau Fort.(present owner Rawal Sanjai Singh ji Of Bissau ) Raj ki Chhatri (A Cenotaph of Maharaja's of Bissau) Temple of Venkat(Baanke) Bihari Ji.(Maharaja's of Bissau) Temple of Narsingh Deo Ji. 132 Ft Neelkanth Mahadev Temple Barfani baba mandir Budhia Mahadev Mandir. jeen mata mandir (meena ka mohalla word no. 07) Goga Medi & Mandir & Talab(Maharaja's of Bissau) Gaushala Bissau(Maharaja's of Bissau) Dholpalia Johad(Maharaja's of Bissau) Gaushala Johad(Maharaja's of Bissau) Soorsagar(Maharaja's of Bissau) Madarsa Inamul uloom Bajranglal ji Jhunjhunwala ki Haveli. Jai Narain Gopi Ram Tibrewal Haveli. Chandi Prasad sigatia Haveli. Budhar Mal Mertia Haveli. Shri Lal Didwania (Tibrewal) Haveli. Girdhari Lal Sigatia Haveli. Bajrang Lal sigatia Haveli. Radhey Shyam Singhania Haveli. Satya Narain Banwari Lal Bagla Haveli. Hari Prasad Nand Lal Kyala Haveli. Hari Bax Fatehpuria Haveli. Kashi prasad Vaidhya (S/O Tularam ji Sharma ) Haveli. Ram Dayal Fatehpuria Haveli. Brij Mohan Kanodia Haveli. Jorawar Mal Poddar Haveli. Keshardev Ji Kanodia Haveli Nathu Ram Poddar Haveli. Murli Dhar Hira Lal Jhunjhunuwala ki Haveli. Niranjan Lal jai Dayal Kedia Haveli. Shri Babulal Hajarimal Jatiaji Haveli Dhawalpaliha Johda. Samash Khan Peer Ki Dargkah 121 Ft Minaret at Arafat Mosque • Ramanyana Bala ji Mandir Ghochiya ki bari It is also famous for mute ramleela performed since last 150 years. It is performed by locals and is performed in daylight at Ram leela chowk, Main market. Its only ramleela in world of its type. It continue for 15 days starting for Navratri. Education Bissau, Rajasthan has some very good educational institutions. Lakshmipat Singhania Academy (rated 4.2 of 5 on SchoolMyKids) is one of the top K12 school in Bissau. Demographics India census, Bissau had a population of 21,133. Males constitute 51% of the population and females 49%. Bissau has an average literacy rate of 60%, higher than the national average of 59.5%; with male literacy of 70% and female literacy of 50%. 18% of the population is under 6 years of age. References http://www.censusindia.gov.in/ Category:Cities and towns in Jhunjhunu district

Professional esports is expected to see continued revenue growth and investment, driven by a range of factors that have pushed the industry further into the mainstream, according to a new survey conducted by law firm Foley & Lardner LLP and The Esports Observer. But industry participants are also eyeing an array of concerns as they focus on protecting and legitimizing their brands at this critical juncture in the esports industry’s development. The 2018 Esports Survey was completed by 124 professionals, primarily from esports and traditional professional sports teams and leagues, as well as technology and media companies. What’s Driving Growth? Respondents identified several factors that have had a significant impact on the growth of esports over the past year, including increased interest in streaming deals from major tech companies and TV networks (69%), the growing involvement of traditional professional sports teams, leagues and figures (68%) and the broadening of sponsorships beyond brands endemic to gaming (59%). The traditional professional sports industry, eyeing ways to diversify revenue streams, is the group respondents most expect to increase their investment in esports over the next year (57%), followed by private equity and venture capital firms (39%) and media groups (38%). Meanwhile, respondents ranked advertising and sponsorships as the area they expect to drive the most revenue growth in esports over the next year, followed by media rights. “Respondents’ belief that advertising and sponsorships will drive growth is a positive development for esports as these revenue streams benefit participants across the industry, independent of the developers and publishers that largely dominate the broader gaming industry,” said Michael Wall, of counsel and a member of Foley’s Sports Industry Team. “This growth can be expected to accelerate as traditional sponsors become increasingly comfortable with evolving metrics for evaluating return on sponsorship investment.” Tobias Seck, business analyst at The Esports Observer, added that “the near-term growth anticipated from sponsorship deals might be explained by their relatively lower degree of complexity and duration compared to media rights deals, which – especially considering the impact of mobile streaming – are likely to contribute significantly to the industry’s long-term growth.” Risks Abound Despite the significant promise of esports, survey respondents are also cognizant of the risks facing the industry. Match fixing topped the list of threats to the legitimacy and growth of esports, with 78% of respondents calling it a serious or moderate risk. A substantial percentage said the same of the recent repeal of U.S. net neutrality regulations (71%), the lack of safeguards and protections for underage players (60%) and illegal gambling (57%). “When you consider the amount of money in esports gambling, combined with the ability of one player to make or break a team’s prospects for success, match fixing is really the elephant in the room,” said Mary K. Braza, co-chair of Foley’s Sports Industry Team. “Looking ahead, match fixing has the potential to negatively impact the popularity of esports if fans get the impression that cheating is widespread or that results are illegitimate.” A strong majority (69%) said their organizations are focused on staying up to date on legal issues concerning esports and complying with current laws and regulations. Respondents also identified a number of legal issues that they believe pose a substantial risk to the esports industry, including cybersecurity and malware attacks targeting gamers’ and fans’ data (65%), intellectual property rights and licensing issues (50%), cyberbullying within games (43%) and contracts that do not provide adequate protections for players (43%). “Survey respondents are keenly focused on legal compliance. This is not surprising as the commercial growth of esports requires greater sophistication across the landscape of potentially applicable laws,” said Jon Israel, vice chair of Foley’s Sports Industry Team. “At the same time, the unique aspects of the esports industry makes the panoply of legal considerations novel and complex, particularly in the absence of laws or regulations specific to esports.” Esports Institutions – and What Else Might be Ahead Amid this risk and uncertainty, a substantial percentage of respondents feel there is a need for stronger esports institutions. They expressed the greatest support for players associations that represent the interests of professional esports players (77%), likely to bring greater credibility to esports and to protect players from exploitation. Another 57% agreed with the need for an organized lobbying group to spur development of esports and influence government regulations. Roughly two-thirds of respondents expect that each would be established within three years. The creation of an overarching esports governing body was more controversial, with 47% indicating a need for such a body and 34% dissenting. Supporters indicated that such a governing body could boost legitimacy and mainstream appeal, while opponents argued that it would be impractical or even counterproductive, given the disparate and evolving nature of esports. “The survey responses indicate some recognition of a need – and overall desire – for the esports industry to band together,” said Kevin Schulz, co-chair of Foley’s Sports Industry Team. “There’s also notable uncertainty about how that would look and acknowledgment of the practical issues with applying a uniform standard in a constantly changing and dynamic industry comprised of different games and developers.” Respondents also identified other developments that will support the burgeoning esports industry. Over the next year, the overwhelming majority (88%) foresee the construction of more specialized esports facilities and 47% expect virtual reality esports to grow substantially. For more information and to download the complete 2018 Esports Survey report, please click here. Get The Latest Business and Marketing Related Esports Insights Straight Into Your Inbox Foley & Lardner LLP looks beyond the law to focus on the constantly evolving demands facing our clients and their industries. With over 1,100 lawyers in 24 offices across the United States, Mexico, Europe, and Asia, Foley approaches client service by first understanding our clients’ priorities, objectives, and challenges. We work hard to understand our clients’ issues and forge long-term relationships with them to help achieve successful outcomes and solve their legal issues through practical business advice and cutting-edge legal insight. Our clients view us as trusted business advisors because we understand that great legal service is only valuable if it is relevant, practical and beneficial to their businesses. Learn more at Foley.com. About Foley’s Sports Industry Team Foley’s multidisciplinary Sports Industry Team provides comprehensive, integrated legal counsel on a full range of commercial and regulatory issues facing organizations in the sports industry, including professional and college sports organizations, amateur and charitable sports organizations, sports technology companies, fantasy sports and sporting goods manufacturers. With a long history and depth of experience in the sports world, Foley helps clients navigate all aspects of the dynamic and growing esports industry. Foley’s sports attorneys bring a diverse range of legal disciplines and practical industry experience to counsel clients on a wide range of issues, including investments, acquisitions and financing; sports facility development; antitrust and litigation matters; negotiation of media rights deals; intellectual property issues; and labor and employment matters. Chambers USA, U.S. News-Best Lawyers and The Legal 500 United States have recognized Foley’s Sports Industry Team as one of the top sports practices in the country for more than a decade. About The Esports Observer The Esports Observer is the world’s leading source for esports business news and insights. TEO offers an integrated platform that enables companies to make the right decisions when venturing into the esports industry. We offer real-time business intelligence and reports, in addition to planning and hosting industry events and conferences. Our ultimate goal is to increase transparency and foster growth in esports.

Percutaneous transluminal angioplasty of a large septal artery. A severely stenotic, large-caliber, first septal artery was successfully dilated in a patient with refractory angina and nonsurgical, multivessel coronary artery disease. The success of this dilatation was related to favorable coronary anatomy and to the availability of a guidewire-directed dilatation catheter. Septal artery stenosis with or without surgically accessible stenoses in other coronary vessels represents a potential indication for percutaneous transluminal coronary angioplasty.

1. Introduction {#S1} =============== Congenital coronary artery anomalies are defined as a coronary pattern that is found in less than 1% of the general population, with a prevalence ranging from 0.3%−5.6% \[[@R1]\]. In few types of the anomalies, there is an association with sudden death and premature coronary disease \[[@R2]\]. Congenital absence of left main coronary artery (LMCA) and anomalous origins of left anterior descending artery (LAD) and left circumflex artery (LCX) arising from right sinus of Valsalva is rarely reported. Here we are presenting a 62-year-old male who presented with non-ST NSTEMI who found to have anomalous absence of left main coronary artery and anomalous origins of left anterior descending artery and left circumflex artery from right sinus of Valsalva. 2. Report of the Case {#S2} ===================== 62 years old man with past medical history of hypertension, dyslipidemia and type II diabetes mellitus presented with acute chest pain. The pain started suddenly, pressure like, at the left side, 9/10 in intensity, radiates to left arm and was associated abdominal discomfort, nausea and diaphoresis. The pain was relieved by sublingual nitroglycerin. Electrocardiography showed tall positive T waves at inferior leads ([Figure 1](#F1){ref-type="fig"}). His troponin was initially 0.5 ng/L then increased after 4 hours to 1.2 ng/L. He was started on aspirin, clopidogrel and heparin. Transthoracic echocardiography showed ejection fraction estimated to be 60% without wall motion abnormality. He was taken for cardiac catheterization, which showed 95% occlusion of proximal left circumflex artery (LCX) and 60% occlusion of distal Left anterior descending artery (LAD). LCX and LAD were originated from right coronary cusp ([Figure 2](#F2){ref-type="fig"}). He was treated with drug-eluting stent for proximal LCX ([Figure 3](#F3){ref-type="fig"}). He was discharged on aspirin and ticagrelor in a stable medical condition. 3. Discussion {#S3} ============= Coronary heart disease one of the leading causes of death in developed countries \[[@R3]\]. Congenital coronary artery anomalies are relatively rare entities with a prevalence that is reported to be approximately 0.3%-5.6%. The variation in prevalence is likely explainable by the diversity of the study populations \[[@R1]\]. Studies suggest that congenital coronary artery anomalies are the second most common cause of sudden death in young athletes, likely due to premature coronary disease \[[@R2]\]. Based on predisposition to CAD, congenital coronary artery anomalies are classified into 3 major groups: first: anomalies that predispose to ischemia such as coronary vessels originating from right atrium; second: anomalies that do not predispose to ischemia, as in anomalous origin of right coronary artery from posterior sinus of Valsalva; third: anomalies that might predispose to ischemia as in congenital absence of LAD \[[@R4]\]. It is usually diagnosed incidentally by CT coronary angiography, interventional coronary angiography, and in some severe and unusual cases, by transthoracic or transesophageal echocardiography, particularly in pediatric populations \[[@R4]\]. In our case, the patient has multiple anomalies: congenital absence of the left main coronary artery (LMCA) which was reported in 0.41%−0.67% of the cases \[[@R5]\]. It is, in most of the cases, clinically benign. However, an association with myocardial infarction and syncope were reported \[[@R6]\]. The second one is anomalous origins of left anterior descending artery (LAD) and left circumflex artery (LCX) from right sinus of Valsalva, were report separately as 0.03% and 0.032% respectively. The combination of both is extremely rare. The clinical significance of this anomaly is according to the course of the LAD. The possibilities of LAD course are: pre-pulmonic anterior to the right ventricular outflow tract which rarely causes ischemia; retro-aortic posterior to the aortic root, as in our case, usually benign; inter-arterial between the aorta and pulmonary artery, often associated with unfavorable outcomes; trans-septal subpulmonic course, which rarely causes ischemia; and retro-cardiac in the posterior atrioventricular groove, which predisposes to coronary disease \[[@R6]\]. The other aspect of the anomaly management is technical difficulties of coronary angiography and percutaneous coronary intervention due to unexpected positions and difficult angles. 4.. Conclusion {#S4} ============== We reported a case of combined anomalies of the coronary arteries including absence of Left Main Coronary Artery with Anomalous Origin of Left Anterior Descending and Left Circumflex Arteries that presented with NSTEMI. This combination of anomalies is exceedingly rare. While congenital coronary artery anomalies are quite rare, these entities could result in acute coronary syndrome with technical difficulties during percutaneous coronary interventions. Our case report highlights the need to keep that possible diagnosis of congenital coronary anomalies in mind while managing patients with acute myocardial infarction. This work is supported, in part, by the efforts of Dr. Moro O. Salifu M.D., M.P.H., M.B.A., M.A.C.P., Professor and Chairman of Medicine through NIH Grant number S21MD012474. {#F1} {#F2} {#F3}

Ultrastructural characteristics and lysozyme content in hypergranular and variant type of acute promyelocytic leukaemia. We investigated the electronmicroscopic (EM) features and cellular lysozyme (LZ) content in 16 cases of acute promyelocytic leukaemia (APL): 11 cases of the hypergranular form (M3) and five cases of the microgranular variant (M3-V). The main EM features in all cases were: irregular, folded or bilobed nuclei, many cytoplasmic granules, distended rough endoplasmic reticulum (RER) cisternae which, in some cases, presented as stellate forms (more frequent in M3-V), and bundles of cytoplasmic microfilaments. Many Auer rods were present in M3 cases and few in M3-V; most of these disclosed parallel tubular arrays (PTA) with a varied periodicity ranging from 13 to 26 nm. There was a significant difference between M3 and M3-V (P<0.0001) in both the number of granules per cell section (62.9 +/- 34.5 v 38.0 +/- 23.6) and in the granule section area (0.044 +/- 0.033 v 0.026 +/- 0.015 microm2). In some cases, mainly in M3-V, we found cells with large granules containing PTA which probably represent poorly developed Auer rods. Intracellular LZ content assayed by a post-embedding immunogold method, showed high granular LZ density (in the range of that found in M4 and M5) in M3 cells and very low granular LZ content in M3-V. This study adds new objective parameters for the diagnosis of these two types of APL and provides new information on their LZ pattern of expression.

Drunk Florida Woman Calls 911 Out of Loneliness, Gets Arrested On March 30, a woman in Florida started drinking to combat her loneliness. She soon became drunk. Standard enough, right? We've all been there. Less standard, however, is what the woman did next. According to police reports, 64-year-old Fleurette French then called 911 to report a fake medical issue. When a medic arrived on the scene, French told him the truth. "French told [a medic] the real reason she called 911 was 'because she was lonely,'" a deputy wrote in an affidavit obtained by the TC Palm. The medic also noted that French was "highly intoxicated" but "in no obvious distress." Despite the lack of obvious injury or ailment, the medic took French to the Indian River Medical Center, a nearby hospital. The deputy who responded to the initial call grew suspicious and investigated French, eventually discovering that she had called 911 five times in the week before this incident; each time, she had been drunk and was taken to the hospital. The deputy decided that, crushing loneliness or not, law enforcement officers in Florida had better things to do with their time, so he went to the hospital and arrested French, charging her with abuse of emergency services.

Q: Unable to connect to Postgres on Vagrant Box - Connection refused? First off, I'm new to Vagrant and Postgres. I created my Vagrant instance using http://files.vagrantup.com/lucid32.box without any trouble. I am able to run vagrant up and vagrant ssh without issue. I followed the instructions with one minor alteration, I installed the "postgresql-8.4-postgis" package instead of "postgresql postgresql-contrib". I started the server using: postgres@lucid32:/home/vagrant$ /etc/init.d/postgresql-8.4 start While connected to the vagrant instance I can use psql to connect to the instance without issue. In my Vagrantfile I had already added: config.vm.forward_port 5432, 5432 but when I try to run psql from the localhost I get: psql: could not connect to server: Connection refused Is the server running locally and accepting connections on Unix domain socket "/tmp/.s.PGSQL.5432"? I'm sure I am missing something simple. Any ideas? Update: I found a reference to an issue like this and the article suggested using: psql -U postgres -h localhost with that I get: psql: server closed the connection unexpectedly This probably means the server terminated abnormally before or while processing the request. A: The instructions from the blog post you mentioned are not right at all for ubuntu: they use pieces from the installation of a self-compiled server that don't mix well with a packaged version. One should not create /usr/local/pgsql/data and run initdb to that directory, because the ubuntu package uses /var/lib/postgresql/<pg-version-number>/<cluster-name> and runs initdb on behalf of the the user. The error mentioning "/tmp/.s.PGSQL.5432" shows that the expected location for this file is incorrect (for ubuntu). It should be in /var/run/postgresql. This is probably due to running initdb manually with parameters that are incompatible with ubuntu. The postgresql.conf and pg_hba.conf files to edit to enable non-local connections should be inside /etc/postgresql/8.4/main, and not /usr/local/pgsql/data. The /etc/init.d/postgresql-8.4 should be launched by root (as everything else in /etc/init.d), not by the postgres user. PGDATA should not be set manually, because again it really gets in the way of how the ubuntu postgres packages works. My answer would be to purge and reinstall the postgresql-8.4 package without following any of the instructions from the blog post. postgresql-8.4-postgis depends on postgresql-8.4 so it will be removed as well. Also make sure to undo the setting of PGDATA in /etc/bash.bashrc.

Cybersecurity Skills Shortage & the UK The cybersecurity skills shortage is a big problem. It was predicted as a key forecast for 2017 and has been a growing concern within the cybersecurity sector for some time. 45% of organisations now identify that they have a shortage of cybersecurity skills, versus 28% only two years prior. In addition, by 2019 it’s anticipated there will be a global shortage of two million professionals within the cybersecurity space. With the number of high-profile hacks, data breaches and cases of leaked sensitive information increasing in volume and severity worldwide, it is now more imperative than ever for organisations to ensure they are adequately protected against cyber threats. What steps are being taken within the UK to tackle this issue? None traditional hiring practices With such a limited talent pool to choose from, organisations in the UK are now ‘thinking outside the box’ when it comes to recruiting cybersecurity talent. Previously, 92% of hiring managers prioritised the presence of many years of cybersecurity experience of candidates above all other requirements, but things are beginning to change. Presently, only 25% of candidates hold qualifications outside of the technology space. Moving forward, hiring managers are employing individuals at graduate level that can be trained in the field. Traditionally, those with Computer Science and Technology relevant qualifications would have been the only ones considered for such roles, but whilst the talent pool remains lean, other educational backgrounds are being considered as alternatives. Their ability to view things from outside of a technical mind-set has been highlighted as a key benefit by hiring managers looking for candidates outside of the usual remit. On average, it takes around six months to fill a cyber security vacancy, and only 12% of the cybersecurity workforce are under 35 years old. Things will need to change. Cyber Schools Programme Further to shifting hiring focus onto the graduate market, the UK is going one step further and also encouraging those at school-level to develop an interest in cybersecurity. The UK Government has established an initiative known as the ‘Cyber Schools Programme’. Targeting 14-18 year olds, the plan is for this programme to have trained in excess of 5,500 young people in cybersecurity skills by 2021. With £20 million in funding, the course aims to cover aspects such as ‘digital forensics, defending web attacks, programming and cryptography’. It is hoped that as a result, organisations will create apprenticeships and internships to allow integration of these individuals into their company, reducing the strain and competition for higher-level cybersecurity professionals within organisations. National Cyber Security Centre Launched in October 2016, the National Cyber Security Centre has been created to provide ‘a single point of contact for SMEs, larger organisations, government agencies and departments’. The introduction of this service shows that the UK is taking cybersecurity seriously, and is clearly looking at ways to encourage individuals to learn more about this evolving technology. As a central hub for all-things cybersecurity, they provide support to academic institutions to ensure that the next generation of cyber security professionals are educated and enthused about the future of national cyber security. In addition, the NCSC also offers a ‘CyberFirst’ programme aimed at 11 to 17 year olds. A combination of residential, and non-residential short courses, hosted by a number of UK Universities; CyberFirst is designed to introduce students to cybersecurity and is free of charge. To attend. Using Artificial Intelligence Whilst the UK waits for the next generation of cybersecurity professionals to complete their academic studies, other avenues are being explored. One such avenue is the use of Artificial Intelligence. In its most simplistic form, artificial intelligence can support organisations by detecting and identifying abnormal behaviours in their network. These can then be flagged for the attention of a cybersecurity professional, who can look at the context of these anomalies to determine if they are a genuine threat. By delegating the detection aspect of cybersecurity to Artificial Intelligence, human professionals will be able to focus their attention elsewhere. With the threat of cybercrime increasing at an alarming rate, it is essential that countries do everything they can to encourage individuals into the cybersecurity field in order to reduce the cybersecurity skills shortage worldwide. In 2017, the UK took strides towards closing the gap – will others follow during 2018? Are you looking for as new role in Cybersecurity? Click here to see our current vacancies.

Hansal Mehta’s achievement is to turn what first appeared to the public as a sensational sex scandal into a quiet and reflective film that bears witness to the humiliation suffered by Siras and his struggle to preserve his dignity. As it considers curative petitions seeking the decriminalisation of homosexuality, the Supreme Court must realise that acts of prejudice which provoke hate crimes and push people towards death need to be redeemed by the law. Twitter Acknowledgment The Independent and Public Spirited Media Foundation has provided financial support to the Foundation for Independent Journalism (FIJ) for the purpose of reporting and publishing stories of public interest. IPSMF does not take any legal or moral responsibility whatsoever for the content published by FIJ on their website thewire.in or on any of its other platforms.

Fantastic beasts and how to find them-Molecular identification of the mitochondrial ATP-sensitive potassium channel. Despite reported sightings over many years, certain mitochondrial-specific channels have proven to be elusive beasts, evading molecular identification. However, combining modern genetics with a wave of their ion-sensing wand, researchers have managed to capture first the mitochondrial calcium uniporter, and now that semi-mythological beast, the mitochondrial ATP-sensitive potassium (mitoKATP) channel.

Trion Worlds is no stranger to taking a well-established idea and making it its own. The company’s first MMO Rift was heavily inspired by World of Warcraft, but the game’s titular Rifts planted the seed for many of the “world events” seen in modern MMOs. Later on, Trion’s Defiance married FPS and MMO mechanics years prior to Destiny. If you’re a big MMO fan, chances are fairly good that you’ve already heard of Trove, which officially launches today. The voxel-based “MMO Adventure,” as Trion calls it, has been around in open beta form since November of last year. As of today, the game has officially been released. The game’s blocky look and building mechanics certainly bring Minecraft to mind, but Trove has more in common with a standard MMO than with Minecraft’s open-ended building style. As opposed to different servers, Trove takes place in one vast open world. “Trove started out as two guys who had been working on Rift,” Trion CEO Scott Hartsman told VentureBeat. “They had been working on Rift for a lot of years, and they asked if they could go start a passion project. It took them about six weeks, and they put this prototype together. We said, ‘There’s something there.'” Like a traditional MMO, the game features different character classes. The latest, which is being introduced with the official launch of the game today, is the Tomb Raiser. As the name implies, this class raises skeletons from the dead to aid it in combat. The official launch of Trove is about more than the version number ticking over to 1.0. This also marks the launch of the game on Steam, which is sure to see more players flocking to the game. Trion plans to continue to add new features in addition to keeping the game fresh with content, and PVP combat is planned for the future.

Large-scale Web services often employ distributed memory caching solutions to reduce client response latencies by lowering loads at the critical backend database tier. Such in-memory caching solutions are also offered as a service by several cloud service providers, including Amazon Web Services and Google Cloud Platform. A popular example of such a caching solution is Memcached, that is currently employed by many online service providers, including Facebook, Reddit, Twitter, Wikipedia, YouTube, and Zynga. The memory caching tier sits in between the client and the backend database or storage tier, and aggregates the available memory of all nodes in the caching tier to cache data. Requests from clients are first looked up at the faster (memory access) caching tier. If the lookup fails in the caching tier, it is then tried at the slower (disk access), persistent database tier. However, distributed caching systems, such as Memcache, are not elastic due to their stateful nature. There are many challenges in dynamically scaling the caching tier. The primary challenge is that the scaling action will result in an immediate, albeit transient, performance degradation. Addition of a new cache node results in a cold cache, whereas removal of an existing cache node results in loss of hot data. In both cases, performance suffers by as much as a factor of 10 due to cache misses — until the cache is warm again (which can take many minutes, significantly costing businesses in lost revenues). To avoid such performance issues, system administrators typically over-provision caching systems, leading to significant cost/energy waste given the large amounts of expensive DRAM deployed. This project aims to investigate novel architectures for memory caching systems that will enable dynamic scaling without any performance degradation. Our research will enable significant cost and energy savings, and will also scale to Internet-sized systems such as Facebook and Amazon.

Aeromexico unveils the exterior design of its first Boeing 787-9 Dreamliner Aeromexico has presented the special livery of its first Dreamliner 787-9. The aircraft will be named Quetzalcoatl (meaning “Feathered Serpent”) after one of the principal deities of pre-Hispanic Mexico. Aeroméxico’s Quetzalcoatl plane left the Boeing Aircraft Paint Hangar after a nine-day process-six days longer than expected-as the engineers found that they needed extra time to add all of the original hues and colours featured in the winning design. In November 2014, Aeroméxico announced the “Design is in the Air” contest via social media and at several universities, inviting participants to submit a creative image to be painted on an aircraft’s fuselage. More than 1,000 participants presented their designs during the four-week contest period, 400 of which were chosen for meeting the requirements established in the rules. The winning design was created by graphic designer José Manuel Escudero of the Mexican state of Veracruz. Aeroméxico CEO Andrés Conesa said: “At Aeroméxico, we are very excited about the buzz the Quetzalcoatl design has generated. As Mexico’s flagship carrier, this aircraft will become an icon of our fleet and a reflection of what Mexico is today, with culture and tradition represented in what we consider to be one of the most sophisticated creations of modern aviation engineering.” Conesa added: “We hope this plane will make our country proud. Quetzalcoatl will fly between major airports in Europe and Asia visited by millions of travellers each year.” Aeroméxico is the second carrier in Latin America to operate the Boeing 787-9 Dreamliner and plans to continue investing until its fleet has ten 787-9 aircraft, with the purpose of providing a better flight experience to customers. The airline has said that it will wait until the plane lands in Mexico to unveil the interior of this new aircraft that will change its customers’ travel experience. Latest Jobs Aviation Tribune is a respected source of valuable information about the aviation industry and indexed by all the major news aggregators, including Google News. Our articles database is continuously updated thanks to our dedicated team of in-house reporters.

Climatic change and its ecological implications at a subantarctic island. Marion Island (47°S, 38°E) has one of the most oceanic climates on earth, with consistently low air temperatures, high precipitation, constantly high humidity, and low incident radiation. Since 1968 mean surface air temperature has increased significantly, by 0.025° C year-1. This was strongly associated with corresponding changes in sea surface temperature but only weakly, or not at all, with variations in radiation and precipitation. We suggest that changing sealevel (atmospheric and oceanic) circulation patterns in the region underlie all of these changes. Sub-Antarctic terrestrial ecosystems are characterized by being species-poor and having a simple trophic structure. Marion Island is no exception and a scenario is presented of the implications of climatic change for the structure and functioning of its ecosystem. Primary production on the island is high and consequently the vegetation has a large annual requirement for nutrients. There are no macroherbivores and even the insects play only a small role as herbivores, so most of the energy and nutrients incorporated in primary production go through a detritus, rather than grazing, cycle. Ameliorating temperatures and increasing CO2 levels are expected to increase productivity and nutrient demand even further. However, most of the plant communities occur on soils which have especially low available levels of nutrients and nutrient mineralization from organic reserves is the main bottleneck in nutrient cycling and primary production. Increasing temperatures will not significantly enhance microbially-mediated mineralization rates since soil microbiological processes on the island are strongly limited by waterlogging, rather than by temperature. The island supports large numbers of soil macro-arthropods, which are responsible for most of the nutrient release from peat and litter. The activities of these animals are strongly temperature dependent and increasing temperature will result in enhanced nutrient availability, allowing the potential for increased primary production due to elevated temperature and CO2 levels to be realized. However, housemice occur on the island and have an important influence on the ecosystem, mainly by feeding on soil invertebrates. The mouse population is strongly temperature-limited and appears to be increasing, possibly as a result of ameliorating temperatures. We suggest that an increasing mouse population, through enhanced predation pressure on soil invertebrates, will decrease overall rates of nutrient cycling and cause imbalances between primary production and decomposition. This, along with more direct effects of mice (e.g. granivory) has important implications for vegetation succession and ecosystem structure and functioning on the island. Some of these are already apparent from comparisons with nearby Prince Edward Island where mice do not occur. Other implications of climatic change for the island are presented which emphasize the very marked influences that invasive organisms have on ecosystem structure and functioning. We suggest that changing sealevel circulation patterns, by allowing opportunities for colonization by new biota, may have an even more important influence on terrestrial sub-Antarctic ecosystems than is suggested merely on the basis of associated changes in temperature or precipitation.

MSC Armonia MSC Armonia is a cruise ship that was built in 2001 for the now defunct Festival Cruises as MS European Vision. Since 2004 the ship has been owned and operated by MSC Cruises. At 58,600 gross register tons, she can accommodate 2,065 passengers in 783 cabins and 760 crew members. History As the European Vision, she was chartered for the 27th G8 summit in Genoa, Italy as a secure location to house world leaders. Terrorism fears were high in advance of the September 11, 2001 attacks and Al Qaeda was believed to be considering Genoa as a target. Although the ship was protected by a phalanx of anti-terrorism units including helicopters and missile launchers, U.S. President George W. Bush stayed instead at a dockside hotel. Deployments MSC Armonia has cruised around the Mediterranean Sea and ports within the Eastern Atlantic. Most recently, she was homeported in Havana until December 2018 when she repositioned to Miami to offer cruises between the United States and Cuba, and later, the Caribbean. In November 2020, she will homeport in Tampa, Florida for the first time, sailing to the Caribbean. Accidents MSC Armonia was involved in a docking accident in Roatan Honduras on April 10, 2018, when it made contact with the port with 2,679 guests on board. Damage to the ship was minor, the company says. After repairs, Honduran Port State Control authorities cleared the ship to continue its journey. At about 5:30 a.m. this Wednesday morning, the ship left for Belize and is scheduled for a 1 p.m. arrival. The company says that all passengers and about 721 crew members were not injured. Video of the incident can be view at https://www.usatoday.com/story/travel/2018/04/11/watch-msc-armonia-cruise-ship-crashes-into-dock-roatan/506382002/ References External links msccruises.co.uk Armonia page Category:Cruise ships Category:Ships of MSC Cruises Category:2000 ships

Introduction ============ The epidemic of diabetes is worsening. The Centers for Disease Control estimates that over 23 million Americans suffer from diabetes, with an incidence of over 1.4 million new cases of diabetes every year.[@b1-vhrm-5-225] As the prevalence of diabetes increases, there is greater concern for the vascular complications that accompany diabetes. Insulin remains the most potent medication available to treat diabetes, and arguably to prevent diabetic complications. Some advocate using insulin much sooner in the course of diabetes.[@b2-vhrm-5-225] On the other hand, others believe that insulin may actually be harmful in obese type 2 diabetic subjects because it increases body fat, which may exacerbate insulin resistance.[@b3-vhrm-5-225],[@b4-vhrm-5-225] This review explores the interplay between insulin and the vascular system with special emphasis on the rapid-acting insulin analogs. Because of the heterogeneity of the literature, this paper will refer to vascular events defined very loosely, including peripheral events, cardiovascular events, cerebrovascular events, and death due to vascular causes. Is insulin harmful? =================== The relationship between insulin and vascular events is debatable. One study has associated higher serum insulin levels as an independent predictor of cardiovascular events. The Helsinki Policeman study was a retrospective study of 22-year mortality data of 970 non-diabetic men without coronary artery disease. The authors found an increase in cardiovascular mortality among subjects with higher serum insulin levels.[@b5-vhrm-5-225] A larger study, the Paris Protection Study, followed 7246 non-diabetic men without coronary artery disease for an average of 63 months and concluded that higher fasting plasma insulin levels were an independent risk factor for the development of coronary artery disease.[@b6-vhrm-5-225] Although these studies may suggest that elevated circulating insulin is a direct cause of vascular disease, this does not seem to be true. Subjects with insulin producing neoplasms do not have an increase in clinically overt atherosclerotic disease.[@b7-vhrm-5-225] This suggests that factors other than hyperinsulinemia are responsible for an increased risk of vascular disease. Insulin resistance is often associated with hypertension, lipid abnormalities, and obesity, all of which are thought to contribute much more than hyperinsulinemia to the development of vascular disease.[@b8-vhrm-5-225] In fact, some have proposed that insulin resistance is another symptom associated with the metabolic syndrome and cardiovascular disease, rather than the root cause of cardiovascular disease. Cardiologists performing a population study on 322 healthy adults have described an "insulin gradient."[@b9-vhrm-5-225] These researchers noted a direct correlation between body weight and blood pressure and insulin levels. The heavier their subjects were, the higher the blood pressure and insulin level. Thus, the higher cardiovascular rates seen with higher insulin levels may be caused by an increase in other risk factors such as hypertension, rather than insulin itself. Such a relationship is often ignored in articles that claim an association between insulin resistance and cardiovascular events. For example, in the Veteran Affairs-HDL Intervention Trial (VA-HIT), the authors concluded that "the occurrence of a new cardiovascular event was dependent on ... the presence or absence of insulin resistance."[@b10-vhrm-5-225] However, it is interesting to note that the group with insulin resistance had an average body mass index of over 31 while those without insulin resistance had an average body mass index of only 27.[@b10-vhrm-5-225] Furthermore, there was no reporting of blood pressure values. Although it is possible that higher levels of insulin increased the rate of cardiovascular events in this population, it is equally plausible than other factors such as hypertension were responsible. This then begs the question of whether hypertension is a byproduct of hyperinsulinemia. Although no unequivocal data to answer this question exist, multiple experiments in dogs have shown this not to be the case. There were no pressor effects noted in normal dogs infused with insulin, or in dogs with a 70% reduction in kidney mass on a high salt diet.[@b11-vhrm-5-225] Interestingly, chronic hyperinsulinemia actually caused a reduction in total peripheral vascular resistance as well as arterial pressure.[@b11-vhrm-5-225] This decrease in vascular resistance disappeared when the dogs were made obese via a high-fat diet.[@b11-vhrm-5-225] This series of experiments suggests that in dogs, hyperinsulinemia does not cause hypertension. Whether or not this translates into humans remains to be seen. However, a cross-sectional relational study found obesity to be an independent risk factor for left ventricular hypertrophy, but not insulin resistance or fasting insulin levels.[@b12-vhrm-5-225] These data seem to suggest that obesity and its complications are responsible for cardiovascular risk, not merely high insulin levels. Although there is a theoretical concern of a mitogenic effect of insulin analogs, this concern appears limited to the long-acting insulin glargine.[@b13-vhrm-5-225] Glargine appears to be a more potent stimulus of DNA synthesis in human osteosarcoma cell lines than the native insulin molecule; the rapid-acting analogs appear to be equivalent to regular insulin.[@b14-vhrm-5-225] Some have postulated that mitogenic potency is related to the half-life of the receptor--ligand binding complex, which would explain why the rapid-acting analogs do not appear to have as much theoretical mitogenic effect as the long-acting analog glargine.[@b15-vhrm-5-225] Does intensive diabetes therapy with insulin improve vascular events? ===================================================================== Recently, there have been several large prospective studies examining the relationship between the treatment of hyperglycemia and vascular complications. The first major study to associate a decrease in vascular events with glycemic control was the United Kingdom Prospective Diabetes Study (UKPDS). This prospective observational study included 4585 type 2 diabetic subjects. It concluded that each 1% reduction in mean HbA~1c~ was associated with a risk reduction of 21% for deaths related to diabetes, 14% for myocardial infarction, and 37% of microvascular complications.[@b16-vhrm-5-225] These patients were followed for another 10 years without diabetic treatment manipulation by the researchers. Despite the difference in HbA~1c~ disappearing after one year, the group intensively treated initially with insulin or sulfonylurea still had a 24% risk reduction for microvascular disease, a 15% in risk reduction for myocardial infarction, and a 13% reduction for death from any cause.[@b17-vhrm-5-225] Because patients initially treated with metformin also had risk reductions, the authors of this study concluded that this legacy effect was not the result of insulin, but rather a possible reduction in advanced glycation end products from the initial intensive treatment of hyperglycemia.[@b18-vhrm-5-225] The Diabetes Control and Complications Trial (DCCT) and the subsequent Epidemiology of Diabetes Interventions and Complications (EDIC) illustrated that intensive insulin therapy in type 1 diabetic patients reduced the major diabetic complications of neuropathy, nephropathy, and retinopathy.[@b19-vhrm-5-225] Intensive insulin therapy was associated with less cardiovascular disease as evidenced by decreased intima-media thickness and lower coronary artery calcium accumulation.[@b20-vhrm-5-225] Intensive insulin treatment also decreased the risk of any cardiovascular disease by 42% and the risk of non-fatal stroke, myocardial infarction, or cardiovascular death by 57% in type 1 diabetic subjects.[@b21-vhrm-5-225] Intensive insulin treatment was also shown to be beneficial to those with the worst vascular disease. Diabetic patients who suffered an acute myocardial infarction had an absolute reduction in mortality of 11% when treated with intensive insulin therapy.[@b22-vhrm-5-225] Other studies have been less convincing. The recent Action in Diabetes and Vascular Disease (ADVANCE) trial was aimed to address the effect of intensive glucose control on vascular outcomes in subjects with type 2 diabetes. The researchers randomly assigned 11,140 type 2 diabetic patients to standard glucose control or intensive glucose control using to a HbA~1c~ of 6.5% or less.[@b23-vhrm-5-225] Although the first line drug was a sulfonylurea, 40.5% of subjects in the intensive arm and 24.1% of subjects in the standard arm ended up on insulin.[@b23-vhrm-5-225] After a median of 5 years of follow-up, the researchers found that intensive glucose control led to a reduction in nephropathy (4.1 versus 5.2%), but had no effect on retinopathy, major macrovascular events, or death from cardiovascular causes.[@b23-vhrm-5-225] The Action to Control Cardiovascular Risk in Diabetes (ACCORD) trial also attempted to address the relationship between vascular events and glucose control in patients with type 2 diabetes. One distinguishing feature of this trial is that all subjects had to have either established cardiovascular disease or additional cardiovascular risk factors. Therefore, it was aimed for secondary instead of primary prevention of vascular disease. 10,251 subjects were randomly assigned to intensive therapy (HbA~1c~ \< 6%) or standard therapy (HbA~1c~ 7.0%--7.9%).[@b24-vhrm-5-225] This portion of the study (a blood pressure arm is still ongoing) was discontinued after a mean of 3.5 years of follow up due to an increase in total mortality (257) in the intensive group as opposed to the standard group (203).[@b24-vhrm-5-225] Interestingly, the number of events in the primary outcome (non-fatal myocardial infarction, non-fatal stroke, or death from cardiovascular cause) was actually lower in the intensive group (352) as compared to the standard group (371).[@b24-vhrm-5-225] This calls into debate whether the increase in deaths was due to vascular complications, or if the increase would have panned out had the trial not ceased prematurely. Thus far, there has been no concrete explanation for the increase in mortality seen in the intensive arm. However, some postulate that hypoglycemia may have contributed to the cardiovascular events.[@b25-vhrm-5-225] If so, then theoretically, in comparison to regular insulin, the lower hypoglycemic rate associated with the rapid-acting analogs could provide a cardiovascular benefit.[@b26-vhrm-5-225] A third trial, the Veterans Affairs Diabetes Trial, also examined the effects of intensive blood glucose control on cardiovascular events. The intensive goal in this trial was defined by a goal HbA~1c~ of \< 7.5% and a standard arm goal of HbA~1c~ \< 8.3%, while controlling lipids and blood pressure in both arms.[@b27-vhrm-5-225] This trial was conducted at 20 different VA centers with 1791 patients with a mean follow-up of 6.25 years. In this study, there was no significant reduction in cardiovascular events in the intensive arm.[@b28-vhrm-5-225] Thus, the effect of aggressive control of blood glucose on cardiovascular events remains debatable. UKPDS and DCCT/EDIC have shown that tight control in younger patients in recently diagnosed disease was beneficial, whereas ADVANCE, ACCORD, and VADT have shown that in older patients with long-standing disease the benefits of tight glucose control are not as convincing. Diabetes control may very well have different effects on different cohorts. How might insulin reduce vascular events? ========================================= Insulin's beneficial effects on the vascular system are likely due to actions on the endothelium (see [Table 1](#t1-vhrm-5-225){ref-type="table"}). Insulin has been shown to be a potent vasodilator by causing an increased production of nitric oxide.[@b29-vhrm-5-225] Insulin induces the expression of nitric oxide synthetase, which converts arginine to nitric oxide.[@b30-vhrm-5-225] Separate experiments then illustrated that nitric oxide levels increase in a dose dependent manner in human vein endothelial cells as well as human aortic endothelial cells.[@b31-vhrm-5-225],[@b32-vhrm-5-225] These observations were translated in humans when researchers infused insulin into normal subjects' arteries, and found that blood flow increases in a dose dependent manner with insulin.[@b29-vhrm-5-225] However, in type 2 diabetic as well as non-diabetic obese patients, the vasodilatory effect of insulin is blunted.[@b33-vhrm-5-225],[@b34-vhrm-5-225] Whether this decrease in vasodilation is due to insulin resistance or if insulin resistance is a byproduct of a decrease in skeletal muscle perfusion and insulin-mediated glucose uptake remains to be seen. In addition to effects on vascular tone, diabetes also has an inflammatory component, characterized by endothelial dysfunction and elevated adhesion molecules.[@b35-vhrm-5-225] Insulin helps to counteract this inflammation, by suppressing the expression of adhesion molecules, allowing monocytes to couple with endothelial cells, releasing monocyte chemoattractant protein-1 (MCP-1). This in turn attracts more monocytes which then intermingle with low-density lipoprotein cholesterol, forming foam cells.[@b29-vhrm-5-225] Insulin also reverses the increase in the adhesion molecule e-selectin seen in type 2 diabetic subjects.[@b36-vhrm-5-225] Along with suppressing MCP-1 and e-selectin, insulin also suppresses nuclear factor kappa B (NF-kB).[@b37-vhrm-5-225] NF-kB is a central figure in inflammation, responsible for the production of cytokines, enzymes, and adhesion molecules.[@b38-vhrm-5-225] When human aortic endothelial cells were incubated with insulin, intranuclear NF-kB binding activity and MCP-1 mRNA expression were both suppressed.[@b37-vhrm-5-225] This decrease in MCP-1 was replicated in vivo in obese subjects, in whom the translocation of NF-kB was inhibited by insulin infusion.[@b39-vhrm-5-225] Insulin also decreases NADPH oxidase, plasma tissue factor, and matrix metalloproteinase.[@b29-vhrm-5-225] Insulin has been shown to decrease the inflammatory marker C-reactive protein in critically ill patients.[@b40-vhrm-5-225] In patients suffering from an acute myocardial infarction, insulin has anti-inflammatory and pro-fibrinolytic effects as evidenced by a blunting of the increase in high-sensitivity C-reactive protein, serum amyloid A, and plasminogen activator inhibitor-1.[@b41-vhrm-5-225] Are the effects of insulin a class effect? ========================================== It is unclear if the effects of insulin are unique to a certain formulation or are class effects that extend to the rapid-acting insulin analogs. [Table 1](#t1-vhrm-5-225){ref-type="table"} summarizes the experimental evidence of the various formulations of short-acting insulin. One type of rapid-acting insulin is lispro (Humalog^®^, Eli Lilly and Company). Lispro is a human insulin analog manufactured from *Escherichia coli* with the amino acids at positions 28 and 29 reversed.[@b42-vhrm-5-225] This reversal of lysine and proline allows the insulin to be absorbed much faster than regular insulin from subcutaneous tissue. Lispro has a peak action of 30 to 90 minutes.[@b42-vhrm-5-225] Because of its fast onset, lispro is often used as a bolus insulin to address postprandial glucose excursions. Like the other rapid-acting analogs, it can be used alone in an insulin pump, or in combination with a longer acting insulin formulation. It is marketed by itself as well as pre-mixed with lispro protamine, a crystallized form of lispro made by combining lispro with protamine sulfate, lengthening its duration of action.[@b43-vhrm-5-225] Clinical guidelines and algorithms for the use of rapid-acting analogs in diabetic patients are beyond the scope of this article. There are some data to show that lispro is beneficial to the vascular system. Specifically, lispro improves microvascular blood flow in postprandial type 1 diabetic patients.[@b44-vhrm-5-225] In this study, 20 non-diabetic patients and 20 diabetic patients had their skin microvascular blood flow measured by laser Doppler flux every 30 minutes after a standardized test meal. The researchers found that microvascular blood flow was impaired in type 1 diabetic patients given regular insulin, but when given insulin lispro, the microvascular blood flow improved to mimic the non-diabetic subject. This is thought to be due to the treatment of acute hyperglycemia, which stimulates the production of free radicals and augments thrombin formation.[@b44-vhrm-5-225] Hyperglycemia is also thought to create an increase in adhesion molecules and endothelin, while decreasing levels of nitric oxide.[@b45-vhrm-5-225] Because lispro has a faster onset of action than regular insulin, it reduces these postprandial excursions better, and is more likely to counteract the increase in adhesion molecules and decrease in nitric oxide.[@b46-vhrm-5-225] Similar to lispro, glulisine (Apidra^®^, Sanofi-Aventis) has also been shown to have beneficial effects on surrogate vascular markers. Glulisine is a rapid-acting insulin homologous with regular human insulin save for the amino acid asparagine at position B3 replaced with lysine and the lysine at position B29 substituted with glutamic acid.[@b47-vhrm-5-225] This analog is produced by recombinant DNA using *Escherichia coli*, and it is employed to lower blood glucose in a similar fashion as lispro. In a microvascular blood flow study similar to the one described above using lispro and regular insulin, glulisine was compared to regular insulin in 15 type 2 diabetic subjects after a liquid meal challenge. Serial laser Doppler fluxometry was then performed. Like the results in the lispro study, glulisine-reated subjects had higher postrandial insulin levels, lower glucose excursions, and higher microvascular blood flow.[@b48-vhrm-5-225] Again, without any head to head comparison studies, it is impossible to say that the short-acting insulin analogs are equal. Yet, the fact that both glulisine and lispro had similar effects in a similarly designed study suggests a class effect benefit from treating postprandial glucose excursions. Although a similar study using laser fluxometry has not been published using aspart (NovoLog^®^, Novo Nordisk Inc.), there have been other studies examining the effect of aspart on vascular risk factors. Aspart is similar in composition to regular human insulin, save for the substitution of the amino acid proline with aspartic acid in position B28.[@b49-vhrm-5-225] It is produced using recombinant DNA technology using *Saccharomyces cerevisiae* (baker's yeast) and is used to treat hyperglycemia in a similar fashion as lispro and glulisine. Despite the similar function and onset of action, the data on aspart's effects on the vascular system are not as clear as with the other rapid-acting analogs. Twenty-one patients with insulin-treated type 2 diabetes were given neutral protamine Hagedorn (NPH) insulin and pre-prandial regular insulin or aspart for 6 weeks.[@b50-vhrm-5-225] At the end of the study, although there was no statistical difference in hemoglobin A~1c~ (HbA~1c~), the aspart group had a significantly lower postprandial (90 minutes after a meal) average glucose (7.9 mmol/L versus 9.3 mmol/L).[@b50-vhrm-5-225] Despite this decrease in glucose excursions, there were no statistical differences in markers of vascular risk (fasting lipid profile, apolipoproteins, fibrinogen, plasminogen activator inhibitor-1, E-selectin, or homocysteine). However this study has several limitations to preclude the conclusion that treating postprandial glucose excursions has no effect on vascular risk. This study's conclusion may reflect a lack of power, brief study duration, or even a difference between the effects of distinct insulin analogs on vascular risk. Does treatment of postprandial glucose help? ============================================ The rapid-acting insulins' superiority lies in their ability to treat postprandial glucose and excursions. Is such an ability clinically relevant? Fortunately, several studies highlight how postprandial excursions and high glucose variability affect the vascular system. One such study involved type 1 diabetic patients who underwent myocardial perfusion studies while either on a euglycemic or hyperglycemic hyperinsulinemic clamp. The myocardial perfusion reserve was significantly decreased when subjects were hyperglycemic.[@b51-vhrm-5-225] Just as chronic diabetes is associated with inflammation, acute hyperglycemia has also been shown to cause an increase in proinflammatory cytokines such as tumor necrosis factor-alpha, interleukin (IL)-6, IL-1 beta, and IL-8, which leads to vascular inflammation.[@b52-vhrm-5-225] This increase in cytokines was counteracted by insulin infusion and a return to normoglycemia.[@b52-vhrm-5-225] By mitigating hyperglycemia with a faster onset of action than regular insulin, some have argued that rapid-acting insulin may have favorable cardiovascular effects.[@b53-vhrm-5-225],[@b54-vhrm-5-225] One argument is that using premixed lispro combinations lower postprandial glucose better than regular insulin combinations, and therefore may reduce CVD risk.[@b54-vhrm-5-225] When lispro was added to bedtime NPH insulin and compared to twice-daily NPH in type 2 diabetic subjects, the lispro-treated group experienced lower postprandial glucose, lower HbA~1c~, lower triglycerides, low-density lipoprotein cholesterol (LDL), and higher high-density lipoprotein cholesterol (HDL).[@b53-vhrm-5-225] The authors surmised that this favorable milieu might have a positive cardiovascular effect. In addition, a recent study was performed comparing the long-acting insulin detemir (Levemir^®^, Novo Nordisk Inc.) to the rapid-acting aspart. It found that patients using a prandial bolus of insulin aspart had a lower HbA~1c~ than those treated with basal detemir.[@b55-vhrm-5-225] These two studies would suggest that the postprandial excursions can drive overall blood glucose control, and that by treating this variability, vascular events could be mitigated. Reducing glycemic variability could also lessen glycemic events due to fewer episodes of hypoglycemia. A recent study of 100 type 1 diabetic patients followed for 11 years found a strong correlation between glycemic variability and hypoglycemic unawares.[@b56-vhrm-5-225] It is possible that using insulin analogs could reduce glycemic variability and hypoglycemic episodes, whereby overall glucose control and vascular events are improved. However, this theory can only be answered with a prospective long-term study with an extremely large sample size using rapid-acting insulin. On the other hand, specifically targeting postprandial glucose may not have a clinically significant vascular effect. The hyperglycemia and its effect after acute myocardial infarction on cardiovascular outcomes in patients with type 2 diabetes mellitus (HEART2D) attempted to randomize 1355 subjects with type 2 diabetes and acute myocardial infarction to either pre-meal insulin lispro with basal NPH insulin, (with a target 2-hour postprandial blood glucose of \< 135 mg/dL) or basal insulin only (NPH insulin twice daily, insulin glargine once daily, or pre-mixed human insulin \[70% NPH/30% regular\] twice daily) targeting fasting.[@b57-vhrm-5-225] Although both groups ended up with similar HbA~1c~ values (7.6%), and the lispro-treated group had statistically fewer postprandial excursions, there was no significant difference in cardiovascular events between the two groups and the study was stopped for "futility."[@b58-vhrm-5-225] These data would suggest that glycemic variability does not increase cardiovascular events, although the sample size of the study was relatively small and it experienced a high drop out rate. Conclusion ========== In summary, the UKPDS has shown that treating diabetes to a goal HbA~1c~ \< 7% will decrease some vascular events. Intensively treating diabetes to \< 6% is debatable and difficult given present treatment modalities. Individualized goals should be designed between physician and patient. In meeting these goals, insulin has been shown to be beneficial by not only by treating hyperglycemia, but also by providing vasodilatory and anti-inflammatory effects. Although not proven, these effects likely extend to the rapid-acting analogs. With its faster onset of action and lower postprandial glucose excursions, rapid-acting insulin appears superior to regular insulin, and could possibly reduce vascular events further. **Disclosures** The authors declare no conflicts of interest. ###### Comparison of rapid-acting insulin analogs with regular insulin **Regular insulin** -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------   Time of onset 30--60 minutes   Peak action 50--120 minutes   Duration of action 5--8 hours   Effects on vascular system     Improved outcomes in diabetic subjects with decreased        Intima-media thickness       Cardiovascular risk       Risk of non-fatal stroke       Risk of myocardial infarction       Risk of cardiovascular death       Mortality post-acute myocardial infarction     Vasodilation     Increases        Nitric oxide     Suppresses        Adhesion molecules       E-selectin       MCP-1       Nf-kB       NADPH oxidase       Plasma tissue factor       Matrix metalloproteinase       C-reactive protein       Serum amyloid A       Plasminogen activator inhibitor-1 **Lispro (Humalog^®^)**   Time of onset 5--15 minutes   Peak action 30--90 minutes   Duration of action 3--5 hours   Difference from regular insulin     Produced from *Escherichia coli*     Lysine and proline at positions 28 and 29 transposed     Lower postprandial glucose   Effects on vascular system     Improved postprandial blood flow **Glulisine (Apidra^®^)**   Time of onset 5--15 minutes   Peak action 34--91 minutes   Duration of action 55--149 minutes   Difference from regular insulin     Produced from *Escherichia coli*     Asparaginase at B3 replaced with lysine and lysine at B29 replaced with glutamic acid     Lower postprandial glucose   Effects on vascular system     Improved blood flow postprandially **Aspart (Novolog^®^)**   Time of onset 5--15 minutes   Peak action 40--50 minutes   Duration of action 3--5 hours   Difference from regular insulin     Produced from *Saccharomyces cervisiae*     Proline replaced with aspartic acid at B28     Lower postprandial glucose   Effects on vascular system     No changes in fasting lipid profile, apolipoproteins, fibrinogen, plasminogen activator inhibitor-1, E-selectin, or homocysteine when compared to regular insulin. **Note:** Time values assume subcutaneous bolus injection.

Q: Displaying better error message than "No JSON object could be decoded" Python code to load data from some long complicated JSON file: with open(filename, "r") as f: data = json.loads(f.read()) (note: the best code version should be: with open(filename, "r") as f: data = json.load(f) but both exhibit similar behavior) For many types of JSON error (missing delimiters, incorrect backslashes in strings, etc), this prints a nice helpful message containing the line and column number where the JSON error was found. However, for other types of JSON error (including the classic "using comma on the last item in a list", but also other things like capitalising true/false), Python's output is just: Traceback (most recent call last): File "myfile.py", line 8, in myfunction config = json.loads(f.read()) File "c:\python27\lib\json\__init__.py", line 326, in loads return _default_decoder.decode(s) File "c:\python27\lib\json\decoder.py", line 360, in decode obj, end = self.raw_decode(s, idx=_w(s, 0).end()) File "c:\python27\lib\json\decoder.py", line 378, in raw_decode raise ValueError("No JSON object could be decoded") ValueError: No JSON object could be decoded For that type of ValueError, how do you get Python to tell you where is the error in the JSON file? A: I've found that the simplejson module gives more descriptive errors in many cases where the built-in json module is vague. For instance, for the case of having a comma after the last item in a list: json.loads('[1,2,]') .... ValueError: No JSON object could be decoded which is not very descriptive. The same operation with simplejson: simplejson.loads('[1,2,]') ... simplejson.decoder.JSONDecodeError: Expecting object: line 1 column 5 (char 5) Much better! Likewise for other common errors like capitalizing True. A: You wont be able to get python to tell you where the JSON is incorrect. You will need to use a linter online somewhere like this This will show you error in the JSON you are trying to decode. A: You could try the rson library found here: http://code.google.com/p/rson/ . I it also up on PYPI: https://pypi.python.org/pypi/rson/0.9 so you can use easy_install or pip to get it. for the example given by tom: >>> rson.loads('[1,2,]') ... rson.base.tokenizer.RSONDecodeError: Unexpected trailing comma: line 1, column 6, text ']' RSON is a designed to be a superset of JSON, so it can parse JSON files. It also has an alternate syntax which is much nicer for humans to look at and edit. I use it quite a bit for input files. As for the capitalizing of boolean values: it appears that rson reads incorrectly capitalized booleans as strings. >>> rson.loads('[true,False]') [True, u'False']

Q: Make Windows require password after hibernate I set password for User-Accounts and for the Windows (Using syskey), but when I turn on my system after a hibernate, it don't require neither system password nor accounts password. and directly navigate me to desktop! Why?! Note: I have this problem only after hibernate! (After a shutdown or restart everything is ok). A: Strictly speaking, the purpose of a SYSKEY password is not to lock down boot, but only to protect the system account database (the SAM). So the only time you'll be asked for it is when Windows needs to open the account database for the first time. Now, the whole point of hibernation is that it does not terminate the running OS; it merely pauses it, and later resumes the kernel and all processes completely intact. So Windows doesn't need the SYSKEY password because it already has the SAM open ever since the last time you rebooted. As for the account passwords – this needs to be enabled in the power management settings: Open Power Options by clicking the Start button Picture of the Start button, clicking Control Panel, clicking System and Security, and then clicking Power Options. On the Select a power plan page, in the task pane, click Require a password on wakeup. If necessary, click Change settings that are currently unavailable. On the Define power buttons and turn on password protection page, click Don't require a password. Click Save changes.

1. Field of the Invention The present invention relates to a device equipped with series connected thyristors and adapted for use as a reactive power compensator or the like. FIG. 1 shows a conventional reactive power compensator as an example of this type, wherein there are included an AC power source 1 for supplying a voltage V, a power source impedance 2, an inductive load 3, a reactive power compensator 4, a phase advance capacitor 5, a current controller 6 consisting of a diode 7 and a thyristor 8 which are so connected as to constitute an antiparallel circuit, a voltage transformer 9, a current transformer 10, a reactive power detector 11, and a gate signal generator 12. The reactive power detector 11 serves to detect a reactive power Q out of a circuit voltage V.sub.R obtained from the voltage transformer 9 and a circuit current I.sub.R obtained from the current transformer 10 and, upon increase of the detected reactive power Q to a preset value, feeds a capacitor output command signal q to the gate signal generator 12. As shown in FIG. 3, the gate signal generator 12 comprises a timing pulse generator 121, an inverter 122, AND elements 123a and 123b, and a signal generator 124. The timing pulse generator 121 receives the output V.sub.R of the voltage transformer 9 shown in FIG. 1 and, as illustrated in FIG. 5, produces a gate-on command pulse P.sub.ON synchronously with the negative maximum value of the output V.sub.R and also a gate-off command pulse P.sub.OFF after delay of a predetermined time To therefrom. And both the pulse P.sub.ON and the capacitor output command signal q are fed to the AND circuit 123a, while the pulse P.sub.OFF and the inverted capacitor output command signal q obtained from the inverter 122 are fed to the AND circuit 123b. The gate signal generator 124 consists of a self-excited oscillator which, in response to an input signal received at its terminal A from the AND circuit 123a, feeds a wide-duration gate signal GP to the gate of the thyristor 8 and maintains such an action continuously until arrival of a signal at its terminal B from the AND circuit 123b. FIG. 2 shows a current controller 6 employed when the main circuit of the device is of high-voltage type. This controller consists of a plurality of series connected diodes 7a, 7b and 7c and a plurality of series connected thyristors 8a, 8b and 8c. Also shown are pulse transformer 13 and demodulators 14a, 14b and 14c. Hereinafter the operation of this device will be described with reference to the waveform charts of FIGS. 4 and 5. Since the thyristor 8 remains in its off-state until arrival of the capacitor output command signal q, the phase advance capacitor 5 is charged at a potential equivalent to the negative maximum value V.sub.max of the voltage V, so that a voltage V.sub.A-K having a waveform of FIG. 4 (c) including both the supply voltage V and the output voltage V.sub.C of the capacitor 5 superposed thereon is applied between the anode and the cathode of the thyristor 8. Supposing now that the capacitor output command signal q is produced at time t.sub.0, the gate-on command signal P.sub.ON is not outputted despite application of the signal q to the gate signal generator 12 until time t.sub.1 at which the supply voltage V reaches its negative maximum value, so that the gate signal GP is not generated either until arrival of time t.sub.1. This circuit configuration is designed in such a manner as to prevent flow of a rush current from the phase advance capacitor 5 by placing the thyristor 8 in a conducting state when the voltage V.sub.A-K applied thereto is in the vicinity of its zero level. Upon generation of the gate signal GP, the thyristor 8 is turned on to permit flow of a capacitor current Ic of FIG. 4 via the phase advance capacitor 5, thereby compensating for the reactive power in the main circuit to improve the power factor thereof. When the power factor is thus improved to reduce the reactive power below a predetermined value, the capacitor output command signal q comes to be extinct. But even after extinction of the signal q at time t.sub.2 as shown, the capacitor current Ic still keeps flowing via the diode 7 until time t.sub.4 at which the supply voltage V reaches its negative maximum value. For this reason, the gate-off command pulse P.sub.OFF is preset to have a duration shorter than one cycle of the supply voltage V by the turn-off time T.sub.OFF of the thyristor 8. The above conventional device performs its operation as mentioned when the load 3 is an inductive one. However, in case the load 3 is a thyristor unit or the like, the waveform of the supply voltage V is distorted as shown in FIG. 6 due to higher harmonics included in the circuit current I, so that a distorted current comes to flow in the phase advance capacitor 5. An example of such distorted current is shown in FIG. 6 (d). If the time point, at which the current Icd flowing in the diode 7 (hereinafter referred to as diode current) becomes zero like the capacitor current Ic, deviates toward time t.sub.3 of extinction of the gate signal GP in the case where the current controller 6 is equipped with series connected thyristors 8a, 8b and 8c as shown in FIG. 2, there may occur an undesired phenomenon that, for example, the thyristors 8a and 8b are turned off while the thyristor 8c fails to be turned off because of some variation in the turn-off characteristics of the individual thyristors. And with subsequent increase of the supply voltage V posterior to time t.sub.4, the entire voltage comes to be applied to the thyristor 8c alone to eventually cause its withstand voltage breakdown. (Hereinafter this will be referred to as first case of withstand voltage breakdown.) Furthermore, when the waveform of the capacitor current Ic is distorted as shown in FIG. 7 (d), i.e. in case the current flowing in the circuit of thyristors 8a, 8b and 8c at the time of extinction of the gate signal GP is commutated to the circuit of diodes 7a, 7b and 7c at time t.sub.42 and then is blocked by the thyristors 8a, 8b and 8c at time t.sub.43 : the period from time t.sub.42 to time t.sub.43 is excessively short to fail in securing a sufficient turn-off time as a result, and due to the variation in the characteristics of the individual thyristors, there occurs a phenomenon that, e.g. the thyristor 8c alone is left in its on-state and is finally led to withstand voltage breakdown. (Hereinafter this will be referred to as second case of withstand voltage breakdown.)

Description: O-Acetylserine Sulfhydrylase (OASS) is a pyridoxal phosphate enzyme that catalyzes the reaction of O-acetyl-Lserine with sulfide to give L-cysteine. OASS is present as two isoforms, designated -A and -B. The kinetic mechanism of OASS-A is well known and there is also much known concerning the acid-base chemistry of the enzyme. However, little is known concerning the location of the rate determining steps, the sequencing of chemical steps that occur at the active site, or the nature of the rate determining transition states. The studies performed to help elucidate these aspects of the OASS-A mechanism included determination of the thermodynamics of both half reactions, along with studies utilizing substrate analogs of OAS halting the reaction at specific points along the reaction pathway allowing the identification of reaction intermediates. The free energy change of the first half reaction was shown to be -5.7 Kcal/mole while the second half reaction was shown to be, for all intents and purposes, irreversible. Intermediates along the reaction pathway that have been previously identified include the internal Schiff base and the a-aminoacrylate. The external Schiff base was identified using the analogs cysteine, alanine, and glycine while the geminal diamine was identified using the analog serine. Formation of ... Description: N-Acylethanolamines (NAEs) are endogenous lipid metabolites that occur in a variety of dry seeds, and their levels decline rapidly during the first few hours of imbibition (Chapman et al., 1999, Plant Physiol., 120:1157-1164). Biochemical studies supported the existence of an NAE amidohydrolase activity in seeds and seedlings, and efforts were directed toward identification of DNA sequences encoding this enzyme. Mammalian tissues metabolize NAEs via an amidase enzyme designated fatty acid amide hydrolase (FAAH). Based on the characteristic amidase signature sequence in mammalian FAAH, a candidate Arabidopsis cDNA was identified and isolated by reverse transcriptase-PCR. The Arabidopsis cDNA was expressed in E. coli and the recombinant protein indeed hydrolyzed a range of NAEs to free fatty acids and ethanolamine. Kinetic parameters for the recombinant protein were consistent with those properties of the rat FAAH, supporting identification of this Arabidopsis cDNA as a FAAH homologue. Two T-DNA insertional mutant lines with disruptions in the Arabidopsis NAE amidohydrolase gene (At5g64440) were identified. The homozygous mutant seedlings were more sensitive than the wild type to exogenously applied NAE 12:0. Transgenic seedlings overexpressing the NAE amidohydrolase enzyme showed noticeably greater tolerance to NAE 12:0 than wild type seedlings. These results together provide evidence in vitro ... Description: Dissociation constants for alternate dirmcleotide substrates and competitive inhibitors suggest that the dinucleotide binding site of the Ascaris suum NAD-malic enzyme is hydrophobic in the vicinity of the nicotinamide ring. Changes in the divalent metal ion activator from Mg^2+ to Mn^2+ or Cd^2+ results in a decrease in the dinucleotide affinity and an increase in the affinity for malate. Primary deuterium and 13-C isotope effects obtained with the different metal ions suggest either a change in the transition state structure for the hydride transfer or decarboxylation steps or both. Deuterium isotope effects are finite whether reactants are maintained at saturating or limiting concentrations with all the metal ions and dinucleotide substrates used. With Cd^2+ as the divalent metal ion, inactivation of the enzyme occurs whether enzyme alone is present or is turning over. Upon inactivation only Cd^2+ ions are bound to the enzyme which becomes denatured. Modification of the enzyme to give an SCN-enzyme decreases the ability of Cd^2+ to cause inactivation. The modified enzyme generally exhibits increases in K_NAD and K_i_metai and decreases in V_max as the metal size increases from Mg^2+ to Mn^2+ or Cd^2+, indicative of crowding in the site. In all cases, affinity for malate greatly ... Description: An 18.5-kb human DNA segment was selected from a human XCharon-4A library by hybridization to mammalian valine tRNAiAc and found to encompass a cluster of three tRNA genes. Two valine tRNA genes with anticodons of AAC and CAC, encoding the major and minor cytoplasmic valine tRNA isoacceptors, respectively, and a lysine tRNAcuu gene were identified by Southern blot hybridization and DNA sequence analysis of a 7.1-kb region of the human DNA insert. At least nine Alu family members were found interspersed throughout the human DNA fragment. The tRNA genes are accurately transcribed by RNA polymerase III in a HeLa cell extract, since the RNase Ti fingerprints of the mature-sized tRNA transcription products are consistent with the DNA sequences of the structural genes. Three members of the chimpanzee triosephosphate isomerase (TPI) gene family, the functional transcription unit and two processed pseudogenes, were characterized by genomic blotting and DNA sequence analysis. The bona fide TPI gene spans 3.5 kb with seven exons and six introns, and is the first complete hominoid TPI gene sequenced. The gene exhibits a very high identity with the human and rhesus TPI genes. In particular, the polypeptides of 248 amino acids encoded by the chimpanzee and human ... Description: Two phage lambda clones encompassing human tRNA genes have been isolated from a human gene library harbored in bacteriophage lambda Charon-UA. One of the clones (designated as hLeuU) containing a 20-kb human DNA fragment was isolated and found to contain a cluster of four tRNA genes. An 8.2-kb Hindlll fragment encompassing the four tRNA genes was isolated from the 20-kb fragment and subcloned into pBR322 for restriction mapping and DNA sequence analysis. The four tRNA genes are arranged as two tandem pairs with the first pair containing a proline tRNAAGQ gene and a leucine tRNAAAQ gene and the second pair containing another proline tRNAAGG gene and a threonine tRNAuQU gene. The two pairs are separated about 3 kb from each other, and the leucine tRNAAAG gene is of opposite polarity from the other three tRNA genes. The tRNA transcription units were sequenced by a unidirectional deletion dideoxyribonucleotide chain-termination method in the M13mpl8 and 19 vectors. The coding regions of the four tRNA genes contain characteristic internal split promoter sequences and do not encode intervening sequences nor the CCA trinucleotide found in mature tRNAs. The proline t R N A A G G gene is separated from the leucine t R ... Description: Two highly homologous synthetic peptides MLC(3-13) (K-R-A-K-A-K-T-TK-K-R-G) and MLC(5-13) (A-K-A-K-T-T-K-K-R-G) corresponding to the amino terminal amino acid sequence of smooth muscle myosin light chain were utilized as substrates for protein kinase C purified from murine lymphosarcoma tumors to determine the role of the primary amino acid sequence of protein kinase C substrates in defining the lipid (phosphatidyl serine and diacylglycerol) requirements for the activation of the enzyme. Removal of the basic residues lysine and arginine from the amino terminus of MLC(3-13) did not have a significant effect on the Ka value of diacylglycerol. The binding of effector to calcium-protein kinase C appears to be random since binding of one effector did not block the binding of the other. Description: A number of protein kinases have been shown to undergo autophosphorylation, but few have demonstrated a coordinate increase or decrease in enzymatic activity as a result. Described here is a novel S6 kinase isolated from human placenta which autoactivates through autophosphorylation in vitro. This S6/H4 kinase, purified in an inactive state, was shown to be a protein of Mr of 60,000 as estimated by SDS-PAGE and could catalyze the phosphorylation of the synthetic peptide S6-21, the histone H4, and myelin basic protein. Mild digestion of the inactive S6/H4 kinase with trypsin was necessary, but not sufficient, to activate the kinase fully Description: Three genomic clones encompassing human DNA segments (designated LhX-3, LhX-4, and LhX5) were isolated from an X chromosome-specific library and subjected to analysis by physical mapping and DNA sequencing. It was found that these three clones are very rich in repetitive DNA sequence elements and retropseudogenes. Description: Resonance energy transfer was employed to study the conformational changes of actomyosin during ATP hydrolysis. To calibrate the technique, the parameters for resonance energy transfer were defined. With conformational searching algorithms to predict probe orientation, the distances measured by resonance energy transfer are highly consistent with the atomic models, which verified the accuracy and feasibility of resonance energy transfer for structural studies of proteins and oligonucleotides. To study intramyosin distances, resonance energy transfer probes were attached to skeletal myosin's nucleotide site, subfragment-2, and regulatory light chain to examine nucleotide analog-induced structural transitions. The distances between the three positions were measured in the presence of different nucleotide analogs. No distance change was considered to be statistically significant. The measured distance between the regulatory light chain and nucleotide site was consistent with either the atomic model of skeletal myosin subfragment-1 or an average of the three models claimed for different ATP hydrolysis states, which suggested that the neck region was flexible in solution. To examine the participation of actin in the powerstroke process, resonance energy transfer between different sites on actin and myosin was measured in the presence of nucleotide analogs. The efficiencies of energy transfer between myosin catalytic domain and actin ... Description: To define the overall kinetic and chemical mechanism of adenosine 3',5'-monophosphate dependent protein kinase catalytic subunit, the mechanism in the direction of MgADP phosphorylation was determined, using studies of initial velocity in the absence and presence of dead-end inhibitors. The kinetic mechanism was determined as a function of uncomplexed Mg^2+ (Mg_f) at pH 7.2 and as a function of pH at low (0.5 mM) Mg_f. At pH 7.2 data are consistent with a random kinetic mechanism in the direction of MgADP phosphorylation with both pathways allowed: the pathway in which MgADP binds to enzyme prior to phosphorylated peptide (PSP) and that in which PSP binds before MgADP. One or the other pathway predominates, depending on Mg_f concentration. At 0.5 mM Mg_f, the mechanism is steady-state ordered with the pathway where PSP binds first preferred; at 10 mM Mg_f, the mechanism is equilibrium ordered, and the pathway in which MgADP binds first preferred. This change in mechanism to equilibrium ordered is due to an increase in affinity of enzyme for MgADP and a decrease in affinity for PSP. There is also a pH-dependent change in mechanism at 0.5 mM Mg_f. At pH 6 the mechanism is equilibrium ordered with the pathway ... Description: The studies described in this dissertation examine the effects of F-2,6-P2 and AMP or phosphorylation on the kinetic mechanism of d-PFK. The effect of varied pH on the activation by F-2,6-P2 is also described. Description: Improvements in mass spectrometry (MS)-based strategies for characterizing the plant lipidome through quantitative and qualitative approaches such as shotgun lipidomics have substantially enhanced our understanding of the structural diversity and functional complexity of plant lipids. However, most of these approaches require chemical extractions that result in the loss of the original spatial context and cellular compartmentation for these compounds. To address this current limitation, several technologies were developed to visualize lipids in situ with detailed chemical information. A subcellular visualization approach, direct organelle MS, was developed for directly sampling and analyzing the triacylglycerol contents within purified lipid droplets (LDs) at the level of a single LD. Sampling of single LDs demonstrated seed lipid droplet-to-droplet variability in triacylglycerol (TAG) composition suggesting that there may be substantial variation in the intracellular packaging process for neutral lipids in plant tissues. A cellular and tissue visualization approach, MS imaging, was implemented and enhanced for visualizing the lipid distributions in oilseeds. In mature cotton seed embryos distributions of storage lipids (TAGs) and their phosphatidylcholine (PCs) precursors were distribution heterogeneous between the cotyledons and embryonic axis raising new questions about extent and regulation of oilseed heterogeneity. Extension of this methodology provides an avenue for understanding metabolism ... Description: In order to understand the structural changes in myosin S1, fluorescence polarization and computational dynamics simulations were used. Dynamics simulations on the S1 motor domain indicated that significant flexibility was present throughout the molecular model. The constrained opening versus closing of the 50 kDa cleft appeared to induce opposite directions of movement in the lever arm. A sequence called the "strut" which traverses the 50 kDa cleft and may play an important role in positioning the actomyosin binding interface during actin binding is thought to be intimately linked to distant structural changes in the myosin's nucleotide cleft and neck regions. To study the dynamics of the strut region, a method of fluorescent labeling of the strut was discovered using the dye CY3. CY3 served as a hydrophobic tag for purification by hydrophobic interaction chromatography which enabled the separation of labeled and unlabeled species of S1 including a fraction labeled specifically at the strut sequence. The high specificity of labeling was verified by proteolytic digestions, gel electrophoresis, and mass spectroscopy. Analysis of the labeled S1 by collisional quenching, fluorescence polarization, and actin-activated ATPase activity were consistent with predictions from structural models of the probe's location. Although the fluorescent intensity of the ... Description: The kinetic mechanism of activation of the NAD-malic enzyme by fumarate and the transition state structure for the oxidation malate for the NAD-malic enzyme reaction have been studied. Fumarate exerts its activating effect by decreasing the off-rate for malate from the E:Mg:malate and E:Mg:NAD:malate complexes. The activation by fumarate results in a decrease in K_imalate and an increase in V/K_malate by about 2-fold, while the maximum velocity remains constant. A discrimination exists between active and activator sites for the binding of dicarboxylic acids. Activation by fumarate is proposed to have physiologic importance in the parasite. The hydride transfer transition state for the NAD-malic enzyme reaction is concerted with respect to solvent isotope sensitive and hydride transfer steps. Two protons are involved in the solvent isotope sensitive step, one with a normal fractionation factor, another with an inverse fractionation factor. A structure for the transition state for hydride transfer in the NAD-malic enzyme reaction is proposed. Description: To elaborate on the function(s) of the ENOD8 gene in the nodules of M. truncatula, several different experimental approaches were used. A census of the ENOD8 genes was first completed indicating that only ENOD8.1 (nt10554-12564 of GenBank AF463407) is highly expressed in nodule tissues. A maltose binding protein-ENOD8 fusion protein was made with an E. coli recombinant system. A variety of biochemical assays were undertaken with the MBP-ENOD8 recombinant protein expressed in E. coli, which did not yield the esterase activity observed for ENOD8 protein nodule fractions purified from M. sativa, tested on general esterase substrates, α-naphthyl acetate, and p-nitrophenylacetate. Attempts were also made to express ENOD8 in a Pichia pastoris system; no ENOD8 protein could be detected from Pichia pastoris strains which were transformed with the ENOD8 expression cassette. Additionally, it was shown that the ENOD8 protein can be recombinantly synthesized by Nicotiana benthamiana in a soluble form, which could be tested for activity toward esterase substrates, bearing resemblance to nodule compounds, such as the Nod factor. Transcription localization studies using an ENOD8 promoter gusA fusion indicated that ENOD8 is expressed in the bacteroid-invaded zone of the nodule. The ENOD8 protein was also detected in that same zone by ... Description: Symbiotic nitrogen fixation occurs in plants harboring nitrogen-fixing bacteria within the plant tissue. The most widely studied association is between the legumes and rhizobia. In this relationship the plant (legumes) provides the bacteria (rhizobia) with reduced carbon derived from photosynthesis in exchange for reduced atmospheric nitrogen. This allows the plant to survive in soil, which is low in available of nitrogen. Rhizobia infect and enter plant root and reside in organs known as nodules. In the nodules the bacteria fix atmospheric nitrogen. The association between the legume, Medicago truncatula and the bacteria Sinorhizobium meliloti, has been studied in detail. Medicago mutants that have defects in nodulation help us understand the process of nitrogen fixation better. One such mutant is the Mtnip-1. Mtnip-1 plants respond to S. meliloti by producing abnormal nodules in which numerous aberrant infection threads are produced, with very rare rhizobial release into host plant cells. The mutant plant Mtnip-1 has an abnormal defense-like response in root nodules as well as defects in lateral root development. Three alleles of the Mtnip/latd mutants, Mtnip-1, Mtlatd and Mtnip-3 show different degrees of severity in their phenotype. Phylogenetic analysis showed that MtNIP/LATD encodes a protein belonging to the NRT1(PTR) family of ... Description: Fatty acid amide hydrolase (FAAH) terminates the endocannabinoid signaling pathway that regulates numerous neurobehavioral processes in animals by hydrolyzing a class of lipid mediators, N-acylethanolamines (NAEs). Recent identification of an Arabidopsis FAAH homologue (AtFAAH) and several studies, especially those using AtFAAH overexpressing and knock-out lines suggest that a FAAH-mediated pathway exists in plants for the metabolism of endogenous NAEs. Here, I provide evidence to support this concept by identifying candidate FAAH cDNA sequences in diverse plant species. NAE amidohydrolase assays confirmed that several of the proteins encoded by these cDNAs indeed catalyzed the hydrolysis of NAEs in vitro. Kinetic parameters, inhibition properties, and substrate specificities of the plant FAAH enzymes were very similar to those of mammalian FAAH. Five amino acid residues determined to be important for catalysis by rat FAAH were absolutely conserved within the plant FAAH sequences. Site-directed mutation of each of the five putative catalytic residues in AtFAAH abolished its hydrolytic activity when expressed in Escherichia coli. Contrary to overexpression of native AtFAAH in Arabidopsis that results in enhanced seedling growth, and in seedlings that were insensitive to exogenous NAE, overexpression of the inactive AtFAAH mutants showed no growth enhancement and no NAE tolerance. However, both active ... Description: Bacterial toxins have been shown to modify animal cell proteins in vivo with ADPR. Animal cells also contain endogenous enzymes that can modify proteins. Indirect evidence for the existence in vivo of rat liver proteins modified by ADPR on arginine residues has been reported previously. Presented here is direct evidence for the existence of ADP-ribosylarginine in rat liver proteins. Proteins were subjected to exhaustive protease digestion and ADP-ribosyl amino acids were isolated by boronate chromatography. Description: The model legume, Medicago truncatula, is able to enter into a symbiotic relationship with soil bacteria, known as rhizobia. This relationship involves a carbon for nitrogen exchange in which the plant provides reduced carbon from photosynthesis in exchange for reduced, or “fixed” atmospheric nitrogen, which allows the plant to thrive in nitrogen depleted soils. Rhizobia infect and enter plant root organs, known as nodules, where they reside inside the plant cell in a novel organelle, known as the symbiosome where nitrogen fixation occurs. the symbiosome is enriched in plant proteins, however, little is known about the mechanisms that direct plant proteins to the symbiosome. Using the M. truncatula ENOD8 (MtENOD8) protein as a model to explore symbiosome protein targeting, 3-cis domains were identified within MtENOD8 capable of directing green fluorescent protein (GFP) to the symbiosome, including its N-terminal signal peptide (SP). the SP delivered GFP to the vacuole in the absence of nodules suggesting that symbiosome proteins share a common targeting pathway with vacuolar proteins. a time course analysis during nodulation indicated that there is a nodule specific redirection of MtENOD8-SP from the vacuole to the symbiosome in a MtNIP/LATD dependent manner. GFP expression by the MtENOD8 promoter revealed spatial ... Description: A complete initial velocity study of the 6-phosphogluconate dehydrogenase from Candida utilis in both reaction directions suggests a rapid equilibrium random kinetic mechanism with dead-end E:NADP:(ribulose 5-phosphate) and E:NADPH:(6- phosphogluconate) complexes. Initial velocity studies obtained as a function of pH and using NAD as the dinucleotide substrate for the reaction suggest that the 2'-phosphate is critical for productive binding of the dinucleotide substrate. Primary deuterium isotope effects using 3-<i-6-phosphogluconate were obtained for the 6-phosphogluconate dehydrogenase reaction using NADP and various alternative inucleotide substrates. Description: Initial velocity studies of O-acetylserine sulfhydrylase-B (OASS-B) from Salmonella typhimurium using both natural and alternative substrates suggest a Bi Bi ping pong kinetic mechanism with double substrate competitive inhibition. The ping pong mechanism is corroborated by a qualitative and quantitative analysis of product and dead-end inhibition. Product inhibition by acetate is S-parabolic noncompetitive, indication of a combination of acetate with E followed by OAS. These data suggest some randomness to the OASS-B kinetic mechanism. The pH dependence of kinetic parameters was determined in order to obtain information on the acid-base chemical mechanism for the OASS-B reaction. A mechanism is proposed in which an enzyme general base accepts a proton from α-amine of O-acetylserine, while a second enzyme general base acts by polarizing the acetyl carbonyl assisting in the β-elimination of the acetyl group of O-acetylserine. The ε-amine of the active site lysine acts as a general base to abstract the α-proton in the β-elimination of acetate. At the end of the first half reaction the ε-amine of the active site lysine that formed the internal Schiff base and the general base are protonated. The resulting α-aminoacrylate intermediate undergoes a Michael addition with HS‾ and the active site lysine donates its ... Description: Data obtained from isotope exchange at equilibrium, exchange of inorganic phosphate against forward reaction flux, and positional isotope exchange of 18O from the (βγ-bridge position of pyrophosphate to a (β-nonbridge position all indicate that the pyrophosphate-dependent phosphofructokinase from Propionibacterium freudenreichii has a rapid equilibrium random kinetic mechanism. All exchange reactions are strongly inhibited at high concentrations of the fructose 6-phosphate/Pi and MgPPi/Pi substrate-product pairs and weakly inhibited at high concentrations of the MgPPi/fructose 1,6-bisphosphate pair suggesting three dead-end complexes, E:F6P:Pi, E:MgPPi:Pi, and E:FBP:MgPPi. Neither back-exchange by [32p] nor positional isotope exchange of 18O-bridge-labeled pyrophosphate was observed under any conditions, suggesting that either the chemical interconversion step or a step prior to it limits the overall rate of the reaction. Reduction of the pyridoxal 5'-phosphate-inactivated enzyme with NaB[3H]4 indicates that about 7 lysines are modified in free enzyme and fructose 1,6-bisphosphate protects 2 of these from modification. The pH dependence of the enzyme-reactant dissociation constants suggests that the phosphates of fructose 6-phosphate, fructose 1,6-bisphosphate, inorganic phosphate, and Mg-pyrophosphate must be completely ionized and that lysines are present in the vicinity of the 1- and 6-phosphates of the sugar phosphate and bisphosphates probably directly coordinated to these phosphates. The pH dependence of ...

Investigators looking at bullet hole and poking pen through it. Zimmerman said to be okay pic.twitter.com/tSoApZjrJy — Greg Warmoth (@GWarmothWFTV) May 11, 2015 George Zimmerman, the Florida man that was in 2013 acquitted in the killing of 17-year-old Trayvon Martin, was injured in a confrontation with a driver in Seminole County Monday afternoon.Zimmerman was sprayed with glass from his vehicle's windshield after being involved in a shooting stemming from a road rage dispute. Zimmerman's injuries were not serious and he was been released from the hospital."His injuries would be considered minor," West said. "The bullet missed his head. I think it broke a window and lodged in his vehicle."ABC affiliate WFTV earlier reported that Zimmerman was shot during the confrontation. Zimmerman's truck appears to have a bullet hole in the passenger-side window, according to WFTV.Lake Mary Police Officer Bianca Gillett said during a news conference Monday that Matthew Apperson called 911 to report the shooting shortly after Zimmerman flagged down an officer to say someone had shot at him. Both Zimmerman and Apperson have yet to be interviewed formally by investigators, she said.Apperson was involved in another road rage incident with Zimmerman last year. Last September, Apperson said Zimmerman threatened to kill him, asking "Do you know who I am?" during a confrontation in their vehicles. Apperson decided not to pursue charges, and police officers were unable to move forward without a car tag identified or witnesses.No charges were immediately filed against either man.In 2012, Zimmerman, a neighborhood watchman in Sanford, Fla., shot and killed 17-year-old Trayvon Martin. Florida prosecutors tried to convict Zimmerman of state-level murder and manslaughter charges, but in July 2013 a jury acquitted him, saying prosecutors didn't have enough evidence to prove their case.Since his acquittal, Zimmerman has had several brushes with the law, including allegations of assault by girlfriends, and his wife claiming he smashed her iPad. Charges were either dropped or not pursued because of a lack of evidence in those cases.Earlier this year, the Department of Justice said it would not pursue civil rights charges against Zimmerman in Martin's death.

I am in Baltimore, preparing for Otakon this weekend. Monday will either bring a regular QC strip or a delightful guest comic depending on what drawing I can get done this weekend. Either way, enjoy this one and I will see you either this weekend in conventionland or Monday on the Intar Wubs.

Q: Пустое значение в заявке Кто может подсказать в чем причина? Когда нажимаю кнопку отправить, полученное значение становится NaN let input = $('#total_price'); $('button').on('click', function(){ let price = parseInt($('.'+$(this).attr('id')).text()), // раз класс "цены" и ид кнопки совпадает, то будем это использовать. check = $(this).attr('data-check'), // для проверки, типо "вкл\выкл" altText = $(this).attr('data-alt-text'); // будем менять текст на кнопке. // изменяем данные кнопки $(this) .attr({ 'data-check': (check == 1 ? 0 : 1), // заменим "статус" активации 'data-alt-text': $(this).text() // поменяем местами название кнопки }) .text(altText); // относится к смене названия местами // дальше меняем цену в инпуте let val = parseInt(input.val()); // получаем текущую цену input.val(check == 1 ? (val - price) : (val + price)); // есть "добавить", то + к цене, если "убрать", то минус. }); <script src="https://cdnjs.cloudflare.com/ajax/libs/jquery/3.3.1/jquery.min.js"></script> <form method="post" order="post.php"> <input id="total_price" type="text" value="50" readonly> <hr> <div class="price_1">1</div> <button id="price_1" data-check="0" data-alt-text="Убрать">Добавить</button> <br> <div class="price_2">2</div> <button id="price_2" data-check="0" data-alt-text="Убрать">Добавить</button> <br> <div class="price_3">3</div> <button id="price_3" data-check="0" data-alt-text="Убрать">Добавить</button> <button type="submit">Отправить</button> </form> A: Вы слушаете событие click на всех кнопках $('button'). Кнопка отправки тоже имеет тег <button>, поэтому, когда вы на неё нажимаете, загорается событие и срабатывает функционал пересчета. Быстрым фиксом будет заменить селектор на $('button[type!=submit]'). То есть слушать событие на всех кнопках, кроме кнопки, у которой атрибут type="submit".

We deliver our Flexible Fund programme in South Yorkshire on behalf of the Skills Funding Agency (SFA) and the European Social Fund (ESF). Flexible Fund gives people in South Yorkshire aged 19 or over, who are currently unemployed, the opportunity to take up some accredited training in a number of areas like: retail; warehousing; construction; health and social care; customer service and contact centres; hospitality; administration; ESOL; and maths and English. We work with the National Careers Service and other expert partners across South Yorkshire to make sure you get the right support to help you achieve your goals. And it's not just about training. Our courses can lead to apprenticeships, further learning or even full or part-time employment. You don't have to be claiming benefits to take part. Just give us a call and we can help you find the right opportunity for you.

Q: WMQ V8 Connection Factory setup on Tomcat using JNDI Currently on our Tomcat configuration with JNDI is based on this recommendation which currently is working. How do I connect to a Websphere MQ (MQ Series) server using JMS and JNDI? Since we are upgrading to v8 I would like to take advantage of the JMS 2.0 features. This would require updating the jar files to the JMS 2.0 versions. So I have removed the following jars from the tomcat lib folder. com.ibm.mq.jar com.ibm.mqjms.jar connector.jar dhbcore.jar geronimo-j2ee-management_1.0_spec-1.0.jar geronimo-jms_1.1_spec-1.0.jar And replaced them with these jars. Base on this link com.ibm.mq.allclient.jar com.ibm.mq.traceControl.jar My JNDI configuration matches this configuration. <Resource name="jms/MyQCF" auth="Container" type="com.ibm.mq.jms.MQQueueConnectionFactory" factory="com.ibm.mq.jms.MQQueueConnectionFactoryFactory" description="JMS Queue Connection Factory for sending messages" HOST="<mymqserver>" PORT="1414" CHAN="<mychannel>" TRAN="1" QMGR="<myqueuemanager>"/> Now with the updated jar files I'm getting the following exceptions. Caused by: java.lang.NoClassDefFoundError: javax/jms/JMSRuntimeException at com.ibm.mq.jms.MQQueueConnectionFactoryFactory.getObjectInstance(MQQueueConnectionFactoryFactory.java:69) at org.apache.naming.factory.ResourceFactory.getObjectInstance(ResourceFactory.java:141) at javax.naming.spi.NamingManager.getObjectInstance(NamingManager.java:321) at org.apache.naming.NamingContext.lookup(NamingContext.java:842) at org.apache.naming.NamingContext.lookup(NamingContext.java:153) at org.apache.naming.NamingContextBindingsEnumeration.nextElementInternal(NamingContextBindingsEnumeration.java:117) at org.apache.naming.NamingContextBindingsEnumeration.next(NamingContextBindingsEnumeration.java:71) at org.apache.naming.NamingContextBindingsEnumeration.next(NamingContextBindingsEnumeration.java:34) at org.apache.catalina.mbeans.GlobalResourcesLifecycleListener.createMBeans(GlobalResourcesLifecycleListener.java:138) at org.apache.catalina.mbeans.GlobalResourcesLifecycleListener.createMBeans(GlobalResourcesLifecycleListener.java:110) at org.apache.catalina.mbeans.GlobalResourcesLifecycleListener.lifecycleEvent(GlobalResourcesLifecycleListener.java:82) at org.apache.catalina.util.LifecycleSupport.fireLifecycleEvent(LifecycleSupport.java:117) at org.apache.catalina.util.LifecycleBase.fireLifecycleEvent(LifecycleBase.java:90) at org.apache.catalina.util.LifecycleBase.setStateInternal(LifecycleBase.java:402) at org.apache.catalina.util.LifecycleBase.setState(LifecycleBase.java:347) at org.apache.catalina.core.StandardServer.startInternal(StandardServer.java:724) at org.apache.catalina.util.LifecycleBase.start(LifecycleBase.java:150) ... 7 more Questions: Should I be including another jar file to the class path? Or has the configuration of JNDI changed for v8? A: Please do NOT try adding the JMS Jar found in the MQ installation. IBM has as of v8.0 repackaged JMS so that a stand-alone install of the jar files is now supported. But only if you use the complete and intact set of jars and do not mix and match them on a whim. To do so would be reckless and ill-advised. You are on the right track but for your purposes I would go grab the file from the latest 8.0.0.x MQ Client Fix Pack. I would then go to the Technote that explains the install procedure and try that. I'm sure that IBM has a process for grabbing jars from the server install, however since these appear to be packaged differently, I'd put my money on the package designed and tested for stand-alone delivery - e.g. the one I linked to above. By the way, since this is now supported if it doesn't work you can open a PMR, tell IBM you followed their instructions to the letter, and make them walk through fixing it with you. (Then post here what it was that fixed it.) But they won't do that if you just go grabbing random jar files and hope it works.

A fatal case of transfusion-transmitted babesiosis in the State of Delaware. Most cases of human babesiosis in North America are caused by Babesia microti, which is endemic in the northeastern and upper midwestern United States. Although the disease is usually transmitted by a tick bite, there has been an increase in the number of transfusion-transmitted cases reported. We describe a fatal case of transfusion-transmitted babesiosis in a nonendemic state, Delaware. The patient was a 43-year-old Caucasian woman with history of transfusion-dependent Diamond-Blackfan syndrome, hepatitis C, and splenectomy. She was admitted initially for presumptive pneumonia. The next day, a routine examination of the peripheral blood smears revealed numerous intraerythrocytic ring forms, consistent with Babesia. The parasitemia was approximately 5% to 6%. The diagnosis was confirmed by positive polymerase chain reaction (PCR) for B. microti DNA and high titer of antibody to B. microti (1:2048). Despite aggressive therapy including clindamycin and quinine antibiotics, the patient expired 3 days after admission. Subsequently, 13 blood donors were tested for B. microti. All tested donors were negative by PCR. However, one donor living in New Jersey had a significant elevated B. microti antibody titer (1:1024). We believe that this is the first reported case of transfusion-transmitted babesiosis in Delaware, a nonendemic state. Our case illustrates that clinicians should consider babesiosis in the differential diagnosis of immunocompromised patients who have fever and recent transfusion history, even in areas where babesiosis is not endemic. It also demonstrates the need for better preventive strategies including more sensitive, specific, and rapid blood donor screening tests to prevent transfusion-transmitted babesiosis.

Indonesian authorities have resumed their tough stance against illegal fishing in the country's water by sinking 51 foreign ships. Maritime and Fisheries Minister Susi Pudjiastuti says the ships were sunk Saturday at five ports across the archipelago, which has some of the world's richest fishing grounds. The boats had been seized from Chinese, Malaysian, Filipino, Thai and Vietnamese fishermen. The move comes a week after an Indonesian navy ship was rammed by two Vietnamese coast guard vessels after intercepting a boat it says was fishing illegally. Last year, the ministry sunk 125 mostly foreign vessels, including 86 Vietnamese-flagged ships, 20 Malaysian and 14 from the Philippines. Indonesia says it has sunk more than 500 illegal fishing vessels since October 2014.

1. Field of the Invention The present invention relates to a lithographic apparatus and a device manufacturing method. 2. Related Art A lithographic apparatus is a machine that applies a desired pattern onto a target portion of a substrate. The lithographic apparatus can be used, for example, in the manufacture of integrated circuits (ICs), flat panel displays, and other devices involving fine structures. In a conventional lithographic apparatus, a patterning means, which is alternatively referred to as a mask or a reticle, can be used to generate a circuit pattern corresponding to an individual layer of the IC (or other device), and this pattern can be imaged onto a target portion (e.g., comprising part of one or several dies) on a substrate (e.g., a silicon wafer or glass plate) that has a layer of radiation-sensitive material (e.g., resist). Instead of a mask, the patterning means can comprise an array of individually controllable elements that generate the circuit pattern. In general, a single substrate will contain a network of adjacent target portions that are successively exposed. Known lithographic apparatus include steppers, in which each target portion is irradiated by exposing an entire pattern onto the target portion in one go, and scanners, in which each target portion is irradiated by scanning the pattern through the beam in a given direction (the “scanning” direction), while synchronously scanning the substrate parallel or anti-parallel to this direction. It will be appreciated that, whether or not a lithographic apparatus operates in stepping or scanning mode, it is desired that the patterned beam or beams is/are directed onto the appropriate target portion of the substrate surface. In many circumstances, multi-layer structures are built up on the surface of the substrate as a result of a sequence of lithographic processing steps. It is of course desired that the successive layers formed in the substrate are correctly in register with each other. Thus, great care is taken to ensure that the position of the substrate relative to the beam projection system is accurately known. Various techniques are used to determine the position of a substrate relative to the beam projection system. These generally rely upon the substrate having formed upon it alignment marks that are arranged around the periphery of areas of the substrate onto which active circuit components or the like are to be formed. These marks are located to provide reference points relative to which the position of target portions on the substrate are determined. The alignment marks can be detected optically using the beam projection system, which is also used to project patterns onto the substrate. Such a “through the lens” or TTL approach to the problem of locating alignment marks allows for the position measurement location to be the same as the image formation location. Thus, “Abbe” errors are minimized. In other systems, the alignment mark detectors and the main beam projection system have different optical axes, in which case some means can be provided for compensating for relative movement of these axes. In an example of a scanning-based system, as the frame supporting the beam projection system and the alignment mark detectors is scanned across the surface of a substrate by moving the substrate, the position of the substrate in the direction perpendicular to the scan direction and the scan speed is adjusted in dependence upon the measured positions of the alignment marks. Alternatively, or additionally, the digital image to be projected can be adjusted. In the case where the patterning means comprises an array of individually controllable elements, this can involve translating or otherwise adjusting the digital pattern applied to the array. The height of the substrate can also be controlled using some type of level sensor arrangement. Typically, a lithographic apparatus of a given production facility is designed (or configured in a relatively inflexible way) for use with substrates of a fixed size. In the case of flat panel displays or color filter plates, the substrate dimensions can be of the order of several meters, with multiple panels being formed on each substrate. The alignment marks are provided around the periphery of the substrate, as well as between panels. However, there is a desire to introduce flexibility in the layout of panels on the substrates, such that a given production facility can be used to produce panels with different dimensions. This has meant that, for non-standard panel layouts, either only alignment marks around the periphery of the substrate can be used (as the periphery is the only “blank” region common to all substrate layouts), or some manual realignment of the detectors must be carried out While a continuous array of alignment mark detectors positioned across the substrate to detect alignment marks in various intermediate positions can be desirable, this is not practical due to the very high resolution required and the number of detectors that that would necessitate. A number of factors, for example thermal effects, can cause local variations in the shape of a substrate. It is therefore desirable to provide alignment marks at relatively small intervals across the surface of the substrate. However, the approach described in the previous paragraph mitigates against this as the entire central area of the substrate is effectively unusable for the placement of alignment marks. Therefore, what is needed is a lithographic apparatus and method that allow for the flexible positioning of alignment marks within the central area of a substrate to be patterned.

WinAntiRansom – Prevents encryption of your files - spaceboy https://www.winpatrol.com/winantiransom/ ====== eyer2016 Lol

Eosinophil cationic protein as a serological marker of disease activity in childhood bronchial asthma. To study the value of eosinophil cationic protein (ECP) as a serological marker of disease activity in childhood bronchial asthma, ECP levels were measured in 20 healthy control children and 25 asthmatic children, during and 2 weeks after acute exacerbation. The mean serum ECP level of all asthmatic patients, during and after exacerbation, was significantly higher than the control group and was significantly higher during attacks than 2 weeks after their termination. ECP levels were highest in severe attacks, but did not differ between mild and moderate attacks. ECP levels in asthmatic patients 2 weeks after mild and moderate attacks were comparable to normal; after severe attacks levels remained higher than normal. Measurement of serum ECP will be helpful in determining asthma activity and deciding the use of anti-asthma drugs.

MR imaging and MR spectroscopy in prostate cancer management. Currently, endorectal coil MR imaging has the ability to improve accuracy in staging of localized prostate cancer. The addition of MR spectroscopic imaging has further improved the sensitivity of MR imaging for intraprostatic tumor localization. Additional refinements and techniques are expected to further improve the performance of MR imaging for prostate cancer imaging and to aid in patient management. Further studies are required to identify the ideal role for MR imaging in the diagnosis and management of prostate cancer.

--- abstract: 'The cardiovascular system is composed of the heart, blood and blood vessels. Regarding the heart, cardiac conditions are determined by the electrocardiogram, that is a noninvasive medical procedure. In this work, we propose autoregressive process in a mathematical model based on coupled differential equations in order to obtain the tachograms and the electrocardiogram signals of young adults with normal heartbeats. Our results are compared with experimental tachogram by means of Poincaré plot and dentrended fluctuation analysis. We verify that the results from the model with autoregressive process show good agreement with experimental measures from tachogram generated by electrical activity of the heartbeat. With the tachogram we build the electrocardiogram by means of coupled differential equations.' address: - '$^1$Instituto Federal de Educação, Ciência e Tecnologia do Paraná, Telêmaco Borba, PR, Brazil.' - '$^2$Pós-Graduação em Ciências, Universidade Estadual de Ponta Grossa, Ponta Grossa, PR, Brazil.' - '$^3$Departamento de Matemática e Estatística, Universidade Estadual de Ponta Grossa, Ponta Grossa, PR, Brazil.' - '$^4$Instituto de Física, Universidade de São Paulo, São Paulo, SP, Brazil.' - '$^5$Institute for Complex Systems and Mathematical Biology, Aberdeen, Scotland, UK.' - '$^6$Departamento de Física, Universidade Federal do Paraná , Curitiba, PR, Brazil.' - '$^7$Faculdade de Medicina de São José do Rio Preto, São José do Rio Preto, SP, Brazil.' author: - 'Ronaldo M Evaristo$^{1,2}$, Antonio M Batista$^{2,3,4,5}$, Ricardo L Viana$^6$, Kelly C Iarosz$^{4,5}$, José D Szezech Jr$^{2,3}$, Moacir F de Godoy$^7$' title: Mathematical model with autoregressive process for electrocardiogram signals --- heartbeat ,autoregressive model ,electrocardiogram Introduction ============ The cardiovascular system (CVS) is responsible for supplying the human organs with blood. It is composed by the heart, the arteries, and the veins. The heart has as function to pump blood throughout the body, that is realised by means of contractions [@mohrman14]. The human heart beats an average $72$ beats per minute and pumps 0.07 liters of blood per beat [@curtis89; @hall11]. The contraction and relaxation of the heart is obtained by a single cycle of the electrocardiogram signal (ECG), namely the ECG records of the electrical activity of the heart. Waller in 1887 [@sykes87] measured for the first time the electrical activity from the heart, and the first practical electrocardiograph was invented by Einthoven in 1901 [@ruiz08] that it was used as a tool for the diagnosis of cardiac abnormalities. In the recent past, several theoretical investigations pertaining to CVS have been carried out to analyse electrocardiogram signal [@gaetano09; @kudinov15; @schenone16]. Mathematical models have been developed to understand physiological function and disfunction in CVS. A mathematical model which have been used to generate ECG signals is the Van der Pol oscillator [@pol26]. Gois and Savi considered three modified Van der Pol oscillators connected by time delay coupling to describe heart rhythm behaviour [@gois09]. The coupled Van der Pol oscillators was also used in studies about the control of irregular behaviour in pathological heart rhythms [@ferreira14]. McSharry and collaborators [@mcsharry03] introduced a dynamical model to describe generating synthetic electrocardiogram signals. This model is based on a set of three ordinary differential equations in that it is incorporated the respiratory sinus arrhythmia (RSA) by means of a bimodal power spectrum consisting of the sum of two Gaussian distributions. In this work, instead two Gaussian distributions we propose an autoregressive (AR) process for the RSA to obtain the tachograms and, consequently, the ECGs of young adults with normal heartbeats. AR model can be used to quantify gains and delays by which cardiac interval, lung volume, blood pressure and sympathetic activity affect each other [@cohen02]. Cardiologists utilise AR model when they are interested in fit tachograms through mathematical regressions softwares. The tachogram is a signal that allows the study of heart rate variability (HRV) [@yasuma04; @acharya06]. Boardman and collaborators [@boardman02] study autoregressive model for the HRV. They found the optimum order of autoregressive model which can be used for spectral analysis of short segments of tachograms. We compare the results obtained from two Gaussian distributions and AR process with experimental tachograms of healthy young adults. To do that, we use as diagnostic tools the Poincaré plot [@guzik07] and detrended fluctuation analysis (DFA) [@peng94]. We have verified that the result with AR process agrees with the experimental tachogram more closely than the result with two Gaussian distributions. This way, we generate the ECG by means of coupled differential equations considering the AR process to obtain the tachogram and the frequency of the ECG. The frequency is an important parameter in the mathematical model for the ECG signal, and variation in the frequency produces variation in the times elapsed between successive heartbeats. This article is organised as follows: in Section 2 we introduce the ECG model with autoregressive process for tachograms, in Section 3 we compare our results with experimental data, and in the last Section we draw our conclusions. The mathematical model ====================== ![(Colour online) ECG following a normal hearbeat.[]{data-label="fig1"}](fig1.eps){height="5.5cm" width="11cm"} The ECG is a noninvasive method used to measure electrical activity of the heart through electrodes placed on the surface of the skin. Figure \[fig1\] shows the relationship between the cardiac conduction and the ECG. In the sinoatrial node (SA), known as natural pacemaker, the heartbeat starts. The atrioventricular node (AV) is responsible for the passage of electrical signals from the atria to the ventricles. At last, the signal arrives at the Purkinje fibers and makes the heart contract to pump blood, where the R-peak occurs. The time between successive R-peaks is the RR-interval and the series of RR-intervals is known as RR tachogram. McSharry and collaborators [@mcsharry03] argued that the heartbeat can be described by means of three coupled ordinary differential equations with the inclusion of RSA at the high frequencies ($f_{\rm RSA}$) and Mayer waves (MW) at the low frequencies ($f_{\rm MW}$). The equations are given by $$\begin{aligned} \label{eqgaus} {\dot x} & = & \alpha x-\omega y,\nonumber \\ {\dot y} & = & \alpha y+\omega x, \\ {\dot z} & = & z_0-z-\sum_i a_i\Delta\theta_i {\rm e}^{-\frac{\Delta\theta_i^2}{2b_i^2}}, \nonumber\end{aligned}$$ where $i\in\{P,Q,R,S,T\}$, $\alpha=1-\sqrt{x^2+y^2}$, $\Delta\theta_i=\theta-\theta_i$ (mod $2\pi$), $\theta={\rm atan}2(y,x)$ ($-\pi\leq {\rm atan}2(y,x)\leq \pi$), $z_0(t)=A\sin(2\pi f_{\rm RSA}t)$, and $A=0.15$mV. Visual analysis of a ECG from a normal individual is used to obtain the times, as well as the angles $\theta_i$, the $a_i$ and $b_i$ values for the PQRST points. The parameters values are given in Table \[pareq\] according to Reference [@mcsharry03]. index (i) time (s) $\theta_i$ (rad) $a_i$ $b_i$ ----------- ---------- ------------------ ------- ------- P -0.2 $-\pi/3$ 1.2 0.25 Q -0.05 $-\pi/12$ -5.0 0.1 R 0 0 30.0 0.1 S 0.05 $\pi/12$ -7.5 0.1 T 0.3 $\pi/2$ 0.75 0.4 : Parameters for Equation (\[eqgaus\]).[]{data-label="pareq"} The frequency $\omega(t)$ controls the variations in the RR-intervals, and it is given by $$\label{omega} \omega(t)=\frac{2\pi}{r(t)},$$ where $r(t)$ is the continuous version of the $r(n)$ time series which is obtained from the inverse discrete-time Fourier transform (DTFT) [@oppenheim10; @proakis07] of the power spectrum $$\label{eqbimodal} |H_G(f)|^2=\frac{\sigma^2_{\rm MW}}{\sqrt{2\pi c_{\rm MW}^2}} \exp \frac{(f-f_{\rm MW})^2}{2c^2_{\rm MW}}+ \frac{\sigma^2_{\rm RSA}}{\sqrt{2\pi c_{\rm RSA}^2}} \exp \frac{(f-f_{\rm RSA})^2}{2c^2_{\rm RSA}},$$ with phase randomly distributed from $0$ to $2\pi$ [@mcsharry03]. The tachogram exhibits similarity with a real one when the phase is randomly distributed. Figure \[fig2\](a) exhibits the power spectrum $|H_G(f)|$ for $f_{\rm MW}=0.1$Hz, $f_{\rm RSA}=0.25$Hz, $c_{\rm MW}=0.01$, $c_{\rm RSA}=0.01$, and $\sigma^2_{\rm MW}/\sigma^2_{\rm RSA}=0.5$. The values of the frequencies $f_{MW}$ and $f_{RSA}$ are motivated by the power spectrum of a real RR tachogram. The $f_{\rm MW}$ value is approximately equal to $0.1$ in humans, and it is related to arterial pressure occurring spontaneously in conscious subjects. RSA is characterised by the presence of oscillations in the tachogram considering the parasympathetic activity. It is synchronous with the breathing rate which for normal subjects is equal to $15$ breaths per minute, i.e., $f_{\rm RSA}=0.25$Hz. The spectrum has a bimodal form, where one peak is located in the low frequency range $0.04\leq f< 0.15$Hz and the other is located in the high frequency range $0.15\leq f\leq 0.4$Hz. These two bands appear due to the effects of both Mayer waves and RSA. The tachogram $r(n)$ is generated by the inverse DTFT from the power spectrum $|H_G(f)|$ with random phase. To obtain the continuous signal $r(t)$, first we increase the sample rate of $r(n)$ to the same sample rate of the desired ECG by interpolation [@mcsharry03; @oppenheim10; @proakis07]. Then, a R-peak detection algorithm [@mcsharry03] is applied to the interpolated signal to determine $r(t)$, as a result $\omega(t)$ (Eq. \[omega\]) is calculated and the ECG is built by means of Equation (\[eqgaus\]). In this work, in order to model electrocardiogram signals we propose an autoregressive (AR) stochastic process [@boardman02] to determine $\omega(t)$. The AR process of order $p$ is defined as $$R(n)=\sum_{l=1}^p d_lR(n-l)+\epsilon(n),$$ where $\epsilon(n)$ is a white noise with zero mean and unit variance. Boardman and collaborators [@boardman02] found that $p=16$ is an optimum order of autoregressive model for heart rate variability. The AR power spectrum density is $$\label{HAR} |H_{AR}(f)|=\frac{1}{\left|1-\sum_{l=1}^p d_l{\rm e}^{-{\rm i}2\pi fl}\right|},$$ with the coefficients values given in Table \[tabd\]. The coefficients values for the AR power spectrum density have been adjusted to be used for the set of data that we obtained from healthy individuals. The presence of arrhythmia can influence the coefficients values, and as a consequence it would be necessary to calculate the new coefficients values. ----------------- ------------------ ------------------ ----------------- $d_{1}=-0.9099$ $d_{2}=0.5188$ $d_{3}=-0.2840$ $d_{4}=-0.2063$ $d_{5}=0.0382$ $d_{6}=0.0709$ $d_{7}=0.0305$ $d_{8}=-0.1533$ $d_{9}=0.0009$ $d_{10}=-0.0070$ $d_{11}=-0.0218$ $d_{12}=0.0043$ $d_{13}=0.0316$ $d_{14}=0.0155$ $d_{15}=-0.0591$ $d_{16}=0.0252$ ----------------- ------------------ ------------------ ----------------- : Coefficients values for the AR power spectrum density (Eq. \[HAR\]).[]{data-label="tabd"} Figure \[fig2\](b) shows the power spectrum calculated from the tachogram generated by means of the AR process. In placed of the two separated Gaussian distributions, the AR process produces a damped in the power spectrum, and as consequence the separation between the frequency components cannot be exactly identified, as in real situation. This way, with the tachogram $r(n)$ we find $r(t)$ (interpolation followed by R-peak detection) and $\omega(t)$ to build the ECG using Equation (\[eqgaus\]). ![Power spectrum from (a) Equation (\[eqbimodal\]) and (b) Equation (\[HAR\]).[]{data-label="fig2"}](fig2.eps){height="7cm" width="8cm"} Results and discussions ======================= In this work, the power spectrum is considered to obtain the theoretical tachogram and consequently the frequency (Eq. \[omega\]) that is used in Equation (\[eqgaus\]) to build the ECG. We generate $124$ theoretical ECG signals, being $62$ from the Gaussian spectrum and $62$ from the AR spectrum. Then, we obtain their respective tachograms and compare them with $62$ experimental tachograms collected from healthy adults. The experimental protocol consisted of $20$min of monitoring of the heartbeat frequency in resting from patients without sound and visual stimulations in a supine rest position. The heartbeats were recording with a sample rate of $1000$Hz, and $1000$ RR intervals were analysed. The experimental tachograms were filtered to remove ectopic beats and noise effects. We calculate the power spectrum from Gaussian distributions (blue), AR process (red), and experimental data (green), as shown in Figure \[fig3\](a). The green dashed lines exhibit the confidence interval of the experimental power spectrum that are calculated from $62$ experimental tachograms. ![(Colour online) (a) Power spectrum and (b) dentrended fluctuation analysis (DFA) for Gaussian distributions (blue), AR process (red), and experimental data (green). The green dashed lines exhibit the confidence interval of the experimental power spectrum that are calculated from $62$ experimental tachograms.[]{data-label="fig3"}](fig3.eps){height="6.5cm" width="8cm"} With regard to Figure \[fig3\](a), we see that the power spectrum from AR process has a shape closer the experimental result than the power spectrum from the Gaussian distributions. This way, in order to verify the agreement among the experimental tachogram and the tachograms obtained from theoretical power spectra we have utilised the dentrended fluctuation analysis (DFA) [@hu01; @chen02]. DFA yields a fluctuation function $F(k)$ as a function of $k$, given by [@peng94] $$F(k)=\sqrt{\frac{1}{N}\sum_{n=0}^{N-1}[r_I(n)-r_k(n)]^2},$$ where $N=1000$, $r_I(n)=\sum_{l=0}^{n}r(l)$ is the cumulative sum of the $r(n)$, $k$ is the box size that partitions the time interval of the tachogram, and $r_k(n)$ is the local trend in each box. DFA is a nonlinear dynamical analysis that have been used for the understanding of biological systems [@peng94]. Moreover, the DFA allows the detection of long-range correlations embedded in a patchy landscape. Figure \[fig3\](b) shows the mean DFAs for $4<k<100$, where linear regressions present slopes equal to $0.1955\pm 0.0150$, $0.7034\pm 0.0686$, and $0.6817\pm 0.2448$ for Gaussian distributions, AR process and experimental data, respectively. The experimental data are collected from $62$ healthy young adults. Each one with length equal to $1000$ heartbeats without trend removal. In general, ectopic beats or noise effects are excluded of time series through filters [@santos13]. As a result, the DFA for the tachogram generated by the experimental data and AR process are in close agreement with each other. Whereas DFA for the Gaussian distributions exhibits a good agreement only for $k<20$. ![(Colour online) Tachograms generated by (a) the sum of two Gaussian distributions, (b) the AR process, (c) experimental data, and respective Poincaré plots in (d), (e), and (f).[]{data-label="fig4"}](fig4.eps){height="7.5cm" width="12cm"} Through the Gaussian power spectrum with phases randomly distributed between $0$ and $2\pi$ we build a ECG and extract the tachogram $r_G(n)$ shown in Figure \[fig4\](a). A tachogram extracted of ECG generated by the AR spectrum $r_{AR}(n)$ is illustrated in Figure \[fig4\](b) and an experimental tachogram $r_{EXP}(n)$ of the healthy adult is in Figure \[fig4\](c). In Figures \[fig4\](d), \[fig4\](e), and \[fig4\](f) we calculate the respective Poincaré plots. The Poincaré plot is a visualising technique to analyse RR intervals, where it is computed the standard deviation of points perpendicular to the axis (SD1) and points along (SD2) the axis of line-of-identity. Table \[tabSD\] exhibits the mean SD1 and SD2 values of the tachograms shown in Figure \[fig4\]. Comparing the Poincaré plots we see that both SD1 and SD2 for the AR process agree with the experimental results better than the method based on the Gaussian distribution. In addition, we calculate the $p$-values according to the two-sided Wilcoxon rank sum test [@wilcoxon45] of the SD1 and SD2 time series from the simulated and experimental data. This statistical test verifies if two paired time series have the same distribution when the data cannot be assumed to be normally distributed. We find that the $p$-values of SD1 and SD2 are greater than $0.05$ for the AR process, consequently the time series of SD1 and SD2 in the AR process and the experimental data have the same distributions. However, the same does not happen for the Gaussian distributions, where the $p$-values are less than $0.05$. RR-intervals $r_G(62)$ \[A\] $r_{AR}(62)$ \[B\] $r_{EXP}(62)$ \[C\] $p$-value -------------- ----------------- -------------------- --------------------- ---------------------- SD1 \[ms\] $63.9\pm 1.9$ $32.8\pm 10.5$ $38.8\pm 19.6$ $0.0$ \[A$\times$C\] $0.2$ \[B$\times$C\] SD2 \[ms\] $103.4\pm 2.6$ $82.0\pm 26.2$ $79.0\pm 28.5$ $0.0$ \[A$\times$C\] $0.6$ \[B$\times$C\] : Mean SD1 and SD2 values for the theoretical and experimental tachograms with $p$-values of the Wilcoxon rank sum test.[]{data-label="tabSD"} ![ECG signal generated by means of Equation (\[eqgaus\]) considering AR process.[]{data-label="fig5"}](fig5.eps){height="5cm" width="8cm"} All in all, we obtain the tachogram $r(n)$ (discrete-time) by means of the AR process. Then, an interpolation followed by a R-peak detection allows us to determine the signal $r(t)$ (continuous-time). As a result, we calculate $\omega(t)$ and solve the ordinary differential equations to build the ECG signal. We use the fourth order Runge-Kutta method to solve the ordinary differential equations, where we consider a fixed time step $\Delta t=1/f_s$ and sampling frequency $f_s=256$Hz. Figure \[fig5\] shows the ECG signal in the time interval $0\leq t\leq 20$s, where $z(t)$ yields a synthetic ECG with a realistic PQRST morphology according to Figure \[fig1\]. Conclusions =========== In conclusion, we have studied a mathematical model given by coupled differential equations that describes electrocardiogram signals and it was proposed by McSharry and collaborators [@mcsharry03]. In the original model, the frequency is calculated from a power spectrum with two Gaussian distributions that incorporates both respiratory sinus arrhythmia and Mayer waves. The use of two Gaussian distributions is in disagreement with our experimental data obtained from healthy adults, due to the fact that the two distributions are not well separated in the power spectrum. This way, we propose to calculate the frequency by means of the AR process. We believe that our model also allows the study of respiratory sinus arrhythmia. We verify that the power spectrum from AR process has a good agreement with the power spectrum from experimental data. We have also compared the tachograms generated from Gaussian distributions and AR process with the experimental tachogram using DFA and Poincaré plot. As a result, in both DFA and Poincaré plot, the tachogram generated considering the AR process is in closer agreement with experimental data than the two Gaussian. As a consequence, with the tachogram, the frequency is calculated and the ECG signal can be built utilising coupled differential equations with AR process. We believe that the mathematical model with autoregressive process constitutes an important step toward developing strategies to simulate electrocardiogram signals. We have considered many experimental tachograms from healthy adults to obtain the parameters, this way our simulations allow to obtain and also to do forecast of electrocardiogram signals of individuals in the same situation analysed in this work. We have tested our results using experimental tachograms obtained from $62$ healthy patients without sound and visual stimulations in a supine rest position. In future works, we plan to do the same analyse considering patients with different clinical conditions. Acknowledgements {#acknowledgements .unnumbered} ================ This study was possible by partial financial support from the following agencies: Fundação Araucária, Brazilian National Council for Scientific and Technological Development (CNPq), Coordination for the Improvement of Higher Education Personnel (CAPES), and São Paulo Research Foundation (FAPESP) process numbers 2011/19296-1, 2015/07311-7, and 2016/16148-5. [00]{} Mohrman DM, Heller LJ. Cardiovascular physiology. New York: McGraw-Hill Education; 2014. Curtis H. Biology. New York: Worth; 1989. Hall J. Guyton and hall textbook of medical physiology. Philadelphia: Elsevier; 2011. Sykes AH. A D Waller and the electrocardiogram. Br Med J 1987; 294:1396-1398. Rivera-Ruiz M, Cajavilca C, Varon J. Einthoven’s string galvanometer. Tex Heart Inst J 2008;35:174-178. de Gaetano A, Panunzi S, Rinaldi F, Risi A, Sciandrone M. A patient adaptable ECG beat classifier based on neural networks. Appl Math Comput 2009;213:243-249. Kudinov AN, Lebedev DY, Tsvetkov VP, Tsvetkov IV, Mathematical model of the multifractal dynamics and analysis of heart rates. Math Models Comput Simul 2015;7:214-221. Schenone E, Colin A, Gerbeau J-F. Numerical simulation of electrocardiograms for full cardiac cycles in healthy and pathological conditions. Int J Numer Meth Biomed Engng 2016;32:e02744. Van der Pol B. On relaxation oscillations. Philos Mag 1926;7:978-992. Gois SRFSM, Savi MA. An analysis of hearth rhythm dynamics using a three-coupled oscillator model. Chaos Solitons Fractals 2009;41:2553-2565. Ferreira BB, Savi MA, de Paula AS. Chaos control applied to cardiac rhythms represented by ECG signals. Phys Scripta 2014;89:105203. McSharry PE, Clifford GD, Tarassenko L, Smith LA. A dynamical model for generating synthetic electrocardiogram signals. IEEE Trans Biomed Eng 2003;50:289-294. Cohen MA, Taylor JA. Short-term cardiovascular oscillations in man: measuring and modelling the physiologies. J Physiol 2002;542:669-683. Yasuma F, Hayano J. Why does the heartbeat synchronize with respiratory rhythm? Chest 2004;125:683-690. Acharya UR, Joseph KP, Kannathal N, Lim CM, Suri JS. Heart rate variability: a review. Med Bio Eng Comput 2006;44:1031-1051. Boardman A, Schlindwein FS, Rocha AP, Leite A. A study on the optimum order of autoregressive models for heart rate variability. Physiol Meas 2002;23:325-336. Guzik P, Piskorski J, Krauze T, Schneider R, Wesseling KH, Wykretowicz A, Wysocki H. Correlations between the Poincaré plot and conventional heart rate variability parameters assessed during paced breathing. J Physiol Sci 2007;57:63-71. Peng C-K, Buldyrev SV, Havlin S, Simons M, Stanley HE, Goldberger AL. Mosaic Organization of DNA Nucleotides. Phys Rev E 1994;49:1685-1689. Oppenheim AV, Schafer RW. Discrete-time signal processing. New Jersey: Pearson Prentice Hall; 2010. Proakis JG, Manolakis DG. Digital signal processing. New Jersey: Pearson Prentice Hall; 2007. Hu K, Ivanov PCh, Chen Z, Carpena P, Stanley HE. Effect of trends on detrended fluctuation analysis. Phys Rev E 2001;64:011114. Chen Z, Ivanov PCh, Hu K, Stanley HE. Effect of nonstationarities on detrended fluctuation analysis. Phys Rev E 2002;65:041107. Santos L, Barroso JJ, Macau EEN, Godoy MF. Application of an automatic adaptive filter for Heart Rate Variability analysis. Med Eng Phys 2013;35:1778-1785. Wilcoxon F. Individual comparisons by ranking methods. Biometrics Bulletin 1945;1:80-83.

Just like the traditional file cabinet, your computer needs to have organized files in order to be able to find important information quickly. As a business owner, searching for client or product files among thousands of documents is a time thief. Folders When you opened that file cabinet you saw manila folders. In the same way your computer should have folders. And those folders need to be in the right place and labeled correctly. Don’t make the mistake of creating one gigantic folder for all your files. Work smarter not harder; the few minutes it takes you to set up your folders will save time in the long run. Categories Please One effective way to organize your computer files and folders is by category. For example, create one folder for local clients, another for out of state customers and yet a third for international customers. Now use the same strategy for your products, perhaps separating those folders by specific products or services you offer. If you’re not computer proficient consider hiring a Virtual Assistant who is. Subfolders to Organize Files Using subfolders is a necessity to organizing your files but don’t go overboard. Efficient use of subfolders looks like this: create a folder called Products in My Documents, and two subfolders titled Widgets under $100 and Widgets over $100 in the Products folder. Pay attention to how many subfolders you set up because it can be frustrating to open subfolder after subfolder. Use Caution When Organizing by Date Organizing your files by date isn’t that helpful because you’ll have to open the file to see what’s inside. You’ll be pulling your hair out the first time you perform a file search. This method is useless if you arranged your folders this way and have all types of files intermixed with each other. For time sensitive files or documents that you update frequently, like customer lists, be sure to add a clear description before or after the date. Organizing by Type Organizing your files by type (Word, Excel) is also not best practice. Use this system for mass organizing files you don’t really need. Otherwise, it’ll be “clean up on aisle 5” later, stealing your valuable time. Whatever method you use, start now. Over time, you‘ll be able to expand your folders in a way that works best for you. Contact Us Necessities Social Networking Testimonials "A superb service, they understood my needs right from the start and all the way through, whether your big or small, am confident Contemporary VA can help any organisation or individual meet there outsourcing needs. I was kept up to date on all ongoing work, and work was only done when the go ahead from me was given. No surprises, no hassle, and even added bonus support from a dedicated admin staff whom coordinated all my tasks to various assistants I am now proceeding with working with the company on an ongoing basis and hopefully long term 10/10! Thanks"- Waseem, Virtual World Direct

An interesting fact is that the man I bought that coin off was most likely alive when it was minted he was a retired Indian army officer aged 93 in the early 60's so he would have been born in the 1870's An interesting fact is that the man I bought that coin off was most likely alive when it was minted he was a retired Indian army officer aged 93 in the early 60's so he would have been born in the 1870's interesting one.....most of the coins you share is connected to a history! Thanks for the excellent info. But recently I came across a William rupees sold on a very famous/known house in India, which has a perfect rim on the reverse/brockage side. Surprising sold for whooping 1.1Lakhs. I am not an expert on the type, nor on mint errors. But have you noted that there is another impression on the shoulder of Victoria on the incuse side ? There you can see faint signs of the top of her crown upside-down. I did notice the inverted bust on the brockage side as well. Looks like the pressure came down twice, at different orientations. I was trying to think of the mechanics of how this could occur... You can also barely make out the double lettering around the edge as well, with some imagination. Unfortunately, I don't have this coin, but have seen several of these pop up recently. I have one specimen, but not at hand. The weight of my specimen and this coin is good (~11.66 grams). The edge of my coin looks like the edge of a normal coin, without the flow/extrusion on the brockage side that Vic showed. I think it may be just that the pressure is not high enough to make the metal flow out. Or, possibly, just a very good fake?!

What Is Cloud Technology What Is Cloud Technology One of the commonly used terms today is cloud technology or applications and programs that run in the cloud? If you have doubts about how this technology works, what it is used for and what are the advantages of using it, in this post, you will find a mini-guide on this new trend in Informatics, which is called to change the software paradigms that we know nowadays. Until a few years ago, cloud computing was seen as a trend. The bet was that no one else would need to install any program on their computer to perform basic tasks (like tinkering with worksheets) to more complex jobs (see editing images and videos) because everything would be done over the internet. In this article, you will learn more about the basics what is cloud technology and computing. And also check out the current landscape of this technology as you can find more and more services that work from an internet connection. Cloud Technology The definition of cloud technology is extremely simple. This is a new trend of software, in which all services provided to the computer are done directly from the Internet, therefore, you will no longer have to install a huge amount of files on the computer, since the program you want Use, it will run directly from the server of the software provider, lightening our hard drives. The only drawback of this technology is that we will necessarily have to have an Internet connection to access it. We can say that it is a technology oriented to the use of small and portable computers (using online services), which simplifies the installation of software and optimises the use of hard disk space, not having to fill it with huge Amounts of supplementary files. How does it work? When talking about cloud computing, there is a talk of accessing files and performing different tasks over the internet. That is, you do not need to install applications on your computer for everything because you can access different online services to do what you need since the data is not on a specific computer but on a network. Once properly connected to the online service, you can enjoy your tools and save all the work that is done to access it after all – that’s why your computer will be in the clouds because you can access the applications from of any computer that has access to the internet. Just think that from an internet connection, you can access a server capable of running the desired application, which can be from a word processor to even a game or a heavy video editor. While servers run a program or access certain information, your computer only needs the monitor and peripherals for you to interact with. Its operation is simple; we just need to install a small application on our PC: A client of the software that we want to use. Each time we run this client, it will be connected through the Internet connection with the server that contains the software that we are using, becoming a kind of client-server program, where we will send information to the server to execute our task. It is a similar operation to the terminal machines of a network. Of course, this represents a huge advantage for the end user, as it gains space on their disks and mobility. The only drawback is that all the work will be done in a central computer, which will otherwise leave our files registered and present problems, we will not have the opportunity to work until said inconvenience is solved. Types of cloud There are basically three types of cloud applications: Public clouds, of global use. Private clouds, which are oriented to corporate solutions. Hybrid clouds, which are a mixture of previous clouds. Among advantages and disadvantages As you can see, the advantages provided by cloud computing are many. One of them – perhaps the most shocking for most people – is the need to have a powerful machine, since everything runs on remote servers. Another benefit is the ability to access data, files and applications from anywhere, just by having an internet connection to it – that is, it is not necessary to keep important content on a single computer. However, not everything is flowers. Cloud storage also creates mistrust, especially when it comes to security. After all, the proposal is to keep important information in a virtual environment, and not all people are comfortable with it. It should also be noted that since there is a need to access remote servers, it is essential that the internet connection is stable and fast, especially when it comes to streaming and games. And one must also take into account that the servers are in distant places, therefore, an unstable or low-speed internet is detrimental to the full exploitation of the technology. But there is no doubt that cloud computing is an increasingly solid reality. In recent years, big companies have paid close attention to this technology, and everything makes us believe that this will continue. Cloud technology today Today, software that works with cloud technology is becoming more and more popular. Among the major programs of this type, we have Panda Cloud antivirus, online office applications and file storage programs, such as Flickr. The tendency to use this technology is increasing and it is possible that in the future the software developers create only this type of programs.

Paul Glen McDonald, Jr. v. The State of Texas IN THE TENTH COURT OF APPEALS No. 10-97-158-CR      PAUL GLEN MCDONALD, JR.,                                                                               Appellant      v.      THE STATE OF TEXAS,                                                                               Appellee   From the County Court at Law Coryell County, Texas Trial Court # 96-42629                                                                                                                   MEMORANDUM OPINION                                                                                                                         Paul Glen McDonald, Jr. was convicted of driving while intoxicated and sentenced to 45 days in jail plus a $2,500 fine. He appeals pro-se. Although we have requested the statement of facts, he has neglected to see that we receive it. Because we have determined that the statement of facts is not dispositive of any appealed error, we assume the facts of the trial to be as he states them in his brief, and we address his argument accordingly. The crux of McDonald’s complaint is that the trial court erred in admitting the results from his toxicology report because he requested counsel before submitting a breath sample. We will affirm.       At the time that Officer David Roberts requested a breath sample from McDonald, he had no right to counsel. See Kirby v. Illinois, 406 U.S. 682, 92 S.Ct. 1877, 32 L.Ed.2d 411 (1972); Forte v. State, 707 S.W.2d 89, 91 (Tex. Crim. App. 1986). The right to counsel under the Sixth Amendment attaches only upon or after formal initiation of judicial proceedings. Forte, 707 S.W.2d at 91. His Sixth Amendment right to counsel did not attach until the complaint and information were filed. Id. at 92.       A defendant, when faced with a decision whether to provide a breath or blood sample for chemical analysis of alcohol concentration, may not avoid making a decision by invoking the protection of the Fifth Amendment privilege against self-incrimination or the prophylactic safeguards of Miranda. See South Dakota v. Neville, 459 U.S. 553, 564, n. 15, 103 S.Ct. 916, 923, n. 15, 74 L.Ed.2d 748 (1983).         In Schmerber v. California, a blood sample was extracted from a defendant by a physician without the defendant's consent. The defendant claimed that his Fifth Amendment privilege against self-incrimination was violated. The Court held that neither the extraction of blood nor the subsequent chemical analysis of the blood for alcohol concentration required appellant to testimonially incriminate himself in violation of the Fifth Amendment. Schmerber v. California, 384 U.S. 757, 765, 86 S.Ct. 1826, 1833, 16 L.Ed.2d 908 (1966).       The Court of Criminal Appeals has followed Schmerber with regard to the collection of a breath sample, holding that providing a breath sample for chemical analysis of alcohol concentration is not a testimonial communication protected by the privilege against self-incrimination under the Fifth Amendment. Rodriguez v. State, 631 S.W.2d 515, 517 (Tex. Crim. App. 1982). The Court further held that police officers are not required to give a suspect Miranda warnings prior to asking him to provide a breath sample. Id.       We find no denial of appellant's Fifth or Sixth Amendment right to counsel. The judgment is affirmed.                                                                                    BILL VANCE                                                                                Justice     Before Chief Justice Davis,       Justice Cummings, and       Justice Vance Affirmed Opinion delivered and filed January 21, 1998 Do not publish                     

Alfred Séguin François-Léo Séguin called Alfred Séguin (22 November 1825, Baignes-Sainte-Radegonde – circa 1900) was a 19th-century French novelist and playwright. A tax civil servant, his plays were presented, inter alia, at the Théâtre des Délassements-Comiques and the . Works 1860: À bon chat, bon rat !, vaudeville-opéretta in 1 act 1862: Rondes et rondeaux chantés... dans les Folies de Montmartre, Dubois and E. Vert 1865: Le Jour de l'an, one-act comédie en vaudevilles 1865 Paul et Virginie dans une mansarde, one-act comédie en vaudevilles, with Jean Pierre Charles Perrot de Renneville 1867: Les Hommes en grève, new vaudeville in 4 acts, with Édouard Hermil 1871: Paris ne mourra pas !, P.-M. Cadoret 1875: Bengali, ou les Fils du paria followed by À vol d'oiseau, Didier 1876: La Petite Franchette, ou Tout est bien qui finit bien, one-act comédie en vaudevilles 1877: Le Robinson noir, P. Ducrocq 1877: Le Talisman de Marguerite, Didier 1877: Théâtre de jeunes gens, T. Olmer 1879: Le Courrier persan, J. Bonhoure 1879: Les Finesses de Pierrette, one-act comedy 1887: Si j'étais grand !, A. Picard et Kaan 1891: Les Infortunes de Simonne, A. Picard et Kaan 1894: Les Petits coureurs des bois, A. Picard et Kaan 1897: Lise, Lisette et Lison, A. Picard et Kaan 1897: Les Promesses de Mlle Augustine, A. Picard et Kaan External links Alfred Seguin on Data.bnf.fr Le Robinson noir on Gallica Category:People from Charente Category:19th-century French dramatists and playwrights Category:19th-century French novelists Category:1825 births Category:1900s deaths

Johann Georg Reißmüller Johann Georg Reißmüller (20 February 1932 – 10 December 2018) was a German journalist, a co-publisher of the Frankfurter Allgemeine Zeitung (FAZ). He was a correspondent in Belgrade, then the capital of Yugoslavia, from 1967 to 1971. When the country broke up, he was instrumental in Germany recognizing Croatia and Slovenia. Career Born in Leitmeritz, Reißmüller grew up in Bohemia. He took singing lessons as a child. He had to leave after World War II in the 1946 Expulsion of Germans from Czechoslovakia, and was deported to Vorpommern. His father was arrested in 1950, and Reißmüller escaped to West Berlin. Reißmüller studied law at the University of Tübingen where he obtained his J.D. in 1958, under Günter Dürig, with a dissertation about the limits of the common right to freedom (Schranken des allgemeinen Freiheitsrechts). From 1957 to 1961 Reißmüller worked for the JuristenZeitung (JZ) in Tübingen. He joined the FAZ on 1 April 1961, writing for the political editorial department. He was a reporter in Belgrade from 1967 to 1971, then the capital of Yugoslavia. His topics were communism in Eastern Europe, socialism in Yugoslavia and the churches there. In 1974, he became one of five publishers (Herausgeber) of the FAZ. Reißmüller supported in his articles, almost 130 between 1990 and 1992, the recognition of Croatia and Slovenia, and was credited with his influence on politics when their independence was recognised on 15 January 1992. In 1995, he received an honorary doctorate from the University of Zagreb which was the only award he accepted. Reißmüller retired from the FAZ on 1 March 1999. He performed songs from the early German Democratic Republic at the farewell celebration, accompanied by the journalist and musicologist . Several songs were published as a CD by , Uns gefällt diese Welt – Lieder der frühen DDR. Reißmüller died on 10 December 2018 in Frankfurt am Main. Work Music Johann Georg Reißmüller: Uns gefällt diese Welt – Lieder der frühen DDR. 55 min CD, Biton 4007 bei Zweitausendeins, Frankfurt/M. 2000. Literature Fritz Behrendt (author), Johann Georg Reißmüller (preface): Eine Feder für die Freiheit: Zeichnungen und Karikaturen 1950–2000. Deutsche Verlags-Anstalt DVA, 2000, . Books Johann Georg Reißmüller: Jugoslawien. Vielvölkerstaat zwischen Ost und West. Diederichs Verlag, Düsseldorf 1971, . Johann Georg Reißmüller (ed.): 111 Zeitgenossen. 1st edition. Societäts-Verlag, Frankfurt 1977. Johann Georg Reißmüller: Die vergessene Hälfte. Osteuropa und wir. Langen Müller-Verlag, 1986, . Der Krieg vor unserer Haustür. Hintergründe der historischen Tragödie. Deutsche Verlags Anstalt, Stuttgart 1991, . Die bosnische Tragödie. Deutsche Verlags Anstalt, Stuttgart 1993, . Johann Georg Reißmüller (ed.): Dazu möchte ich bemerken--: Leserbriefe in der Frankfurter Allgemeinen Zeitung aus 50 Jahren. Keyser, 1999. Essay Johann Georg Reissmüller: Das Monopol des Bundesverfassungsgerichts aus Art. 18 des Grundgesetzes. Juristenzeitung 1960, pp. 529ff References External links Category:1932 births Category:2018 deaths Category:People from Litoměřice Category:Sudeten German people Category:German journalists Category:German publishers (people) Category:Frankfurter Allgemeine Zeitung people

My Home Ideas Special Offers Be the first to know about This Old House contests, sweepstakes, and events and receive special offers and promotions from your favorite home improvement brands. We'll even send you regular reminders to enter our sweepstakes. If this is your first visit, be sure to check out the FAQ by clicking the link above. You may have to register before you can post: click the register link above to proceed. To start viewing messages, select the forum that you want to visit from the selection below. Choice of heated floor, new windows, or new furnace? Help!! Our 10ft.X 11 ft. dining area is an addition, built over a crawl space, with two exterior walls (facing SE and SW) that are mostly window. This room is always cold in winter, and I feel like it is more from cold air than from a cold floor. The crawl space has some heat supply, and the exterior walls of the crawl space are insulated on the outside with styrofoam. The ceiling of this dining area and the 6 inch exterior walls (that are not window) are packed with batt insulation. However the windows are 5 feet tall and almost 21 feet linear width (double-paned sealed, 24 years old if that matters). There are 4 heat registers (2 for each ext. wall) and the area is wide open to the rest of the house. We have had several furnace people out to look at why the space is so cold in winter... they have all agreed that the 4 heat registers should be sufficient, and that the furnace (5 years old) is powerful enough etc. So I believe the problem is either from the expanse of windows or having a crawl space rather than full basement underneath. We are now planning to replace the flooring material and would like to fix the heating problem first. We would greatly appreciate advice on where to put our money: 1. should we put in radiant electric floor mats (still keeping the 4 heat registers) or would that mean only the floor would be warmer and the temperature while sitting around the table will still be unpleasant? 2. should we instead replace the windows with triple glazing or whatever is the newest window technology? 3. or should we replace the furnace with a high efficiency one that might blow hotter air into the room? (ps it seems that by the time the air gets to the heat registers in this area, it has already cooled off quite a bit even when we close off the heat in rooms closer to the furnace)(and the basement gets almost unbearably hot from heat radiating through the ductwork nearest the furnace, but ducts are practically cold as they get to the farthest rooms...but furnace people say there is no problem with the design) I suppose all 3 would be the best but we cannot afford to do more than one... and since the floor is being changed, now is the time if radiant heat is the best solution. Re: Choice of heated floor, new windows, or new furnace? Help!! i don't think that radiant floor heating is the solution to your problem. ideally, it would be nice to have closed cell foam insulation installed betewen the floor joists, a backup option would be fiberglass batt insulation. then work on the windows. the difference between windows manufactured 24 years ago and today is vastly different regarding R value. if money is a big deciding factor, which it usually is, i would do fiberglass batts in the floor and get some new "good" windows. then maybe in a year or two you could afford to add in the closed cell insulation in the floor joists. Re: Choice of heated floor, new windows, or new furnace? Help!! What MLB said! I would also wonder about all that glass in one room---if the room is only 10 x 11 that"s 110 sq ft.; except for the amount of glass & the weak heating registers, if the room has insulation like you say, it should be easy to heat this relatively small room; as part of a rudimentary HEAT LOSS CALCULATION you have to multiply the L X W of each window to get the total square footage of all the glass in the room---a lot of heat is going to go right through the glass to the great outdoors on a cold day; the only other factors you haven't mentioned so far are the height of the ceiling (standard is 8') and whether you live in a bitterly cold part of the US or Canada. I also wonder about the heat output from your forced hot air registers---it sounds like all the heat is being left in the cellar because the main cellar ducts are not insulated & only lukewarm air is getting to the room; the supply/return ducts in the room sound like they also need adjusting/modification---I would call another heating tech & see if he can get a lot more heat coming out of the room registers than what you have now----this should cost a small amount & deliver more heat to the room. There is also the option of creating a SEPARATE ZONE for the living room heating supply/return registers with the LR having its own thermostat, so that you can control the amount of heat coming into the room, apart from the heat going to the rest of the house; ;if you DO succeed in zoning off the living room for the coming winter , & set the living room T-stat at say 72, you will find out very quickly how long the room heated air will satisfy the T-stat before the furnace has to come on again to replenish the LR warm air---if the T-stat is constantly calling for heat, then the window glass is no doubt the culprit. If it gets to the point where you have to have the glass replaced with glass that will better hold the heat (better R value), also consider reducing the size of each window in the process, which will also save on heat. The heating industry uses heat loss calculations (below, rudimentary) to determine how many BTUs (British Thermal Units) of heat per hour it takes to heat up a given room, & how long it takes for the heat to dissipate to the outdoors (depending on outside temp) thru the walls, floor, windows, etc.; warm room air always seeks to escape & move out of the room toward cold air; assuming there is enough warm air being produced by the warm air furnace registers, this warm air will attempt to escape thru the easiest exits---the window glass, any exterior doors, air leaks around windows & doors, a fireplace, uninsulated walls, floor, ceilings, etc.---if there are NO windows (impractical) or doors, uninsulated walls, or fireplaces, any heat introduced into the room will last for many hours. The basic concept: Is the amount of hot air being produced by the hot air registers sufficient to heat the room; and how long will the room hold the amount of heat produced by the hot air registers so the room feels comfortable----if the warm air being introduced is sufficient, but this warm air very quickly exits the room due to inadequate R factor (heat-holding ability) of the components (walls, doors, windows, etc.), the room is wasting heat & will feel cold. You would need a heating pro using a sophisticated HLC to determine how much heat output in BTUs/hr is being produced by the hot air registers, & is it enough to meet the heat loss in BTUs/hr of the heated air going thru the windows, floor, walls, etc., which could be 8,000 to 10,000 BTUs/hour; if, for example, the calculated heat loss for the room is 8,000 BTUs/hr, the hot air registers have to be introducing that many BTUs/hr of hot air to keep the room comfortable. You should be getting SOME radiant heat from the sun thru the SW windows during daytime hours, which should help during those hours; there are insulating-type quilt window treatments that can prevent a lot of heat loss during the overnight hours. Re: Choice of heated floor, new windows, or new furnace? Help!! To MLB and von_steuben - Neither my husband nor I are handy at all, so we really appreciate your help! And I don't know how to send individual replies to you so hope you read these. Yes we are in Canada, so it is pretty cold. Our ceilings are standard, flat 8 feet high. And for some reason we thought the floor joists under the eating area should NOT be insulated, but instead the crawl space has the styrofoam outside, and I think there were some batts placed on top of the dirt of the crawlspace and then vapor barrier on top of them (I could be wrong but remember something about that). So the crawl space is a bit heated from openings to the fully heated basement, as well as from 'leaks' as heat escapes from the furnace ducts feeding the eating area. So it will be our first priority to put in Closed Cell Foam Insulation between the joists. Will we have to remove the vapor barrier or the batts sitting on the crawl space floor? (which is about 2-3 feet below joists)? I don't want to have a moisture problem down there... We love the large windows so shrinking them is not an option. However getting new ones will be second priority. I believe your advice will have saved us almost $2000 that the heated floor system was going to cost and now we can put that money towards insulating the floor and installing better windows that hopefully WILL do the trick. Thank you so much. This is such a great forum Re: Choice of heated floor, new windows, or new furnace? Help!! I forgot to mention something important - there are some plumbing lines in the crawlspace, so maybe that's why the insulation was put on the crawlspace floor and the floor joists were not insulated? Will that make a difference for using Closed Cell Foam Insulation? Re: Choice of heated floor, new windows, or new furnace? Help!! Thanks again MLB - so if the plumbing pipes have foam insulation all around them, then will that keep them from freezing even if the crawlspace isn't warm anymore? Or should we keep the heat ducts unfoamed so they can still emit some heat in the crawlspace as they pass through to the heat registers above, and therefore keep the crawlspace and foamed-up pipes from freezing? I may not understand correctly but am worried if all the joists and the "ceiling" and walls of the crawlspace are foamed, as well as all the pipes and ducts, then the crawlspace itself will be colder than it already is cause almost no heat will transfer into it except from the little access door from the basement to the crawlspace. And then in winter the pipes in that crawlspace might explode...? or maybe i am misunderstanding.... Re: Choice of heated floor, new windows, or new furnace? Help!! if all the pipes, ductwork, between the floor joists, etc are properly insulated you shouldn't have a problem. you don't want any hot air duct to be un-insulated. if it is un-insulated then you are not sending warm enough air into the room above. the cold duct work will cool the air on it's way to the room and will not come out as hot as it should be. a good insulation person will be able to wrap everything properly, water pipe and heat ducts, so that there won't be any concern about something freezing. Re: Choice of heated floor, new windows, or new furnace? Help!! Re: Choice of heated floor, new windows, or new furnace? Help!! I'm going to take a slightly different attack than the other responses. Have you actually had a thermometer in your dining space to see if it actually is cold? It wouldn't surprise me if you feel cold because of heat loss through the glass and small downdrafts off the glass (and even the movement of warm air from the heat registers can cool you off). To give you an example, I'm cold at work, even in summer, and despite our little portable office thermometer being 72/73 the drafts and large single-pane window make it feel cold most of the time. In other words, you are actually feeling cold rather than being cold. If that's the case, you might be better off replacing the windows or putting some form of radiant heat in (either in the floor at the perimeter or beneath the windows, ugly as that would be) to counteract the feel of being cold. Triple glazing would really help (I've even seen quadruple glazing in Sweden [they've been double glazing since 1600+/- due to wood shortages], it's supposed to eliminate cold drafts off the face of the glass) you in the comfort department. All that said, insulating the ducts in the crawl space wouldn't hurt as long as it doesn't cool it off enough to freeze the pipes, since windows are a big cost and disruptive. Another option might be simply more insulation on the walls of the crawlspace (I assume your basement is heated) to keep that space warmer and give you a warmer floor.

--- abstract: 'Collimated supersonic flows in laboratory experiments behave in a similar manner to astrophysical jets provided that radiation, viscosity, and thermal conductivity are unimportant in the laboratory jets, and that the experimental and astrophysical jets share similar dimensionless parameters such as the Mach number and the ratio of the density between the jet and the ambient medium. When these conditions apply, laboratory jets provide a means to study their astrophysical counterparts for a variety of initial conditions, arbitrary viewing angles, and different times, attributes especially helpful for interpreting astronomical images where the viewing angle and initial conditions are fixed and the time domain is limited. Experiments are also a powerful way to test numerical fluid codes in a parameter range where the codes must perform well. In this paper we combine images from a series of laboratory experiments of deflected supersonic jets with numerical simulations and new spectral observations of an astrophysical example, the young stellar jet HH 110. The experiments provide key insights into how deflected jets evolve in 3-D, particularly within working surfaces where multiple subsonic shells and filaments form, and along the interface where shocked jet material penetrates into and destroys the obstacle along its path. The experiments also underscore the importance of the viewing angle in determining what an observer will see. The simulations match the experiments so well that we can use the simulated velocity maps to compare the dynamics in the experiment with those implied by the astronomical spectra. The experiments support a model where the observed shock structures in HH 110 form as a result of a pulsed driving source rather than from weak shocks that may arise in the supersonic shear layer between the Mach disk and bow shock of the jet’s working surface.' author: - 'P. Hartigan , J. M. Foster B. H. Wilde R. F. Coker P. A. Rosen J. F. Hansen B. E. Blue R. J. R. Williams R. Carver A. Frank' title: 'Laboratory Experiments, Numerical Simulations, and Astronomical Observations of Deflected Supersonic Jets: Application to HH 110' --- Introduction ============ Collimated supersonic jets originate from a variety of astronomical sources, including active galactic nuclei [@agnref], several kinds of interacting binaries [@binaryjetref], young stars [@ysojetref], and even planetary nebulae [@pnjetref]. Most current jet research focuses on how accretion disks accelerate and collimate jets, or on understanding the dynamics of the jet as it generates shocks along its beam and in the surrounding medium. Both areas of research have broad implications for astrophysics. Models of accretion disks typically employ magnetized jets to remove the angular momentum of the accreting material. The distribution and transport of the angular momentum in an accretion disk affects its mass accretion rate, mixing, temperature profile, and density structure, and in the case of young stars, also helps to define the characteristics of the protoplanetary disk that remains after accretion ceases. At larger distances from the source, shock waves in jets clear material from the surrounding medium, provide insights into the nature of density and velocity perturbations in the flow, and enable dynamical studies of mixing, turbulence and shear. Jets from young stars are particularly good testbeds for investigating all aspects of the physics within collimated supersonic flows [see @ray07 for a review]. Shock velocities within stellar jets are low enough that the gas cools by radiating emission lines rather than by expanding. Relative fluxes of the emission lines determine the density, temperature, and ionization of the postshock gas, while the observed Doppler shifts and emission line profiles define the radial velocities and nonthermal motions within the jet [see @hartigan08 for a review]. Moreover, many stellar jets are located relatively close to the Earth, so that one can observe proper motions in the plane of the sky from observations separated by several years [@heathcote92]. Combining this information with radial velocity measurements gives the orientation of the flow to the line of sight. Using the Hubble Space Telescope, one can observe morphological changes of knots within jets, and follow how these changes evolve in real time [@hartigan01]. Results from these studies show that internal shock waves, driven by velocity variations in the flow, sweep material in jets into a series of dense knots. Typical internal shock velocities are $\sim$ 40 km$\,$s$^{-1}$, or $\sim$ 20% of the flow speed. In several cases it is easy to identify both the bow shock and the Mach disk from emission line images. Because stellar jets are mostly neutral, strong H$\alpha$ emission occurs at the shock front where neutral H is collisionally excited [@heathcote96]. Forbidden line radiation occurs in a spatially-extended cooling zone in the postshock material. Temperatures immediately behind the internal shocks can exceed $10^5$K, but the gas in the forbidden-line-emitting cooling zone is typically 8000 K. Young stars show a strong correlation between accretion and outflow, leading to the idea that accretion disks power the outflows [@heg95; @cabrit07]. Most current models use magnetic fields in the disk to launch a fraction of the accreting material from the disk into a collimated magnetized jet [@ferreira06]. Stellar jets often precess, and there is some evidence that they rotate [@ray07], although rotation signatures are difficult to measure because the rotational velocities are typically only a few percent of the flow speeds and precession can mimic rotational signatures [@cerquieriaref]. In all cases proper motion measurements show that jets move radially away from the source. Jets show no dynamical evidence for kink instabilities, and in fact while magnetic fields may dominate in the acceleration regions of jets, they appear to play a minor role in the dynamics at the distances where most jet knots are observed [@hartigan07]. In the cooling zones behind the shock waves the plasma $\beta$ can drop below unity, so that magnetic fields dominate thermal pressure in those areas. However, the magnetic pressure is small compared with the ram pressure of the jet. While more unusual than internal working surfaces produced by velocity perturbations, shocks also occur when jets collide with dense obstacles such as a molecular cloud. When the obstacle is smaller than the jet radius, it becomes entrained by the jet, and a reverse bow shock or ‘cloudlet shock’ forms around the obstacle [@schwartz78; @l1551]. Alternatively, when a large obstacle like a molecular cloud deflects the jet, a quasi-stationary deflection shock at the impact point forms, followed by a spray of shocked jet material downstream. The classic example of such a jet is HH 110 [@riera03; @lopez05]. Though the observations summarized above provide a great deal of information about stellar jets, several important questions remain unanswered. The basic mechanism by which disks load material onto field lines (assuming the MHD disk scenario is correct), and the overall geometry of this wind is unknown, and the roles of reconnection and ambipolar diffusion in heating the jet close to the star are unclear. At larger distances, the magnetic geometry and its importance in shaping the internal working surfaces is poorly-constrained, as are the time scales and spatial scales associated with mixing in supersonic shear layers and working surfaces. The inherently clumpy nature of jets also affects the flow dynamics and observed properties of jets in uncertain ways, and the degree to which fragmentation and turbulence influence the morphologies of jets is unknown. Developing laboratory analogs of stellar jets could help significantly in addressing the questions above. Observations of a specific astronomical jet are restricted to a small range of times and to a particular observing angle, while laboratory experiments have no such restrictions. In principle, one could explore a wide range of initial collimations, velocity and density structures within the jet, as well as densities, geometries, and magnetic field configurations with laboratory experiments. The experiments also provide a powerful and flexible way to test 3-D numerical fluid codes, and to investigate how real flows develop complex morphologies in 3-D. The challenge is to design an experiment that is relevant to the astrophysical case of interest. Laboratory experiments differ by 15 $-$ 20 orders of magnitude in size, density and timescale from stellar jets, but because the Euler equations that govern fluid dynamics involve only three variables, time, density, and velocity, the behavior of the fluid is determined primarily by dimensionless numbers such as the Mach number (supersonic or subsonic), Reynolds number (viscous or inertial), and Peclet number (importance of thermal conduction). If the experiments behave as a fluid and have similar dimensionless fluid numbers as those of stellar jets, then the experiments should scale well to the astrophysical case [@ryutov99]. Other parameters, such as magnetic fields and radiational cooling are more difficult to match, and it is impossible to study the non-LTE excitation physics in the lab because the critical density for collisional deexcitation is not scalable. In any case, the materials are markedly different between the experiments and stellar jets, so it is not possible to study emission line ratios in any meaningful way with current laboratory capabilities. Hence, at present the main utility of laboratory experiments of jets is to clarify how complex supersonic flows evolve with time. Laboratory work relevant to stellar jets is an emerging area of research, and several papers have appeared recently which address various aspects of supersonic flows in the appropriate regime [see @remington06 for a review]. @hansen07 observed how a strong planar shock wave disrupts a spherical obstacle and tested numerical models of the process, and @loupias generated a laboratory jet with a Mach number similar to that of a stellar jet. In a different approach, @lebedev04 and @ampleford07 used a conical array of wires at the Magpie facility to drive a magnetized jet, and explored the geometry of the deflection shock formed as a jet impacts a crosswind. Laboratory experiments have also recently studied the physics associated with instabilities along supernova blast waves [@snrref; @drake09], and the dynamics within supernovae explosions [@snrcoreref]. In this paper we present the results of a suite of experiments which deflect a supersonic jet from a spherical obstacle, where the dimensionless fluid parameters are similar to those present in stellar jets. In section 2, we describe our experimental design, consider how the experiments scale to astrophysical jets, demonstrate that the experiments are reproducible, and report how the observed flows change as one varies several parameters, including the distance between the axis of the jet and the obstacle, the time delay, the density probed with different backlighters, and the viewing angle. The numerical work is summarized in section 3. Detailed calculations with the 3-D RAGE code reproduce all of the major observed morphologies well. In section 4, we present new high-resolution optical spectra of the shocked wake of the HH 110 protostellar jet, and a new wide-field H$_2$ image of the region. These observations quantify how the internal dynamics of the gas behave as material flows away from the deflection shock and show how the jet entrains material from the molecular cloud core. Finally, in section 5 we consider how the experiments and the simulations from RAGE provide new insights into the internal dynamics of deflected supersonic jets, especially in the regions of the working surface and at the interface where jet material entrains and accelerates the obstacle. Laser Experiments of Deflected Supersonic Jets ============================================== Experimental Design ------------------- Figure 1 shows the experimental assembly we used to collide a supersonic jet into a spherical obstacle. The design consists of a 125 $\mu$m thickness titanium disk in direct contact with a 700 $\mu$m thickness titanium washer with a central, 300 $\mu$m diameter hole. The surface of the disk is heated by the thermal (soft x-ray) radiation from a hohlraum laser target, which itself is heated by 12 beams of the Omega laser at the University of Rochester [@soures96]. X-ray driven ablation of the surface of the disk creates a near-planar shock within the disk and washer assembly, and the subsequent breakout of this shock from the inner surface of the disk results in the directed outflow of a plug of dense, shock-heated titanium plasma through the cylindrical hole in the washer. This outflow is further collimated by the hole in the washer, and directed into an adjacent block of low-density (0.1 g$\,$cm$^{-3}$) polymer foam within which it propagates to a distance of $\sim$ 2 mm in $\sim$ 200 ns. After the primary jet forms, the ablation-driven shock continues to progress through the titanium target assembly and along the sides of the hole in the washer. As the hole collapses inward a secondary jet of material forms by a process analogous to that occurring in a shaped-charge explosive. The secondary jet forms after the primary jet, and propagates into the high-pressure cocoon of material already within the polymer foam. At later times, the shock propagates from the surrounding titanium washer into the foam, and causes the interface between the titanium washer and the hydrocarbon foam to move. A bow shock runs ahead of the jets into the foam. Both jets form as a result of hydrodynamic phenomena alone; there is no significant magnetic field and associated magneto-hydrodynamics, and the temperature of the jet is sufficiently low for thermal-conduction and radiative energy losses to be insignificant. Hence, the hydrodynamic phenomena which determine how the jet forms and evolves are scalable (see Section 2.2) to jets of very different dimensions that evolve over very different timescales. The experimental assembly described above is identical in many respects to that used in experiments we have reported previously [@foster05], but with the following two significant differences [see @rosen06; @coker07 for further details]: (1) in the present case we use indirect (hohlraum) drive, instead of the direct laser drive used in our earlier work; and (2) the foam medium through which the jet propagates contains an obstacle (a ball of CH). The hohlraum drive enables us to obtain greater spatial uniformity of the ablation of the titanium surface, and thereby generates a jet of improved cylindrical symmetry. The (optional) addition of an obstacle in the foam along the path of the jet medium makes it possible to set up, and in a controlled manner test, how the flow behaves when the two-dimensional cylindrical symmetry is broken. A pinhole-apertured, laser-produced-plasma, x-ray backlighting source projects an image of the jet onto radiographic film for later, detailed analysis. Details of the experimental setup are as follows. A 1600 $\mu$m diameter, 1200 $\mu$m length (internal dimensions) cylindrical gold hohlraum target with a single 1200 $\mu$m diameter laser-entry hole [see also @foster02] generates the radiation drive. The experimental package mounts over an 800 $\mu$m diameter hole in the end wall of the hohlraum, immediately opposite the laser entry hole. This axisymmetric configuration enables us to model the assembly at high resolution using two-dimensional radiation hydrocodes during the stages of formation and early-time evolution of the jet; the later stages of three-dimensional hydrodynamics are modeled by linking to a three-dimensional hydrocode, albeit at lower spatial resolution. The hohlraum is heated by 12 beams of the Omega laser with a total energy of 6 kJ in a 1 ns duration, constant power laser pulse of 0.35 $\mu$m wavelength. The resulting peak radiation temperature in the hohlraum measured with a filtered x-ray diode diagnostic (Dante) is 190 $-$ 200 eV [@foster02]. The titanium experimental assembly is made of an alloy with 90% titanium, 6% aluminium, and 4% vanadium. The diamond-polished surfaces of the hole and the planar surfaces of the components each have a 0.05 $-$ 0.3 $\mu$m peak-valley, and 0.01 $-$ 0.03 $\mu$m RMS, surface finish. We place a 100 $\mu$m thickness, 500 $\mu$m diameter gold ‘cookie-cutter’ disk between the hohlraum and the titanium disk to control the area of the titanium disk illuminated by x-rays, and to control the time it takes shocks to propagate into the titanium washer. By this means we are able to adjust, to some extent, the relative importance to the overall hydrodynamics of the primary and secondary jets, and the late-time motion of the titanium/foam interface that surround both jets. The medium through which the jets propagate is a 4 mm diameter, 6 mm length cylinder of resorcinol-formaldehyde (C$_{15}$H$_{12}$O$_4$; hereafter RF) foam, of 0.1 g$\,$cm$^{-3}$ density. We used RF foam because it has a very small ($<$ 1 $\mu$m) pore size. The obstacle in the foam is a 1 mm diameter, solid polystyrene (1.03 g$\,$cm$^{-3}$ density) sphere, supported by a small-diameter, silicon-carbide-coated tungsten stalk. The axial position and radial offset (impact parameter) of the sphere within the monomer material is set (approximately) before polymerisation of the foam, but is determined accurately after polymerisation by inspecting each experimental assembly radiographically. Typically, the axial position of the center of the ball, relative to the titanium-to-foam interface is 800 $-$ 1000 $\mu$m, and the impact parameter (perpendicular distance from the axis of the jet to the centre of the ball) is in the range 300 $-$ 500 $\mu$m. We could determine these quantities with an accuracy of approximately $\pm$ 10 $\mu$m, by analyzing pre-shot radiographs of the experimental assembly. The process of target fabrication is to some extent non-repeatable, and necessitates a separate hydrocode simulation of each experimental shot once the target dimensions are known. A sequence of experimental shots, diagnosed at different times, thus measures the hydrodynamic behavior of several very similar (but not strictly identical) target assemblies. A thin-foil, transition-metal, laser target illuminated with 2 $-$ 5 beams of the Omega laser creates the x-ray point backlighting source we use to diagnose the hydrodynamics. Each beam provides 400 J of energy in a 1 ns duration laser pulse, focused into a 600 $\mu$m diameter spot (spot size determined by use of a random-phase plate). X-ray emission from this laser-produced plasma passes through a laser-machined pinhole of typically 10 $-$ 20 $\mu$m diameter in 50 $\mu$m thickness tantalum foil, and generates a backlighting source of size comparable to the pinhole aperture. He-like resonance-line radiation of the backlighter target material dominates the spectrum of this x-ray backlighting source, and the choice of backlighter targets of typically titanium, iron or zinc results in He-like resonance line radiation of, respectively, 4.75, 6.7 and 9.0 keV. Radiation from the point x-ray backlighting source creates a point-projection (shadow) image of the experimental assembly on Kodak DEF x-ray film, with approximately 10-times magnification. Temporal resolution is determined by the duration of the x-ray backlighting source (very nearly equal to the laser pulse length). Motion blurring is insignificant for the 1 ns duration backlighting source. The time delay between the laser beams heating the hohlraum target, and the laser beams incident on the x-ray backlighting target is varied from shot to shot to build up a sequence of x-ray images of the jet hydrodynamics. Scaling the Experiments to Stellar Jets --------------------------------------- The size scales, times, densities and pressures within the Omega experiments differ markedly from those present in stellar jets. For the laboratory results to be meaningful the fluid dynamical variables must scale well, and the experiment should resemble the overall density and velocity structures present in astrophysical jets. We can connect the fluid dynamics of the astrophysical and experimental cases through the Euler equations for a polytropic gas [e.g. @ll87] $$\label{eq:mass} {{\partial \rho}\over{\partial t}} + \nabla \cdot \left(\rho\bf{v}\right) = 0$$ $$\label{eq:momentum} \rho\left({{\partial\bf{v}}\over{\partial t}} + \bf{v}\cdot\bf{\nabla v} \right) + \nabla {\rm P} = 0$$ $$\label{eq:energy} {{\partial {\rm P}}\over{\partial t}} + \gamma {\rm P} \nabla \cdot \bf{v} + \bf{v} \cdot \nabla {\rm P} = 0,$$ where $\rho$ is the density, $\bf{v}$ is the velocity, and P is the gas pressure. @ryutov99 showed that these equations are invariant to the rescaling $$r^\prime = ar ;\ \ \ \rho^\prime = b\rho ;\ \ \ P^\prime = cP$$ where a, b, and c are constants, provided one also rescales the time as $$t^\prime = a\sqrt{{b\over c}}t.$$ With this scaling, the velocity transforms as $$V^\prime = \sqrt{{c\over b}}V.$$ Solutions to the Euler equations will be identical in a dimensionless sense provided equation 6 holds. Hence, to verify that the experiment scales to the astrophysical case we need to estimate the pressures, temperatures, and velocities in both the experiment and in the HH 110 system. The parameters in the jet differ from those in the working surface where the jet deflects from the obstacle, and from those in the working surface where the bow shock impacts the ambient medium, so we must consider these regions separately. The density and temperature vary throughout stellar jets as material encounters weak shocks, heats, and cools, so we are interested in order of magnitude estimates of these quantites for the scaling estimates. As the discussion below will show, the two working surfaces scale well in our experiment but the jet scales less well. Consider the parameters in the jet first. Unlike most other jets from young stars, the HH 270 jet that collides with the molecular cloud to produce HH 110 is rather ill-defined, and consists of several faint wisps that resemble weak bow shocks [@choi06]. The electron density and ionization fraction in this part of the flow is poorly-constrained by observations, but an electron density of $10^3$ cm$^{-3}$ is typical for faint shocked structures of this kind. Taking a typical ionization fraction of 10% we obtain a total density of $10^4$ cm$^{-3}$, or about $2\times 10^{-20}$ g$\,$cm$^{-3}$. These values refer to the material in the radiating bow shocks; densities (and temperatures) between the bow shocks are likely to be lower. The temperature where \[S II\] radiates in the HH 270 bow shocks will be $\sim$ 7000 K. Material in the jet is mostly H, so using the ideal gas law we obtain 1$\times 10^{-8}$ dyne$\,$cm$^{-2}$ for the pressure. As shown in Table 1, a $\sim$ $5\times 10^{16}$, b $\sim$ $2\times 10^{-20}$, and c $\sim$ $3\times 10^{-19}$. With this scaling, 200 ns in the laboratory experiments corresponds to $\sim$ 80 years for an HH flow. Bow shocks in HH objects typically move their own diameter in $\sim$ 20 years, so the agreement with the observed timescales of HH objects and the experiment is ideal. However, the jet velocity transforms less well, with 10 km$\,$s$^{-1}$ in the experiment scaling to $\sim$ 40 km$\,$s$^{-1}$ in the stellar jet, where the actual velocity is a factor of four higher. This difference arises in part because the stellar jet cools radiatively, lowering the pressure and therefore the value of c. Another way to look at the velocity scaling is to consider the Euler number V/V$_E$, where V$_E$ = (P/$\rho$)$^{0.5}$ is the sound speed for $\gamma$=1. The Euler number in the HH 270 jet is about 20, and for other stellar jets may range up to 40. In the experiment this number is only $\sim$ 6. The main effect of the difference in Euler numbers is that the experimental jet has a wider opening angle than the stellar jet does. However, both numbers are significantly larger than unity, so both jets are highly supersonic. As we discuss in section 2.3, collapse and subsequent rebound of the washer along the axis of the flow determines to a large extent how the experimental jet is shaped, and has no obvious astrophysical analog. For this reason we will focus our analysis primarily on the leading bow shock and on entrainment of material in the obstacle rather than on the collimation of the jet. The working surfaces are generally modeled well by the experiment. In these regions the critical parameters are the timescales, which match very well, the Mach numbers in the shocks, and the density contrasts between the jet and the material ahead of the working surface. In stellar jets, the velocity of the bow shock into the preshock medium (equivalently, the velocity of the preshock medium into the bow shock) is similar to that of the jet, $\sim$ 200 km$\,$s$^{-1}$, because the jet is much denser than the ambient medium. The sound speed in the ambient medium can range from 1 $-$ 10 km$\,$s$^{-1}$, depending on how much ambient ultraviolet light heats the preshock gas. So the Mach number of the leading bow shock can range from about 20 $-$ 200. In our experiments, the sound speed ahead of the bow shock is low ($\sim$ 0.03 km$\,$s$^{-1}$), so the Mach number of the leading bow shock in the experiments is also very large, $\sim$ 200. When a stellar jet encounters a stationary obstacle like a molecular cloud, the preshock sound speed is that of the molecular cloud, $\lesssim$ 1 km$\,$s$^{-1}$, so the Mach number of material entering the shock into the molecular cloud is $\gtrsim$ 200. The Mach number of this shock in the experiments depends on the impact parameter, but is typically $\gtrsim$ 100. The ratio $\eta$ of the density in the jet to that in the ambient medium to a large extent determines the morphology of the working surface that accelerates the ambient medium. Overdense jets with $\eta$ $>$ 1 act like bullets, and have strong bow shocks and weak Mach disks, while the opposite case of $\eta$ $<$ 1 produces jets that ‘splatter’ from strong Mach disks (sometimes called hot spots) and create large backflowing cocoons [@krause]. Stellar jets are overdense, with $\eta$ $\sim$ 10 while extragalactic jets are underdense with $\eta$ $\lesssim$ $10^{-3}$ [@krause]. In our experiments, $\eta$ ranges from 8 $-$ 1 between 50 ns and 200 ns, respectively, in good agreement with the overdense stellar jet case. For the obstacle, the molecular cloud density increases from at least an order of magnitude less than that of the jet in the periphery of the cloud (essentially the ambient medium density), to $\gtrsim$ 2 orders of magnitude larger than the jet at the center of the core. So the equal densities of the jet and obstacle in the experiment cover a relevant astrophysical regime. The main difference between the experimental and astrophysical cases is the uniform density of the experimental obstacle as compared with the $\sim$ r$^{-2}$ density falloff in an isothermal molecular cloud core. Internal shock waves are by far the most common kind of shock in a stellar jet. Here, velocity perturbations of 30 $-$ 60 km$\,$s$^{-1}$ produce forward and reverse shock waves within a jet as it flows outward from the source at 150 $-$ 300 km$\,$s$^{-1}$ [e.g. @hartigan01]. Gas behind these shock waves cools rapidly to $\sim$ 4000 K by emitting permitted and forbidden line radiation [e.g. @hrh87], and then more slowly thereafter. Typically the temperature falls to $\sim$ 2000 K before the gas encounters another shock front, so the sound speed of the preshock gas is $\sim$ 5 km$\,$s$^{-1}$. Hence, the internal Mach number is $\sim$ 10 for these shock waves. Unlike the astrophysical case, our experiments do not produce multiple velocity pulses, and so are less relevant to studying the internal shocks within the beams of stellar jets. However, when jets are deflected obliquely from an obstacle the velocities in the deflected flow can remain supersonic, and may form weaker shocks in the complex working surface area that lies between the leading bow shock and the deflection shock (Mach disk analog) within the jet. Our experiments are very useful for studying the dynamics of this region, and for investigating how a jet penetrates and accelerates an obstacle along its path. For scaling to hold, several additional conditions must apply. First, dissipation mechanisms such as viscosity and heat conduction must be negligible. Hence, the Reynolds number $Re \sim VL/(\nu_{mat}+\nu_{rad})$ and Peclet number $Pe \sim VL/\chi$, need to be much larger than unity, where $\nu_{mat}$ and $\nu_{rad}$ are kinematic viscosities for matter and radiation, respectively, and $\chi$ is the thermal diffusivity. Using expressions for $\nu_{mat}, \nu_{rad}$, and $\chi$ from @ryutov99 and @drake06, we find thermal conductivity and viscosity are unimportant for both the experimental and astrophysical cases (Table 1). The Euler equations above implicitly assume that the gas behaves as a polytrope. In reality, stellar jets cool by radiating emission lines from shock-heated regions, and so are neither adiabatic ($\gamma$ = 5/3) nor isothermal ($\gamma$ = 1). Existing numerical simulations provide some insight into how jet morphologies change between the limiting cases of adiabatic and isothermal. In the adiabatic case, material heated by strong shocks cools by expanding, so working surfaces of jets tend to have rounder and more extended bow shocks, while working surfaces collapse into a dense plug for strongly-cooling jets [e.g. @blondin90]. The effect is less pronounced for weaker oblique shocks like those we are studying here in the wakes of the deflected flows. However, cooling should affect the morphologies of the stronger shocks as described above. In order to use the Euler equations, the laboratory jet must act as a fluid. Hence, the material mean free path ($\lambda_{mat} \sim v_{th}/\nu_c$ where $v_{th} \sim \sqrt(k_BT/m)$ is the particle thermal velocity and $\nu_c$ is the sum of ion and electron collisional frequencies) of the electrons and ions must be short compared with the size of the system ($\tau_{mat} \sim L/\lambda_{mat} \gg 1$). Table 1 shows that this condition is easily satisfied in both stellar jets and the laboratory experiments. The Euler equations do not include the radiative energy flux, and so we must verify that this number is small compared with the hydrodynamical energy flux. When, as in our experiments, the minimum radiation mean free path $\lambda_{rad}$ from Thomson scattering or thermal bremsstrahlung is short compared to $L$ (i.e., $\tau_{rad} \sim L/\lambda_{rad} \gg 1$), the appropriate dimensionless parameter for determining the importance of radiation is the Boltzmann number Bo\# $\sim \rho U^3 / f_{rad}$, where $U$ is a velocity scale and $f_{rad}$ is the radiative flux. In the Omega experiments, Bo\# $>>$ 1, implying that the radiative energy flux is unimportant in the flow dynamics. Radiative fluxes are also negligible in optically thin astrophysical shocks like those in stellar jets. Even in the brightest jets the observed radiative luminosity is $\lesssim$ $10^{-3}$ of the energy of the bulk flow [@bbm81], so the observations and experiments are consistent with regard to radiative energy flux. Finally, stellar jets have magnetic fields while our experiments do not. Field strengths within stellar jets are difficult to measure, but could dominate the flow dynamics close to the acceleration region [i.e., V$_{Alfven}$ $<$ V$_{flow}$ @hartigan07]. At the larger distances of interest to these experiments, fields are weaker and act mainly to reduce compression in the postshock regions of radiatively-cooling flows [@morse92]. In summary, the experiments are good analogs of jets from young stars. The Mach numbers of the jet relative to the ambient medium and to the obstacle are high in both cases, the density contrasts between the jet and the obstacle are similar, and the scaled times match almost exactly. Both systems behave like fluids, and viscosity, thermal conduction, and radiative fluxes are unimportant to the dynamics in both cases. The main differences are that stellar jets cool radiatively and the experimental jets do not, stellar jets may have magnetic fields that are not present in the experimental jets, and the density profile within the experimental jet is unlikely to have an astrophysical analog. Results ------- The complete suite of our experimental radiographs are available on the web (http:$//$ sparky.rice.edu$/\sim$hartigan$/$LLE\_shots.html). Because our experiment generates only a single image for each shot, if we wish to investigate how the flow changes with time or compare experiments that have different offsets of the ball from the axis of the jet (we refer to this distance as the ‘impact parameter’ in what follows), we must first quantify the degree to which target fabrication affects the radiographs of the flow. To this end, we obtained several groups of laser shots that had identical backlighters and delay times. One such set appears in Fig. 2, where the overall morphology of the flow and position of the bow shock is reproduced well between the shots, but irregularities appear in the bow shock shape that are specific to each target. In the case of the Ti backlighter image the bow shock resolves into a collection of nearly cospatial shells. The level of difference between the two images at the left of Fig. 2 indicates a typical variation caused by target fabrication and alignment. We varied the backlighter type, exploring V, Fe, Zn, and Ni. Each backlighter has a different opacity through the material, making it possible to probe the different depths within the structure of the flow at any given time. For example, the Ti backlighter image in Fig. 2 has significantly less opacity than that of the V images. We also tested four different types of foam, normal RF, large-pore RF, TPX (poly-4-methyl-1-pentene), and DVB (divinylbenzene), and found that the neither the foam pore size nor the foam type had any effect on the results. Fig. 3 summarizes the results from our experiments. The time sequence at the top shows how the jet evolves in a uniform medium without an obstacle. As described in section 2.1, the experiment first accelerates a plug of Ti into the foam, followed by a secondary jet of Ti that originates primarily from the collapse of the washer. At 50 ns, the radiograph shows a flat-topped profile that defines the shape of the plug, and as the plug proceeds into the foam the leading shock becomes bow-shaped. Irregularities in the shape of the bow shock are similar in size and shape to those caused by variations in the manufacture of the target (Fig. 2). By 100 ns the secondary jet has also formed, but it does not become well-collimated until about 200 ns. At 150 ns the end of the jet has a flute-shape, with a less-dense interior (see also Fig. 5, below). This shape is not a particularly good analog for a stellar jet, so we place less emphasis on this area in our analysis. The second row in Fig. 3 illustrates the principal shock structures that form when the jet encounters a sperical obstacle (labeled ‘Ball’ in the Figure) along its path. In general we expect two shocks to form when a continuous supersonic jet impacts ambient material $-$ a forward bow shock that accelerates the ambient medium, and a reverse shock, sometimes called a Mach disk, that decelerates the jet. The area between the forward and reverse shocks is known as the working surface, and within the working surface there is a boundary known as the contact discontinuity which separates shocked jet material from shocked ambient (or shocked ball) material. The two forward bow shocks, one into the ball and the other from the deflected jet into the foam, are clearly visible in the radiographs. However, the Mach disks for these bow shocks are more difficult to see in Fig. 3. At 150 ns the Ti plug is the primary driver of the deflected bow shock, and the RAGE simulations discussed below show that the shocked plug is located near the head of the bow shock at this time (Fig. 4). Fig. 5 shows that a disk-shaped area of high temperature material exists in the shocked plug and at the end of the flute, and it is tempting to associate these areas of hot gas with the Mach disk. The situation is complicated by the fact that the plug jet is impulsive, so one would expect the Mach disk to disappear once material in the plug has passed through it, though the temperature will remain elevated in this area. The last two rows of images in Fig. 3 depict two sequences of radiographs taken at common times after the deposition of the laser pulse, but with impact parameters that increase from left to right. As expected, the jet burrows into the ball more when the impact parameter is smaller, and is deflected more when the impact parameter is larger. In all cases the forward bow shock into the ball is quite smooth, with no evidence for any fluid dynamical instabilities. In contrast, the contact discontinuity between the shocked jet and shocked ball material is highly structured. As we discuss further in section 5, the irregularity of the contact discontinuity plays a major role in breaking up the ball. Images obtained with the Zn backlighter are best for revealing the morphology of the secondary jet, which at late times appears to fragment into a complex filamentary structure in the region of the flute. The ability to observe a flow from an arbitrary viewing angle is an attractive feature of the laboratory experiments that is not available to astrophysicists who study stellar jets. Fig. 6 shows two pairs of identical laser shots, one with a 150 ns time delay the other with a 200 ns delay, where the viewing angle changed by 90 degrees within each pair. The outline of the ball is clearly visible through the deflected jet in the symmetrical view ($\theta$=0) at 150 ns. Discerning the true nature of the deflected flow is much more difficult in the symmetrical view, where the radiograph resembles a single, less-collimated bow shock. Numerical Simulations of the Laboratory Experiments =================================================== The design of these experiments and their post-shot analysis was done with the RAGE (Radiation Adaptive Grid Eulerian) simulation code. We have also adapted the astrophysical MHD code AstroBEAR to model laser experiments by including a laser drive and real equation of state for different materials, but we summarize the results of this work elsewhere [@carver09]. RAGE Simulations ---------------- RAGE is a multi-dimensional, multi-material Eulerian radiation-hydrodynamics code developed by Los Alamos National Laboratory and Science Applications International (SAIC) [@gittings08]. RAGE uses a continuous (in space and time) adaptive-mesh-refinement (CAMR) algorithm to follow interfaces and shocks, and gradients of physical quantities such as material densities and temperatures. At each cycle, the code automatically determines whether to subdivide or recombine Eulerian cells. The user also has the option to de-zone (that is, reduce the resolution of the mesh) as a function of time, space, and material. Adjacent square cells may differ by only one level of resolution, that is, by a factor of 2 in cell size. The code has several interface-steepening options and easily follows contact discontinuities with fine zoning at the material interfaces. This CAMR method speeds calculations by as much as two orders of magnitude over straight Eulerian methods. RAGE uses a second-order-accurate Godunov hydrodynamics scheme similar to the Eulerian scheme of @colella85. Mixed cells are assumed to be in pressure and temperature equilibrium, with separate material and radiation temperatures. The radiation-transfer equation is solved in the grey, flux-limited-diffusion approximation. Given the placement of the ball with respect to the symmetry axis of the undeflected jet, these experiments are inherently three-dimensional. However, before the jet impacts the ball, the hohlraum and the jet are two-dimensional. This allows us to perform highly resolved, two-dimensional simulations in cylindrically-symmetric geometry to best capture the ablation of the titanium, the acceleration of the titanium plug through the vacuum free-run region in the washer, the collapse of the titanium hole onto the symmetry axis, and the subsequent jet formation. The two-dimensional simulations are initialized by imposing the measured radiation-drive temperature in a region that is inside the hohlraum. To save computer time, we have determined that it is sufficient to eliminate the hohlraum and just use the measured temperature profile as the source of energy that creates the ablation pressure to drive the jet. Neglecting asymmetries that arise from initial perturbations and unintentional misalignment of the hohlraum with the vacuum free-run region (the hole in the washer), the early-time experimental data show that the jet remains cylindrically symmetric until at least 50 ns. At approximately this time we link the two-dimensional, cylindrically-symmetric simulation into three dimensions and add the 1 mm diameter ball at the different impact parameters. While the two-dimensional simulations are run with a resolution of 1.5 $\mu$m to capture the radiation ablation of the titanium correctly, the three-dimensional simulations are typically run at lower resolution, especially during the design of the experiments. Fig. 4 shows the model density, composition, and expected radiograph for a deflected jet at 200 ns. Material labeled as blue (Ti plug) comes from the Ti disk, while orange (Ti sleeve) originates in the Ti washer and constitutes most of the secondary jet. The flute-shape of the secondary jet is clear in this figure. The areas of greatest interest are the region where the jet is creating a cavity in the ball, because this shows how jets destroy obstacles and entrain material, and the region of filaments in the working surface of the leading bow shock, because these filaments could in principle propagate downstream as weak shocks like those seen in HH 110. The processes of jet formation and propagation are illustrated in Fig. 5, which show ‘snapshots’ of the temperature and density distribution within the jet taken from a RAGE hydrocode simulation (single choice of axial position and impact parameter for the polystyrene sphere) at different times. The primary (plug) and secondary (‘shaped-charge’ hole collapse) jets are identified in Fig. 5, as well as the late-time motion at the titanium-to-foam interface that results in the formation of an opaque pedestal-like feature at the base of the jet in the synthetic radiographs. All these features are clearly discernible in the experimental data. Fig. 7 shows post-processed, zinc-backlit (9 keV x-ray backlighter energy) radiographic images from two perpendicular views that represent the time evolution of the jet, and how it subsequently deflects from the ball, in the RAGE simulation. Data Analysis and Comparisons with RAGE Simulations --------------------------------------------------- The experimental data recording the jet hydrodynamics are in the form of radiographic images recorded on x-ray-sensitive film. Fig. 3 shows a composite of experimental radiographs from several laser shots, to illustrate the formation and deflection of the jets, in a series of shots where the position and impact parameter of the polystyrene sphere inevitably vary somewhat from shot to shot. We digitized the film data with a Perkin-Elmer PDS scanning microdensitometer and converted the film density to exposure using calibration data for the Kodak DEF film that recorded the images [@henke86]. Ideally, the pinhole-apertured x-ray backlighting source would provide spatially uniform illumination of the experimental assembly, although in practice this is not the case because of laser intensity variations at the backlighting target and vignetting resulting from the specific size and shape of the pinhole aperture. Regions of the image resulting from x-ray transmission through the undisturbed foam (that is, outside the jet-driven bow shock) provide a means to determine the uniformity of backlighting intensity, after we allow for the known x-ray attenuation resulting from the undisturbed foam. Starting from this measured intensity distribution we use a polynomial fitting procedure to infer the unattenuated backlighter intensity that underlies the image of the jet and bow shock. We divide the backlit image data by the inferred (unattenuated) backlighter intensity to obtain a map of x-ray transmission through the experiment. We compare this x-ray transmission data with post-processed hydrocode calculations that simulate the experimental radiographs. Because the absolute variation of backlighter intensity across the image is small (typically, 10 $-$ 20% across the entire image), the polynomial fitting procedure enables the absolute x-ray transmission to be inferred with second-order accuracy. We use three principal metrics for comparing the experimental radiographs with synthetic x-ray images obtained by post-processing of our hydrocode simulations. These are: (1) the large-scale hydrodynamic motion (determined by comparison of the positions of the bow shock in experiment and simulation); (2) the spatial distribution of mass of the titanium jet material (obtained from the spatial integral of optical depth throughout the image, or from sub-regions of the image); and (3) the small-scale structure in the deflected jet (quantified by the two-dimensional discrete Fourier transform of sub-regions of the image, and its corresponding power spectral density function of spatial frequency). In making comparison of the experimental with hydrocode simulation, two specific points of detail require attention: (i) each laser-target assembly has its own specific location of the polystyrene sphere within the polymer foam cylinder (because of target-to-target variations arising in fabrication), and (ii) the angular orientation of the polymer-foam cylinder attached to the laser-heated hohlraum target determines the x-ray backlighting line of sight, relative to the plane in which the polystyrene sphere is displaced from the axis of the jet. Ideally all laser targets would be identical, and all backlit images would be recorded orthogonal to the axis of the target, and either in the plane of radial displacement of the polystyrene sphere or orthogonal to that plane. The geometry of the target chamber of the Omega laser facility determines the possibilities for backlighting orthogonal to the axis of the experimental assembly, and is well-characterized. However, to model a specific experiment fully, we must run three-dimensional hydrocode simulations specific to that experiment which include target-to-target differences of the fabrication assembly, followed by post-processing specific to the backlighter line of sight used in each experiment (which may differ by up to 10 degrees from the two preferred directions dictated by the symmetry of the experiment). The three-dimensional hydrocode simulations are expensive in their use of computing time and resources, and we therefore make detailed comparison of the experimental data with simulation for only a small number of representative cases. ### Large-Scale Hydrodynamics and Bow Shock Position Figs. 8 and 9 compare images of the deflected jet at 200 ns after the onset of radiation drive to the experimental assembly, and for backlighting lines of sight orthogonal to the plane of jet deflection (Fig. 8) and within the plane of jet deflection (Fig. 9). In each case, the data are compared with post-processed simulations from the RAGE hydrocode. The x-ray backlighting source was the 9.0 keV resonance line of He-like zinc (Fig. 8) or the 6.7 keV line radiation of He-like iron (Fig. 9). In each case, we corrected for spatial variations of incident backlighter intensity (as described above) and the images are therefore maps of absolute backlighter transmission through the experiment. The spatial resolution of both experiments was 15 $\mu$m. The bow shock in the hydrocarbon foam ahead of the jet is clearly visible, as is the late-time hydrodynamic behavior of the primary (outflow) jet (the mushroom-like feature lying off axis, resulting from deflection of the jet) and the secondary (hole-collapse) jet (the dense, near-axis stem apparently penetrating the initial position of the polystyrene sphere). Also evident in the radiographs is the mound-shaped pedestal that arises from motion of the titanium-to-foam interface following shock transit across this interface at late time. In the case of each experiment (the two images were obtained from different experimental shots) the radial offset of the center of the sphere from the axis (impact parameter) was close to 350 $\mu$m , and the axial position of the center of the sphere was close to 920 $\mu$m . A single RAGE simulation is shown for purposes of comparison, in which the impact parameter was 350 $\mu$m, and the axial position for the sphere 915 $\mu$m. The spatial resolution of this simulation was 3.1 $\mu$m. We make quantitative comparisons of experiment and simulation by comparison of lineouts of x-ray transmission in Fig. 10 and Fig. 11. The simulation reproduces the large-scale hydrodynamics of the experiment (bow-shock position, formation of the deflected jet, motion of the pedestal and the creation of a Mach-stem-like feature where it meets the bow shock). However, the simulation does less well with other features of the hydrodynamics, including the “clumpiness” of the deflected jet material and its proximity to the bow shock running ahead of the deflected jet, and the small-scale structure at the interface of the titanium washer and foam (apparently at the surface of the pedestal feature). The finely-resolved simulations capture more fine-scale structure $-$ the jet does indeed break up into structure similar to that seen in the experiment with simulations at 1 $\mu$m spatial resolution, although at a somewhat later time than observed experimentally. These small-scale structures tend to have larger local Mach numbers and are therefore closer to the bow shock. The filigree structure at the pedestal probably arises from Richtmyer-Meshkov growth of small-scale machining or polishing marks on the surface of the titanium washer, following shock transit across this interface. There are also multiple shock interactions that form Mach stems which are not captured by these simulations owing to the reduced computational resolution in the pedestal area. ### Spatial Distribution of Mass To proceed further with quantitative comparison with simulation, we consider the spatial distribution of mass of the materials present in the experiment. At each point in the experimental and synthetic images, the optical depth at the photon energy of the backlighter radiation is given by $$\tau = \kappa_1\sigma_1 + \kappa_2\sigma_2 + \kappa_3\sigma_3$$ where $\tau$ and $\sigma$ are the opacity and areal density (integral of density along the line of sight) and subscripts distinguish the titanium jet (1), the hydrocarbon foam (2) and the polystyrene sphere (3) materials, respectively. The opacity of the titanium jet is significantly greater than that of either the RF foam or the polystyrene sphere, and their temperatures are sufficiently low for the opacity of these materials to be essentially constant throughout the volume of the experiment. For example, at 9 keV (the photon energy of the zinc backlighting source) the opacities of titanium, RF foam and polystyrene are, respectively, 150, 4.12 and 2.83 cm$^2$g$^{-1}$. We divide the experimentally measured and simulated images, arbitrarily, into 500 $\mu$m square regions, and for each region we calculate the mean optical depth $\bar\tau$ using $\tau$ = $-$ln(I/I$_\circ$), and $$\bar\tau = {{\int\tau dA}\over{\int dA}}$$ where I/I$_\circ$ is the measured (or simulated) x-ray transmission, dA is the pixel area, and the integration extends over the area of each specific region of the image. A comparison of mean optical depth defined in this way, for both experiment and simulation, appears in Fig. 12. The grouping together of adjacent, square regions of the image enables the mean to be calculated for rather larger areas encompassing all of, or the majority of, the mass of the deflected jet. In particular, we consider two larger areas of the images shown in Fig. 12: the rectangular region composed of six adjacent 500 $\mu$m squares and labeled A, and the L-shaped region composed of three adjacent 500 $\mu$m squares and labeled B. These encompass essentially all of the mass of the jet that has interacted with the polystyrene sphere (region A), and all except the mass of the primary jet deflected by the sphere (in the case of the L-shaped region B). In each case, the simulation reproduces the experimentally measured optical depth to $\sim$ 10%: for the rectangular region A, mean optical depths are 0.94 for the experiment and 0.86 for the simulation; for the L-shaped region B, mean optical depths are 1.15 for the experiment and 1.10 for the simulation. The greatest difference between experiment and the simulation arises in the magnitude and distribution of mass of the primary (outflow) jet deflected by the obstacle. Material from this primary jet resides mainly in a further L-shaped region, labeled C in Fig. 12. Although the mean optical depths for region C differ by only 15% (0.72 in the case of experiment, 0.62 in the case of simulation), the distribution of mass shows significant variation (mean optical depths of 1.14 and 0.65 in the case of the 500 $\mu$m square region where the difference is most evident). Fig. 12 shows that the RF foam makes only a relatively small contribution to the measured optical depth, but we may assess the magnitude of this contribution simply by setting the opacity of the other components of the experiment (titanium jet and polystyrene sphere) to zero in the post-processing of the hydrocode simulation. We conclude that for the various 500 $\mu$m square regions of the images shown in Fig. 12, the optical depth of the foam lies in the range 0.10 $-$ 0.17 (this variation arises because of chord-length effects, and because density variations of the foam at the bow shock and within the cocoon). Hence, RF foam contributes a negligible optical depth in these experiments. ### Discrete Fourier Transform and Power Spectral Density To compare the experimental data with the small-scale structure of the jet in the simulations, we use the two-dimensional discrete Fourier transform (DFT) of optical depth. Starting from the experimental (or simulated) images of the experiment, we obtain maps of optical depth ($\tau$ = -ln(I/I$_\circ$)) and use the fast Fourier transform algorithm to obtain the DFT of selected regions of the experimental (or simulated) data and then proceed to calculate the power spectral density (PSD). Fig. 13 shows an image of the deflected jet within which we have identified two separate regions (green and dark red boxes), as well as an area of undisturbed hydrocarbon foam (bright red box), and part of the fiducial grid attached to the surface of the foam (blue box). For each region, we show the PSD of optical depth. We define the PSD as the sum of amplitude-squared of all Fourier components whose spatial frequency lies in the range k $-$ k + dk, where k = (k$_x^2$ + k$_y^2$)$^{0.5}$ and k$_x$ and k$_y$ are orthogonal spatial frequency components of the two-dimensional DFT. Fig. 13 clearly shows the fundamental spatial frequency of the grid and its harmonics, the flat spectrum of white noise of the backlighter transmission through the undisturbed foam, and a spectrum arising from the clumpy, perhaps near turbulent, structure arising within the deflected titanium jet. Fig. 14 shows an analogous PSD analysis, for three different RAGE simulations of the experiment. Our approach is the same for the simulation as it is for the experimental data: we obtain a map of optical depth from the simulated radiograph and then the PSD of regions whose size and position is identical to those chosen in analysis of the experimental data. In the case of Fig. 14, we show the result of RAGE simulations for three different levels of AMR calculational resolution: 12.5, 6.25, and 3.125 $\mu$m. Although the calculational resolution (dimension of the smallest Eulerian cell) differs in these three cases, we first obtain (by interpolating the post-processed data) a simulated radiograph with the same spatial resolution as the experimental data before proceeding to calculate the PSD. This procedure enables us to avoid any potential uncertainty of the scaling of PSD amplitude and frequency spacing when comparing with the experimental data. Astronomical Observations and Numerical Models of the Internal Dynamics within the Deflected Jet HH 110 ======================================================================================================= Spectral Maps of HH 110 ----------------------- We observed HH 110 on 9 Jan 2008 UT with the echelle spectrograph on the 4-m Mayall telescope at Kitt-Peak National Observatory in order to quantify the dynamics present in a shocked, deflected astrophysical jet. The 79-63 grating and 226-1 cross disperser combined with the T2KB CCD and 1.5 arcsecond slit gave a spectral resolution of 3.0 pixels, or 11.1 km$\,$s$^{-1}$ as measured from the FWHM of night sky emission lines. The CCD, binned by two along the spatial direction, produced a plate scale of 0.52 arcseconds per pixel. The position angle of the slit was 13 degrees, and the length of the slit was limited by vignetting to be about 140 arcseconds. Seeing was 1.3 arcseconds, and skies were stable with light cirrus. A plot of the slit position superposed on an archival HST image of HH 110 appears in Fig. 15. We employed an unusual mode of observation, long slit but with a wide order separating filter (GG 435). This setup causes orders to overlap at different spatial positions along the slit, but in the case of HH 110 there is no ambiguity because no continuum sources are present. The advantage of this setup is that one can obtain position-velocity diagrams simultaneously for all the bright emission lines, including \[S II\] 6716, \[S II\] 6731, \[N II\] 6583, \[N II\] 6548, and H$\alpha$. The \[O I\] 6300 and 6363 lines were also present, but the signal-to-noise of these faint lines was too low to warrant any profile analysis. Distortion in the spectrograph optics causes each emission line to be imaged in a curved arc whose shape varies between orders. Fortunately, there is strong background line emission in each of the emission lines from the HH 110 molecular cloud, and we used this emission to correct for distortion and to define zero radial velocity for the object. A third degree polynomial matched the distortion of the night sky emission lines within an rms of about 0.2 pixels (0.74 km$\,$s$^{-1}$). It is important to remove night sky emission lines as well as the background emission lines from the molecular cloud, as these lines contaminate multiple orders in our instrumental setup. To this end, we imaged blank sky near HH 110 frequently and subtracted this component from the object spectra after aligning the night sky emission between the object and sky frames to account for flexure in the spectrograph. Cosmic rays and hot pixels were removed using a routine described by @hartigan04, and flatfielding, bias correction, and trimming were accomplished using standard IRAF tasks[^1]. Alignment of individual exposures was accomplished in two ways. First, we compared the position of a star relative to the slit that was captured from the guide camera, whose plate scale of 0.16 arcseconds per pixel we determined by measuring the length of the slit image when a decker of known size truncated the slit. More precise positioning in the direction along the slit is possible by extracting the spatial H$\alpha$ trace and performing a spatial cross correlation between frames. The uncertainty in the positional measurements from the guide camera image inferred from the secondary corrections required by the cross-correlations is about 1.0 arcseconds. To align and compare different emission lines we must also register the position-velocity diagrams to account for the spatial positions of the orders and for the tilt of the spectrum across the CCD within each order, but this is easy to do with a continuum lamp exposure through a small decker to define the spectral trace. The guide camera images indicate, and the spectra confirm, that the last three object exposures drifted by 1.5 arcseconds relative to the position shown in Fig. 15, so these were not used in the final analysis. In all, the total exposure time for the spectra is 140 minutes. There were no differences between the \[S II\] 6716 and \[S II\] 6731 position-velocity diagrams, so we combined these to produce a single \[S II\] spectrum. The \[N II\] 6548 line is fainter by a factor of three than the companion line \[N II\] 6583, and the fainter line is also contaminated by faint residuals from a bright night sky emission line from an adjacent order, so we simply use the 6583 line for the \[N II\] line profiles. Internal Dynamics of HH 110 --------------------------- The image in Fig. 15 divides the position-velocity diagram into ten distinct emitting regions along the slit. Spectra for each of these positions appear in Fig. 17 for H$\alpha$ and for the sum of \[N II\] + \[S II\]. All regions have well-resolved emission line profiles in H$\alpha$, \[N II\], and in \[S II\]. Only object 9 showed any difference between the \[S II\] and \[N II\] profiles, with \[N II\] blueshifted by 12 km$\,$s$^{-1}$ relative to \[S II\]. In low-excitation shocks like HH 110, the forbidden line emission peaks when the gas temperature is $\sim$ 8000 K [@hartigan95], which corresponds to a spread in radial velocity owing to thermal motions of HWHM = ((2ln2)kT/m)$^{0.5}$, or 2.6 km$\,$s$^{-1}$ for N, and 1.7 km$\,$s$^{-1}$ for S. These thermal line widths will be unresolved with the Kitt-Peak observations, which have a spectral resolution of 11 km$\,$s$^{-1}$. Therefore, the observed widths of the forbidden lines measure nonthermal line broadening in the jet. This line broadening most likely arises from nonplanar shock geometry or clumpy morphologies on small scales, as the HST images show structure down to at least a tenth of an arcsecond. However, other forms of nonthermal line broadening, such as magnetic waves or turbulence, may also contribute to the line widths. Figs. 16 and 17 show that the H$\alpha$ emission line widths are larger than those of the forbidden lines. This behavior is expected because a component of H$\alpha$ occurs from collisional excitation immediately behind the shock front where the temperature is highest. The thermal FWHM of H$\alpha$ is given by $$V_{th} = \left(V_{OBS}^2 - V_{forb}^2\right)^{0.5}$$ where V$_{forb}$ = (V$_{NT}^2$ + V$_{INST}^2$)$^{0.5}$ is the observed FWHM of the forbidden lines, V$_{NT}$ the nonthermal FWHM and V$_{INST}$ the instrumental FWHM. We can use the thermal line width observation to measure the shock velocity in the gas. The temperature immediately behind a strong shock is given by $$T = {3\over 16}{\mu m_H V_S^2\over k}$$ where $\mu$ is the mean molecular weight of the gas and V$_S$ is the shock velocity. The mean molecular weight depends on the preshock ionization fraction of the gas, and the postshock gas will have different ion and electron temperatures immediately behind the shock until the two fluids equilibrate [@mckee74], but the equilibration distance should be unresolved for HH 110. For simplicity we take the preshock gas to be mostly neutral, so $\mu$ $\sim$ 1. For thermal motion along the line of sight, the FWHM of a hydrogen emission line profile is then $$V_{th} = 2.354\left({k T\over {m_H}}\right)^{0.5}$$ Combining these two equations we obtain $$V_S = 0.98 V_{th}$$ so the shock velocity is closely approximated by the observed thermal FWHM. Fig. 18 summarizes the kinematics and dynamics within HH 110. The radial velocity gradually becomes more negative at distances greater than about $2\times 10^{17}$ cm. The radial velocities in the different emission lines track one another well. However, the same is not true for the line widths: both Fig. 17 and Fig. 18 show clearly that H$\alpha$ is broader than the forbidden line profiles. This behavior is expected because when the preshock gas is neutral, much of the H$\alpha$ comes from collisional excitation immediately behind the shock front where the temperature is high. The low atomic mass of H also increases its line width relative to those of N and S. The graph shows that the nonthermal component of the line profiles stays approximately constant at $\sim$ 40 km$\,$s$^{-1}$, and the thermal component of H$\alpha$ and the shock velocity are $\sim$ 50 km$\,$s$^{-1}$. There are two epochs of HST images available (Reipurth PI), separated by about 22 months, and these data show intriguing and complex proper motions. Regions 1 through 4 have multiple shock fronts some of which move in the direction of the jet while others move along the deflected flow. Fig. 18 shows that this impact zone has higher nonthermal line widths than present in the flow downstream, consistent with the HST data. Throughout this rather broad region, denoted as such in Fig. 15, jet material impacts the molecular cloud. Hints of this behavior are evident in the ground based proper motion data of @lopez05, which show proper motion vectors directed midway between the direction of the jet and that of the deflected flow. Downstream from region 4, the material all moves in the direction of the deflected flow and gradually expands in size. The electron density of the shocked gas declines as the flow expands [@ro91]. The slow increase in the blueshifted radial velocity could arise if the observer sees a concave cavity that gradually redirects the deflected flow towards our line of sight. One gets the impression from the HST images of a series of weak bubbles that emerges from the impact zone. Published proper motion measurements [@lopez05] suggest tangential velocities of $\sim$ 150 km$\,$s$^{-1}$ along the deflected flow. Hence, the nonthermal broadening is $\sim$ 25% of the bulk flow speed in the deflected jet, while the internal shock speeds are typically 30% of the flow speed. The temperature immediately behind a 50 km$\,$s$^{-1}$ shock is $\sim$ $5.7\times 10^4$ K, and will drop to $\lesssim$ 5000 K in areas where forbidden lines have cooled. The corresponding sound speeds are $\sim$ 20 km$\,$s$^{-1}$ and 8 km$\,$s$^{-1}$, respectively, so the bulk flow speed is $\sim$ Mach 10 in the deflected flow, while the internal shocks there are $\sim$ Mach 3 $-$ 6. The magnetosonic Mach numbers will be lower, depending on the field strength. Wide-Field H$_2$ Images of the HH 110 Region -------------------------------------------- In order to better define how the HH 110 jet entrains material from the molecular cloud, and to verify that the deflected jet model is appropriate for this object, we obtained new wide-field near-infrared images of the region. In Figs. 19 and 20 we present a portion of an H$_2$ image taken 21 Sept., 2008 with the NEWFIRM infrared camera attached to the 4-m telescope at Kitt Peak National Observatory. The image was constructed from 20 individual dithers of 2 minutes apiece for a total exposure time of 40 minutes. The wide-field image in Fig. 19 shows VLA 1, the driving source of the HH 110 flow [@choi06]. The jet from this source, known as HH 270, does not radiate in H$_2$ until it strikes the molecular cloud, although the jet is visible in deep \[S II\] images [@choi06]. Our H$_2$ image clearly shows two other jets that emanate from sources embedded within the molecular cloud core. IRS 1 (aka IRAS 05487+0255) is a bright near-IR source, while IRS 2 appears to be obscured by a flared disk seen nearly edge-on (as in HH 30, @burrows96). These sources drive a molecular outflow along the direction of the jets we see in the H$_2$ image [@ro91]. Archival Spitzer images of the region at mid-infrared (3.6 $\mu$m $-$ 8 $\mu$m), and far-infrared (24 $\mu$m, 70 $\mu$m and 160 $\mu$m) wavelengths reveal three very bright sources that persist in all bands in the region, VLA 1, IRS 1, and IRS 2. The spectral energy distribution of IRS 1 is still rising at 100 $\mu$m, indicative of a heavily embedded source. The morphology of the HH 30 clone IRS 2 splits into two pieces at shorter wavelengths in the Spitzer images, consistent with an obscuring disk seen edge-on. Epoch 2000 coordinates for the midpoint of the HH 30-like disk in IRS 2 are 5:51:22.70 +2:56:05, and for IRS 1 are 5:51:22.60 +2:55:43. The ubiquity of jets in this region is a common occurrence, as most star-forming regions have multiple sources that drive jets. However, it does potentially bring into question whether or not what we and others [e.g. @rrh96] interpret as a deflected jet for HH 110 may simply be a distinct flow generated by some other embedded source to the northeast of the emission. The counter to this argument is that Fig. 19 does not show a source near the apex of HH 110, and the Spitzer images of the region also show nothing there at mid-infrared wavelengths. If the hot H$_2$ is dragged out from the molecular cloud core by the impact of the jet, there should be a spatial offset between the H$_2$ from the core and the H$\alpha$ in the jet, with the H$_2$ located on the side of the spray closest to the core. The color composite in Fig. 20 demonstrates this effect very well, as noted previously for a small portion of the jet [@nc96]. Connecting the Laboratory Experiments With Astrophysical Jets ============================================================= Our laboratory results highlight two aspects of the fluid dynamics that are particularly useful for interpreting astronomical images and spectra $-$ entrainment of ambient material and the dynamics within contact discontinuities. The experiments also serve as a reminder that viewing angle affects how a bow shock appears in an image. We discuss each of these ideas below. Interpretation of Astronomical Images ------------------------------------- Keeping in mind that magnetic fields may play some role in the dynamics, we can look to the experiments as a guide to how material from an obstacle like a molecular cloud core becomes entrained by a jet in a glancing collision. As noted above, in the astronomical images the H$_2$ emission in Fig. 20 must arise from the cloud core to be consistent with the observed spatial offset of the H$\alpha$ and H$_2$, and the lack of H$_2$ in the jet before it strikes the cloud. In the experiments, the jet entrains material in the ball in part because the flute penetrates into the ball and ‘scoops up’ whatever material falls within the flute (Fig. 4). This type of entrainment is probably of little interest astrophysically because its origin is unique to the relatively hollow density structure within the experimental jet. However, material from the ball is also lifted into the flow because the jet penetrates into the ball along the contact discontinuity. Both the radiographs and the RAGE simulations show this region to be highly structured (Figs. 3-5). The experiments indicate that once a part of the jet becomes deflected into the ball along the contact discontinuity it creates a small cavity where the jet material lifts small fragments of the ball into the flow. We see the same morphology in the astrophysical case. This type of entrainment is one that occurs as a natural outgrowth of the complex 3-D structure along a contact discontinuity. As Fig. 6 shows, the deflected bow shock appears much wider when the bow shock has a significant component along the line of sight. While this result is rather elementary, Fig. 6 provides a graphic example that is important to keep in mind when interpreting astronomical images of bow shocks when the shocked gas has a large redshift or blueshift. In such cases a flow may appear to be much less collimated than if one were to observe the bow shock perpendicular to its direction of motion. An example of a wide bow shock oriented at a large angle from the plane of the sky is HH 32A, which has been thoroughly studied at optical wavelengths [@beck04]. Filamentary Structures in the Experiment and the Astronomical Observations -------------------------------------------------------------------------- The working surface of the deflected bow shock in the experiment exhibits an intriguing filamentary structure in the observed radiographs and in the RAGE simulations (Figs. 3 and 21) that resembles the filamentary shock waves seen in HH 110 (Fig. 15). If differential motions between adjacent filaments in the working surface are supersonic, then weak shocks like those seen in HH 110 could form as the filaments interact at later times. To test this idea, we generated synthetic images of the Mach number and the velocity along a plane that contains the center of the ball in Fig. 21. Together, these two images indicate whether shock waves are likely to form within the working surface at later times. Neither image alone provides this information: a constant velocity flow with two adjecent regions of different temperature will show markedly different Mach numbers in close proximity but will not create a shock; similarly, a shock will only form between adjacent fluid elements with differing velocities and the same temperature if the difference between the Mach numbers exceeds unity. Velocity differences between the filaments in the working surface in Fig. 21 are typically 1 $-$ 2 km/s, or only about 10% of the initial jet velocity. In contrast, the shock waves in HH 110 have higher velocities, about 30% of the jet speed (section 4.2; Fig. 18). Moreover, Mach numbers in the filaments range from $\sim$ 1 $-$ 2, so differences between the filaments are $\lesssim$ 1, indicating that the relative motions between the filaments are subsonic. We conclude that the velocity differences between the filaments in the working surface are too low to form shock waves unless the filaments cool. Even if that were to occur, the shock velocities will be about a factor of three smaller relative to the jet speed than those seen in HH 110. Hence, the best explanation for the shocks observed in HH 110 is that the source is impulsive, where each pulse impacts the molecular cloud in a similar manner to our experimental setup. It is instructive to consider what one might observe in a position-velocity diagram in the experiment, were it possible to align a slit down the axis of the deflected flow and obtain a velocity-resolved spectrum, as is possible with astronomical observations. We show this exercise in Fig. 22, where we have simply assumed the emissivity of the gas to be proportional to its density. For a real emission line the emissivity depends on the temperature, density, and ionization state of the gas in a complex manner determined by the atomic physics of the line. However, it is still instructive to see what sort of morphologies appear in a p-v diagram of this sort. The synthetic p-v diagram in Fig. 22 contains a series of arcs that resemble those present in astronomical slit spectra of spatially-resolved bow shocks [@raga86; @hrm90]. These arcs occur when the slit crosses the jet or an interface such as the cavity evacuated by the jet. In the case of spatially resolved bow shocks, arcs in the p-v diagram result from the motion of a curved shell of material, where the orientation of the velocity vector relative to the observer changes along the slit. The lesson from the experiment seems to be that in highly structured flows like our deflected jet, curved cavities and filaments naturally produce p-v diagrams that contain multiple arcuate features. As in the case of resolved bow shocks, the velocity amplitude of the arcs in the p-v diagram is on the order of the shock velocity responsible for the arc. In an optically thin astrophysical nebula one can measure five out of the six phase space dimensions: x and y position on the sky from images, proper motion velocities V$_x$ and V$_y$ from images taken at two times, and the radial velocity V$_z$ along the line of sight from spectroscopy. As we have shown above, V$_z$ is an extremely useful diagnostic of the dynamics of a flow, but one that is currently not possible to measure in laboratory experiments. If such a diagnostic instrument could be developed it would open up a wide range of possibilities for new studies of supersonic flows. Summary and Future Work ======================= The combination of experimental, numerical and astronomical observational data from this study demonstrates the potential of the emerging field of laboratory astrophysics. In this paper we have studied how a supersonic jet behaves with time as it deflects from an obstacle situated at various distances from the axis of the jet. The laboratory analog of this phenomenon scales very well to the astrophysical case of a stellar jet which deflects from a molecular cloud core. An important component to our study was to expand the observational database of best astrophysical example, HH 110, by obtaining new spatially-resolved high-spectral resolution observations capable of distinguishing thermal motions from turbulent motions, and by acquiring a new deep infrared H$_2$ image that can be compared with existing optical emission line images from the Hubble Space Telescope. The laboratory experiments span a range of times, spatial offsets between the axis of the jet and the center of the ball (impact parameters), viewing angles, opacities (backlighters), and materials. The experiments are reproducible and do not depend on composition or structure of foam, or on the pinhole diameter of the backlighter (spatial resolution of the experiment). Synthetic radiographs of the experiment from RAGE match the experimental data extremely well, both qualitatively as images and quantiatively with Fourier analysis. In fact, the agreement is so good that we have used the synthetic velocity maps from RAGE to compare the internal dynamics of the experiment with those that we measure from the new spectral maps of HH 110. A new wide-field H$_2$ image supports a scenario where HH 110 represents the shocked ‘spray’ that results from a glancing collision of the HH 270 jet with a molecular cloud core. The H$_2$ in HH 110 is offset from the H$\alpha$ toward the side closest to the molecular core, consistent with the deflected jet model. The H$_2$ images also uncovered two sources within the core that drive collimated jets, one a bright near-infrared source, and the other a highly-obscured source that appears to be a dense protostellar disk observed nearly edge-on, as in HH 30. The experiments provide several important insights into how deflected supersonic jets like HH 110 behave. In the experiment, entrainment of material in the obstacle occurs in part because the morphology of the contact discontinuity between the shocked jet and shocked obstacle easily develops a complex 3-D structure of cavities that enables the jet to isolate clumps of obstacle material and entrain them into the flow. A similar process likely operates in HH 110. The experiments also reveal filamentary structure in the working surface area of the deflected bow shock, but the relative motion between these filaments is subsonic. Hence, while this dynamical process will generate density fluctuations in the outflowing gas, it cannot produce the filamentary structure and $\sim$ Mach 5 shocks shown by the new velocity maps of HH 110. For this reason the best model for HH 110 remains that of a pulsed jet which interacts with a molecular cloud core. Synthetic position-velocity maps along the deflected jet from the RAGE simulations of the experiments appear as a series of arcs, similar to those observed in astronomical observations of resolved bow shocks. A close examination of the experimental data shows that these arcs correspond to regions where the slit crosses different regions of the flow, such as cavities evacuated by the jet, the jet itself, or entrained material from the ball. This correspondance between the appearance of a p-v diagram and the actual morphology of a complex flow is an intuitive, although perhaps unexpected result of studying the dynamics within the experimental flow. Finally, observations of the deflected bow shock from different viewing angles emphasize that the observed morphology and collimation properties of bow shocks depend strongly upon the orientation of the flow with respect to the observer. As one would expect, a bow shock deflected toward the observer appears less collimated than one that is redirected into the plane of the sky. The impact parameter of the jet and obstacle determines how much the jet deflects from the obstacle and how rapidly the obstacle becomes disrupted by the jet. While experimental analogs of astrophysical jets are highly unlikely to ever reproduce accurate emission line maps, laser experiments can provide valuable insights into how the dynamics of complex flows behave. Our study of a deflected supersonic jet is only one example of how the fields of astrophysics, numerical computation, and laboratory laser experiments can compliment one another. We are currently embarking on a similar program to study the dynamics within supersonic flows that are highly clumpy, and other investigations are underway related to the launching and collimation of jets [@bellan09]. We are grateful to Dean Jorgensen, Optimation Inc., Burr-Free Micro Hole Division, 6803 South 400 West, Midvale, Utah 84047, USA, for supplying the precision-machined titanium-alloy components for these experiments. We thank K. Dannenberg for her assistance in manufacturing the initial targets for these experiments, the staff of General Atomics for their dedication in developing new targets and delivering them on time, the staff at Omega for their efficient operation of the laser facility, and an anonymous referee for useful comments regarding scaling. This research was made possible by a DOE grant from NNSA as part of the NLUF programs DE-PS52-08NA28649 and DE-FG52-07NA28056. Ampleford, D., et al. 2007, Ap&SS 307, 29 Balick, B., & Frank, A. 2002, ARA&A 40, 439 Beck, T., Riera, A., Raga, A., & Aspin, C. 2004, AJ 127, 408 Bellan, P. et al. 2009, Phys. Plasmas 16, 41005 Blondin, J., Fryxell, B., & Königl, A. 1990, ApJ 360, 370 Brugel, E., Böhm, K.-H., & Mannery, E. 1981, ApJS 47, 117 Burrows, C., et al. 1996, ApJ 473, 437 Cabrit, S. 2007, Proceedings of the IAU Symposium 243, J. Bouvier & I. Appenzeller eds., (Cambridge:Cambridge University Press), 203 Carver, R., et al. 2009, in preparation. Cerqueira, A., Velazquez, P., Raga, A., Vasconcelos, M. & de Colle, F. 2006, A&A 448, 231 Choi, M., & Tang, Y.-W. 2006, ApJ 648, 504 Coker, R. F. et al. 2007, Ap&SS 307, 57 Colella, P. 1985, SIAM J. Comput. 6, 104 Cunningham, A.J., Frank, A., & Blackman, E.G. 2006, ApJ, 646, 1059 Drake, R.P., Davison, L., & Horie, Y. 2006, “High-Energy-Density Physics: Fundamentals, Inertial Fusion, and Experimental Astrophysics” (Berlin:Springer). Drake, P., Kuranz, C., Miles, A., Muthsam, H., & Plewa, T. 2009, Phys. Plasmas 16, 41004 Cunningham, A. J., Frank, A., Varniere, P., Mitran, S., & Jones, T. W. 2008, ArXiv e-prints, 710, arXiv:0710.0424 Ferreira, J., Dougados, C., & Cabrit, S. 2006, A&A 453, 785 Foster, J. M. et al. 2002, Phys. Plasmas 9, 2251 Foster, J. M. et al. 2005, ApJ 634, L77 Gittings, M., et al. 2008, Comput. Sci. Disc. 1, 15005 Hansen, J. F., Robey, H. F., Klein, R. I., & Miles, A. R. 2007, ApJ 662, 379 Harris, D., & Krawzynski, H. 2006, ARA&A 44, 463 Hartigan, P. 2008, Lecture Notes in Physics 742, 15 Hartigan, P., Edwards, S., & Ghandour, L. 1995, ApJ 452, 736 Hartigan, P., Edwards, S., & Pierson, R. 2004, ApJ 609, 261 Hartigan, P., Frank, A., Varniere, P., & Blackman, E. 2007, ApJ 661, 910 Hartigan, P., Morse, J., & Raymond, J. 1995, ApJ 444, 943 Hartigan, P., Morse, J., Palunas, P., Bally, J., & Devine, D. 2000, AJ 119, 1872 Hartigan, P., Morse, J., Reipurth, B., Heathcote, S. & Bally, J. 2001, ApJ 559, L157 Hartigan, P., Raymond, J., & Hartmann, L. 1987, ApJ 316, 323 Hartigan, P., Raymond, J., & Meaburn, J. 1990, ApJ 362, 624 Heathcote, S., Morse, J., Hartigan, P., Reipurth, B., Schwartz, R., Bally, J., & Stone, J. 1996, AJ 112, 1141 Heathcote, S., & Reipurth, B. 1992, AJ 104, 2193 Henke, B. L., Uejio, J., Y., Stine, G., F., Dittmore, C., H., & Fujiwara, F. G. 1986, J. Opt. Soc. Am. B 3, 1540 Krause, M. 2003, A&A 398, 113 Kuranz, C. et al. 2007, Ap&SS 307, 115 Landau, L., & Lifshitz, E. 1987, Fluid Mechanics, (Oxford:Pergamon) Lebedev, S., et al. 2004, ApJ 616, 988 Loupias, B. et al. 2007, PRL 99, 265001 Lopez, R., Estalella, R., Raga, A., Reira, A., Reipurth, B., & Heathcote, S. 2005, A&A 432, 567 McKee, C. 1974, ApJ 188, 335 Mirabel, I., & Rodriguez, L. 1999, ARA&A 37, 409 Morse, J., Hartigan, P., Cecil, G., Raymond, J., & Heathcote, S. 1992, ApJ 399, 231 Mottura, L. 1997, J. Comp. Phys. 138, 354 Noriega-Crespo, A., Garnavich, P., Raga, A., Canto, J., & Böhm, K.-H. 1996, ApJ 462, 804 Raga, A., & Böhm, K.-H. 1986, ApJ 308, 829 Ray, T., Dougados, C., Bacciotti, F., Eislöffel, J., & Chrysostomou, A. 2007, in “Protostars & Planets V”, B. Reipurth, D. Jewitt, & K. Keil eds., (Tucson:Univ. of Arizona Press) Reighard, A. & Drake, R. 2007, Ap&SS 307, 121 Remington, B., Drake, P., & Ryutov, D. 2006, Rev. Mod. Phys. 78, 755 Riera, A., Raga, A., Reipurth, B., Amram, P., Boulesteix, J., Canto, J., & Toledano, O. 2003, AJ 126, 327 Reipurth, B., & Olberg, M. 1991, A&A 246, 535 Reipurth, B., & Bally, J. 2001, ARA&A 39, 403 Reipurth, B., Raga, A., & Heathcote, S. 1996, A&A 311, 989 Ryutov, D., Drake, R., Kane, J., Liang, E., Remington, B. & Wood-Vasey, W. 1999, ApJ 518, 821 Rosen, P. A. et al. 2006, J. Phys. IV France 133, 1019 Soures, J., et al. 1996, Phys. Plasmas 3, 218 Schwartz, R. 1978, ApJ 223, 884 [lcc]{} = 0.08in =0em L (cm) \[jet size\] & 1e15 & 0.02\ V (km$\,$s$^{-1}$) \[jet velocity\] & 150 & 10\ $\rho$ (g$\,$cm$^{-3}$) \[jet density\] & 2e-20 & 1\ P (dyne cm$^{-2}$) \[jet pressure\] & 1e-8 & 3e10\ t$_{flow}$ (sec) \[flow timescale\] & 3e9 & 1e-7\ Composition & H & Ti\ T (eV) \[temperature of wake\] & 0.6 & 1\ Euler number in jet &22 & 6\ $\nu_{mat}$ (cm$^2$s$^{-1}$) \[viscosity\] & 9e13 & 2e-5\ $\nu_{rad}$ (cm$^2$s$^{-1}$) \[viscosity\] & 2e21 & 1e-12\ $\nu_c$ (s$^{-1}$) \[collision freq\] & 0.002 & 2e13\ $\chi$ (cm$^2$s$^{-1}$) \[diffusivity\] & 5e24 & 5e-18\ Re$_{mat}$ \[Reynolds number\] & 7e8 & 1e9\ Pe$_{mat}$ \[Peclet number\] & 1e7 & 3e4\ $\lambda_{mat}$ (cm) (mean-free path) & 3e8 & 8e-9\ $\lambda_{rad}$ (cm) (mean-free path) & $>>$L$^a$ & 3e-5\ $\tau_{mat}$ \[optical depth\] & 9e6 & 2e6\ $\tau_{rad}$ \[optical depth\] & $<<$1$^a$ & 7e2\ Bo\# & $>$1e3 & 2e4\ 6.9in 0.0in 0.0in 0.0in 0.0in [^1]: IRAF is distributed by the National Optical Astronomy Observatories, which are operated by the Association of Universities for Research in Astronomy Inc., under cooperative agreement with the National Science Foundation.

Manushi Manushi: A Journal about Women and Society is an Indian magazine devoted to feminism as well as to gender studies and activism. The magazine was founded in 1978 by Madhu Kishwar and Ruth Vanita, two scholars based in New Delhi. It is currently published as a bi-monthly; a total of 157 issues have appeared by the end of the year 2006. Manushi is also a publishing house which prints not just works on the status of women in India but also novels and short stories with a less direct connection to gender issues. Manushi from the beginning has sought to publish articles about the full range of South Asian communities. It regularly includes articles about women's issues in Pakistan, Nepal, Bangladesh and Sri Lanka as well as less frequent articles from around the world. The editors strive to cover people often relatively ignored in English-language media in South Asia. Activists are asked to contribute articles about peasants, workers and minorities, whether religious or ethnic. Manushi sponsors series of lectures and training seminars and also furnishes information to victimised women. References Kishwar, Madhu and Vanita, Ruth (eds.). In search of Answers: Indian Women's voices from Manushi. ( First edition 1984, various reprints and revised editions by Indian and British publishers between 1985 and 1999.) External links Category:1978 establishments in India Category:English-language magazines in India Category:Feminism and society Category:Feminist magazines Category:Feminism in India Category:Indian women's magazines Category:Magazines established in 1978 Category:Media in Delhi Category:Women's rights in Asia Category:Bi-monthly magazines

Written by Chris Bing A proliferation of cheap, easy-to-use hacking tools on the dark web is causing an increasing number of U.S. teenagers to commit computer crimes, according to FBI and Justice Department officials. Government lawyers are seeing such a noticeable spike in adolescent cases that it reminds some of the late 1990s, when the term “script kiddies” was first coined. “When I first joined the computer crime prosecution business, you would have these gray-haired lawyers who would talk about the ’80s and ’90s, when they were prosecuting like 13- and 16-year-olds but that [had] really dropped off,” said Josh Goldfoot, deputy chief of the DOJ’s Computer Crime and Intellectual Property Section. “The 16-year-olds are coming back as a threat because it’s so easy now on the other side to acquire this type of stuff.” Adolescent hackers are once again becoming common, Goldfoot expounded, because of greater accessibility to exploit kits online and more publicity surrounding the practice. Additionally, it has become easier to make money — making the practice much more financially attractive than a part-time or summer job. “Maybe I shouldn’t advertise this, but you can get into the hacking business right now for a couple thousand dollars,” Goldfoot said during a presentation Thursday at McAfee’ Security Through Innovation Summit, produced by FedScoop and CyberScoop. “The level of technical sophistication required to do this work has fallen dramatically to the extent where we have seen juveniles re-enter the picture as a real threat.” Last year, a group of teenagers were arrested in Scotland, England and the U.S. for executing a series of high profile hacks against the U.S. government, including leaking personal and sensitive details of tens of thousands of FBI and Homeland Security employees. The group, dubbed “Crackas With Attitude,” claims to have also hacked into former CIA director John Brennan’s personal email account. Arrested members of the group include 16-year-old and 17-year-old boys. “When I started this in the early to mid 90s, we were chasing everything from the scientist guy to the guy in the basement and the teenagers are finally getting into it. There’s a war games scenario,” said FBI Cyber Readiness Section Chief Trent Teyema. “Script kiddies are downloading exploit tools [from the dark web] and launching them. That’s actually a real issue.” Tools used to launch a historically disruptive distributed denial-of-service attacks last year against internet company Dyn were quickly shared on hacking forums. The incident showcased how certain hacking capabilities can quickly be shared and adopted by a wide array of actors. In January, noted security journalist Brian Krebs laid out evidence that pointed to a 20-year-old New Jersey resident as being responsible for the Mirai botnet. “More people are availing themselves of this technology because there is such a low buy in,” Teyema told a group of reporters Thursday during a closed door briefing. “One or two people with bad intent can really cause big problems.” To combat script kiddies, Goldfoot said that the Justice Department is prioritizing efforts to investigate and prosecute hacking tool creators and dark web marketplace administrators, where many of these exploits are posted for sale. Teyema, a career FBI official with more than 20 years of service, said that even his own son had been experimenting with hacking tools. “My youngest son came home and he took out his Surface device and downloaded a few rootkits. His whole goal was to go to school and see if he could pop root on the thing to do some hacking. ” Teyema said between a laugh. “I ended up calling him a noob for doing it. I told him ‘You just downloaded a rootkit on your own computer and you may have just infected your own device.” In order to discourage teens from hacking, The FBI launched a science, technology, engineering and mathematics program designed for high school students last year. “We’ve been talking with principals for how we can capture that brilliant mind and push them in the right areas so kids don’t get in trouble,” said Teyema. “It’s like the old don’t do drugs campaign.” The Bureau’s anti-hacking, education-first campaign aimed at high school students mirrors an effort also led by the Europe’s own law enforcement agency, Europol. An October 2016 report authored by Eurpol similarly suggested that parallels exists between why teenagers turn into hackers and how youths become addicted to drugs and alcohol — “frameworks of addiction assist with explaining the difficulties in cessation as well as an escalation in deviancy and targeted victimisation,” the report reads. Europol, like the FBI, recommends that alternative educational opportunities should be provided to at-risk youth, who may be attracted to cybercrime.

POPULAR CATEGORY Welcome to Tech 5 Blog, it's great pleasure for us that you read our article. If you have any suggestion or want to write a post with us then contact us. Suggest any topic that you want to see on our blog. We provide all Tech news with entertainment topic. Thank you for Visiting our website.

Ruins of Adventure It's like 2nd Edition with ascending ACs and Attack bonuses. What's not to love? Ring of Naonúr Thar A bone ring, carved with a skull, and set with a piece of uncut amethyst. Category: ring Description: This bone ring is carved with a skull on either side, and set with a piece of uncut amethyst. The gem and the bone blend into each other, as if the gem were were somehow grown from the bone before it was carved. It radiates a strong aura of necromantic magic when such is detected. This ring is part of a series of eight rings fashioned by the Warrior Mystics of the ancient Nogian Empire. Sometimes referred to as the Rings of Affliction, each ring corresponds to a single school of magic, greatly enhancing the wearer’s abilities in that school at the expense of others. This ring grants an attuned wearer advantage on all saving throws against spells from the Necromancy school, but disadvantage on saving throws against spells from the schools of Illusion or Enchantment. Similarly, the wearer gains advantage on attack rolls made with Necromancy spells that he casts, but disadvantage on attacks made with Illusion or Enchantment spells. Other creatures must save against any Necromancy spells cast by the wearer with disadvantage, but gain advantage on saving throws against the wearer’s Illusion and Enchantment spells. Once per day, an attuned wearer of the Ring of Naonúr Thar can cast a single spell of the Necromancy school as if it were cast using a spell slot of 2 levels higher than the slot actually used (to a maximum of 9th level).

816 F.2d 669 Gabrelianv.Gabrelian 86-7908 United States Court of Appeals,Second Circuit. 3/11/87 1 E.D.N.Y. AFFIRMED

Luis Enrique delighted as Barca extend record unbeaten run LONDON (Reuters) - Barcelona coach Luis Enrique was impressed with the way his team performed in their Champions League win at Arsenal on Tuesday, which extended their club record unbeaten run to 33 games. The holders won the last 16 first leg tie 2-0 with second-half goals from Lionel Messi, including a penalty, as they moved closer to becoming the first team to lift the European Cup in successive seasons since AC Milan in 1989 and 1990. "I liked everything from the very beginning," Luis Enrique told reporters. "We had plenty of possession, we defended very well and we managed Arsenal's transitions (counter-attacks) very well. "They are one of the best teams in the world with their transitions, but we coped with them, kept the game level and then turned it in our favour. "I liked everything that we did tonight and we were the deserved winners. We dealt with Arsenal's pressure really well in the second half and my players coped perfectly the whole match." The one blemish on Barcelona's performance was a yellow card for defender Gerard Pique after 85 minutes which means he misses the return at the Nou Camp on March 16, leaving him with a clean slate for a probable quarter-final in April. After Messi scored from the spot to put Barca 2-0 ahead, Pique went to the touchline and had a quick conversation with the coach as the pair covered their mouths with their hands. Soon after that Pique went rushing in with a late lunge on Arsenal substitute Danny Welbeck and was booked by Turkish referee Cuneyt Cakir. However, Luis Enrique denied any skullduggery. "No, it was not a deliberate foul by Gerard Pique, he had to commit that foul," he said. "There was nothing deliberate about it at all."

Two Days in Bangkok Bangkok traffic – the busiest in the world I’m alone and running across a strange city on a strange new continent. It’s melty degrees and I’m sweating as I dodge between tuk-tuks, hoping that my girlfriend will be alright left on the platform on the other side of the city for an hour and a half. Leaving my phone charging in the Bangkok hostel wasn’t the smartest move I’ve ever made and now we’ve missed the bus… We got up for a 4am taxi to the airport in Christchurch, New Zealand. I found $30AUD in my pocket so bought a South East Asian phrasebook at Sydney airport for our adventures ahead. Boarding the Sydney to Bangkok flight, the Aussie airline assistant took one look at my All Blacks shirt and said to me: ‘they already kicked you out of Australia for wearing that?’ I was feeling nervous and naive to enter a non-first world country for the first time in nearly a quarter of a century on this planet. Time for something new… Our first taste of Thailand On arrival we followed directions from the Bangkok airport to the hostel via the train, and checked in. It was hot and muggy and clearly a melting pot of all forms of human life – I was excited and slightly overwhelmed by the assault on all of my senses. On first impression, Bangkok felt more alive than any other city I’d been in. We got a free whisky shot at the hostel (which tasted like mouthwash) and bought some chicken noodles before grabbing some overdue sleep. The next morning we had a croissant and bought an asian plug converter, then got a train to the bus station and bought tickets to go to Koh Samet for the following day. We got a train into town to Hua Lamphong and walked around for quite a while. We found our way to Rachawongse Pier, where we got a boat to Tha Chang Pier up the Chao Phraya River and had an awesome stir fry noodle lunch at the market. We turned right and walked round all four sides of the Grand Palace in sweltering heat but by the time we finally reached the entrance it was 3.30pm and the Palace was closed. If only we had turned left… There’s something alluring about downtown Bangkok We walked along Saham Luang Royal Ground to Khao San Road, the ultimate backpacker street. It was very touristy, as you would expect. We also walked along Kraisri Road, which is parallel to Khao San and just more of the same, really. We got the ferry again from from Phra Arthit to Oriental Pier and walked back through Silam Road to Lub D hostel, where we were given free beef and pork kebabs. A bit later I grabbed some seafood rice from down the road – thus far the Bangkok food had been great! The Bangkok Sky Bar was famously used in the film Hangover Part II and we walked over to it, excited to have a drink atop the skyscraper with surely the best view of all of Bangkok. Frustratingly, we weren’t allowed in due to their dress code so we went back to the hostel to get changed. The sky bar was worth the hassle – apparently the world’s highest rooftop restaurant at a dizzying 64 flights up, this was one incredible experience. The bar was super busy but eventually we got served a cocktail each. As we went to leave we were informed that there was another rooftop bar on floor 52. We had a cocktail each there too and it hosted equally stunning views but was far less crowded. I stupidly had the cocktail all guys ask for pretending to be James Bond, forgetting how disgusting it is in real life: a Vesper Martini. I did finish it, though, and it was a pretty awesome night! The Sky Bar from Hangover II! The next day we awoke fairly early and had another croissant breakfast at Lub D. It was only after taking two trains to the bus station that I realised I had left my phone on charge back at the hostel! I had to go back and left Jodes at the station with our bags for about an hour and a half. By now we had missed the bus so had to buy another to Trat – we decided to bypass Koh Samet and go straight to Koh Chang… Search Whaddup JP I’ve been to… @WhaddupJP on Twitter What are people reading? Copyright Notice All content used on this website is my own, unless stated otherwise. No images should be used without the image credit's permission. All opinions are my own and I have not been paid to write a positive or negative view on anything.

A Nanobionic Light-Emitting Plant. The engineering of living plants for visible light emission and sustainable illumination is compelling because plants possess independent energy generation and storage mechanisms and autonomous self-repair. Herein, we demonstrate a plant nanobionic approach that enables exceptional luminosity and lifetime utilizing four chemically interacting nanoparticles, including firefly luciferase conjugated silica (SNP-Luc), d-luciferin releasing poly(lactic-co-glycolic acid) (PLGA-LH2), coenzyme A functionalized chitosan (CS-CoA) and semiconductor nanocrystal phosphors for longer wavelength modulation. An in vitro kinetic model incorporating the release rates of the nanoparticles is developed to maximize the chemiluminescent lifetimes to exceed 21.5 h. In watercress (Nasturtium officinale) and other species, the nanoparticles circumvent limitations such as luciferin toxicity above 400 μM and colocalization of enzymatic reactions near high adenosine triphosphate (ATP) production. Pressurized bath infusion of nanoparticles (PBIN) is introduced to deliver a mixture of nanoparticles to the entire living plant, well described using a nanofluidic mathematical model. We rationally design nanoparticle size and charge to control localization within distinct tissues compartments with 10 nm nanoparticles localizing within the leaf mesophyll and stomata guard cells, and those larger than 100 nm segregated in the leaf mesophyll. The results are mature watercress plants that emit greater than 1.44 × 1012 photons/sec or 50% of 1 μW commercial luminescent diodes and modulate "off" and "on" states by chemical addition of dehydroluciferin and coenzyme A, respectively. We show that CdSe nanocrystals can shift the chemiluminescent emission to 760 nm enabling near-infrared (nIR) signaling. These results advance the viability of nanobionic plants as self-powered photonics, direct and indirect light sources.

Shapefield UG (haftungsbeschränkt) is a company located in Germany, 66115 Saarbrücken at Altenkesseler Straße 17/C1. Shapefield UG (haftungsbeschränkt) has an ACTIVE entity status and an ISSUED LEI code. The Legal Entity Identifier code of Shapefield UG (haftungsbeschränkt) is 391200G8VPMLKJQI1D50. The legal form of this company is 63KS.

Q: Android/iOS mobile browser - disable events How can I disable default mobile browser events like zoom (dblclick, expand) and options (when you hold down your finger on a screen a popup appears with options)? I tried this: document.addEventListener('ontouchstart', function(event) { event.preventDefault(); }, false); A: You can prevent the finger move(scroll the page) like this: document.addEventListener('ontouchstart', function(e) { e.preventDefault(); }); document.body.addEventListener('touchmove', function(e) { e.preventDefault(); }); And the zoom you just need to adjust the viewport like this: <meta name="viewport" content="width=device-width, minimum-scale=1.0, maximum-scale=1.0, user-scalable=no">

--- abstract: 'We study electrostatic interaction between molecules of the DNA in which a number of phosphate groups of the sugar-phosphate backbone are exchanged for the pyrophosphate ones. We employ a model in which the DNA is considered as a one-dimensional lattice of dipoles and charges corresponding to base pairs and (pyro)phosphate groups, respectively. The interaction between molecules of the DNA is described by a pair potential $U$ of electrostatic forces between the two sets of dipoles and charges belonging to respective lattices describing the molecules. Minima of potential $ U$ indicate orientational ordering of the molecules and thus liquid crystalline phases of the DNA. We use numerical methods for finding the set of minima in conjunction with symmetries verified by potential $U$ . The symmetries form a noncommutative group of 8-th order, ${\cal S}$. Using the group ${\cal S}$ we suggest a classification of liquid crystalline phases of the DNA, which allows of several cholesteric phases, that is polymorphism. Pyrophosphate forms of the DNA could clarify the part played by charges in its liquid crystalline phases, and make for experimental research, important for nano-technological and bio-medical applications.' author: - 'V.L. Golo$^1$' - 'E.I.Kats$^2$' - 'S.A. Kuznetsova$^3$' - 'Yu.S. Volkov$^1$' date: 'August 3, 2008' title: Pyrophosphate Groups in Liquid Crystalline Phases of the DNA --- Introduction ============ According to the familiar legend the discovery of the cholesteric phase of the DNA was due to a happy chance that occurred to C.Robinson, who was sharp enough to see it, [@robinson]. The story resembles that of Fleming’s discovering the penicilin. Since then cholesteric phases of the DNA have been the subject of numerous experimental and theoretical investigations owing to their variety and regularity, [@livolant1]. It has been established that the formation of the phases depends on chemical properties of an ambient solution and ions, the ingenious experimental technique has been worked out, [@livolant1], [@livolant2], and liquid crystalline phases of the DNA have become instrumental in studying the DNA itself. Another important development began surfacing in chemical physics of nucleic acids early in the 90-th. The group led by Z.A.Shabarova at the Lomonosov Moscow University, [@s1] — [@s5] succeeded in synthesizing the DNA in which some inter-nucleotide phosphate groups are exchanged for the pyro-phosphate ones, and thus considerably extended the field of research, providing new insights into the chemistry of nucleic acids, as well as new possible bio-medical applications. In this paper we aim at making it clear that pyrophosphate forms of the DNA could be helpful in studying liquid crystalline phases of the DNA. Theoretical work on the physics of liquid crystalline phases dates from the seminal paper by Onsager, [@onsager], which relies on the picture of hard rods representing molecules in solvent. Applications of the model require the use of phenomenological constants and theoretical assumptions, difficult to verify in specific situations. Cholesteric phases need even more careful investigating owing to their chirality. In a series of papers Kornyshev, Leikin, and their collaborators[@lk_model], [@lk1] - [@lk3], [@kim], [@osipov], put forward the theory of cholesteric liquid crystalline phases of the DNA that relies on the helical distribution of charges of the DNA. Within the framework of this theory one can employ various approaches and approximations and investigate specific conformations. Generally, a molecule of the DNA is considered as a charged rod or cylinder, the charge being distributed continuously over the surface of the rod, complying with the helical symmetry, theoretical tools employed being of analytical character. In the present paper we use a discrete approximation for the charge’s distribution and rely a computer simulation for finding molecular conformations. It should be noted that the distribution of charge in the DNA molecule is essentially discrete being caused by (1) the dipole moments of the base pairs, (2) the charges of the phosphate groups, (3) counterions which are not uniformly distributed round the DNA molecule. The electrostatic interaction between two DNA molecules is due to this essentially non-uniform distribution of charges. Our approach, still remaining within the framework of papers [@lk_model], [@lk1], provides new details of the phenomenon. It is worth noting that we aim only at a qualitative description, which could be useful for explaining experimental data. Since the current theory considers electrostatic interaction as a cause for the formation of liquid crystalline phases the DNA , it is interesting to investigate opportunities that can be provided by the use of the DNA containing a number of pyrophosphate groups, PP-forms, instead of the usual phosphate ones, P-forms, see Figure 1, so as to have a means of changing the charge conformation of the molecule. It is important that synthetic forms of the DNA can contain PP-groups in the duplex of the DNA instead of the usual phosphate ones in such a way that the structures of the pyro-modified and usual phosphate molecules, remain rather close,[@s5], the inter-nucleotide distance, the stacking, and the Watson-Crick interaction suffering no change. Synthetic forms of the DNA are instrumental in the study of fundamental problems in molecular biology, biochemistry, medicine, ferments’ activity in nucleotide exchange, protein-nucleic acids complexes, structural functioning of biopolymers, and regulation of the genetic expression. The modification of inter-nucleotide groups is of particular importance owing to its preserving the ability of molecules of the DNA to penetrate cell membranes and regulate gene expression, while retaining the basic function of the DNA, that is to interact with the complimentary sequences of nucleotides. It is possible to synthesize the DNA so as to have the exchanged pyrophosphate groups located at prescribed sites of the sugar-phosphate spine, each pyrophosphate group bringing forth an additional negative charge. Minima of the potential [U]{} for pair-interaction of molecules of the DNA should correspond to orientational ordering of the molecules in solvent and therefore liquid, or solid, crystalline phases. Special means are required to find the minima of $ U$. At this point the symmetry of [U]{} provides valuable information. As was found in the previous paper [@gkv], $ U$ is invariant under the action of a group of discrete transformations, and therefore its minima form a set having the same symmetry. The circumstance reduces the amount of numerical work, which is quite large. But we feel that the symmetry of the pair-interaction $ U$ is by far of more general importance for understanding the physics of liquid crystalline phases of the DNA than one can infer from its numerical applications. Preliminaries. =============== We shall recall certain basic facts of the DNA. A molecule of the DNA can attain several hundred $\mu m$ in length. If we neglect details that have a size of one thousand Å, or more, we can visualize it as a soft shapeless line and conclude that on this scale it behaves like an ordinary polymer. In contrast, looking at its smaller segments, of one hundred Åor less, we observe that it tends to be straight. Thus, borrowing a comparison from everyday life, we may say that a molecule of the DNA looks like a piece of steel wire whose long segments are flexible and the short ones are stiff. The elastic properties of the DNA are intimately related to its being a double helix. The latter imposes severe constraints on deformations which can be effected without destroying the molecule and to a large extent determines its mechanical properties. In fact, the two strands comprising the molecule of DNA have just small bending rigidities, just as usual polymers. But the formation of the two-stranded structure drastically changes the DNA by making it both stiff and capable of forming sophisticated spatial shapes. As was mentioned above, the double helix of DNA consists of long chains, or strands, which have the backbones composed of sugar and phosphate residues, and special chemicals, bases, keeping the two strands together (the structure is illustrated in Figure 2). The fundamental building blocks of the strands are nucleotides, joined to each other in polynucleotide chains. The nucleotide consists of a phosphate joined to a sugar (2’-deoxyribose), to which a base is attached. The sugar and base alone are called a nucleoside. The chains, or strands, of the DNA wind round each other in a spiral forming a double helix, the bases being arranged in pairs: adenine - thymine (AT), guanine - cytosine (GC), so that the sequence of bases in one strand determines the complimentary sequence of bases in the other and constitutes the genetic code stored by the molecule of DNA. There are several forms of the DNA, denoted by A,B, and Z. The most common one in nature, is the so-called B-form. One turn of the helix of the B-form, corresponds approximately to $10.5$ base-pairs, and the distance between adjacent pairs of bases is approximately $3.4$ Å. In real life there are considerable deviations from the canonical B-form of the DNA. Therefore, there is a need for a special nomenclature for describing its conformations (see [@calladine] for the details),and generally a considerable set of parameters is required. It is worth noting that the deviations from the canonical form are by no means small, and may have a size of tens of degrees. Synthetic analogues of nucleic acids (NA) containing modified internucleotide groups are useful for solving various problems of molecular biology, biotechnology, and medicine. Shabarova et al, [@s1], [@s2] ,developed a novel type of modified DNA duplexes containing pyrophosphate ( PP) and substituted pyrophosphate ( SPP) internucleotide groups at the definite position of the sugar-phosphate backbone [@s1] - [@s5] (see Figure 1). The PP-group bears one additional negative charge in comparison with a natural internucleotide group; SPP group contains no additional charges. The introduction of PP-groups into DNA leads to an increase of total negative charge of a molecule of the DNA. The study of oligonucleotide duplex containing a PP and SPP groups has revealed that stacking and Watson-Crick interactions are not significantly affected. By flipping out of the disubstituted phosphate these groups fit into the helix structure without elongation of the internucleotide distance. The analysis of helical parameters of base-pairs , internucleotide distances, and overall global structure, reveals a close similarity of the initial and modified duplexes. The location of PP-groups of the DNA are to verify certain conditions: 1. their total number does not exceed 10 % of the total number of phosphates;\ 2. they are not allowed to be located opposite each other;\ 3. they are not allowed to occupy the ends of a molecule;\ 4. two adjacent pyrophosphate groups are to be separated by at least 10 phosphate ones. ![Phosphate, pyrophosphate and substituted pyrophosphate group.[]{data-label="fig:p-groups"}](fig1.eps){width="50.00000%"} ![DNA with a pyrophosphate group.[]{data-label="fig:p-dna"}](fig2.eps){width="50.00000%"} \[sec: Main\] Model. ==================== Theoretical study of liquid crystalline phases of the DNA generally uses models that are necessarily based on very crude simplifications. The first point at issue is the right choice of a potential of interaction. In this paper we model the molecular of the DNA on a 1-dimensional lattice of charges and dipoles with an elementary cell of size $3.4$ Å. It mimics the spatial conformation of charges of phosphate groups and dipoles of base-pairs. We consider short segments of the DNA, approximately $500$ Å, that is of the size of persistence length, so that to a good approximation they are segments of straight lines, and assume that both molecules have the same number, 151, of base-pairs that can be visualized as points on a straight line parallel to the axis of the molecule, one base-pair being located at the center of a corresponding molecule (see Figure 3). The centers of the straight lines belong to a straight line perpendicular to plane x-y which is parallel to either of them. We shall denote by $\xi$ the angle between the straight lines describing the molecules. Both molecules are of the same helicity, which is determined by the rotation of the frame of the dipole moments. Thus, we model a molecule of the DNA on a one-dimensional lattice having at its sites either vectors of dipoles of the base pairs or scalars of the phosphate charges. It is important that the values of the dipoles and charges are renormalized owing to screening effects caused by counterions and ions adsorbed at the molecule. Therefore, we consider effective phosphate charges and dipoles of base pairs. The case of total neutralization of phosphate charges was considered in paper [@kik]. The dipoles are suggested to have the helix symmetry with $\pi / 5$ rotation / bp, corresponding to the structure of the ideal double helix of the DNA. Of course, it is necessary to take into account the structure of DNA being not uniform and the relative positions of the base pairs varying slightly from base pair to base pair. Hence, the dipole moments of the base pairs do not form a precise lattice structure. Even more so they should depend on the local DNA sequence. Therefore, our assumption of the regular dipole positions is a crude [*approximation*]{}. The distance, $\kappa$, between the centers of the lattices, which is fixed, is an important parameter of the model. In what follows we use the distance between adjacent base-pairs, that is $3.4$ Å, as a unit of length, take a unit of charge for which the dipole moment of $1 \; Debye$ equals $1$, and perform calculations in the dimensionless units generated by these quantities. The energy of electrostatic interaction of two molecules can be cast in the sum $$\label{U} \epsilon \, U = U_0 + u_{dd} + u_{dc} + u_{cd} + u_{cc}$$ in which $\epsilon$ is the dielectric permeability of solvent and $U_0$ is the self energy of the pair, which does not influence its conformation, the first term describes the interaction between dipoles of the first molecule and those of the second; the second term - dipoles of the first and phosphate charges of the second; the third - charges of the first and dipoles of the second; the fourth - charges of the first and the second. The interactions are given by the equations $$\begin{aligned} u_{dd}(\rho) &=& e^{-\nu \,\rho} \, \left[ g(\rho) \frac{1}{\rho^3} (\vec p \cdot \vec p^{\; \prime}) - 3 h(\rho) \frac{ [\vec p \cdot (\vec r - \vec r^{\; \prime})] [\vec p^{\; \prime} \cdot (\vec r - \vec r^{\; \prime})] } {\rho^5} \right] \label{Udd} \\ u_{dc}(\vec r, \vec r^{\; \prime}) &=& e^{-\nu \,\rho} k(\rho) Q^{\prime} \frac{\vec p \cdot \vec r^{\; \prime}}{\rho} \label{Ucd}\\ u_{cd} (\vec r^{\; \prime}, \vec r) &=& e^{-\nu \,\rho} k(\rho) Q \frac{\vec p^{\; \prime} \cdot \vec r}{\rho} \label{Udc}\\ u_{cc}(\vec r, \vec r^{\; \prime}) &=& e^{-\nu \,\rho} \frac{ Q Q^{\prime}}{\rho} \label{Ucc}\end{aligned}$$ in which $\nu$ is the inverse Debye length $\nu = \lambda^{-1}$, and $$\rho = |\vec r - \vec r^{\; \prime}|$$ We shall take the screening functions $k(\rho), g(\rho), h(\rho)$ in Schwinger’s form $$k = g = 1 + \nu \, \rho, \quad h = 1 + \nu \, \rho + \frac{1}{3} \, \nu^2 \rho^2$$ The important point about the electro-statical interaction between molecules of the DNA is a wise choice of the screening factor. The common practice is to employ the Debye-Hückel theory, or its modifications that might accommodate the dipole charges, the so-called Schwinger screening, [@podg]. The full treatment of this problem requires a separate investigation. In this paper we confine ourselves to the Debye-Hückel and the Schwinger theories, [@podg]. It is worth noting that the pair potential $U$ is invariant: if we change the sign of angle $\xi$ between the axes of the two molecules, at the same time as the sign of helicity, the potential $U$ remains the same. There are symmetry rules for the helixes of the same kind. One may convince oneself that the following transformations $$\begin{aligned} \label{t1} t_1 : \; (\phi_1, \; \phi_2, \; \xi) & \rightarrow & (\phi_1, \; \pi - \phi_2, \; \xi + \pi) \\ \label{t2} t_2 : \; (\phi_1, \; \phi_2, \; \xi) & \rightarrow & ( \pi - \phi_1, \; \phi_2, \; \xi + \pi) \\ \label{t3} t_3 : \; (\phi_1, \; \phi_2, \; \xi) & \rightarrow & (\phi_2 + \pi, \; \phi_1 + \pi, \; \xi)\end{aligned}$$ leave the potential $U$ invariant. The angles are defined within limits $$- \pi \le \phi_1 \le \pi, \quad - \pi \le \phi_2 \le \pi, \quad - \pi \le \xi \le \pi$$ values $\pm \pi$ corresponding to the same configurations of the molecules. The transformations given by equations (\[t1\]-\[t3\]) verify the equations $$t^2_1 = t^2_2 = t^2_3 = id, \quad t_2 \, t_3 = t_3 \, t_1, \quad t_1 \, t_2 = t_2 \, t_1,$$ where $id$ is a transformation that leaves all $\phi_1, \phi_2, \xi$ invariant. Using the above equations one can easily convince oneself that $t_1, t_2, t_3$ generate a [*non-commutative group*]{} of 8-th order, ${\cal S}$. Its maximal subgroup ${\cal H}$ is a normal subgroup of 4-th order, commutative, and generated by the transformations $$\label{f12} f_1 = t_3, \quad f_2 = t_1 \, t_2 \, t_3$$ Elements $f_1, \; f_2$ in its turn generate subgroups ${\cal H}_1$ and ${\cal H}_2$ of ${\cal H}$, respectively. It is worth noting that ${\cal H}_1, \;{\cal H}_2$ are of second order, both. They are conjugate subgroups of [S]{}, that is for an element $g$ of ${\cal S}$ we have $f_1 = g^{-1} \, f_2 \, g$, or we may state ${\cal H}_1 = g^{-1} \, {\cal H}_2 \, g$, in the notations of group theory, which can be cast in the form of the diagram $$\label{conjug} {\cal H}_1 \longleftrightarrow {\cal H}_2$$ The element $$\label{f3} f_3 = t_1 \, t_2$$ generates subgroup ${\cal H}_3$ of ${\cal H}$. It is important that ${\cal H}_3$ is a normal subgroup of ${\cal S}$, that is $g^{-1} \, {\cal H}_3 \, g = {\cal H}_3 $ for any element $g$ of ${\cal S}$. Thus, we have the diagram of subgroups inside the symmetry group ${\cal S}$ $$\label{groupdiagram} \begin{array}{lllll} {\cal H}_1 & & & \\ & \; \searrow & & & \\ {\cal H}_3 & \longrightarrow & {\cal H} & \longrightarrow & {\cal S} \\ & \; \nearrow & & & \\ {\cal H}_2 & & & \end{array}$$ in which the arrows signify the embedding of subgroups. The group of symmetries, ${\cal S}$, plays the key role in finding minima of the potential $U$. The following general arguments, based on the theory of groups, are quite useful in this respect. Consider a point $\mu$ of space ${\cal X}$ of the angles $\phi_1, \, \phi_2, \, \xi$. Suppose that $\mu$ is a minimum of $U$. Then points $$\mu^{\prime} = g \cdot \mu,$$ called the orbit of the point $\mu$ under the action of the group ${\cal S}$, are also minima of $U$. The number of points $\mu^{\prime}$ of the orbit can vary. In fact, let us consider all transformations $g$ of ${\cal S}$ that leave $\mu$ invariant, that is $\mu^{\prime} = g \cdot \mu = \mu$. It is alleged to be known that the transformations form a subgroup of ${\cal S}$, called stationary subgroup ${\cal H}_{\mu}$. The stationary subgroups, ${\cal H}_{\mu}$ and ${\cal H}_{\nu}$ , for points $\mu$ and $\nu$ of an orbit, are conjugate, that is $ {\cal H}_{\mu} = g^{-1}\, {\cal H}_{\nu} \, g$ for an element $g$ of ${\cal S}$. The number of different points $\mu^{\prime}$ equals to the ratio of the orders of ${\cal S}$ and ${\cal H}_{\mu}$, that is to 2 or 4, depending on the choice of point $\mu$. To be specific, consider a point $\mu$ having a stationary subgroup ${\cal H}_{\mu}$ that coincides with the subgroup ${\cal H}$. The latter is a normal subgroup of ${\cal S}$ of index 2, that is the factor set ${\cal S} /{\cal H}$ consists of two elements. Thus, the orbit of $\mu$ under the action of ${\cal S}$ consists of only two points that correspond to the same value of $U$ and have the same stationary subgroup ${\cal H}$, because the latter is a normal subgroup of ${\cal S}$. The situation is quite different if we take a point $\nu$ having stationary subgroup ${\cal H}_1$, which is different from ${\cal H}_2.$. The subgroups do not coincide in ${\cal S}$, even though they are conjugate. The orbit of ${\cal \mu}$ under the action of ${\cal S}$ indicated above consists of four points that we may sort out as follows: two points having the stationary subgroup ${\cal H}_1$ and two points having ${\cal H}_2$. This is due to the fact that for one thing the subgroup ${\cal H}$ is commutative and therefore its elements generate points of the orbit but with the same stationary subgroup, that is ${\cal H}_1$, and for another there is an element $g$ that gives points of the orbit having the stationary subgroup ${\cal H}_2$. In contrast, a point $\mu$ having the stationary subgroup ${\cal H}_3$ has the orbit consisting of four points which have the same stationary subgroup ${\cal H}_3$, because the latter is a normal subgroup of ${\cal S}$.\[statsubgr\] Numerical simulation ==================== ![ Scheme for the locations of dipoles and charges of base pairs and P-groups, respectfully, in a molecule of the DNA. The conformation of a pair of molecules is determined by angle $\xi$ between the axes of the molecules, and angles $\phi_1, \; \phi_2$ of rotations of the molecules about their axes. []{data-label="fig:model"}](fig3.eps){width="40.00000%"} It is to be noted that numerical evaluation of the minima runs across a poor convergence of standard algorithms for minimization, owing to flat surfaces of constant value for the function of three variables, $U(\phi_1, \; \phi_2, \; \xi)$. To some extent, one may get round the difficulty by observing that for points remaining fixed with respect to a subgroup ${\cal G}$ of ${\cal S}$, the minimization problem is reduced to that for a smaller number of variables. This is due to the necessary conditions for extremum being verified automatically for degrees of freedom perpendicular to the set of invariant points, so that one needs only to study the conditions for longitudinal variables, that is to solve a smaller system of equations. To see the point let us consider a function $f(x,y,z)$ of variables $x, y, z$ even in $x$, so that $f(x,y,z) = f(- \, x, y,z)$. The set of invariant points is $y-z$ plane, and we may look for minima of the function $f(x=0,y,z)$, thus we need to solve only two equations $$\frac{\partial}{\partial y}f(x=0, y,z) = 0, \quad \frac{\partial }{\partial z}f(x=0, y,z) = 0$$ The number of variables necessary for calculations can be reduced even further in case of larger groups of symmetries. It is easy to convince oneself that the sets of fixed points $(\phi_1, \phi_2, \xi)$, that is invariant under the action of a subgroup of ${\cal S}$, read as follows $$\begin{aligned} {\cal F}_1 &:& (\phi_1 = \phi, \; \phi_2 = \phi + \pi, \; \xi) \label{F1} \\ {\cal F}_2 &:& (\phi_1 = \phi, \; \phi_2 = - \, \phi , \; \xi) \label{F2} \\ {\cal F}_3 &:& (\phi_1 = \pm \, \frac{\pi}{2}, \; \phi_2 = \pm \,\frac{\pi}{2} , \; \xi) \label{F3}\end{aligned}$$ in which the ${\cal F}_i$ are invariant under the action of subgroups ${\cal H}_1, \; {\cal H}_2, \; {\cal H}_3$, respectively. The above symmetries are illustrated in Figure 4. ![ \[symmetrygraph\] (a) Cube of the symmetries indicating sets in space $\phi_1, \phi_2, \xi$ invariant with respect to subgroups of ${\cal S}$. Main diagonal plane, $B$, corresponding to subgroup ${\cal H}_2$; two rectangles perpendicular $A$ to ${\cal H}_1$; solid lines $\gamma_1, \; \gamma_4$, and $\gamma_2, \; \gamma_3$ corresponding, to ${\cal H}_3$ and ${\cal H}$, respectfully. (b) Cube of the symmetries view from the top. Dotted line describes invariant points ${\cal F}_2$, corresponding to subgroup ${\cal H}_2$; dashed line points ${\cal F}_1$ and subgroup ${\cal H}_1$; solid circles $\gamma_1$ and $\gamma_4$ to subgroup ${\cal H}_3$; $\gamma_2$ and $\gamma_3$ to subgroup ${\cal H}$. ](fig4.eps){width="1.\textwidth"} The analysis of symmetries of $U$ given above, cf. p. , enables us to sort out the minima according to the effective value of the phosphate charge $Q$. The dependence of the values of minima on the effective charge is illustrated in Figure 5. ![ Minima of $U$ in units of $k_B T, \; T = 300 K$: (a) cholesteric angle $\xi > 0$; (b) $\xi < 0$; against effective charge $q$ in units of the electron charge. Values of $U(\xi, \phi_1, \phi_2)$ and $U(- \; \xi, \phi_1, \phi_2)$ are equal to within $0.01 \; k_B T$. Minima that could correspond to cholesteric phase with $\xi > 0$ vanish at $q = 0.013$ []{data-label="fig:chargeagainstenergy-separated"}](fig5.eps){width="60.00000%"} ![\[q\_E\] Cholesteric angle $\xi$ against effective charge $q$ in units of the electron charge. PP-groups are located symmetrically: (A) no PP-groups; (B) one PP-group at either end of a molecule; (C) two PP-groups at either end of a molecule; (D) three PP-groups; (E) every tenth P-group is exchanged for the PP-one. ](fig6.eps){width="60.00000%"} It should be noted that minima of the pair-interaction $U$ depend on the distance between molecules $\kappa$, and the effective phosphate charge $Q$. The latter is the control parameter we employ in numerical simulation. It is also useful for the description of possible experimental results. In this paper we are considering $\kappa$ to within $10.2 \pm 34$ Å. Effective charge $Q$ of phosphate groups determines the neutralization; it varies to within $0 \pm .6$, in dimensionless units, $Q=0$ corresponding to the total neutralization. Charges $Q$ that correspond to the charge inversion, have not been considered. The Debye length, $\lambda$, has been varied to within $7 \pm 35$ Å, depending on the ion strength of solution. The value of effective charge $Q$ is determined by its electrostatic surrounding. It depends not only on ion charges in solvent, but also on those adsorbed by a molecule of the DNA.It seems that the conventional Debye — Hückel theory does not work in this situation, [@podg]. At any rate, it does not accommodate the adsorbed charges.According to [@livolant2] the effective charge is small. The numerical data and the symmetry analysis given above suggest that there should be the following three types of the minima. 1. Type I characterized by molecules having a cross-like conformation, “ snowflakes”, that is $\xi$ being close to $\pi /2$. It exists for $Q$ large enough. Its symmetry subgroup depends on $Q$ and may take values ${\cal H}_1, \; {\cal H}_2, \; {\cal H}_3, \;{\cal H}$. Therefore, we may claim that there exist four sub-types of minima I: $\rm{I}_{{\cal H}_1}, \; I_{{\cal H}_2}, \;I_{{\cal H}_3}, \;I_{{\cal H}}$, each of them consisting of two subtypes which are given by specific conformations of the angle variables.\ 2. Type II for which $\xi$ takes values to within $0.1^{o}$; the symmetry subgroups are ${\cal H}_1$ and ${\cal H}_2$, either type consists of two sub-types. 3. Type III for which $\xi$ is to within $1^{o}$, that is larger than for II. The symmetry subgroup is ${\cal H}_3$, and there are four constituent types of the same symmetry. As can be inferred from the considerations given above, the study of the pair-interactions between molecules of the DNA requires a means to vary the charges of a molecule and their positions in it. By now the only method available to that end is to vary the ion composition of solvent, the molecules itself being intact. The use of the DNA containing PP-groups, should provide new opportunities for the research, for it could change in a prescribed way the conformation of charges of the molecule. Thus one may compare the formation of liquid crystalline phases for the same solutions but for a different charge conformation of the DNA. Our numerical simulation suggests that the effect could be tangible enough to be looked in experiment. The dependence of the minima on effective charge taking into account PP-groups is indicated in Figure 6. The behavior of $U$ is illustrated in Figure 7 by means of iso-energy surfaces. Another point in favor of working with the pyro-phosphate forms of the DNA is that one can vary the effective charges of a molecule. In the case of the usual phosphate DNA the phosphate charges are all equal, and therefore one may suggest that the effective charges, which enter in our simulation, are also equal. Using the pyro-phosphate forms we may expect to achieve even the regime for which all the phosphate charges are neutralized whereas the pyro-phosphate ones still remain, even though being small. Such an experiment would be helpful in determining the nature of intra-molecular pair interaction that leads, according to the accepted physical picture, [@lk_model], to the formation of cholesteric phases of the DNA. The main point about our numerical simulation is the choice of values for effective charges and dipoles. In case there are PP-groups we may consider the effective charges in a way described above. The situation is more subtle as far as dipoles are concerned. We assume their numerical values being of the first order in the units indicated above. This is as much as to say that the charges of base pairs that constitute dipoles, are screened much less than the phosphate ones. If we proceed otherwise and take small values of the dipoles, there are no minima small but nonzero value of $\xi$, that is no cholesteric phases. In fact, they are, [@livolant1]. Thus, it is reasonable to assume that the charges of base pairs are screened in a manner different from that for the phosphate ones. One may suggest to the effect that the renormalization of charges is due mainly to adsorption of ions from the solvent, and not to the screening clouds of ions in the solvent. If so, it is likely that the charges of P-groups, due to ions of $O^{-}$, are in a different positions than those of the base pairs, and the renormalization of charges of P-groups and base pairs follow different paths. For this argument we are indebted to Yu.M. Yevdokimov. The important point is that PP-groups make for the formation of cholesteric angles different from those of P-groups, and thus provide a means of the identification of new phases. Summing up: - the phase of “snowflakes” sustains the presence of PP-groups; - the PP-groups may result in splitting energy levels of minima, so that minima corresponding to the same values of $U$ become different, when PP-groups are present; - minima of $U$ are separated by low potential barriers; iso-energy surfaces of constant values of $U$, being like galleries between halls that illustrate the minima; - minima corresponding to cholesteric phases are very narrow, whereas those of snowflakes are broad and sloping; energy barriers separating minima corresponding to snowflakes and cholesteric phases, respectively, are of the order $k_{B}T$; - values of angles $\phi_1, \; \phi_2$ are subject to constraints inside galleries joining two minima, ![ Surfaces of constant value of $U$ near cholesteric minima. (a) Screened charge $q = 0.0086$ $q_e$, energy level is $0.05 \; kT$. (b) Screened charge $q = 0.0086$ $q_e$, energy level is $0.2 \;kT$. \[fig:cube1\] ](fig7.eps){width="1.\textwidth"} Conclusions: New opportunities for studying the liquid crystalline phases of the DNA. ====================================================================================== The pyro-phosphate DNA may serve a valuable probe into the physics of cholesteric phases of the DNA. providing a unique opportunity for changing the effective charge of a molecules of the DNA. The use of PP-forms may result in appreciable experimental effects, which in its turn could throw light on the nature of intramolecular interaction in solution of the DNA. The charge screening still poses a number of questions. The usual Debye - Hückel theory does not seem to be an adequate solution, [@podg], especially as the screening of electrical dipole moments is concerned. A theory that could give a reasonable agreement with experiment, should be that of finite number of particles, whereas the Debye - Hückel theory relies on the use of macroscopical considerations. The study of the cholesteric phases of the DNA with pyrophosphate inter-nucleotide insertions could provide a means to find characteristics that indicate a way to understanding the phenomenon. An important issue is the different screening of the phosphate charges and the dipoles of the base pairs. It is should be noted that the screening is caused by a non-uniform adsorption of counterions at a molecule of the DNA, so that the phosphate charges and the base pair dipoles are not screened in the same manner. Our calculations rely on a model that is based on general and qualitative assumptions of the helical charge distribution of the DNA. We feel that it accommodates a picture of the DNA, without going into finer details, and agrees with the approach of paper [@lk_model] in which the continuous approximation plays the directive part. The choice of the pair-potential for the intramolecular interaction is important. The shape of the pair potential chosen in this paper enabled us to accommodate the two different sets of charges — the Coulomb and the dipole ones, and also take into account a finer detail of the pyrophosphate charges, which could turn out to be a valuable instrument for further investigating the cholesteric phases. The symmetry constraints have played an important part in finding the minima of the pair-potential. It seems that their meaning could be greater than a simple arithmetic device for simplifying calculations, and could indicate certain symmetry law peculiar to the cholesteric phases of the DNA. It is reasonable to expect the polymorphism liquid crystalline phases of the DNA. New artificially synthesized phases of the DNA could be a fruitful instrument to that end. We are thankful to F.Livolant for the useful correspondence. This work was done within the framework of the Interdisciplinary Programme of the Lomonosov Moscow State University, and partially supported by RFBR Grant \# NS—660.2008.1. [99]{} C.Robinson, Tetrahedron, [**13**]{}, 219 (1961). F.Livolant, J.de Phys. (Paris), [**47**]{}, 1605 (1986). F.Livolant, Biophys. J., [**65**]{}, 56 (1993). Onsager L., Ann.Acad.Sci. NY, [bf 51]{}, 621 (1999). A.A. Purmal, V.L. Druca, Z.A. Shabanova, Bio-Org.Chem. [**10**]{}, 394 (1984) (in Russian). S.A. Kuznetsova, C. Clusel, E. Ugarte, I. Elias, M. Vasseur, M. Blumenfeld, and Z.A. Shabanova, Nucl.Acids Res. [**24**]{}, 4783 (1996). G.Ya. Sheflyan, E.A. Kubareva, S.A. Kuznetsova, A.S. Karyagina, I.I. Nikol’skaya, E.S. Gromova, and Z.A. Shabanova, FEBS Lett. [**390**]{}, 307 (1996). A.A. Purmal, Z.A. Shabanova, R.I. Gumport, Nucl.Acids Res. [**20**]{}, 3713 (1992). M.V. Rogacheva, A.V. Bochenkova, S.A. Kuznetsova, M.K. Saparbaev, and A.V. Nemukhin, J.Phys.Chem. [**111**]{}, 432 (2007). A.A.Kornyshev and S.Leikin, J.Chem.Phys. [**107**]{}, 3656 (1997). A.A.Kornyshev and S.Leikin, Phys.Rev.Lett., [**84**]{}, 2537 (2000). A.A.Kornyshev, D.J.Lee, S.Leikin, A.Wynveen, and S.B.Zimmerman, Phys.Rev.Lett., [**95**]{}, 148102-1, (2005). A.A.Kornyshev and S.Leikin, Proc.Natl.Acad.Sci.U.S.A. [**95**]{}, 13579 (1998). Y.H.Kim, J. de Phys.(Paris) [**43**]{}, 559 (1982). B.Samorĭ, M.Osipov, I.Domini, and A.Bartolini, Int.J.Macromol., [**15**]{}, 353 (1993). V.L.Golo, E.I.Kats, and I.P.Kikotx, Pisma ZhETF [**84**]{}, 334 (2006). V.L. Golo, E.I.Kats and, Yu.S.Volkov, Pis’ma ZhETF [**86**]{}, 311 (2007), M.A.El Hassan and C.R.Calladine 1995 J.Mol.Biol. [**251**]{} 648 Punkkinen1 O., Naji A. , Podgornik R., . Vattulainen1 I., and Hansen  P.-L., EPL, [**82**]{}, 48001, (2008).

I will blog here anything that I find interesting and useful in the world of internet. I will write about internet,news and events around the world in the fields of Science, Technology, Money Making, Fashion, Politics, Automobile, Spirituality, E-commerce, Religion, Education, Blogging, Business, Entertainment, Movie world, Books, Video games, Television, Celebrities, Festivals, Shopping, Computer Security, Search Engines and Directories, Home and Garden. My life slogan: Pass it on; Share Tuesday, June 3 Have you seen the magnetic field? We have all been reading about magnetic field since our school days. We have seen and participated in conducting experiments on magnetic field, took a few readings on a gauge and graphed the map of showing the magnetic field but.. But we have never really seen a magnetic field with our eyes-right? Now are you ready to see it? Warning!After seeing this video clip and reading the comments, it is likely to develop doubts over the authenticity of it. I just took it in my stride and enjoyed it.

Introduction {#Sec1} ============ A hexanucleotide repeat expansion mutation in *chromosome 9 open reading frame 72* (*C9orf72*) is the most common known genetic cause of amyotrophic lateral sclerosis (ALS), a fatal neurodegenerative disease characterized by the progressive loss of corticospinal, brainstem and spinal motor neurons. A *C9orf72* mutation underlies approximately 40% of familial and 5% of sporadic ALS cases^[@CR1]--[@CR3]^. This hexanucleotide expansion is also found in approximately 10% of cases of a second neurodegenerative disease, frontotemporal dementia (FTD), a common cause of dementia in middle-aged patients^[@CR3]--[@CR5]^. Mutations in *C9orf72* are a rare risk factor for several additional neurologic and psychiatric disorders including Alzheimer's disease, Parkinson's disease, Huntington's disease phenocopy patients, multiple system atrophy, depressive pseudodementia, bipolar disorder, and schizophrenia^[@CR6]--[@CR16]^. However, it is not known how this genetic mutation leads to these cell type-specific neurodegenerative disorders. Both loss-of-function and gain-of-function mechanisms have been proposed to mediate *C9orf72*-linked ALS^[@CR17],\ [@CR18]^. Several studies have demonstrated decreased *C9orf72* transcript and protein levels in patients with ALS and FTD^[@CR19]--[@CR23]^. Deletion of the mouse ortholog of the *C9orf72* gene (3110043O21Rik, referred to here as *C9orf72*) has been reported to shorten lifespan and induce modest motor deficits in some, but not all mouse models, and cause profound dysregulation of the immune system^[@CR24]--[@CR29]^. Gain-of-function toxicity of the repeat expansion induced by sense and anti-sense RNA transcripts, as well as dipeptide proteins generated through repeat-associated non-ATG (RAN) translation, are also thought to contribute to neurodegeneration^[@CR17],\ [@CR18]^. Several transgenic mouse lines recently developed using patient-derived gene constructs demonstrate that *C9orf72* repeat expansions induce age-dependent accumulation of RNA foci and dipeptide repeat proteins, along with neurodegeneration and behavioral abnormalities that at least partially recapitulate human disease^[@CR26],\ [@CR28],\ [@CR30],\ [@CR31]^. Although the complex mechanisms underlying *C9orf72*-related disease have not been resolved, understanding the expression pattern of *C9orf72* in the central nervous system (CNS) is not only important for understanding the pathogenesis of ALS, but is also relevant to the wide spectrum of *C9orf72*-associated diseases. Although the signature of ALS is the loss of corticospinal, brainstem, and spinal motor neurons, multiple cell types have been shown to contribute to the pathogenesis of the disease. Non-neuronal cells including oligodendrocytes, astrocytes, and microglia are also critical players in the pathogenesis of ALS^[@CR17]^. Although some progress has been made in understanding the cell-type specific expression of *C9orf72* ^[@CR26],\ [@CR28],\ [@CR32]^, a comparison of the distribution of *C9orf72* expression across different neuronal and glial cell types in relevant regions of the brain and spinal cord is still lacking. Whether *C9orf72* promoter activity is specifically enriched in affected corticospinal neurons, spinal motor neurons, or oligodendrocytes in regions implicated in ALS is not yet fully understood. Here, we systematically mapped the promoter activity of the mouse ortholog of *C9orf72* in a genetically engineered strain of mice containing a targeted *LacZ* insertion under the control of the *C9orf72* native promoter. Through quantitative comparisons among different types of neurons and glial cells labelled with retrograde neuronal tracers and cell type-specific markers, we demonstrate that mouse *C9orf72* promoter activity, although widespread throughout the brain and spinal cord, is specifically enriched in corticospinal and spinal motor neurons and in oligodendrocytes, subsets of cells known to undergo degeneration in ALS, in regions affected by ALS. In contrast, *C9orf72* promoter activity was detected in only a small percentage of microglial cells and even fewer astrocytes. Thus, these data suggest that, despite widespread expression, *C9orf72* promoter activity reflects the patterns of degeneration typically seen in this disease, consistent with direct cell autonomous toxicity. Results {#Sec2} ======= The distribution of *C9orf72* promoter activity and cellular density are highly correlated in the CNS {#Sec3} ----------------------------------------------------------------------------------------------------- Mice have a single gene, 3110043O21Rik (here referred to as *C9orf72*), which is orthologous to human *C9orf72* ^[@CR32]^. To determine the distribution of *C9orf72* promoter activity in the central nervous system, we generated chimeric mice using several mouse embryonic stem cell lines heterozygous for an allele with a *LacZ* insertion in the *C9orf72* locus generated by the Knock Out Mouse Project (KOMP)^[@CR29],\ [@CR32]--[@CR35]^. The *LacZ* insertion results in deletion of exons 2--6 of the mouse *C9orf72* gene, producing a knockout allele (Supplementary Fig. [1a](#MOESM1){ref-type="media"}). Analysis of RNA-sequencing (RNA-seq) data from mice generated using the same targeting cassette and embryonic stem (ES) cell background indicates that the transcript structure is largely maintained between wild type (WT) and *C9orf72* ^*LacZ*/+^ mice^[@CR28]^ (Supplementary Fig. [1b](#MOESM1){ref-type="media"}). Although WT transcripts have two alternative starts, exon 1a or 1b, while the *LacZ* allele appears to use only exon 1a, there is no reported evidence for differential usage of exon 1a and 1b among different cell types indicating that the *LacZ* reporter likely reflects the pattern of the wild type gene expression. The heterozygous mice have a normal phenotype until six months of age, after which a fraction of *C9orf72* ^*LacZ*/+^ mice exhibit an age-dependent decrease in survival, with approximately 20% of the heterozygotes dead by 600 days^[@CR29]^. We therefore used young, six to eight-week-old heterozygotes to assess the distribution of *LacZ* as a reporter for *C9orf72* promoter activity. We confirmed that *C9orf72* promoter activity was not limited to areas known to degenerate in ALS and FTD. X-gal staining to assess regions of β-galactosidase (β-gal) expression (encoded by *LacZ*) revealed widespread promoter activity throughout the brain and spinal cord. The regions with the most intense X-gal signals in the brain corresponded to regions with high cell density, such as the dentate gyrus of the hippocampus and the granular layer of the cerebellum (Fig. [1a](#Fig1){ref-type="fig"}). Regions with the weakest signals corresponded to areas with low cell densities such as the molecular layer of the cerebellum and the corpus callosum (Fig. [1a](#Fig1){ref-type="fig"}). We also observed broad X-gal staining in primary motor cortex (Fig. [1a](#Fig1){ref-type="fig"}) and in the spinal cord (Fig. [1b](#Fig1){ref-type="fig"}). These results suggest that the distribution of *C9orf72* promoter activity largely follows cellular density across brain regions. To more directly test this hypothesis, we compared the distribution of cells stained with the nuclear marker, DAPI, and an antibody specific to β-galactosidase (β-gal; Supplementary Fig. [1c](#MOESM1){ref-type="media"}) and found that the distribution of β-gal signal correlated with the overall cellular density across layers in primary motor cortex, primary somatosensory cortex, and spinal cord grey matter (Fig. [1c-d](#Fig1){ref-type="fig"}). Together, these results indicate that *C9orf72* promoter activity is widely distributed in the CNS, consistent with that reported in previous studies^[@CR26],\ [@CR27],\ [@CR32]^, and largely correlates with overall cellular density.Figure 1The distribution of *C9orf72* promoter activity follows overall cellular density in the central nervous system. (**a**) The overall distribution of *C9orf72* promoter activity in a parasagittal brain section from a *C9orf72* ^*LacZ/*+^ mouse revealed using X-gal staining. *C9orf72* promoter activity was high in brain regions with high cell density (dentate gyrus of the hippocampus, cerebellar granule cell layer, two left panels), low in regions with low cell density (cerebellar molecular cell layer and corpus callosum, middle panels), and medium in motor cortex (rightmost panel). (**b**) The overall distribution of *C9orf72* promoter activity in a coronal section of the lumbar spinal cord. X-gal staining was seen in both the dorsal and ventral horns (left and right panels) (**c**) Representative images showing the distribution of immunofluorescence staining for β-gal in primary motor (top) and somatosensory (bottom) cortex of *C9orf72* ^*LacZ/*+^ mice concurrently labelled with the nuclear stain, DAPI. The intensities of the β-gal (red) and DAPI (blue) signals were summed along the horizontal axis in the region indicated by the white boxes (n = 3 mice) and the intensity values plotted (mean ± SEM). (**d**) A similar analysis was performed for lumber spinal cord (*n* = 3 mice). Scale bars: (**a**) 1 mm, insets 100 µm, (**b**) 200 µm, insets 100 µm and **(c,d)** 300 µm. *The C9orf72* promoter is active in both excitatory and inhibitory neurons {#Sec4} -------------------------------------------------------------------------- Although at a macroscopic level, *C9orf72* promoter activity was correlated with overall cellular density throughout the brain and spinal cord, enrichment or reduction of *C9orf72* promoter activity in specific regions of the neocortex or spinal cord or within specific cell types in each region would go undetected at this level of analysis. Therefore, we compared the distribution of *C9orf72* promoter activity in neurons in primary motor cortex, a cortical region which undergoes degeneration in ALS, as well as primary somatosensory cortex (see Methods). *C9orf72* promoter activity was observed in more than 80% of the neurons labelled with antibodies to NeuN in layer 5 (L5) of primary motor cortex, which contains corticospinal neurons known to degenerate in ALS (Fig. [2a,b](#Fig2){ref-type="fig"}). Unexpectedly, neurons in layer 2/3 (L2/3) of primary somatosensory cortex, which consists primarily of excitatory corticocortical projection neurons, and L5 of primary somatosensory cortex, exhibited a similar distribution of *C9orf72* promoter activity (Fig. [2a,b](#Fig2){ref-type="fig"}). Due to the high density of small β-gal-positive puncta in our samples, it is possible that we detected *C9orf72* promoter activity in such a large number of neurons spuriously. To assess whether the distribution of the β-gal signal was specific to these neurons, we compared the percentage of β-gal-positive neurons detected before and after inverting the β-gal channel relative to the NeuN channel in each analyzed image. Following channel inversion, the percentage of β-gal-positive neurons significantly decreased, indicating that the relationship between the distribution of β-gal-positive puncta and the distribution of neurons is greater than would be expected by chance (Supplementary Fig. [2](#MOESM1){ref-type="media"}). These data demonstrate that the overall distribution of *C9orf72* promoter activity in neurons is similar between primary motor cortex and primary sensory cortex when specific cell types are not taken into account.Figure 2*C9orf72* promoter activity is widespread in inhibitory neurons. (**a**) Representative images of layer 5 (L5) of primary somatosensory cortex (S1, *top*) and primary motor cortex (M1, *bottom*) from *C9orf72* ^*LacZ/*+^ mice stained for NeuN (green) and β-galactosidase (β-gal; red). High magnification images show β-gal-positive puncta within NeuN-positive neurons (*rightmost panels*). Scale bars: 50 μm and 10 μm. (**b**) The percentage of neurons containing β-gal puncta in layer 2/3 and L5 of somatosensory cortex and L5 of motor cortex (S1 L2/3: 362 of 429 cells, 84.4%; S1 L5, 499 of 583 cells, 85.6%; M1 L5: 425 of 523 cells, 81.3%; *n* = 3 mice for each group, *p* = 0.1378, Chi-Square test). (**c**) Representative images of layer 1 (L1) of somatosensory cortex stained for NeuN (green) and β-gal (red). High magnification images showing β-gal-positive puncta within L1 neurons (*rightmost panels*). Scale bars: 50 μm and 5 μm. (**d**) The percentage of L1 neurons containing β-gal puncta (26 of 32 cells, 81.3%, *n* = 3 mice). (**e**) Representative images of L5 of motor cortex stained for parvalbumin (PV, green) and β-gal (red). High magnification images show β-gal puncta within a PV interneuron (*rightmost panels*). Scale bars: 50 μm and 10 μm. (**f**) The percentage of PV interneurons containing β-gal puncta in L5 of motor cortex and somatosensory cortex (M1 L5: 36 of 51 cells, 70.6%; S1 L5: 32 of 37 cells, 86.5%; *n* = 3 mice for each group, *p* = 0.0789, Chi-Square test). Although *C9orf72* transcripts have been identified in excitatory cortical projection neurons and spinal motor neurons^[@CR26],\ [@CR32]^, whether *C9orf72* promoter activity is found in inhibitory neurons is not known. To test for *C9orf72* promoter activity in inhibitory neurons, we first analysed neurons in layer 1 (L1) of the cortex, which are overwhelmingly GABAergic^[@CR36],\ [@CR37]^. We found that β-gal-positive puncta were detected in more than 80% of L1 inhibitory interneurons (Fig. [2c-d](#Fig2){ref-type="fig"}). Similarly, we found that *C9orf72* promoter activity was detected in approximately 70 to 85% of cortical parvalbumin-expressing (PV) inhibitory interneurons, the most common type of interneurons in the cortex^[@CR37]^ (Fig. [2e,f](#Fig2){ref-type="fig"}), demonstrating that *C9orf72* promoter activity is not limited to glutamatergic cortical projection neurons. Taken together, these data demonstrate that *C9orf72* promoter activity is also widespread in inhibitory interneurons. *C9orf72* promoter activity is enriched in corticospinal and spinal motor neurons {#Sec5} --------------------------------------------------------------------------------- The hallmark of ALS is progressive degeneration of corticospinal and spinal motor neurons. A previous study reported that the majority of layer 5 (L5) cortical neurons exhibiting *C9orf72* promoter activity were CTIP2-positive^[@CR32]^, suggesting that sub-cerebral projection neurons, which include the corticospinal neurons (CSNs) that degenerate in ALS, express *C9orf72*. To further test this hypothesis, we compared the distribution of *C9orf72* promoter activity in retrogradely labelled CSNs and in unlabeled NeuN-positive neurons intermingled within L5 of motor cortex (Fig. [3a,b](#Fig3){ref-type="fig"}). A significantly higher percentage of CSNs exhibited β-gal-positive puncta than unlabeled neighboring neurons, indicating that *C9orf72* promoter activity is specifically enriched in corticospinal neurons (Fig. [3c,d](#Fig3){ref-type="fig"}; *p* \< 0.0001, Chi-Square test). Similarly, a significantly higher percentage of choline acetyltransferase (ChAT)-immunoreactive spinal motor neurons exhibited detectable *C9orf72* promoter activity than either ChAT-immunonegative neurons intermingled within the same region of the ventral horn or ChAT-immunonegative neurons in the dorsal horn of the spinal cord (Fig. [3e,f](#Fig3){ref-type="fig"}; *p* \< 0.0001, Chi-Square test). Together, these results indicate that *C9orf72* promoter activity is specifically enriched in both retrogradely labelled corticospinal neurons and cholinergic spinal motor neurons, neuronal types that are specifically vulnerable in ALS.Figure 3*C9orf72* promoter activity is enriched in corticospinal and spinal motor neurons. (**a**) Schematic of the experimental design. Green fluorescent retrograde tracers were injected into the contralateral cervical spinal cord to retrogradely label corticospinal neurons in *C9orf72* ^*LacZ/*+^mice. (**b**) Retrogradely labelled corticospinal neurons are shown in layer 5 (L5) of primary motor cortex. Scale bar: 100 μm. (**c**) Representative images of L5 of motor cortex showing NeuN-positive neurons (cyan), retrogradely labelled corticospinal neurons (green) and β-gal staining (red). High magnification images show β-gal puncta within a corticospinal neuron (*rightmost panels*). Scale bars: 50 μm and 5 μm. (**d**) The percentage of unlabeled NeuN-positive neurons and of corticospinal neurons (CSNs) containing β-gal puncta in L5 of motor cortex (Unlabeled NeuN-positive neurons: 1357 of 1771 cells, 76.6%; CSNs: 132 of 137 cells, 96.4%; *n* = 5 mice for each group, *p* \< 0.0001, Chi-Square test). Unlabeled NeuN-positive neurons and retrogradely labelled corticospinal neurons were analyzed from the same images. (**e**) Representative images of the dorsal (*top*) and ventral horn (*bottom*) of the spinal cord immunostained for NeuN (green), Choline acetyltransferase (ChAT; cyan), and β-gal (red). High magnification images show β-gal puncta within NeuN-positive neurons in the dorsal horn (*top right)* and a ChAT-positive neuron in the ventral horn (*bottom right*). Scale bars: 50 μm and 10 μm. (**f**) The percentage of ChAT-negative and ChAT-positive neurons containing β-gal puncta in the dorsal and ventral horn of spinal cord (dorsal neurons: 734 of 1050 cells, 69.9%; ventral ChAT-negative neurons: 61 of 78 cells, 78.2%; ventral ChAT-positive neurons: 113 of 114 cells, 99.1%; *n* = 5 mice for each group; *p* \< 0.0001, Chi-Square test). *C9orf72* promoter activity in Purkinje cells and cerebellar granule cells {#Sec6} -------------------------------------------------------------------------- *C9orf72*-mediated disease is notable for RNA foci and neuronal inclusions found in the cerebellum^[@CR38]--[@CR41]^. RAN-translated polypetides stemming from the hexanucleotide repeat expansion have been detected in Purkinje cells and granule cells^[@CR40]^. Furthermore, prior studies have detected high levels of *C9orf72* expression in the cerebellum^[@CR23],\ [@CR42]^. Here we assessed *C9orf72* promoter activity in both Purkinje cells and granule cells in the cerebellum. Consistent with the X-gal staining showing intense signal in the cerebellum (Fig. [1a](#Fig1){ref-type="fig"}), we detected *C9orf72* promoter activity in a large percentage of both Purkinje cells and cerebellar granule cells (Fig. [4](#Fig4){ref-type="fig"}). Overall, 41.2% of Purkinje cells and 55.8% of granule cells had detectable *C9orf72* promotor activity (*p* = 0.0116, Chi-Square test), indicating that *C9orf72* promoter activity is relatively enriched in the granule cell layer. These data provide additional evidence for cell-type specific enrichment of *C9orf72* promoter activity in distinct cell types in affected brain regions in *C9orf72*-mediated disease.Figure 4*C9orf72* promoter activity in Purkinje cells and granule cells of the cerebellum. (**a**) Representative images of the cerebellum showing calbindin-positive Purkinje cells (green), NeuN-positive granule cells (cyan), and β-gal staining (red). Scale bar: 100 μm. (**b**) Representative images of calbindin-positive Purkinje cells (green) and β-gal (red). Scale bars: 50 μm and 10 μm. (**c**) The percentage of Purkinje cells containing β-gal puncta (35 of 85 cells, 41.2%, *n* = 3 mice). (**d**) Representative images of NeuN-positive granule cells (green) and β-gal (red). Scale bars: 10 μm and 2 μm. (**e**) The percentage of granule cells containing β-gal puncta: (306 of 548 cells, 55.8%; *n* = 3 mice). Cell-type and region specific regulation of *C9orf72* promoter activity in glial cells {#Sec7} -------------------------------------------------------------------------------------- Glial cells play important roles in the pathophysiology of ALS. Astrocytes undergo reactive changes in ALS, although their role in the initiation and progression of *C9orf72*-mediated ALS remains to be elucidated^[@CR17],\ [@CR43]--[@CR45]^. While a prior study reported that spinal cord astrocytes did not express *C9orf72* ^[@CR32]^, RNA sequencing experiments detected low levels of *C9orf72* transcripts in mouse^[@CR28],\ [@CR46]^ and human astrocytes^[@CR47]^. Consistent with the RNA sequencing data, we found that approximately 20% of S100β-positive astrocytes in the spinal cord had detectable *C9orf72* promoter activity (Fig. [5a-c](#Fig5){ref-type="fig"}). Interestingly, almost no S100β-positive astrocytes in the cortex exhibited detectable *C9orf72* promoter activity (Fig. [5a-c](#Fig5){ref-type="fig"}). These data indicate that far fewer astrocytes than neurons express *C9orf72*, and that *C9orf72* promoter activity is not only regulated in a cell-type specific manner but also in a region dependent way.Figure 5Differential *C9orf72* promoter activity in cortical and spinal cord astrocytes. (**a**) Representative images of layer 5 (L5) in primary motor cortex (M1, *top*) and the ventral horn of the spinal cord (SC, *bottom*) of *C9orf72* ^*LacZ/*+^ mice immunostained for S100β-positive astrocytes (green), Olig2-positive oligodendrocyte lineage cells (cyan), and β-gal (red). Asterisks indicate S100β-positive Olig2-positive oligodendrocyte lineage cells and S100β-positive motor neurons which were excluded from the analysis. High magnification images show an astrocyte in motor cortex which lacks β-gal puncta (*top right*) and astrocytes in the spinal cord which contain β-gal puncta (*bottom right*). Scale bars: 50 μm and 10 μm. Percentage of astrocytes containing β-gal puncta in L5 of primary motor and primary somatosensory cortex (**b**) L5 motor cortex: 1 of 92 cells, 1.1%, L5 somatosensory cortex, 1 of 98 cells, 1.0%, *n* = 3 mice for each group, *p* = 0.9641, Chi-Square test) and spinal cord (**c**) dorsal spinal cord: 15 of 84 cells, 17.9%, ventral spinal cord: 16 of 78 cells, 20.5%, *n* = 3 mice for each group, *p* = 0.6676, Chi-Square test). Recent studies have demonstrated that *C9orf72* plays an important role in regulating the immune system^[@CR24],\ [@CR25],\ [@CR28]^ and have reported high levels of *C9orf72* transcript expression in bulk cellular populations enriched for microglia^[@CR28],\ [@CR46]^. In contrast, a prior study detected *C9orf72* promoter activity in only a small subset of microglia in the anterior horn of the spinal cord^[@CR32]^. Similarly, we found that only a small proportion of Iba1-immunoreactive microglia in the cortex and spinal cord had detectable *C9orf72* promoter activity (Fig. [6a--c](#Fig6){ref-type="fig"}). These findings suggest that the level of expression of *C9orf72* varies substantially across the population of microglial cells in the brain and spinal cord, with only a few cells expressing high levels and the majority expressing low or undetectable levels.Figure 6*C9orf72* promoter activity is detected in few microglia. (**a**) Representative images of layer 5 (L5) of primary motor cortex (M1, *top*) and the ventral horn of the spinal cord (SC, *bottom*) of *C9orf72* ^*LacZ/*+^ mice immunostained for Iba1-positive microglia (green) and β-gal (red). High magnification images show microglia which do not contain β-gal puncta in the motor cortex (*top right*) and the spinal cord (*bottom right*). Scale bars: 50 μm and 10 μm. The percentage of microglia containing β-gal puncta in L5 of the primary motor and primary somatosensory cortex (**b**) L5 of somatosensory cortex: 16 of 127 cell, 16.0%; L5 of motor cortex: 22 of 160 cells, 15.2%; *n* = 7 mice for each group, *p* = 0.7749, Chi-Square test) and the spinal cord (**c**; dorsal spinal cord: 14 of 106 cells, 13.2%; ventral spinal cord: 2 of 34 cells, 5.9%, *n* = 3 mice for each group, *p* = 0.2427, Chi-Square test). Oligodendrocytes provide metabolic support critical for neuronal health particularly for long axons. The degeneration of oligodendrocytes seen in ALS patient tissue and in mouse models of the disease suggests that these cells play an important role in the selective vulnerability of specific neuronal populations in ALS^[@CR48]--[@CR51]^. Removal of the ALS mutation *SOD1* ^*G37R*^ from the oligodendrocyte lineage significantly delays disease onset and extends the lifespan of ALS model mice^[@CR52]^, providing further support for an important contribution of oligodendrocyte dysfunction in the disease. Although *C9orf72* expression has been reported in oligodendrocytes^[@CR26],\ [@CR28]^, the distribution of *C9orf72* promoter activity in the cortex and spinal cord is still poorly understood. We found that more than 25% of CC1-immunoreactive oligodendrocytes in layer 5 of primary somatosensory cortex and of primary motor cortex exhibited *C9orf72* promoter activity. Interestingly, we detected β-gal puncta in a significantly greater percentage of CC1-positive oligodendrocytes in motor cortex than primary somatosensory cortex (Fig. [7a,b](#Fig7){ref-type="fig"}; *p* = 0.014, Chi-Square test), indicating enrichment of *C9orf72* expression in cortical regions which undergo the most profound degeneration in ALS. An even greater percentage of oligodendrocytes in the spinal cord exhibited detectable *C9orf72* promoter activity (Fig. [7a,c](#Fig7){ref-type="fig"}); the highest percentage of β-gal-positive, CC1-positive oligodendrocytes was found in the ventral white matter of the spinal cord, where almost 65% of oligodendrocytes were positive for β-gal (Fig. [7c](#Fig7){ref-type="fig"}; *p* \< 0.0001, Chi-Square test). *C9orf72* promoter activity was also observed in approximately 20--35% of cortical NG2-immunoreactive oligodendrocyte precursor cells (OPCs; Fig. [7d,e](#Fig7){ref-type="fig"}). More than 50% of OPCs of the spinal cord also exhibited *C9orf72* promoter activity (Fig. [7d,f](#Fig7){ref-type="fig"}). These data indicate that *C9orf72* promoter activity is detected in a much larger percentage of oligodendrocytes and OPCs than in astrocytes and microglia, and that *C9orf72* promoter activity is specifically enriched in oligodendrocytes in regions thought to degenerate in ALS.Figure 7*C9orf72* promoter activity in oligodendrocytes and OPCs is enriched in cortical regions associated with neurodegeneration in amyotrophic lateral sclerosis. (**a**) Representative images of layer 5 (L5) of the primary motor cortex (M1, top), ventral horn of the spinal cord (SC, middle), and the ventral white matter of the spinal cord (SC WM, bottom) of *C9orf72* ^*LacZ/*+^ mice immunostained for CC1-positive oligodendrocytes (green) and β-gal (red). High magnification images show colocalization of β-gal puncta within oligodendrocytes (right panels).The percentage of oligodendrocytes containing β-gal puncta in L5 of primary somatosensory (S1) and motor (M1) cortex (**b**) S1 L5: 38 of 167 cells, 26.0%; M1 L5: 82 of 234 cells, 35.0%; n = 5 mice for each group, p = 0.0140, Chi-Square test) and spinal cord (**c**) dorsal spinal cord: 209 of 533 cells, 39.2%; ventral spinal cord: 191 of 525 cells, 36.4%; spinal cord white matter: 283 of 438 cells, 64.6%, n = 3 mice for each group, p \< 0.0001 Chi-Square) (**d**) Representative images of L5 of primary motor cortex (M1, top) and the ventral horn of the spinal cord (bottom) immunostained for NG2-positive oligodendrocyte precursor cells (OPCs; green) and β-gal (red). High magnification images show colocalization of β-gal puncta within oligodendrocytes (right panels). The percentage of OPCs containing β-gal puncta in L5 of primary motor (M1) and primary somatosensory (S1) cortex (**e**) S1 L5: 21 of 92 cells, 22.6%; M1 L5: 33 of 92 cells, 36.5%; n = 5 mice for each group, p = 0.0520, Chi-Square test) and spinal cord (**f**) dorsal spinal cord: 39 of 75 cells, 52.0%; ventral spinal cord: 44 of 65 cells, 67.7%; n = 3 mice for each group, p = 0.0594, Chi-Square test). Scale bars: 50 μm and 10 μm. Discussion {#Sec8} ========== Genes that are mutated in ALS are widely expressed in the CNS, creating unique vulnerabilities in distinct cell types. To understand how these mutations alter cellular physiology we must define both the tissue and cellular expression patterns of these mutant genes. Here, we show that although the distribution of *C9orf72* promoter activity follows overall cellular density, there is striking enrichment in neuronal and glial cell types that degenerate in ALS. *C9orf72* promoter activity was detected in a significantly higher percentage of both corticospinal and spinal motor neurons than in neighboring neuronal cell types. Similarly, we demonstrate that *C9orf72* promoter activity was enriched in oligodendrocytes in cortical regions associated with ALS pathology compared to unaffected areas. In contrast to neurons and oligodendrocytes, we detected *C9orf72* promoter activity in few astrocytes and microglia^[@CR32]^. Together, these data indicate that the pattern of degeneration seen in ALS reflects the distribution of *C9orf72* promoter activity, suggesting that cell autonomous effects in these populations of neurons and glia may account for their loss. The widespread expression of *C9orf72* promoter activity we observed in this Neo-deleted KOMP mouse is consistent with the overall expression patterns reported in recent studies of the KOMP mouse^[@CR26],\ [@CR32]^ as well as *C9orf72* RNA expression data^[@CR26]--[@CR28],\ [@CR53]^, and indicates that the distribution of *C9orf72* promoter activity grossly follows cellular density throughout the CNS. However, an analysis of specific cell types demonstrated that widely varying fractions of cells expressed *C9orf72*. For example, a large majority of both inhibitory and excitatory neurons exhibited *C9orf72* promoter activity while a small minority of astrocytes did. The widespread expression of *C9orf72* by interneurons which we demonstrate here is particularly interesting, given their pivotal role in regulating neuronal excitability and brain states, and dysfunction of cortical inhibitory neurons may contribute to the cortical hyperexcitability seen in patients with *C9orf72* disease^[@CR54],\ [@CR55]^. Our data also indicate that *C9orf72* promoter activity is enriched in cell types and brain regions that undergo degeneration in ALS. A higher percentage of corticospinal neurons express *C9orf72* than either neighboring neurons in motor cortex or neurons in L5 of somatosensory cortex. Similarly, a higher percentage of oligodendrocytes in L5 of motor cortex express *C9orf72* than in L5 of somatosensory cortex. We also found that approximately 25--50% of oligodendrocytes and OPCs in the cortex and spinal cord expressed *C9orf72*. Importantly, we show that a greater fraction of oligodendrocytes in L5 of motor cortex expresses *C9orf72*, providing further evidence that cell types that degenerate in ALS express *C9orf72* more widely than other cell types in the CNS. Together with the evidence of widespread degeneration of oligodendrocytes in ALS patient tissue and mouse models^[@CR48]--[@CR51]^, and the finding that removal of the *SOD1* ^*G37R*^ ALS mutant transgene selectively from oligodendrocyte lineage cells significantly delays disease onset and extends the lifespan of ALS model mice^[@CR52]^, these data support the hypothesis that oligodendroglia are critical primary players in the selective degeneration of CNS regions in ALS. The pathological mechanisms associated with expression of mutated *C9orf72* may confer selective vulnerability on these cell types during the course of ALS and may help to explain the regional pattern of degeneration observed in ALS. A hallmark of *C9orf72*-mediated disease is cerebellar pathology including RNA foci and neuronal inclusions^[@CR38]--[@CR41]^. Prior studies have also detected high levels of *C9orf72* expression in the cerebellum^[@CR23],\ [@CR42]^. Consistent with this work, we detected *C9orf72* promoter activity in both Purkinje cells and cerebellar granule cells. Interestingly, a higher percentage of granule cells exhibited detectable *C9orf72* promoter activity than neighboring Purkinje cells, contributing to the intense staining we detected in the granule cell layer. Although there are marked neuropathological findings in the cerebellum in *C9orf72*-mediated disease and high levels of *C9orf72* expression, the relationship between these findings and any neurodegeneration remains unclear^[@CR38],\ [@CR56]^. In contrast to the enrichment of *C9orf72* promoter activity that we detected in neurons and oligodendrocyte lineage cells, we found that very few astrocytes and microglia exhibited detectable *C9orf72* promoter activity. Furthermore, there were striking regional differences in expression. For example, almost no cortical astrocytes exhibited *C9orf72* promoter activity while approximately 20% of the astrocytes in the spinal cord expressed *C9orf72*. These results are consistent with analyses of *C9orf72* transcript expression, although an early study did not detect *LacZ* expression in spinal cord astrocytes in a similar mouse line^[@CR24],\ [@CR26],\ [@CR28],\ [@CR32],\ [@CR46]^. Recent studies have demonstrated high levels of *C9orf72* expression in enriched microglia cell populations^[@CR26],\ [@CR28],\ [@CR46]^. This result is surprising in view of the small percentage of spinal cord microglia previously found to exhibit *C9orf72* promoter activity in the KOMP mouse^[@CR32]^. Not only did we also detect *C9orf72* promoter activity in only a small fraction of microglia in the spinal cord, we found that few microglia in the cortex exhibited detectable *C9orf72* promoter activity. It is possible that *C9orf72* transcript levels may depend on the activation state of a microglial cell, and that *C9orf72* expression is rapidly upregulated when cells are dissociated from the brain for gene expression analysis. Recent work demonstrating that immune challenge of monocytes increases *C9orf72* expression hints at this possibility, although unchallenged monocytes express higher levels of *C9orf72* than microglia from fetal human brain tissue^[@CR23]^. Alternatively, there may be widely varying levels of expression in different microglial cells, with a small fraction of microglial cells expressing high levels of *C9orf72* leading to high levels of transcript detection in bulk populations. Understanding the patterns of *C9orf72* expression in combination with the distribution of the protein in different cell types represents an essential step in elucidating the mechanisms of dysfunction in CNS cells in the spectrum of *C9orf72*-associated diseases. Several studies have demonstrated decreased *C9orf72* transcript and protein levels in patients with ALS and FTD^[@CR19]--[@CR23]^, suggesting that haploinsufficiency may contribute to ALS pathogenesis. Our analysis of the patterns of *C9orf72* expression suggests that the cell types that undergo degeneration in ALS, including corticospinal neurons, spinal motor neurons and oligodendrocytes, would be most affected by any *C9orf72* haploinsufficiency. However, the mechanisms underlying the range of phenotypes following *C9orf72* deletions in mouse models remains to be elucidated^[@CR24]--[@CR29]^, and understanding this variability remains an essential step for uncovering the cellular mechanisms underlying ALS and other *C9orf7*2-linked diseases. Methods {#Sec9} ======= Generation of *C9orf72*^*LacZ/*+^ mice {#Sec10} -------------------------------------- All experimental procedures were approved by the Johns Hopkins Animal Care and Use Committee and conducted in accordance with the guidelines of the National Institutes of Health and the Society for Neuroscience. The mice carrying a targeted deletion of *C9orf72* and insertion of *LacZ* were generated as described^[@CR29]^. In brief, several embryonic stem cell lines harboring an insertion that replaced exons 2--6 of the mouse *C9orf72* gene (3110043O21Rik) with *LacZ* (National Institutes of Health Knockout Mouse Project) were used for blastocyst injection to generate chimeric mice which were then selected for germline transmission. The original embryonic stem cells had the genetic background of C57BL/6N-Atm1Brd and the derived mice were maintained on the C57BL/6 background. Male mice bearing the targeted allele were crossed with *Sox2-Cre* recombinase transgenic female mice (Jackson Laboratory, 008454), maintaining the C57BL/6 background, to remove the LoxP-flanked neomycin selection cassette in all progeny. Subsequent breeding eliminated the Sox2-Cre transgene from our mouse line. Six to eight-week-old Neo-deleted *C9orf72* ^*LacZ/*+^ heterozygous mice were used for all experiments. The genotyping primers were the following: gaatggagatcggagcacttatgg (wild-type, forward), gccttagtaactaagcttgctgccc (wild-type, reverse), gcacaagctatgttcatttgg (KO, forward), gactaacagaagaacccgttgtg (KO, reverse). Immunohistochemistry and X-galactosidase staining {#Sec11} ------------------------------------------------- Mice were deeply anesthetized with sodium pentobarbital (100 mg/kg) and perfused transcardially with 4% paraformaldehyde in 0.1 M sodium phosphate buffer. Brain and spinal cord tissue was isolated and postfixed in this solution overnight at 4 °C, then washed in phosphate buffer. Spinal cord tissues were cryoprotected in 30% sucrose, and sectioned at 35 µm thickness on a cryostat. Brain sections, 35 μm thick, were prepared using a vibratome (VT-1000S, Leica). To obtain sections of motor cortex, the brain was mounted in coronal orientation on a 15° ramp prior to cutting slices. To obtain sections of somatosensory cortex, the brain was mounted in parasagittal orientation on a 30° ramp prior to cutting slices. Cerebellar slices were obtained in the parasagittal orientation, after mounting the cerebellum on a flat block. Free-floating sections were permeabilized with 0.3% Triton X-100 in 0.1 M sodium phosphate buffer for at least 5 min and then blocked with 0.3% Triton X-100 and 5% normal donkey serum in 0.1 M sodium phosphate buffer (blocking solution) for at least 1 h at room temperature. When performing immunohistochemistry for calbindin, 5% normal goat serum was also added. Sections were then incubated with primary antibodies prepared in blocking solution overnight at 4 °C and then incubated with secondary antibodies in blocking solution for at least 2 h at room temperature. Primary antibodies used included the following: rabbit anti-β-galactosidase (1:5000; gift from Dr. Joshua Sanes, Harvard University, Cambridge, MA), guinea pig anti-NG2 (1:30,000; Dr. Dwight Bergles, Johns Hopkins University, Baltimore, MD), mouse anti-APC (CC1; 1:50; Millipore, Cat. No. OP80), guinea pig anti-Olig2 (1:20,000; gift from Dr. Ben Novitch, University of California, Los Angeles, CA), mouse anti-S100β (1:400; Sigma, Cat. No. S2532), goat anti-Iba1 (1:250; Novus, Cat. No. NB100--1028), mouse anti-NeuN (1:500; Millipore, Cat. No. MAB377), mouse anti-Parvalbumin (1:300; Swant, Cat. No. PV235), goat anti-ChAT (1:500; Millipore, Cat. No. AB144P) and chicken anti-calbindin D28 (1:100, EnCor Biotechnology Inc., Cat. No. CPCA-Calb). Secondary antibodies used, all raised in donkey except for the goat anti-chicken secondaries, included the following: Alexa Fluor 488-, 546-, and 647- as well as Cy2-, Cy3-, and Cy5-conjugated secondary antibodies to rabbit, guinea pig, mouse, and goat (1:2000; Invitrogen and Jackson ImmunoResearch). For X-galactosidase staining, sections were incubated in 1 mg/mL X-gal (Invitrogen) in a solution of 5 mM potassium ferricyanide (Sigma), 5 mM potassium hexacyanoferrate(II) trihydrate (Sigma), and 2 mM magnesium chloride (Sigma) in PBS for 24 h at 37 °C. Corticospinal neuron identification with retrograde neuronal tracers {#Sec12} -------------------------------------------------------------------- To identify corticospinal neurons, retrograde neuronal tracers were injected into the spinal cord. Mice were anesthetized with ketamine (50 mg/kg), dexmedetomidine (25 μm/kg) and the inhalation anesthetic, isoflurane (0.5--3%). A small laminectomy was performed over the left cervical cord. After removing one vertebra (C5-C6), 100--200 nl of retrograde neuronal tracer, either green Retrobeads (Lumafluor) or Alexa Fluor 488-conjugated cholera toxin B (Invitrogen), were pressure injected through a glass pipet (20--30 μm tip, inner diameter, Drummond), 500 μm lateral to the midline of the exposed spinal cord at a depth of 1000 μm. Buprenorphine (0.05 mg/kg) was administered to all animals post-operatively as an analgesic. Mice were sacrificed 7--12 days after tracer injections and brain sections were cut and processed as described above. Image acquisition and analysis {#Sec13} ------------------------------ To assess the overall distribution of *C9orf72* promoter activity, fluorescence images were collected on an AxioImager M1 microscope (Carl Zeiss). Intensity plots for DAPI, β-gal, and ChAT were made by averaging the signal intensity along the horizontal axis using ImageJ software (NIH). To analyze the distribution of *C9orf72* promoter activity within cell types, fluorescence images were acquired with an LSM 510 Meta confocal microscope (Carl Zeiss). Stacks of confocal images (0.3 µm *z*-interval) were imported into Imaris software for three-dimensional analysis. Surface renderings of NeuN-positive, ChAT-positive, PV-positive, calbindin-positive, Iba1-positive, CC1-positive, NG2-positive, and S100β-positive/Olig2-negative cells were created, the locations of β-gal-positive puncta were marked using the Spots function, and any cell with one or more β-gal-positive puncta within the three-dimensional rendering was counted as exhibiting *C9orf72* expression. As the cerebellar granule cells were very tightly packed, there were occasionally small groups of NeuN-positive neurons that could not be clearly segmented into individual neurons. These groups were eliminated from the analysis. To determine whether the distribution of β-gal puncta related to the underlying cellular distribution, the channel containing the β-gal signal was flipped horizontally while leaving the cell type-specific channels unchanged. The same counting procedure was then applied to this new configuration. Analysis of gene expression {#Sec14} --------------------------- The transcript analysis was performed using RNA-sequencing (RNA-seq) data from a previously published study^[@CR28]^. The RNA-seq data were derived from spinal cords of 3-month old wild-type and *C9orf72* (3110043O21Rik) knockout mice (three animals from each group). These knockout mice and the independent line analyzed in the present study were generated from a common source of mouse embryonic stem cells (DEPD00552, the Mouse Biology Program, [www.mousebiology.org](http://www.mousebiology.org)). The RNA-seq reads were aligned to mouse genome build mm10 using HISAT2 using standard parameters^[@CR57]^. The BAM files were then visualized using integrated genome viewer^[@CR58]^. The Sashimi plot was generated to visualize the RNA alignment as well as the splice junctions with a minimum junction coverage of 2. Statistics {#Sec15} ---------- The Chi-Square test was used to determine whether there was a significant difference in the expected frequencies of β-gal immunoreactive cells between cell types or between different regions. For the flipped image test, a paired *t-*test was used after confirming the normality of data distribution with the Shapiro Wilk normality test. *p* \< 0.05 was considered to be statistical significant, and the asterisk was used to mark the statistical significance on the graphs, \* for *p* \< 0.05, \*\* for *p* \< 0.01, and \*\*\* for *p* \< 0.001. Electronic supplementary material ================================= {#Sec16} Supplementary information Abraham J. Langseth and Juhyun Kim contributed equally to this work. **Electronic supplementary material** **Supplementary information** accompanies this paper at doi:10.1038/s41598-017-05864-2 **Publisher\'s note:** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. We thank Dr. Joshua R. Sanes (Harvard University) for providing the anti-β-gal antibody, and Karen Conchina and Justin Chu for their assistance in the generation and maintenance of the mice. This work was supported by Target ALS (D.E.B., S.P.B.), the Robert Packard Center for ALS Research (J.W., S.P.B.), the U.S. Department of Defense (J.W.) and the National Institutes of Health (J.W.: NS074324 and NS089616; S.P.B.: NS098819; D.E.B.: NS050274). J.K. was supported by a National Research Foundation of Korea Fellowship (NRF‐2011‐357‐E00005). A.J.L. was supported by a National Multiple Sclerosis Society Postdoctoral Fellowship (FG 20114-A-1). S.P.B. is supported by a Klingenstein-Simons Fellowship in the Neurosciences. J.W., D.E.B., and S.P.B. conceived of the project. A.J.L., J.K., D.E.B., and S.P.B. designed the study. J.E.U., Y.S. and J.W. generated the mice. A.J.L. and J.K. acquired and analysed the anatomical data. H.-Y. H. analyzed the RNA-sequencing data. A.J.L., J.K., D.E.B., and S.P.B. interpreted the data and drafted the manuscript. J.E.U. and J.W. contributed to the writing of the manuscript. Competing Interests {#FPar1} =================== The authors declare that they have no competing interests.

Photoelectric technology has spawned a wide variety of digital products, such as scanners, digital cameras, digital video cameras, and the like. Scanners can rapidly transform paper documents to electronic files and have been widely used in paperless office environments. Refer to FIG. 1 for a conventional scanning apparatus 1, which includes at least a body 11, a lid 12, a carrier 13 for holding an optical module, a transport mechanism 14, a human-machine interface 15, a data processing unit 16 and connection lines 17 and 18. The body 11 has a scan window 111 that is permeable to light. The lid 12 is pivotally coupled on one side of the body 11. The carrier 13, transport mechanism 14, data processing unit 16 and connection lines 17 and 18 are housed in the body 11. The transport mechanism 14 is coupled on the carrier 13 to move the carrier 13 reciprocally within the range of the scan window 111. The data processing unit 16 is connected electrically to the carrier 13 and the human-machine interface 15 through the connection lines 17 and 18. When users operate the human-machine interface 15 through the connection line 18, the data processing unit 16 drives the carrier 13 through the connection line 17 to move along the transport mechanism 14 to scan a scanning document (not shown in the drawing) by projecting light through the scan window 111. The optical module determines the scanning quality of the scanning apparatus 1. As the optical module is movable, to prevent the optical module from losing focus or being damaging during transportation, the carrier 13 or the optical module is generally coupled by a locking structure 131 before shipping from the plant so that the carrier 13 (or the optical module) is fixed during transportation or moving to avoid damage. Furthermore, the scanning apparatus 1 is generally quite bulky. When the scanning apparatus 1 is not used, the interior space of the scanning apparatus 1 not filled with scanner elements is not fully utilized.

On Tuesday, Apple will change the way humans interact with electronic devices. All over again. Perhaps the biggest announcement at Apple’s iPhone event on Tuesday will be Assistant, Apple’s evolution of the Siri Personal Assistant Software. Siri, you’ll remember, is the company Apple picked up for a rumored $200 million in April of last year for, in Steve Jobs’ words, its “Artificial Intelligence”, not search or speech recognition. During Siri’s brief two months on its own, it described itself as a ‘VPA’: Virtual Personal Assistants (VPAs) represent the next generation interaction paradigm for the Internet. In today’s paradigm, we follow links on search results. With a VPA, we interact by having a conversation. We tell the assistant what we want to do, and it applies multiple services and information sources to help accomplish our task. Like a real assistant, a VPA is personal; it uses information about an individual’s preferences and interaction history to help solve specific tasks, and it gets better with experience. Apple has long wanted to bring an Artificial Intelligence-based Personal Assistant to the masses. In the late 80’s, Apple made the Knowledge Navigator series of videos (example below) to showcase this ambition. In the video, the professor mentions that someone wrote an article 5 years ago trashing Jill’s research (watch from 1:25 min onwards, at 1:50 min he mentions more details) – The computer says the doctor’s name and says his article in 2006 – which means the professor is in 2011. Ha! Thanks PBHK! The world has come a long way since then, but as you’ll see on Tuesday, Apple had remarkable foresight way back in 1987. We had the chance to speak to Siri’s co-founder and board member, Norman Winarsky… First, Some Background: The device input methods we’ve used in the past have first been the keyboard, then the mouse and more recently, there is the touch interface. All of these methods, while not invented by Apple, were “mainstreamed” by Steve Jobs’ company over the last thirty-five years. But humans didn’t evolve to communicate with keyboards or mice or even a touch screen. We’ve contorted our bodies to deal with our computer tools (Hi RSI!) but really we’re hard-wired for talking and listening – functions we, as a species, have been doing for tens of thousands of years. Unfortunately, we haven’t yet invented a computer that can understand what we say, and more importantly, use that information to go find answers and relay that information back to us. That would require not only recognition of the language but the Artificial Intelligence to understand it, use it, and return something of value. Well, that’s not entirely true. In 2003, the US Government began the most ambitious Artificial Intelligence program in its history called the “Cognitive Assistant that Learns and Organizes” or CALO program. The name was inspired by the Latin word “calonis”, which means “soldier’s servant”. Funded by DARPA as part of its Personal Assistant that Learns project, the program ran for five years and brought together more than 300 researchers from 25 of the top university and commercial research institutions, with the goal of “building a new generation of cognitive assistants that can reason, learn from experience, be told what to do, explain what they are doing, reflect on their experience, and respond robustly to surprise.” The program was coordinated through SRI International in Menlo Park, CA. As the program ended in 2007, SRI took the knowledge gained by the CALO and some of its key players and formed Siri. SRI’s Norman Winarsky, the man uniquely positioned at the crossroads of the CALO project and the company spun off out of it talked to us about the implications of Apple mainstreaming ‘Assistant’. 9to5Mac: What was your role in putting together Siri? Norm: As CALO was coming to an end, we realized that there were incredible commercial opportunities to build a smart personal assistant from what we learned over the five years of the CALO project. My job was getting funding (VC’s were Morgenthaler and Menlo Ventures)and assembling the team headed by Dag Kittlaus a former Motorola Executive. With him came Semantic Web genius Tom Gruber and Chief Architect of CALO Adam Cheyer. At the time of Apple purchase, the team was at 19 and growing. All three co-founders still work at Apple with much of the rest of the original team. I obviously stayed at SRI after the purchase. 9to5Mac: Can you tell us a little bit about getting picked up by Apple? What was the process? How did they evaluate the company? Are any of the financials available? Norm: I am bound by non-disclosure on all of the information from the sale that is not public including the [rumored $200 million] sale price. What is notable is that Apple closed its purchase of Siri just two months after we went public with our app. You can probably draw your own conclusions from that. 9to5Mac: How important is Nuance speech recognition to the Siri technology? Norm: It is a lot less important than you’d probably think. When we first built Siri, we use Vlingo for speech recognition and as such, at the time of purchase the speech recognition component is modular. Theoretically, if a better speech recognition comes along (or Apple buys one), they could likely replace Nuance without too much trouble. That being said, Nuance has far and away the most IP in speech synthesis technologies in the industry. We should know, SRI launched Nuance as one of our incubated companies in 1995 and it IPO’d in 2000. 9to5Mac: What kind of power does the Siri AI take? Could it have caused the delay of the next iPhone? Norm: I’m not familiar with Apple’s roadmap and any delays but I can say that AI takes a lot of computing power. The Siri software needs to cache data, needs to access a big dataset at wide bandwidth and needs a big processor to crunch all of the numbers. When we originally released Siri for the iPhone 3GS, we had to perform all kinds of optimizations and shortcuts to get it to work efficiently. All I can say is that it will likely run much better on a faster phone. 9to5Mac: Is this Siri ‘Assistant’ a big deal? Norm: Let me first say I have no knowledge of what Apple plans to do with the Siri purchase. I read the rumors just like everyone else and it appears that Apple is getting ready to reveal what it has done with Siri over the past year and a half (we were actually expecting it at WWDC). Make no mistake: Apple’s ‘mainstreaming’ Artificial Intelligence in the form of a Virtual Personal Assistant is a groundbreaking event. I’d go so far as to say it is a World-Changing event. Right now a few people dabble in partial AI enabled apps like Google Voice Actions, Vlingo or Nuance Go. Siri was many iterations ahead of these technologies, or at least it was two years ago. This is REAL AI with REAL market use. If the rumors are true, Apple will enable millions upon millions of people to interact with machines with natural language. The PAL will get things done and this is only the tip of the iceberg. We’re talking another technology revolution. A new computing paradigm shift. It reminds me of another SRI Project: Doug Engelbart, Inventor of Mouse augmented human ability back in the ’60s. Just as Steve Jobs took that technology and ran with it, we believe that Apple will use Siri to start another revolution. 9to5Mac: Thanks for your time Norm. This reminds us of the Steve Jobs computer is a bicycle for the mind quote: Some other interesting data on the founders: The three founders are all still at Apple, though they work on other projects. We found Dag Kittlaus’ comments that he’s now making “the next big thing into a really big thing” interesting (below). . Adam Cheyer demonstrated (PDF) the CALO Express application in 2007, just before starting Siri. The application ran on Windows CE because it was aimed at government use. Perhaps Tom Gruber at Semantic Web in 2008 just before Siri went public was most interesting: [vodpod id=Video.15499711&w=651&h=488&fv=] Come back to 9to5mac.com Tuesday at 10am Pacific for all of the announcements.

Q: Can we get a custom Tour page? This feature request is related to PPCG not being a Q&A site. The most important part of the onboarding experience for new users (especially those who don't arrive via other sites from the network) is the tour page. Moderators can customise the first paragraph and a few details in the right column, but in the case of PPCG this is hardly enough, because the rest of the page is strongly misleading: Ask questions, get answers, no distractions Get answers to practical, detailed questions Focus on questions about an actual problem you have faced. Include details about what you have tried and exactly what you are trying to do. Ask about... None of these are things that users should actually do here. It would be great if a) those misleading bits could be removed and ideally b) replaced with some important information that applies here instead. The usual process for new users on a Q&A site is that they join the site to ask a question and then start answering others as well when they feel confident about it. Around here, we prefer users to start with solving challenges so they can get a feeling for how challenges work around here before writing their own. (Yes, CH, you are an exception to that...) The things that are most problematic are: The (already customisable) first paragraph start with "Programming Puzzles & Code Golf is a question and answer site for programming puzzle enthusiasts and code golfers." Except it's not. The first two sections "Ask questions, get answers, no distractions" and "Get answers to practical, detailed questions" are the most misleading because they tell people to use this as a Q&A site. These should instead explain how you can solve challenges here and pose your own as well (in that order). The sections about tags, edits, reputation and badges are generally alright, except that some instances of "question" could be replaced with "challenge" and that we might want to mention that edits here shouldn't be used to improve the score (comments should be used instead, as the example there already shows - although that example could possibly be improved). The final bit that sends people off to the site would probably also better be phrased in terms of "posing challenges" rather than "asking questions". "Like this site? Stack Exchange is a network of 152 Q&A sites just like it." Well... Please use the answers to suggest new content for the problematic sections. When we find a consensus what we'd rather have on the tour page, I can inform the CMs to take a look at this. A: I don't know whether to post all my stuff in a single answer or as multiple, I'll just put everything here for now. Things in {braces} are my comments, not part of the text. Most of this is just word/sentence replacement. Our changes may or may not be more extensive than this. Welcome to Programming Puzzles & Code Golf Stack Exchange Programming Puzzles & Code Golf is a site for hosting and participating in programming competitions. It's built and run by you as part of the Stack Exchange network of Q&A sites. With your help, we're working together to build a library of programming puzzles and their solutions create an environment of friendly competition, open to programming enthusiasts of all skill levels {note: kinda cheesy but IDK}. We're a little bit different from other sites {note: this is accurate}. Here's how: Ask questions, get answers, no distractions Compete in challenges, create your own, and have fun This site is all about hosting programming competitions. It's not a discussion forum or a regular Q&A site. There's no chit-chat. Just challenges... And submissions... Good submissions are voted up and rise to the top. The best submissions show up first so that they are always easy to find. The person who created the challenge can mark one submission as "accepted". Accepting doesn't mean it's the best answer, it just means that it worked for the person who asked generally indicates that it is the winner of the contest. {note: should we even mention accepted answers?} {note: I also kinda think we should change the example question that's shown to the right, the current one has a 2-line spec. This may be difficult if they are auto-selected.} Get answers to practical, detailed questions Participate in high-quality programming competitions {note: this section pretty much has to be completely rewritten. I think we should replace it with something that goes into more detail about what is/isn't appropriate here.} Focus on questions about an actual problem you have faced. Include details about what you have tried and exactly what you are trying to do. Focus on challenges which have detailed specifications and clear objectives. All challenges should have an objective winning criterion, which is a well-defined way to determine which submission is the best. {note: it might not worth our time to explain exceptions like the tips tag} Create posts about... Code golf (details) Programming puzzles Other programming contests or challenges {note: maybe include a brief list?} Certain non-challenge topics, such as tips for golfing in a specific language Not all challenges work well in our format. Avoid challenges that are primarily opinion-based, lack a clear objective, or that are likely to generate discussion rather than submissions. Challenges that need improvement may be closed placed on hold until they are improved and reopened. Tags make it easy to find interesting challenges All challenges are tagged with their subject areas and the type of competition. Each can have up to 5 tags, since a challenge might be related to several subjects. Click any tag to see a list of challenges with that tag, or go to the tag list to browse for topics that interest you. You earn reputation when people vote on your posts {note: basically keeping this as-is. Some of the s/question/challenge/gi also needs to be applied to the small image caption text.} Your reputation score goes up when others vote up your challenges, submissions and edits. As you earn reputation, you'll unlock new privileges like the ability to vote, comment, and even edit other people's posts. At the highest levels, you'll have access to special moderation tools. You'll be able to work alongside our community moderators to keep the site focused and helpful. Improve posts by editing or commenting Our goal is to have the best submissions to every challenge, so if you see challenges or submissions that can be improved, you can edit them. Use edits to fix minor mistakes, improve formatting, or clarify the meaning of a post. Edits shouldn't be used to change the informational content of other users' posts, or to change other users' programs. Use comments to ask for more information, clarification, or to suggest improvements to posts. You can always comment on your own posts. Once you earn 50 reputation, you can comment on anybody's post. Remember: we're all here to learn, so be friendly and helpful! Unlock badges for special achievements {note: nothing really to change here either} Badges are special achievements you earn for participating on the site. They come in three levels: bronze, silver, and gold. In fact, you've already earned a badge: Informed Read the entire tour page Participate in an existing challenge, or create your own {note: I wonder if we could add a link to/explanation of the sandbox here} See new challenges Create a challenge Looking for more in-depth information on the site? Visit the Help Center Programming Puzzles & Code Golf Stack Exchange is part of the Stack Exchange network Like this site? Stack Exchange is a network of 152 Q&A sites just like it. Check out the full list of sites.

Leaked north korean documentary exposes western propaganda. - daralthus http://superchief.tv/leaked-north-korean-documentary-exposes-western-propaganda-and-its-scary-how-true-it-is/ ====== draq How do you imagine a world without "propaganda"? Mine would be one without this documentary. ------ stefantalpalaru It's propaganda about propaganda and it seems targeted at westerners. Too many sensitive subjects for Dear Leader's flock. ------ bediger4000 The definition of "reality tee vee" given: shows about "talentless narcissists who like to talk about themselves and go shopping". This is the kind of material that has endeared North Korea to propaganda cognoscenti everywhere. ------ ericxb The film was produced in New Zealand. Here is a link to a video report which includes an interview with the producer: [http://ondemand.tv3.co.nz/Media-3-Season-1-Ep-16/tabid/59/ar...](http://ondemand.tv3.co.nz/Media-3-Season-1-Ep-16/tabid/59/articleID/8890/MCat/540/Default.aspx) ------ calciphus Let's take a moment here and wonder a "documentary team" in a country with the kind of dictatorial control that North Korea has would have access to so much American TV footage. "Leaked"? You mean "released by the North Korean government"? ~~~ ChuckMcM If you read the back story the translator believes exactly that, which is to say that the DPRK created it for westerners. What is interesting is that the website its on has completely bought into the message. They say things like "And jesus, is it on the f&k*g money." That suggests that it was targeted exactly to the sort of non-critical thinker/reader that the site "superchief" represents, and by all indications manages to hit on all of the sensitive spots. That is the point of propaganda, and whether it is anti-Semitic white supremacist crap or DPRK crap it requires that the person reading it check their assumptions at the door.

Afghan President Hamid Karzai confirmed Monday his government is in informal talks with the Taliban. More than 80 per cent of Afghans support the government's efforts to negotiate peace with Taliban insurgents, according to a poll released Tuesday in Kabul. The poll conducted during the summer ranked insecurity as the top concern among citizens, followed by unemployment and corruption. Eighty-three per cent of respondents said they back efforts to secure the country through negotiation with armed anti-government groups, the survey conducted by the Asia Foundation found. That's up from 71 per cent last year. The report also indicated that 55 per cent of Afghan adults had no sympathy at all for the armed opposition groups — up from 36 per cent last year —- and 26 per cent had only a little sympathy. Moreover, 81 per cent — 10 percentage points more than last year — support programs to lure Taliban foot soldiers off the battlefield by providing assistance, jobs and housing to those who lay down their arms and reintegrate into society. President Hamid Karzai has made reconciliation a priority and recently formed a 70-member peace council to find a political solution to the war, now in its 10th year. Officials in the government and the NATO military coalition in Afghanistan have confirmed that contacts are being made with top insurgent leaders, but say no formal peace talks are yet underway. The poll published Tuesday questioned 6,400 adults during June and July in all of Afghanistan's 34 provinces, excluding some dangerous areas. The survey, conducted with funding from the U.S. government's Agency for International Development, claims a margin of error of 4.4 percentage points. The San Francisco-based Asia Foundation describes itself as a non-profit organization working for a peaceful and prosperous Asia-Pacific region.

Q: New Yorker Dieresis Rule; prosaic, unionized? There are lots of informal references to the traditional / "New Yorker" style of using diereses to disambiguate runs of vowels, however I have yet to find a definitive guide. See, for example: http://www.newyorker.com/online/blogs/culture/2012/04/the-curse-of-the-diaeresis.html http://en.wikipedia.org/wiki/Diaeresis_(diacritic) What is the standard rule for using or not using hyphen and diaeresis on the words like reelect , reexamine, and cooperate? My major question is: Is there a definitive reference that one can consult for proper traditional use of the dieresis in English? The accepted answer in last link above outlines some cases (e.g., no dieresis in "coalesce" or "react") but notably does not provide a reference to an authoritative source. My minor questions are: Is it appropriate to use a dieresis in "prosaïc?" How does one most correctly differentiate the two words spelled "unionized" ("union-ized" about the formation of a group or "un-ionized" about how many free electrons a material has)? Assume for a moment that you have to write both within the same document. A: There are lots of informal references to the traditional / "New Yorker" style of using diereses to disambiguate runs of vowels, however I have yet to find a definitive guide. The definitive guide to the "New Yorker" style, is that you submit a piece to the New Yorker, and if it is accepted for publication it will be cast into that orthography whether you had originally attempted it or not. The earlier traditional use of diæreses do not have a definitive guide, because it is traditional, and as such was never consistent. It also isn't really all that traditional, and never dominated English orthography, though it certainly was once more common than before: It was a traditional way of writing, not the traditional way. And, to dash your hopes of finding a definitive guide further, it was, and remains, used to different degrees by some than by others. Today, it would still be very common to use a diæresis with a proper noun, like Zoë, Chloë, or Boötes. Likewise with related proper adjectives. Overlapping with that, it would be much more common to use it in a foreign loan-word that had the diæresis in the original spelling (likewise its identical cousin the umlaut). This though raises another question; how long is a word in English before it is no longer a loan-word? It also brings up a point about how the language has changed, for not only have loan-words become more and more considered to be fully English, but also writers' sensitivity to the foreignness of loan-words has declined so the average scribe is less likely to choose to italicise in a given case than they would a couple of centuries ago. Of such words, perhaps naïve and its relatives (naïf, naïvety, etc.) may be the only word both widely known as English and widely retaining the diacritic it brought with it from France even though it is now 400 years in English use. Perhaps the very fact that it is learnt of relatively early in a child's developing vocabulary that makes it retain the mark; children learn it as "the one with the dots" just as they learn fo'c's'le as "the one with all the apostrophes" and so a general tendency to remove diacritics is resisted just as the general tendency to reduce apostrophes to a ration of one per word. At the other extreme, those who did (or remain) fond of its use, have no logical reason for avoiding it in react and reaction, beyond the simple fact that it is so commonly seen without one that even the most given to affected feel slightly silly using it. In-between, some would use it where there was primary stress on the second vowel, and some more widely. Similarly, many (relatively speaking) would use it where the word was formed by joining two parts, particularly where another might be tempted to hyphenate. Many would take how likely they thought mispronunciation would be without it. There is no doubt some influence too from the lack of such a mark in the Latin source; it coming from Latin already joined rather than combined from re- and act in English, but that also applies to some words where one does see it: It's an influence perhaps, but not a self-sufficient reason. Is it appropriate to use a dieresis in "prosaïc". It would be technically defensible on the basis of the French prosaïque. Some would only use the diæresis when the primary stress is on the second syllable, and so not use it. Some who would tend to use the diæresis anyway still wouldn't as it is so well-known without and not (unlike the also well-known coöperation for example) formed from combining two parts. The New Yorker, incidentally, spells it prosaic. How does one most correctly differentiate the two words spelled "unionized" ("union-ized" about the formation of a group or "un-ionized" about how many free electrons a material has)? From context. Assume for a moment that you have to write both within the same document. As a rule even in the same document the two adjectives are unlikely to be applied to very similar subjects or objects, though certainly if workers are finding themselves ionised on a regular basis they definitely need to organise into a trade union. As such, it's unlikely to cause that much difficulty here. If though, you really wanted to distinguish them orthographically, then the diæresis is not going to be of any help. Note that the hyphen is allowed, albeit unpopular, in one but not the other. Hence: "Organised into a trade union": unionised/unionized "Not ionised": un-ionised/un-ionized "Not made more Ionian": un-Ionised/un-Ionized or even un-Ionicised/un-Ionicized.

Did you know that if Medicare pays for medical care that you received because of someone else's wrongdoing, and you then bring a lawsuit seeking compensation for your injuries, Medicare has a legal obligation to make you repay them? Let me repeat that and explain. Let's say you're in an accident caused when a driver crossed over the double yellow line and hit you. You're in the hospital for weeks and Medicare pays your bills. If you now sue the driver of the car that caused your accident, Medicare will come to you and your lawyer and say "Pay Up." The government wants their money back if you get money from the person who caused your injuries. Depending on how much money you get and how much money Medicare paid, we can, in some cases negotiate with Medicare to reduce the amount that they must be repaid. 4 Comments to "Medicare Can Ruin Your Lawsuit- Find Out How" I sued a party and won. Their insurance agreed to pay damages and to reimburse Medicare for conditional payments for treatment. Medicare then sent me a bill not only for the treatments for the injury but also for subsequent treatments unrelated to the injury. They said I could appeal their demand if I wanted to dispute the amount but that I would have to prove it. The time and effort required is exhausting and the turnaround time is long. Their notice came one year after the settlement and the insurance company was supposed to have reimbursed Medicare. That wouldn't happen if it was a billing problem with a private business. The system is a big hole filled with fly paper and it takes forever to get it all off. Posted by Harold Richardson on July 2, 2013 at 07:13 PM I went to a very bad dentist who ruined my teeth leading to infections and I did not sue because of medicaid-medicare since it would have been a waste of time plus I did not sue for a slip and fall , a major fraude case and a car accident that left me in pain for life so a total of 4 law suites I dropped not to be wasting my time on 4 losers. I live with bowel and kidney disease that is a death sentence. I turned down the last surgery to speed up the death sentence since I am very tired at 54 of pain and poverty and the disgrace of the U.S.A. system. They don't do this in Europe or Australis it is all free no pay backs. Posted by larbacmc on April 21, 2010 at 05:42 PM Hi Lorraine, I'm sorry to learn about your brother. The purpose of bringing any lawsuit in New York is to obtain compensation for the injured victims and their families. Obviously, once permanent damage has occurred, no amount of money can replace the injured victim. Medicare and Medicaid play an important part in being able to provide medical services for people who do not have health insurance in New York. It allows them to obtain medical care from doctors and hospitals without having to worry how they're going to pay their medical and hospital bills. If the medical care and treatment your loved one is receiving came about because of wrongdoing caused by a doctor or a hospital, and you or your family recover his compensation for those injuries or death, then Medicare has a legal obligation to recoup the money that they paid for your family member's medical care and treatment. This means, practically speaking, that anytime you bring a lawsuit seeking compensation for injuries caused by someone else's wrongdoing, and are successful; if Medicare or Medicaid paid for those medical services, then they must, by law, make every effort to retrieve the money that they paid out. Unfortunately, in some cases, this means that you and your family may receive little or no money as compensation, after the attorneys expenses, the attorney fees and the debt that must be repaid to Medicare or Medicaid. You and your family would receive the remaining amount of money after all that. That is why, in some instances, I have recommended that a family not pursue a lawsuit since doing so will likely not result in them receiving any financial compensation after all fees and Medicare and/or Medicaid have been paid back. In many instances, we are able to negotiate with Medicare and/or Medicaid to try and get them to reduce the amount they are seeking, based upon the amount we are actually able to recover as financial compensation for you and your family. I wish you and your family the best of health in the future. Good luck to you. Gerry Posted by Gerry Oginski on November 2, 2009 at 02:51 PM MY BROTHER DIED IN THE CARE OF A NURSING FACULITY. HE WAS ON MEDICARE MEDICAID. IF HE DIED AS A WRONGEFUL DEATH AS WE BELIEVE (THE ATTORNEY GENERALS OFFICE WAS CALLED IN) IS IT TRUE THAT MY BROTHER DIED IN VAIN BECAUSE HE HAD NOTHING? WE COULD NOT SUE. WHAT ABOUT THE LOVE THAT IS LOST OF MY BEST FRIEND AND MY CHILDRENS UNCLE. HE WAS ONLY 58 YRS OLD. Posted by LORRAINE on November 2, 2009 at 02:12 PM Post a comment Post a Comment to "Medicare Can Ruin Your Lawsuit- Find Out How" To reply to this message, enter your reply in the box labeled "Message", hit "Post Message." The material on this website is for informational purposes only. Mr. Oginski practices law exclusively in the State of New York. We do not practice law in any other State. Please do not send any written materials to this office until you have spoken and/or communicated with us. We cannot consider you a client until such time as we have consulted with you, and met with you personally. Since all cases are different and legal authority can and does change, it is important to remember that prior results cannot and do not guarantee similar outcomes with respect to any future matter in which any lawyer or law firm may be retained. To the extent that this website discusses past cases the firm has handled, or in any way mentions the firm or its services, New York courts may deem this to be attorney advertising.

{#sp1 .457}

Safety of retigabine in adults with partial-onset seizures after long-term exposure: focus on unexpected ophthalmological and dermatological events. Retigabine is an antiepileptic drug developed for the adjunctive treatment of adults with epilepsy and partial-onset seizures (POS). Following its approval in 2011, reports of ophthalmological/dermatological pigmentation/discoloration led to a restriction of the indication in 2013, and in 2017, retigabine was voluntarily withdrawn from the market because of its limited usage. Here, data are reported from four open-label extension studies focusing on long-term safety with particular emphasis on ophthalmological and dermatological events. Studies 113413 (NCT01336621), 114873 (NCT01777139), 115097 (NCT00310388), and 115098 (NCT00310375) were multicenter, open-label extension studies of retigabine (300-1200 mg/day) for the adjunctive treatment of adults with POS. Safety assessments included monitoring treatment-emergent adverse events (TEAEs) and serious adverse events (SAEs). When new safety issues were identified, protocols were amended to include additional on-treatment safety evaluations, including ophthalmological and dermatological examinations. Patients who had abnormal retinal pigmentation, unexplained vision change, pigmentation of nonretinal ocular tissue, or abnormal discoloration of skin, lips, nails, and/or mucosa at the end of the treatment phase were asked to enter a safety follow-up continuation phase comprising 6-monthly ophthalmological/dermatological assessments. The safety population (patients receiving ≥1 dose of retigabine in the open-label phase) comprised 98, 30, 376, and 181 patients for studies 113413, 114873, 115097, and 115098, respectively. Mean (standard deviation) treatment exposure ranged from 529 (424) to 1129 (999) days. In total, 68%-96% and 4%-27% of patients across the studies experienced TEAEs and TE SAEs, respectively. There were seven on-treatment deaths and two after discontinuation. Overall, 14%-73% of patients had an on-treatment eye examination, of whom 8/53, 4/22, 17/54, and 14/36 had abnormal retinal pigmentation and 15/53, 7/22, 15/54, and 11/36 had nonretinal ocular pigmentation in studies 113413, 114873, 115097, and 115098, respectively. Four patients had confirmed acquired vitelliform maculopathy. In patients with unresolved events at discontinuation and ≥1 posttreatment follow-up, retinal pigmentation resolved completely in 1/3, 0/3, 0/10, and 1/7 patients and nonretinal ocular pigmentation in 1/4, 0/3, 8/10, and 4/6 patients, respectively. Overall, 12%-83% of patients had an on-treatment dermatological examination, of whom 11/58, 0/25, 23/46, and 23/37 had any-tissue discoloration, respectively. In patients with unresolved events at discontinuation and ≥1 posttreatment follow-up, discoloration of skin, lips, nails, and/or mucosa resolved completely in 2/3, 0/0, 7/13, and 1/11 patients, respectively. The safety profile of retigabine in adults with POS across four open-label studies was generally consistent with data from previous placebo-controlled studies. Discoloration of various tissues occurred in a proportion of patients treated with retigabine and resolved completely in a small number of these patients following treatment discontinuation. In addition, comprehensive eye examination identified a new adverse reaction of acquired vitelliform maculopathy in a limited number of patients.

Q: CentoOS SSH Access I'm executed this commands with root user i'm on a CentOS 6.3 server: #useradd newuser #passwd newuser #visudo then I added this line at end of file: AllowUsers newuser #service sshd restart #exit Now, I can't access server with deployer or root user! Both accounts return: **Permission denied, please try again.** Any suggestions? EDIT: Why add AllowUsers newuser dont allows newuser to login by ssh? A: AllowUsers, quoting man sshd_config, "If specified, [allows] only user names that match one of the patterns". To work around the problem, try logging in as newuser, and then use sudo -i (if newuser is allowed to run the command) or su root (if you know the root password) to become root and take the AllowUsers line out. After modifying sshd_config, restart sshd.

Q: Using a variable in android XML or otherwise programmatically setting an XML attribute Say I have a style that I want to change: <?xml version="1.0" encoding="utf-8"?> <resources> <style parent="Widget.TitlePageIndicator" name="Widget.MyTitlepageIndicator"> <item name="footerColor">#14A804</item> </style> </resources> And I want to change the value of "footerColor", more specifically cycle through the spectrum. Is this possible? How would I obtain a reference to that memory address? A: As far as I know, you can't change the value within this resource file. That is the whole point of a resource file, having a static resource that does not change. What you can do is have multiple definitions of different styles in this resource file, and change the style that is being applied to a layout element. That can be done using this answer. Hope that helps!

Q: concatenating tuples of array within a tuple I have a tuple which contains many tuples. Each tuple within my main tuple has two elements -- the first element is an array with a shape of (700,) and the second element is a integer. Here is a small representation of my tuple: x =( (np.array[3,3,3],1), (np.array[4,4,4],2), (np.array[5,5,5],3)) I'm looking to combine all the arrays into one big matrix, and all the integers into one column vector, which all fit into one tuple. So my output should be something like this: y= (np.array([[3,3,3],[4,4,4], [5,5,5]]), np.array([1,2,3])) One tuple with the first element as an array with shape (3,3), and the second element as an array with a shape of (3,) I'm assuming we can use one of numpy's stack methods but I can't wrap my head around how to access all elements of the tuples to do so. Thank you. A: >>> x = ((np.array([3,3,3]),1), (np.array([4,4,4]),2), (np.array([5,5,5]),3)) >>> y = (np.array([e for e, _ in x]), np.array([i for _, i in x])) (array([[3, 3, 3], [4, 4, 4], [5, 5, 5]]), array([1, 2, 3])) Or, without comprehensions: >>> map(np.array, zip(*x)) [array([[3, 3, 3], [4, 4, 4], [5, 5, 5]]), array([1, 2, 3])]

Q: Attempting to write float to CSV, but it becomes an integer I'm using python 3 to create a csv file with different types of data, one of them being a float. Strings and integers show up correctly on the generated file, but the float becomes a large integer instead of retaining the decimals. For exmaple, 64.5232323 becomes 645.232.323. The data is organized in an array and I'm using python's csv module. Here's the code for writing to file: index_file_exists = os.path.isfile(full_dir+index_filename) with open(full_dir+index_filename, 'a+') as f: csv_file = csv.writer(f, delimiter=";") csv_file.writerow(index_line) index_line is the array containing all the data for that row. I have tried converting the float to a formatted string, as in: index_line[12] = "%.5f" % index_line[12] But the value is still displayed as an integer when opened with Excel. If opened with a text editor like notepad, the float is shown correctly. I don't use excel or csv files regularly, so I'm at a loss here. Any suggestions? A: Check the locale / region settings of Excel. If your region specifies "." as "thousands separator", then your formatted number will be treated as integer. And use the str.format() function, which has a locale-sensitive formatter: # Python < 3.6 index_line[12] = "{:.5n}".format(index_line[12]) # Python >= 3.6 index_line[12] = f"{index_line[12]:.5n}"

Last week, when we debuted our Philly Corruption All-Star playing cards—collect ‘em all and trade them with your friends!—I wrote about the culture of corruption we’ve long tolerated here, a culture notable for its lack of shame and for good people who regularly look the other way in the face of systemic abuse. Of course, we focused on obvious cases of corruption, like the indicted and convicted pols whose perp walks account for so many of our headlines these days. But there’s another type of corruption that also sets us apart, and it’s the kind that’s completely legal. In some ways, it’s more corrosive than good old-fashioned politicians on the take. It’s traditions like Councilmanic Prerogative, the near-absolute power each of the city’s 10 District Council members wield over development projects in their respective districts. It has in the past led to illegal acts—former Council members George Schwartz, Rick Mariano and Leland Beloff all went to jail for shaking down developers—but even when the privilege doesn’t lead to extortion, it constantly reenforces that, when it comes to Philly, all politics are transactional. It’s the product of an insider-dominated game, one in which the players seem to count on ho-hum reactions among voters to their brazen self-dealing. Earlier this month, another example of this Philly Way reared its misshapen head when Council began its seven weeks of budget hearings, with 15 separate agencies appearing before our august legislative body in order to justify their spending of taxpayer dollars. There is one such agency that will, as has long been customary, be exempt from such transparency: Council itself, which doesn’t subject its own $17 million budget to public scrutiny. Kudos to The Inquirer’s Chris Brennan for raising this issue. “There is no way else to view this,” he writes. “Council operates under a different set of rules than it enforces for the rest of Philadelphia’s government.” Forget about the hearing. How about just publishing the itemized $17 million budget on Council’s website? Put it up there for all to see—in an easily understandable format. Why wouldn’t you? You either believe you’re a steward of the people’s money—or not. This hypocrisy is not new. Back in 2012, Brennan worked for me at The Daily News, and he pressed Council President Darrell Clarke on it then; Clarke promised to “enhance the ability for people to see what’s in Council’s budget,” while refusing to say how. Five years later, I guess he’s still working up that plan. What is Clarke hiding? As is so often the case in the insular world of Philly politics, he’s looking out for his own little fiefdom. His Council budget, after all, is what enabled him to create a new position for his buddy, former Councilman Wilson Goode, Jr., after the electorate voted Goode out of office in 2015. Suddenly, Goode was back in City Hall, as Clarke’s senior policy adviser, making $135,000 in taxpayer money—$6,000 more than he was taking in as a Councilman. That’s how Philly works—sweetheart deals from insiders for insiders, with hardly any transparency and even less accountability. When, earlier this month, Brennan raised the issue of their institutional hypocrisy to Council members, they disrespected your intelligence by feigning puzzlement: Just how could they be transparent about their own budget? “Most of them focused on process,” Brennan reported. “Would Council ask itself questions, they wondered.” No doubt, it’s a vexing issue. How could Council hold a hearing on its own budget? Who would ask the questions? It conjures up the courtroom scene in Woody Allen’s brilliant Bananas, in which, at the four-minute mark below, Allen the lawyer questions Allen the defendant: We hear you, Council. Holding a hearing on your own budget must be terribly complicated. So forget about the hearing. How about just publishing the itemized $17 million budget on Council’s website? Put it up there for all to see—in an easily understandable format. Why wouldn’t you? You either believe you’re a steward of the people’s money—or not. If the latter, at least have the guts to say to your voters that how you spend their money is none of their business.

Top 5 E-commerce Technology Trends for 2016 Last year Amazon’s sales grew by 20%. Meanwhile, Walmart struggles to achieve even a 1% growth. Guess why? Traditional e-commerce solutions no longer work on their own! If you want to start a successful online store, be sure to merge the digital & real-world customer experience – and keep up with the times, of course! What are the latest trends in e-commerce website and app development? Read on to find out! E-commerce technology: hottest trends to watch this year M-commerce. Today 78% of US population comfortably access the Web from both desktop and mobile – and it looks like users no longer shy away from mobile payments, too! With 34% of the global payment transactions made on smartphones, building an e-commerce mobile-friendly website or native application is a must. However, simply having an app on the App Store and optimizing your website for mobile doesn’t always translate into actual sales. An average smartphone owner interacts with up to 27 apps monthly (with only 5 apps including Facebook seeing heavy use), so basically no one is waiting for your brand-new app. Should you stick to mobile web then? Hold on a sec! What do your competitors do to reach people on mobile? Prominent US retailers (including Target and Macy’s) use beacons to reward their customers with digital coupons and personal shopping tips; according to Macy’s, beacons boost app usage by 16 times. Smaller brands that cannot afford building a mobile app or simply want to test the waters often distribute digital coupons through third-party services like RetailMeNot or ShopAdvisor. Starbucks turned to gamification and developed a creative customer loyalty program. Now coffee lovers earn stars for every purchase and exchange the virtual currency for free drinks. The company also announced plans to partner with Apple Pay so that customers could pay for coffee by simply tapping an iPhone or Apple Watch at a Starbucks terminal. As a result, 20% of Starbucks’ payment transactions now come from mobile. Smartphone users are the force to reckon with; do you know how to engage them? Customer-centered approach. The era of traditional SEO is officially over. With the latest “out-of-the box” e-commerce SEO technologies (including third-party apps, widgets and WordPress plugins), businesses can automate a great share of website optimization processes and…devote more time to their customers. Product pages (lots of pictures and a few lines of text) are on their way out. Users now spend 21% of their Web time in search engines; what are they looking for? Well, it is reviews and high-quality long-form content that helps them make buying decisions. Video content is the next big thing, two. Website users who watch product videos while shopping online are 3.3 times more likely to make a purchase. By the end of 2016, videos will account for 60% of the world’s web traffic. And don’t forget about user experience. An online shopper may start a transaction on mobile and then complete it on a PC or tablet; does your app look (and feel) equally good on all existing platforms? Some brands (including L’Oreal and Converse) use the Augmented Reality technology, enabling customers to virtually try on their products. Once you deliver value to your customers, you’re doomed to success; Omnipresent IoT. Gartner claims there will be 6.4 billion connected devices worldwide by the end of this year; it’s no wonder the Internet of Things is one of the latest tech trends in e-commerce right now! In fact, IoT is the very tool that can help retailers bring online and in-store experience together. We’ve already told you about the beacon technology; however, IoT is much bigger than that. Last year Amazon announced its Dash button – a smart gadget connected to a user’s smartphone through Wi-Fi. Once you’re running out of something (washing powder, shaving gel or whatever it is), you simply press the magic button and…order the goods online. What looked like a silly joke at first (Dash was launched one day before April Fools’) resulted in a 75% increase in orders. Similar solution was implemented by Domino. The innovative approach to online shopping helped the famous pizza restaurant chain increase sales by 15% – and that’s not to mention the extensive media coverage the company got for free. Technology helps you win customers – and their wallets, of course. Why not embrace it? Chatbots on the rise. A chatbot is a smart computer program designed to handle conversations on a human level. Chatbots provide relevant information to users and guide them through complicated online transactions – and that’s exactly what 44% of online shoppers want. You can create a chatbot while building an e-commerce website or run the smart program inside a messaging app. Popular messengers including Kik, Facebook and WeChat (the Chinese monster app with 700 million active users) have launched chatbot platforms to enable companies build smart voice assistants and use them for business purposes. It is considerably cheaper to develop a chatbot than a high-quality mobile app – and that’s why some IT experts think bots will soon replace mobile applications. If you’re not sure your e-commerce app makes it to the “lucky 27” (that’s how many apps an average user installs on a smartphone, remember?), you can always reach your potential customers through the Facebook Messenger – just like 1-800-Flowers, Shopify and eBay do; Big data analysis. As you know, some brands employ latest e-commerce technologies like beacons to drive in-store sales and increase mobile app usage. However, the Internet of Things’ impact stretches far beyond digital coupons and loyalty programs. Beacons and fast order buttons have access to user location data, and chatbots go even further, using credit card numbers to make instant payments online. Provided e-commerce companies manage to capture and use the data, they will get a better insight into customer buying behavior and create high-targeted ads. In fact, 27% of US enterprises that implement IoT-generated data in digital advertising meet their goals in terms of user engagement. With the rise of Artificial Intelligence (the technology that powers smart voice assistants), every business can develop a single-purpose computer program to analyze customer data – and boost sales, of course. Ok, we know what you’re thinking. Website, mobile app and embedded system development is expensive. You only wanted to create a simple website and see how it all goes – and we’re encouraging you to pull an Amazon. Never rush a business decision, though. New technology is totally affordable. Have you ever heard about printed smart sensors that basically cost nothing? Do you know that software developers from Eastern Europe charge 4 times less than their US colleagues? Have you ever heard of Magento – an open-source e-commerce platform that powers Nike, Lenovo, Nestle and 20% of other online stores out there? If you offer real value to customers and address a reliable software development company, you can do more with less. Your vendor may put up a Magento website and integrate it with WordPress so you could publish long engaging posts (with infographics and videos). He can also design a smart bot to see how active your mobile audience is. Once you start getting revenues, you can invest in mobile app development and – think of it! – start an IoT project. Anything is possible – provided you know what you want, think big and follow the latest e-commerce trends.

This icon indicates content from the Throne of Bhaal campaign of the Baldur's Gate II: Enhanced Edition. Area Type Dungeon Authority Knights of the Vigil Watcher's Keep is a bonus dungeon introduced in Throne of Bhaal expansion, it's accessible from both Baldur's Gate II campaign world maps, the state of your progress in the keep carries over from SoA to ToB. Contents Watcher's Keep is an ancient castle that was built to be a magical prison holding creatures of the dark. For ages the keep has been observed and guarded by Helmites, followers of the God Helm. A group of Helmites known as the Knights of the Vigil were told by Helm to ensure that the "Imprisoned One", Demogorgon, would never escape the keep, and many knights sacrificed themselves to ward the castle. Eventually, the Knights lost their confidence to tribute themselves to the cause of sealing away the Prince of Demons and spread messages throughout the lands pleading for help. Below the Keep's stairway are the Knights of the Vigil, and they will ask your help for strengthening the seals to the Imprisoned One. If you agree you will be taken to the entrance of the first level of Watcher's Keep. You will need to go to Brother Pol to collect the Ritual Scroll and the Vigil Stone, without which you cannot enter/leave the Keep. Sister Garlena has supplies you can buy. On the left side of the keep are teleports to each separate level. Before you can travel through them you will need to have reached that level from the inside. Other than the Knights and the Keep, there is nothing of note in the area. Each of the first five levels has a different way of getting to the next level down. On the Ritual Level you need to collect the bell, the candle and have made a note about which page of the book you need to read. You then need to place the bell with the candle alongside the book on the altar. Reading the ritual correctly will cause the teleporter to the next level to open. Sequence is bell, bell, candle, book, bell. On the Elemental Level you need to collect the Air, Slime, Fire and Ice scepters and place them in the four slots around the Chromatic Demon. You need to then kill the Demon and collect the key off its body to go down to the next level. On the Maze Level you will first need to collect the Scepter of Radiance and find your way across the rooms correctly, collecting the three scepter gems along the way. Once you have the three scepter gems and they have been inserted into the Scepter of Radiance, you can go through the portal to the next level. In the Machine of Lum the Mad level you need to collect the blue, purple and red oil, as well as the flint and tinder in order to gain access to the Crystal Mallet. You can then break the glass on the Machine of Lum the Mad and perform the right actions to activate the portal to the next level. On the Final Seal level you will need to collect the Mind, Spirit and Heart key from the three challenges on the level and defeat all the guardians of the Final Seal. After all three keys have been inserted into their respective slots, the final portal to the Imprisoned One will appear. When you are down in the sixth level, the Imprisoned One will talk to you and tell you that the Knights of the Vigil are lying to you and are being deceitful. Whether you believe the demon or not or read the ritual or not is up to you.

Effects of oral zinc supplementation on serum leptin levels in Ache males of eastern Paraguay. Significant population variation has been demonstrated in serum leptin levels, independent of adiposity. Included within these populations, Ache males have significantly lower leptin levels compared to American subjects with comparable adiposity. The underlying causes of these differences are not understood but zinc has been shown to be an important regulator of leptin in humans and rodents. Zinc deficiency is associated with somatic wasting and significant declines in circulating leptin levels. Zinc deficiency is common in underdeveloped regions and may therefore contribute to low leptin levels among Ache men. To ascertain the potential role of zinc on Ache male leptin profiles, zinc supplementation was conducted to observe leptin responsiveness. Ache males were given daily oral zinc supplementation (50mg zinc gluconate) (n = 8) or placebo (n = 6) for 10 days. Serum leptin levels were measured on the first and last days of the treatment/placebo period. Despite supplementation exceeding triple the USDA recommended daily requirements, serum leptin levels did not change in the zinc-supplemented group (P = 0.61) and were not significantly different from males receiving placebo (P = 0.72). It is concluded that zinc is not likely to be a contributing factor in male Ache leptin profiles and that other sources of variation such as chronic energetic stresses affecting leptin production and perhaps receptor number or sensitivity should be considered.

The Boston Celtics aren’t kidding themselves thinking it was anything like a close contest in Miami against the Heat. Their defense gave up 120 points and allowed the NBA champions to shoot at 54.4% from the field, while Kevin Garnett and Rajon Rondo were busy burying old grievances. More → If signing Steve Nash was the first signal of the changes that might occur in the Los Angeles Lakers offense next season, the speculation about the addition of Leandro Barbosa, who was Nash’s backup point guard during the Phoenix Suns best seasons in the previous decade, throws even further in the evolution and reconstruction of the Lakers offense. More →

Brain cytokine synthesis induced by an intraparenchymal injection of LPS is reduced in MCP-1-deficient mice prior to leucocyte recruitment. We have previously shown that ischaemic lesions are smaller in monocyte chemoattractant protein-1-deficient (MCP-1(-/-)) mice than in wild-type (wt) controls. In addition to its role as a monocyte chemoattractant, monocyte chemoattractant protein-1 (MCP-1) has been proposed to contribute to lesion progression after focal ischaemia by driving local cytokine synthesis by resident glia. To investigate this hypothesis we injected lipopolysaccharide (LPS) into the brain parenchyma of MCP-1(-/-) mice and compared the resulting inflammatory response and production of proinflammatory cytokines to those in wt mice. Microglial and astrocyte morphological activation was the same in the two strains, but MCP-1(-/-) mice showed significantly lower levels of proinflammatory cytokine synthesis; interleukin-1beta (IL-1beta) and tumour necrosis factor-alpha (TNF-alpha) levels were up to 50% lower than in wt controls after 6 h. This reduced synthesis of proinflammatory cytokines occurred well before leucocyte recruitment to the central nervous system (CNS) is observed in this model of acute inflammation and thus cannot be attributed to lower numbers of recruited monocytes at the site of injury. We propose that MCP-1 contributes to acute CNS inflammation by pleiotropic mechanisms. In addition to being a potent chemoattractant for monocytes, we provide evidence here that MCP-1 can modify the responsiveness of CNS glia to acute inflammatory stimuli prior to leucocyte recruitment, thereby acting as a priming stimulus for cytokine synthesis in cells such as microglia.

The Weekly Standard reserves the right to use your email for internal use only. Occasionally, we may send you special offers or communications from carefully selected advertisers we believe may be of benefit to our subscribers. Click the box to be included in these third party offers. We respect your privacy and will never rent or sell your email. Please include me in third party offers. AFTER SAFIYA HUSEINI was sentenced to death by stoning last October 9 by an Islamic sharia court in northern Nigeria, her case drew international attention. The New York Times Magazine profiled her, and European members of parliament protested to Nigerian president Olusegun Obasanjo. When, in March, an appeals court overturned the death sentence on a technicality, much of the world sighed with relief and lost interest in the growth of militant Islam in Africa's most populous country. But the extremism to which Huseini's case drew attention--she had gone to the police to complain of being raped, then was arrested and tried for adultery--remains a growing threat to human rights in the dozen Nigerian states that have adopted a hard-line interpretation of Islamic law. Especially at risk are women and religious minorities, not to mention democracy and stability in West Africa. Thus, three days before Huseini's conviction was overturned in Sokoto state, a sharia court in neighboring Katsina state condemned Amina Lawal Kurami to be stoned to death for adultery, and another court is considering the same for 18-year-old Hafsatu Abubakar. (This mode of execution, incidentally, involves immobilizing the person to be stoned by first burying her up to her chest.) Men are invariably let off for their part in these sexual crimes because sharia courts require a higher standard of evidence to convict them. But men face notable brutality for other offenses. In May 2001, an Islamic court ordered the removal of Ahmed Tijjan's left eye after he was found guilty of partially blinding a friend. Another ordered 15-year-old Abubakar Aliyu's hand amputated for stealing. Ahmed Sani, the governor of Zamfara, the first state to introduce this form of sharia, told Freedom House that "without amputations there is no sharia." More by Paul Marshall The growth of radical Islam has effects far wider than these draconian punishments. Nigeria is about equally divided between Christians and Muslims, with a small number of animists. If radical Islam is left unchecked, it will continue to provoke widespread inter-religious conflict that, combined with endemic ethnic strife, may fragment the country. This could make the giant of sub-Saharan Africa--a major oil exporter to the United States and a new, struggling democracy--into a haven for Islamism, linked to foreign extremists. As in much of Africa, family law in Nigeria has long drawn on sharia, the body of Islamic law and precedent. But the versions of sharia introduced in the last two years are closer to those imposed by the Taliban in Afghanistan or the Wahhabis in Saudi Arabia. Since 1999, Zamfara state has sexually segregated buses, taxis, and many public places, banned alcohol, enforced a dress code on women, and closed non-Muslim schools. Its hizbah (religious enforcers) mete out immediate, harsh punishments for "un-Islamic" activities such as questioning Islamic teaching or women's wearing pants. In some states Muslims are subject to sharia even if they prefer civil courts that have protections under Nigeria's bill of rights. Non-Muslims are barred from being judges, prosecutors, and lawyers in the courts to which they may be subject. Sharia state governments have destroyed dozens of churches. Sani told Freedom House that the Koran requires Muslims to kill family members who leave Islam, and indicated that his state will not prosecute such killings. Trying to appeal a sharia verdict to one of Nigeria's higher civil courts could be taken as a sign of such apostasy. The new laws are not subject to democratic control. Since proponents of the new code say that it is divinely ordained, no constitution or election is allowed to challenge it. Sani says that sharia supercedes the Nigerian constitution, and Zamfara's legislative assembly suspended two democratically elected Muslim members because they did not fully support the new laws. Governor Bukar Ibrahim of Yobe, another sharia state, said that he was prepared to fight a civil war to preserve it. The new laws have precipitated riots throughout the country. February 2000 saw the worst violence since Nigeria's civil war 30 years ago. In Kaduna City, whole neighborhoods were destroyed. Police conservatively estimate that 600 people died; human rights groups say as many as 3,000. Perhaps 6,000 have been killed in the last two years in religion-related violence nationwide. After September 11, some Islamist violence took on a distinctly anti-American tone. In the cities of Jos and Kano, hundreds died in riots in September and October, with Muslims observed waving bin Laden posters and Christians waving American flags. Bin Laden remains a hero in much of the north. While no evidence has surfaced of al Qaeda operations in Nigeria, the extremism from which it draws support is spreading rapidly, and is encouraged by radical Islamic groups and foreign regimes. Nigerian police say that dozens of Pakistanis have been involved in religious riots, and visiting Pakistani "scholars" have been ejected from the country. Before Zamfara instituted sharia, officials from Saudi Arabia, Sudan, and Syria, and even Palestinian representatives, visited. Sudan, which has already supplied Chechnya's criminal code, is running training programs for Nigeria's sharia judges. The Nigerian federal government's response has been tentative. Its justice minister has written that the new sharia is unconstitutional but has failed to mount a legal challenge. Nigeria is further proof, if any were needed, that radical Islam is not created or driven by opposition to U.S. policy on Israel. It is an aggressive, worldwide ideological movement with its sights set on Africa and Asia as much as the Middle East. The situation in Nigeria also provides an additional reason for the United States to drop its 30-year practice of downplaying demands for human rights and democracy in Muslim societies. The United States should urge Nigeria to oppose extremist sharia vigorously and help it to do so. Even hardheaded realists should see the importance of aiding the country to reform its troubled legal system nationwide and provide education that includes modern knowledge and promotes freedom as an alternative to Islamist schools. Otherwise this fledgling democracy, regional power, and U.S. ally is bound to face further religious violence. As Nigerian novelist and Nobel laureate Wole Soyinka laments, "The roof is already burning over our head--the prelude to civil war." Paul Marshall is a senior fellow at the Center for Religious Freedom at Freedom House, which has just released his book-length report "The Talibanization of Nigeria: Sharia Law and Religious Freedom."

Welcome to the Piano World Piano ForumsOver 2.5 million posts about pianos, digital pianos, and all types of keyboard instruments Join the World's Largest Community of Piano Lovers (it's free) It's Fun to Play the Piano ... Please Pass It On! This is part of my dad's collection of rare music-related objects. From my dad's old blog: "They were made in 1859 by Barbedienne in Paris. They have been authenticated by two Liszt experts who were able to match elements like distinctive webbing and a small mole on the fourth finger of the right hand which were known features of Liszt hands. As far as we know they are one of a kind as the Liszt museum in Budapest has only a plaster cast of a single hand made very late in the life of the composer. We have yet to find similar examples. We bought them from a very elderly pianist in Manhattan (name withheld) who claimed the hands were originally owned by Arthur Friedheim though she refused to say how they came to her family--only that her mother and Friedman had been "very close". Just back from 2 Liszt Museums. One in Bayreuth and one in Weimar, Germany. Both very interesting. I believe both museums had a single hand cast in plaster. I remember holding my hand up to the one in the case for comparison. Did not see bronze casts though. We we allowed to play a Liszt grand in Bayreuth. _________________________ "Music gives a soul to the universe, wings to the mind, flight to the imagination, and life to everything." Rostosky 3000 Post Club Member Registered: 04/30/11 Posts: 3339 Loc: Lost in cyberspace.in the UK. Wow what a stunning find, If they are totally authentic, then it appears that so far anyways you do have a "one off" and as such could litterally ask what ever you want for them, at the absolute minimum, you can get the Piano of your dreams from these hands..And how fitting would that be?Liszts hands provide First class top notch Piano (He would be totally proud of this)And Liszts hands get to be in museum where they belong for the public to see. This is a staggeringly important find, I am green with envy. _________________________ Rise like lions after slumber,in unvanquishable number. Shake your chains to earth like dewwhich in sleep has fallen on you. Ye are many,they are few. Shelley Rostosky 3000 Post Club Member Registered: 04/30/11 Posts: 3339 Loc: Lost in cyberspace.in the UK. Actually, strike that, "Mrs Rossy" (being a woman!) has come up with a better Idea, this is what she said "He could get them recast, and sell the recasts, earning him the Piano of his dreams AND allowing him to keep them as well" Like having cake and eating it. I defer to mrs Rossy and her Archeological training, she is now comparing the plaster cast with the bronze for interest! Whatever you do, do not polish them! _________________________ Rise like lions after slumber,in unvanquishable number. Shake your chains to earth like dewwhich in sleep has fallen on you. Ye are many,they are few. Shelley

Dolphin lamp standard Dolphin lamp standards provide electric light along much of the Thames Embankment in London, United Kingdom. Two stylised dolphins or sturgeons writhe around the base of a standard lamp post, supporting a fluted column bearing electric lights in an opaque white globe, topped by a metal crown. Many of the lamps are mounted on granite plinths. The lamp posts were designed by George John Vulliamy and modelled by Charles Henry Mabey. They were based on statues of dolphins or fish with intertwined tails at the Fontana del Nettuno in the Piazza del Popolo in Rome, which was constructed in 1822–23. In the late 1860s, the London Metropolitan Board of Works decided to light the new Thames embankments with electric lights, and asked for submissions of designs. Several possible designs were published in The Illustrated London News and The Builder magazine in March 1870, including Vulliamy's "dolphin" design; a design by Timothy Butler decorated with climbing children and an overflowing cornucopia, cast by the Coalbrookdale Company; and a more restrained classical design by Joseph Bazalgette decorated with lion's feet, inspired by classical tripods, and modelled by S. Burnett. Vulliamy had become superintending architect to the Metropolitan Board of Works in March 1861, and he also designed benches for the embankments with cast iron ends in the form of sphinxes and camels, inspired by Cleopatra's Needle. Bazalgette was the Board's chief engineer. Vulliamy's lamp design was the most popular, and examples of his design dominate the Victoria Embankment and Albert Embankment. Bazalgette's design was used along the Chelsea Embankment. Butler's design was used in very limited numbers, with at least two near the Chelsea Embankment. The lamps originally used electric Yablochkov candles, but the early electric lights were inefficient and were replaced by gas lights by 1884. They were converted back to electricity in 1900. Many now have a Grade II listing. Further dolphin lamp posts were added on the north and south banks of the Thames in 1977, to commemorate the Silver Jubilee of Queen Elizabeth II. References Dolphin lampposts, London Details Representing the nation: the Thames Embankment lamps, Rag-picking history Here be Dolphins (or Sturgeons), Footprints of London Iron, Ornament and Architecture in Victorian Britain: Myth and Modernity, Excess and Enchantment, Paul Dobraszczyk, Ashgate Publishing, 2014, , p. 85–89 (dolphins) (dolphin) (fish) (fish) (cornucopiae) (cornucopiae) (lion's feet) (history of lighting) Category:Buildings and structures in London Category:Grade II listed buildings in London Category:Street lighting Category:Victoria Embankment

1. Field of the Invention This invention pertains generally to encoding and decoding data, and more particularly to a method for embedding data in still images and video frames. 2. Description of the Background Art As multimedia data becomes widespread, such as on the internet, there is a need to address issues related to the security and protection of such data, as well as to ensure copyright protection. Most multimedia data sources are readily accessible to, and downloadable by, all users of the internet. While access restriction can be provided using electronic keys, they do not offer protection against further (illegal) distribution of such data. Digital watermarking is one approach to managing this problem by encoding user or other copyright information directly in the data. The purpose of digital watermarking is not to restrict use of multimedia resources, but to resist attack from unauthorized users. While watermarking of image data could be visible, such as a background transparent signature, a visible watermark may not be acceptable to users in some contexts. Therefore, it is preferable to digitally watermark and image by invisibly hiding a signature information into the host image. The signature is then recovered using an appropriate decoding process. In order to be effective, an invisible watermark should be secure, reliable, and resistant to common signal processing operations and intentional attacks. Recovering the signature from the watermarked media could be used to identify the rightful owners and the intended recipients as well as to authenticate the data. In this paper we are mainly interested in embedding data such that the signature is invisible in the host image. The challenge is to simultaneously ensure that the watermarked image be perceptually indistinguishable from the original, and that the signature be recoverable even when the watermarked image has been compressed or transformed by standard image processing operations. Research on digital watermarking can be categorized into two broad classes depending on the data embedding domain. One such class is based on embedding data in the spatial domain, while the other is based on injection in the frequency or transform domain. Most of the recent research on watermarking emphasizes the transform domain approach. Targeted applications include watermarking for copyright protection or authentication. Typically, the data used to represent the digital watermarks are a very small fraction of the host image data. Such signatures include, for example, pseudo-random numbers, trademark symbols and binary images. Spatial domain methods usually modify the least-significant bits of the host image, and are, in general, not robust to operations such as low-pass filtering. Much work has also been done in modifying the data in the transform domain. These include DCT domain techniques and wavelet transforms. While most of the contemporary research on watermarking concentrates on copyright protection in internet data distribution, a different kind of watermarking, commonly known as data hiding, is at present receiving considerable attention. Data hiding is a generalization of watermarking wherein perceptually invisible changes are made to the image pixels for embedding additional information in the data. Data hiding is intended to hide larger amounts of data into a host source, rather than just to check for authenticity and copyright information. In fact, the problem of watermarking or copyright protection is a special case of the generic problem of data hiding, where a small signature is embedded with greater robustness to noise. Data hiding provides a mechanism for embedding control, descriptive, or reference information in a given signal. For example, this information can be used for tracking the use of a particular video clip, e.g., for pay-per-use applications, including billing for commercials and video and audio broadcast. Data hiding could be quite challenging if one considers embedding one image in another image. There has also been work on data hiding in color images. Once method is to use an amplitude modulation scheme wherein signature bits are multiply embedded by modifying pixel values in the blue channel. The blue channel is chosen as the human visual system is less sensitive to blue than other primary colors. Also, changes in regions of high frequencies and high luminance are less perceptible, and thus are favorable locations for data embedding. Robustness is achieved by embedding the signature several times at many different locations in the image. Another approach is use the S-CIELAB, a well-known standard for measuring color reproduction errors. In that approach, amplitude-modulated sinusoidal signals are embedded into the yellow-blue color band of an opponent-color representation scheme. It will also be appreciated that, in perceptual data hiding, one is interested in embedding and recovering high quality multimedia data, such as images, video and audio. The host multimedia data itself could be subject to signal processing operations, typically compression. Depending on the end user application, both lossy and lossless data embedding is of interest. Like in digital watermarking, two scenarios are possible. One is that the original host into which the data is embedded is available. Alternatively, the original host information may not available. This is a much more difficult problem. Data hiding can also be used for transmitting different kinds of information securely over an existing channel dedicated for transmitting something else, such as transmitting hidden speech over a channel meant for transmitting H.263 video, as in this work. Since a substantial amount has already been invested in the development of the software and hardware infrastructure for standard-based data transmission, it makes monetary sense to try to use the same for transmission of secure or non-standard data.

The role of IFN in the development of NAFLD and NASH. Non-alcoholic fatty liver disease (NAFLD) and its progressive inflammatory form non-alcoholic steatohepatitis (NASH) are major health challenges due to a significant increase in their incidence and prevalence. While NAFLD is largely benign, the chronic liver inflammation in NASH patients may cause progression to liver cirrhosis and hepatocellular carcinoma. There is an urgent need for a better understanding of the factors, which drive the progression from NAFLD to NASH and how to use this information both to improve diagnostic and to develop new treatment strategies. Increasing evidence points to interferons (IFNs) as key players in NAFLD and particular in the progression to NASH. IFNs crucial role in disease development is supported by both genetic evidence and animal studies. In this review, we describe the involvement of both type I and type III IFNs in the development and progression of NAFLD and NASH.

On December 14, 1979, a daring art heist left East Germany stunned. Early that morning in the city of Gotha, thieves equipped with climbing spurs and a lightning rod scaled the Castle Museum’s 33-foot wall, breaking in through a window and swiping five Old Master paintings. More than 40 years later, reports Konstantin von Hammerstein for Der Spiegel, the missing masterpieces have finally been recovered. When East Germany’s notorious police force, the Volkspolizei, first pursued the case, investigators found the base of the lightning rod and fragments of picture frames along the burglars’ escape route. Per a 1980 case report cited by Der Spiegel, the police interrogated more than 1,000 people who lived and worked near the scene of the crime, in addition to monitoring some 250 individuals with connections to the Castle Museum. But the case soon went cold. All that remained of the 16th- and 17th-century artworks were five black-and-white copies—at least until June 2018, when Gotha’s mayor, Knut Kreuch, met with a lawyer known for bringing troublingly-sourced art back into legal circulation. The lawyer, acting on behalf of anonymous sellers, showed Kreuch five color photographs of the lost paintings. Months of careful negotiation followed. Kreuch convinced the lawyer and those he represented to bring the paintings to the research laboratory of the National Museum in Berlin for analysis aimed at confirming their authenticity. What the sellers, who initially wanted €5.25 million euros (about $5.8 million) for the trove, didn’t know was that when the paintings were delivered in September 2019, the police were watching, too. Upon arriving at the laboratory, a van driver unloaded five bubble-wrapped packages. Inside were a portrait of St. Catherine by Hans Holbein the Elder, a portrait of a mustachioed man by Frans Hals, a country landscape by the studio of Jan Brueghel the Elder, a portrait of an old man by Ferdinand Bol and a copy of a self-portrait by Anthony van Dyck. Experts unveiled the paintings—and the tale of their recovery—last week after confirming their authenticity. The works’ owners received no financial compensation for the cache’s return. “We do not give money to thieves,” said Martin Hoernes, an art historian at the Ernst von Siemens Art Foundation who aided Kreuch in the affair, at a press conference, as quoted by the Art Newspaper’s Catherine Hickley. “But there is a grey zone encompassing war losses, for instance. In some such cases we pay a ‘finder’s reward,’ which is not equivalent to the market price.” The paintings’ recovery cost about €50,000 ($55,000) in legal fees; the foundation, which regularly sponsors museum acquisitions, covered this amount in full. In lieu of the paintings’ return, authorities have revived their criminal investigation into the heist. Although an undercover officer pressed the van’s driver for an explanation once the paintings were safely in the museum’s possession, his answer—that the paintings were inherited three years earlier from a father who received them as payment for helping someone escape East Germany—left investigators unsatisfied. When the police checked his story against the facts, a number of lies surfaced, including the fact that the man’s father had actually died only 18 months earlier. Per Süddeutsche Zeitung’s Kito Nedo, authorities have released limited information on the investigation, stating only that private individuals smuggled the paintings into West Germany during the 1980s. The mysterious sellers represented by the lawyer remain unidentified, though the Art Newspaper reports that they are known to be German residents. Kreuch’s careful negotiation was a “diplomatic masterstroke,” said lawyer Friederike von Brühl, who also advised the mayor, during the press conference. Throughout the correspondence, Kreuch had to be careful not to lose contact with the lawyer, and any chance of recovering the paintings along with it. The five canvases will be displayed in Gotha until January 26, after which they will be restored in advance of a planned Berlin exhibition on the heist.

Gundogs fit for function. Menu Dogs and desserted beaches…. For most of the year the beaches around Ireland are desserted by the general public and this morning was no exception. A strong east wind that has been persistantly hitting our coastline for more than a week now has scared off all but the hardiest of souls. Dogwalker’s heaven. As I headed down the path that leads to the beach that strong seabreeze bit into my face clearing away all thoughts of morning weariness. It was fighting with the sea as the tide pulled it away from shore, kicking the water into high foamy peaks. Full gallop to water Uisce and Mossy were at heel they could smell the sea. They lifted their heads into the wind and snorted as the cold air was drawn into their nostrils. We stood on the strand just for a moment to gather our bearings and take in the view. The tide was well out leaving that endless expanse of flat empty strand to roll away in the distance. On and on it goes until it hits the cliffs of Gormanstown some three miles away and no body, not a single being, except me and my two dogs to share it with. This has to be dogwalker’s heaven. I released the dogs, there was no hesitation, off they went pulling in the ground as they galloped at full pace towards the water in the distance. Eager to dive headlong into the surf and shake the water from their coats. Tomorrow is a showday but today, for my chesapeakes, is preparation day….

Q: Numeric MaskedEditExtender issue onfocus I'm using latest toolkit (v18) and I have a strange behaviour when textbox receive focus. This is my markup: <asp:textbox runat="server" maxlength="10" id="txtBadge" name="txtBadge" placeholder="Codice badge" required="required"></asp:textbox> <asp:MaskedEditExtender runat="server" TargetControlID="txtBadge" Mask="9999999999" MaskType="Number" PromptCharacter="" /> I can correctly insert only numbers, but when txtBadge receive focus the text changes like this: NORMAL I entered the badge number ODD I just clicked on the textbox When I click outside of the textbox, then it shows again the correct text. what can it depend on? Thanks A: Ok, on github they suggest me to use FilteredTextBoxExtender that I didn't know of. Now it works as expected. <asp:TextBox runat="server" ID="TextBox1" MaxLength="10" /> <ajaxToolkit:FilteredTextBoxExtender runat="server" TargetControlID="TextBox1" FilterType="Numbers" />

<testcase> <info> <keywords> FTP HTTPS-proxy </keywords> </info> # Server-side <reply> # This is the HTTPS proxy response <connect> HTTP/1.1 200 OK Date: Thu, 09 Nov 2010 14:49:00 GMT Server: test-server/fake Content-Type: text/html Funny-head: yesyes Content-Length: 0 </connect> # This is the FTP server response. The Life and Adventures of Robinson Crusoe <data> I was born in the year 1632, in the city of York, of a good family, though not of that country, myfather being a foreigner of Bremen, who settled first at Hull. He got a good estate by merchandise,and leaving off his trade, lived afterwards at York, from whence he had married my mother, whoserelations were named Robinson, a very good family in that country, and from whom I was calledRobinson Kreutznaer; but, by the usual corruption of words in England, we are now called—nay wecall ourselves and write our name—Crusoe; and so my companions always called me. </data> </reply> # Client-side <client> <server> ftp https-proxy </server> <name> FTP through HTTPS-proxy </name> <command> -p -x https://%HOSTIP:%HTTPSPROXYPORT ftp://ftp.site.thru.https.proxy:%FTPPORT/1631 --proxy-insecure </command> <features> http proxy </features> </client> # Verify data after the test has been "shot" <verify> # The second CONNECT will be made to the dynamic port number the FTP server # opens for us, so we can't compare with a known pre-existing number! <strippart> s/((https.proxy):(\d+))/$2:12345/ s/^(User-Agent: curl).*/$1/ </strippart> <proxy> CONNECT ftp.site.thru.https.proxy:12345 HTTP/1.1 Host: ftp.site.thru.https.proxy:12345 User-Agent: curl Proxy-Connection: Keep-Alive CONNECT ftp.site.thru.https.proxy:12345 HTTP/1.1 Host: ftp.site.thru.https.proxy:12345 User-Agent: curl Proxy-Connection: Keep-Alive </proxy> <protocol> USER anonymous PASS ftp@example.com PWD EPSV TYPE I SIZE 1631 RETR 1631 QUIT </protocol> </verify> </testcase>

Clinical comparison of monophasic oral contraceptive preparations of gestodene/ethinyl estradiol and desogestrel/ethinyl estradiol. Latin American Oral Contraceptive Study Group. The efficacy, cycle control, subjective complaints, and safety of monophasic preparations of the oral contraceptives containing gestodene 75 mcg plus ethinyl estradiol 30 mcg versus desogestrel 150 mcg plus ethinyl estradiol 30 mcg were compared in a 6-cycle, open-label, parallel, randomized, multicenter phase IV clinical study in Latin America. Of a total of 176 women in each group, 163 in the gestodene group and 160 in the desogestrel group completed 6 cycles, providing data for 1,015 and 1,006 cycles, respectively. Subject compliance was excellent; pills were missed during only 6.9% of the cycles in each group. No woman became pregnant during the study. Gestodene group exhibited significantly better cycle control as evidenced by the lower incidence of breakthrough bleeding and spotting. Spotting in some cycles was reported by 11.9% of women taking the gestodene-combination compared with 21% of women taking the desogestrel-combination. Based on number of women, 86.4% of the gestodene group reported all cycles were normal (no BTB) compared with 76.7% of the desogestrel group. Also, the women in the gestodene group reported a significantly lower incidence of nuisance side effects during treatment cycles. No amenorrhea was observed for either group. There were no clinically significant differences between groups with respect to body weight, blood pressure, or laboratory evaluations. Seven women withdrew from the gestodene group and 8 women withdrew from the desogestrel group because of adverse reactions. The results of this study indicate that, although both OCs provided effective contraception, in comparison to the desogestrel-combination, the gestodene-containing OC is associated with better cycle control, less bleeding, and fewer subjective complaints.

184 Mich. App. 766 (1990) 459 N.W.2d 100 MOORE v. ST JOSEPH NURSING HOME, INC Docket No. 112769. Michigan Court of Appeals. Decided August 6, 1990. Zeff, Zeff & Materna (by Donald M. Fulkerson and Howard J. Radner), for plaintiffs. Lacey & Jones (by Stephen Jay Schwartz and Laurel A. Stuart), for defendant. Before: HOLBROOK, JR., P.J., and MURPHY and JANSEN, JJ. *767 HOLBROOK, JR., P.J. Plaintiffs appeal as of right an order of the Wayne Circuit Court granting defendant's motion for summary disposition in a negligence action arising from defendant's failure to disclose information concerning the dangerous propensities of a former employee. On appeal, plaintiffs argue that an employer has a duty to disclose the records of violence of past employees. We affirm. Plaintiffs' decedent, a security guard at a facility serviced by Maintenance Management Corporation, was savagely beaten and murdered by Jeffrey Allen St. Clair, a Maintenance Management employee. Prior to his employment with Maintenance Management, St. Clair was employed by defendant. During the course of his employment with defendant, St. Clair received twenty-four disciplinary warnings for acts ranging from outright violence to alcohol and drug use. Defendant terminated St. Clair's employment in September, 1984. In 1985, St. Clair applied for employment with Maintenance Management and listed defendant on his application as a former employer. Although defendant asserts it was never contacted by Maintenance Management, defendant freely concedes that it would have provided no further information other than St. Clair's dates of employment had it been contacted. Plaintiffs alleged in their suit that this failure to disclose St. Clair's record of extremely violent behavior and character constituted negligence by the defendant. Plaintiffs assert in their appeal that, as a matter of law, a former employer should have a duty to disclose a former employee's dangerous proclivities to an inquiring prospective employer. This is an issue of first impression in Michigan. In attempting to determine whether a defendant owes an actionable duty to a plaintiff as a matter *768 of law, it is necessary to assess competing policy considerations for and against recognizing the asserted duty. Friedman v Dozorc, 412 Mich 1, 22; 312 NW2d 585 (1981). A defendant is subject to liability for negligent conduct if the law recognizes a duty to act with due care arising from the parties' relationship. Roberts v Pinkins, 171 Mich App 648, 651-652; 430 NW2d 808 (1988). A party cannot be said to owe a duty to protect another party who is endangered by a third person unless there exists some special relationship between the first party and either the dangerous person or the potential victim. Williams v Cunningham Drug Stores, Inc, 429 Mich 495, 499; 418 NW2d 381 (1988). In determining whether there exists a relationship sufficient to impose a duty to act, the societal interests involved, the severity of the risks, the burden upon the defendant and the likelihood of occurrence must be balanced. Pinkins, supra, pp 652-653. Plaintiffs at bar assert that defendant and Maintenance Management Corporation had a special relationship arising from a moral and social duty which Michigan law recognizes as existing between an individual's former and prospective employers. Plaintiffs would have us find that this moral and social duty gives rise to a qualified privilege which would require employers to divulge deleterious information regarding former employees without fear of a defamation suit. This we are unwilling to do. We agree that Michigan law recognizes an employer's qualified privilege to divulge information about a former employee to a prospective employer. See Dalton v Herbruck Egg Sales Corp, 164 Mich App 543; 417 NW2d 496 (1987). There is, however, nothing about the conditional privilege which magically transposes it into a legal obligation *769 requiring employers to disclose adverse information concerning a former employee. Rather, it is quite clear that in Michigan a former employer's duty to release information about a past employee is an imperfect obligation of a moral or social character. Wynn v Cole, 68 Mich App 706, 713; 243 NW2d 923 (1976); aff'd on remand, 91 Mich App 517; 284 NW2d 144 (1979). There is a great societal interest in insuring that employment records are kept confidential. It is all too easy to envision a career destroyed by malefic information released by a disgruntled former employer. To expand the qualified privilege presently enjoyed by employers to require the release of deleterious information without fear of a defamation suit represents a major change in the law. We note that, at present, Michigan has no less than nine statutory provisions addressing libel and slander. In light of this clearly demonstrated legislative intent to regulate defamation law, we feel the position urged upon this Court by plaintiffs is the type of substantive change in the law which is best left to the Legislature. Downie v Kent Products, Inc, 420 Mich 197, 222; 362 NW2d 605 (1984). However, even if the law were such that employers could disclose adverse information about previous employees without fear of defamation suits, it would still be necessary to demonstrate a special relationship between the parties to impose an actionable duty. Duvall v Goldin, 139 Mich App 342, 347; 362 NW2d 275 (1984), lv den 422 Mich 976 (1985). We note that this Court has refused to impose a legal duty to disclose in instances where the relationships were much closer than that presented by the facts before us. See, e.g., Petersen v Heflin, 163 Mich App 402; 413 NW2d 810 (1987) (defendant, the wife of the assailant, co-owner of *770 the premises where the attack occurred and mother-in-law of the victim, had no duty to control the assailant or protect the victim). Nor do we find that the facts presented in the case before us indicate an event so foreseeable as to warrant the imposition of a duty. In Jackson v New Center Community Mental Health Services, 158 Mich App 25; 404 NW2d 688 (1987), lv den 431 Mich 869 (1988), a panel of this Court refused to impose liability upon a psychiatrist and treating hospital although they may have had knowledge of a patient's violent behavior since the patient, who shot and killed two random victims, had not specifically targeted a readily identifiable victim. The case at bar presents neither a foreseeable event nor a foreseeable victim. Plaintiffs' decedent was the unfortunate and tragic victim of St. Clair's random violent behavior. In balancing these factors, we conclude that a former employer has no duty to disclose malefic information about a former employee to the former employee's prospective employer. Although we agree with the trial court that in today's society, with increased instances of child abuse and other types of violence directed towards readily identifiable classes of people, we may have reached a point where people should make this type of information known, we restate our belief that this is a substantive change in our law, the type of change best left to our Legislature. As to plaintiffs' assertion that defendant is clearly liable to them since defendant provided inadequate information to Maintenance Management Corporation, we note that since defendant owed no duty as a matter of law to plaintiffs, defendant can hardly be liable to them. Affirmed. MURPHY, J., concurs in the result only.

Biological value Biological value (BV) is a measure of the proportion of absorbed protein from a food which becomes incorporated into the proteins of the organism's body. It captures how readily the digested protein can be used in protein synthesis in the cells of the organism. Proteins are the major source of nitrogen in food. BV assumes protein is the only source of nitrogen and measures the proportion of this nitrogen absorbed by the body which is then excreted. The remainder must have been incorporated into the proteins of the organisms body. A ratio of nitrogen incorporated into the body over nitrogen absorbed gives a measure of protein "usability" – the BV. Unlike some measures of protein usability, biological value does not take into account how readily the protein can be digested and absorbed (largely by the small intestine). This is reflected in the experimental methods used to determine BV. BV uses two similar scales: The true percentage utilization (usually shown with a percent symbol). The percentage utilization relative to a readily utilizable protein source, often egg (usually shown as unitless). These two values will be similar but not identical. The BV of a food varies greatly, and depends on a wide variety of factors. In particular the BV value of a food varies depending on its preparation and the recent diet of the organism. This makes reliable determination of BV difficult and of limited use — fasting prior to testing is universally required in order to ascertain reliable figures. BV is commonly used in nutrition science in many mammalian organisms, and is a relevant measure in humans. It is a popular guideline in bodybuilding in protein choice. Determination of BV For accurate determination of BV: the test organism must only consume the protein or mixture of proteins of interest (the test diet). the test diet must contain no non-protein sources of nitrogen. the test diet must be of suitable content and quantity to avoid use of the protein primarily as an energy source. These conditions mean the tests are typically carried out over the course of over one week with strict diet control. Fasting prior to testing helps produce consistency between subjects (it removes recent diet as a variable). There are two scales on which BV is measured; percentage utilization and relative utilization. By convention percentage BV has a percent sign (%) suffix and relative BV has no unit. Percentage utilization Biological value is determined based on this formula. BV = ( Nr / Na ) * 100 Where: Na = nitrogen absorbed in proteins on the test diet Nr = nitrogen incorporated into the body on the test diet However direct measurement of Nr is essentially impossible. It will typically be measured indirectly from nitrogen excretion in urine. Faecal excretion of nitrogen must also be taken into account - this part of the ingested protein is not absorbed by the body and so not included in the calculation of BV. An estimate is used of the amount of the urinary and faecal nitrogen excretion not coming from ingested nitrogen. This may be done by substituting a protein-free diet and observing nitrogen excretion in urine or faeces, but the accuracy of this method of estimation of the amount of nitrogen excretion not coming from ingested nitrogen on a protein-containing diet has been questioned. BV = ( ( Ni - Ne(f) - Ne(u) ) / (Ni - Ne(f)) ) * 100 Where: Ni = nitrogen intake in proteins on the test diet Ne(f) = (nitrogen excreted in faeces whilst on the test diet) - (nitrogen excreted in faeces not from ingested nitrogen) Ne(u) = (nitrogen excreted in urine whilst on the test diet) - (nitrogen excreted in urine not from ingested nitrogen) Note: Nr = Ni - Ne(f) - Ne(u) Na = Ni - Ne(f) This can take any value from 0 to 100, though reported BV could be out of this range if the estimates of nitrogen excretion from non-ingested sources are inaccurate, such as could happen if the endogenous secretion changes with protein intake. A BV of 100% indicates complete utilization of a dietary protein, i.e. 100% of the protein ingested and absorbed is incorporated into proteins into the body. The value of 100% is an absolute maximum, no more than 100% of the protein ingested can be utilized (in the equation above Ne(u) and Ne(f) cannot go negative, setting 100% as the maximum BV). Relative utilization Due to experimental limitations BV is often measured relative to an easily utilizable protein. Normally egg protein is assumed to be the most readily utilizable protein and given a BV of 100. For example: Two tests of BV are carried out on the same person; one with the test protein source and one with a reference protein (egg protein). relative BV = ( BV(test) / BV(egg) ) * 100 Where: BV(test) = percentage BV of the test diet for that individual BV(egg) = percentage BV of the reference (egg) diet for that individual This is not restricted to values of less than 100. The percentage BV of egg protein is only 93.7% which allows other proteins with true percentage BV between 93.7% and 100% to take a relative BV of over 100. For example, whey protein takes a relative BV of 104, while its percentage BV is under 100%. The principal advantage of measuring BV relative to another protein diet is accuracy; it helps account for some of the metabolic variability between individuals. In a simplistic sense the egg diet is testing the maximum efficiency the individual can take up protein, the BV is then provided as a percentage taking this as the maximum. Conversion Providing it is known which protein measurements were made relative to it is simple to convert from relative BV to percentage BV: BV(relative) = ( BV(percentage) / BV(reference) ) * 100 BV(percentage) = ( BV(relative) / 100 ) * BV(reference) Where: BV(relative) = relative BV of the test protein BV(reference) = percentage BV of reference protein (typically egg: 93.7%). BV(percentage) = percentage BV of the test protein While this conversion is simple it is not strictly valid due to the differences between the experimental methods. It is, however, suitable for use as a guideline. Factors that affect BV The determination of BV is carefully designed to accurately measure some aspects of protein usage whilst eliminating variation from other aspects. When using the test (or considering BV values) care must be taken to ensure the variable of interest is quantified by BV. Factors which affect BV can be grouped into properties of the protein source and properties of the species or individual consuming the protein. Properties of the protein source Three major properties of a protein source affect its BV: Amino acid composition, and the limiting amino acid, which is usually lysine Preparation (cooking) Vitamin and mineral content Amino acid composition is the principal effect. All proteins are made up of combinations of the 21 biological amino acids. Some of these can be synthesised or converted in the body, whereas others cannot and must be ingested in the diet. These are known as essential amino acids (EAAs), of which there are 9 in humans. The number of EAAs varies according to species (see below). EAAs missing from the diet prevent the synthesis of proteins that require them. If a protein source is missing critical EAAs, then its biological value will be low as the missing EAAs form a bottleneck in protein synthesis. For example, if a hypothetical muscle protein requires phenylalanine (an essential amino acid), then this must be provided in the diet for the muscle protein to be produced. If the current protein source in the diet has no phenylalanine in it the muscle protein cannot be produced, giving a low usability and BV of the protein source. In a related way if amino acids are missing from the protein source which are particularly slow or energy consuming to synthesise this can result in a low BV. Methods of food preparation also affect the availability of amino acids in a food source. Some of food preparation may damage or destroy some EAAs, reducing the BV of the protein source. Many vitamins and minerals are vital for the correct function of cells in the test organism. If critical minerals or vitamins are missing from the protein source this can result in a massively lowered BV. Many BV tests artificially add vitamins and minerals (for example in yeast extract) to prevent this. Properties of the test species or individual Under test conditions Variations in BV under test conditions are dominated by the metabolism of the individuals or species being tested. In particular differences in the essential amino acids (EAAs) species to species has a significant effect, although even minor variations in amino acid metabolism individual to individual have a large effect. The fine dependence on the individual's metabolism makes measurement of BV a vital tool in diagnosing some metabolic diseases. In everyday life The principal effect on BV in everyday life is the organism's current diet, although many other factors such as age, health, weight, sex, etc. all have an effect. In short any condition which can affect the organism's metabolism will vary the BV of a protein source. In particular, whilst on a high protein diet the BV of all foods consumed is reduced — the limiting rate at which the amino acids may be incorporated into the body is not the availability of amino acids but the rate of protein synthesis possible in cells. This is a major point of criticism of BV as a test; the test diet is artificially protein rich and may have unusual effects. Factors with no effect BV is designed to ignore variation in digestibility of a food — which in turn largely depends on the food preparation. For example, compare raw soy beans and extracted soy bean protein. The raw soy beans, with tough cell walls protecting the protein, have a far lower digestibility than the purified, unprotected, soy bean protein extract. As a foodstuff far more protein can be absorbed from the extract than the raw beans, however the BV will be the same. The exclusion of digestibility is a point of misunderstanding and leads to misrepresentation of the meaning of a high or low BV Advantages and disadvantages BV provides a good measure of the usability of proteins in a diet and also plays a valuable role in detection of some metabolic diseases. BV is, however, a scientific variable determined under very strict and unnatural conditions. It is not a test designed to evaluate the usability of proteins whilst an organism is in everyday life — indeed the BV of a diet will vary greatly depending on age, weight, health, sex, recent diet, current metabolism, etc. of the organism. In addition BV of the same food varies significantly species to species. Given these limitations BV is still relevant to everyday diet to some extent. No matter the individual or their conditions a protein source with high BV, such as egg, will always be more easily used than a protein source with low BV. In comparison to other methods known There are many other major methods of determining how readily used a protein is, including: Net protein Utilization (NPU) Protein Efficiency Ratio (PER) Nitrogen Balance (NB) Protein digestibility (PD) Protein Digestibility Corrected Amino Acid Score (PDCAAS) These all hold specific advantages and disadvantages over BV, although in the past BV has been held in high regard. In animals The Biological Value method is also used for analysis in animals such as cattle, poultry, and various laboratory animals such as rats. It was used by the poultry industry to determine which mixtures of feed were utilized most efficiently by developing chicken. Although the process remains the same, the biological values of particular proteins in humans differs from their biological values in animals due to physiological variations. Typical values Common foodstuffs and their values: (Note: this scale uses 100 as 100% of the nitrogen incorporated.) Whey Protein: 96 Whole Soy Bean: 96 Human milk: 95 Chicken egg: 94 Soybean milk: 91 Buckwheat: 90+ Cow milk: 90 Cheese: 84 Quinoa: 83 Rice: 83 Defatted soy flour: 81 Fish: 76 Beef: 74.3 Immature bean: 65 Full-fat soy flour: 64 Soybean curd (tofu): 64 Whole wheat: 64 White flour: 41 Common foodstuffs and their values: (Note: These values use "whole egg" as a value of 100, so foodstuffs that provide even more nitrogen than whole eggs, can have a value of more than 100. 100, does not mean that 100% of the nitrogen in the food is incorporated into the body, and not excreted, as in other charts.) Whey protein concentrate: 104 Whole egg: 100 Cow milk: 91 Beef: 80 Casein: 77 Soy: 74 Wheat gluten: 64 By combining different foods it is possible to maximize the score, because the different components favor each other: 85 % rice and 15 % yeast: 118 55 % soy and 45 % rice: 111 55 % potatoes and 45 % soy: 103 52 % beans and 48 % corn: 101 Criticism Since the method measures only the amount that is retained in the body critics have pointed out what they perceive as a weakness of the biological value methodology. Critics have pointed to research that indicates that because whey protein isolate is digested so quickly it may in fact enter the bloodstream and be converted into carbohydrates through a process called gluconeogenesis much more rapidly than was previously thought possible, so while amino acid concentrations increased with whey it was discovered that oxidation rates also increased and a steady-state metabolism, a process where there is no change in overall protein balance, is created. They claim that when the human body consumes whey protein it is absorbed so rapidly that most of it is sent to the liver for oxidation. Hence they believe the reason so much is retained is that it is used for energy production, not protein synthesis. This would bring into question whether the method defines which proteins are more biologically utilizable. A further critique published in the Journal of Sports Science and Medicine states that the BV of a protein does not take into consideration several key factors that influence the digestion and interaction of protein with other foods before absorption, and that it only measures a protein's maximal potential quality and not its estimate at requirement levels. Also, the study by Poullain et al., which is often cited to demonstrate the superiority of whey protein hydrolysate by marketers, measured nitrogen balance in rats after three days of starvation, which corresponds to a longer period in humans. The study found that whey protein hydrolysate led to better nitrogen retention and growth than the other proteins studied. However the study's flaw is in the BV method used, as starvation affects how well the body will store incoming protein (as does a very high caloric intake), leading to falsely elevated BV measures. So, the BV of a protein is related to the amount of protein given. BV is measured at levels below the maintenance level. This means that as protein intake goes up, the BV of that protein goes down. For example, milk protein shows a BV near 100 at intakes of 0.2 g/kg. As protein intake increases to roughly maintenance levels, 0.5 g/kg, BV drops to around 70. Pellet et al., concluded that "biological measures of protein quality conducted at suboptimal levels in either experimental animals or human subjects may overestimate protein value at maintenance levels." As a result, while BV may be important for rating proteins where intake is below requirements, it has little bearing on individuals with protein intakes far above requirements. This flaw is supported by the FAO/WHO/UNU, who state that BV and NPU are measured when the protein content of the diet is clearly below that of requirement, deliberately done to maximize existing differences in quality as inadequate energy intake lowers the efficiency of protein utilization and in most N balance studies, calorie adequacy is ensured. And because no population derives all of its protein exclusively from a single food, the determination of BV of a single protein is of limited use for application to human protein requirements. Another limitation of the use of Biological Value as a measure of protein quality is that proteins which are completely devoid of one essential amino acid (EAA) can still have a BV of up to 40. This is because of the ability of organisms to conserve and recycle EAAs as an adaptation of inadequate intake of the amino acid. Lastly, the use of rats for the determination of protein quality is not ideal. Rats differ from humans in requirements of essential amino acids. This has led to a general criticism that experiments on rats lead to an over-estimation of the BV of high-quality proteins to man because human requirements of essential amino acids are much lower than those for rats (as rats grow at a much faster rate than humans). Also, because of their fur, rats are assumed to have relatively high requirements of sulphur-containing amino acids (methionine and cysteine). As a result, the analytical method that is universally recognized by the Food and Agriculture Organization (FAO), World Health Organization (WHO), the U.S. Food and Drug Administration (FDA), the United States Department of Agriculture (USDA), United Nations University (UNU) and the United States National Academy of Sciences when judging the quality of protein in the human is not PER or BV but the Protein Digestibility Corrected Amino Acid Score (PDCAAS), as it is viewed as accurately measuring the correct relative nutritional value of animal and vegetable sources of protein in the diet. See also Edible protein per unit area of land List of foods by protein content References Proteins Category:Nutrition